>Feature sequence001 2468 198 gene locus_tag LOCUS_00010 2468 198 CDS product bifunctional glycosyltransferase/CDP-glycerol:glycerophosphate glycerophosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028440.1 protein_id gnl|my_center|LOCUS_00010 3147 4253 gene locus_tag LOCUS_00020 gene proB 3147 4253 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028438.1 protein_id gnl|my_center|LOCUS_00020 4387 4815 gene locus_tag LOCUS_00030 4387 4815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028437.1 protein_id gnl|my_center|LOCUS_00030 4905 6191 gene locus_tag LOCUS_00040 4905 6191 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976218.1 protein_id gnl|my_center|LOCUS_00040 6295 6867 gene locus_tag LOCUS_00050 6295 6867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326198.1 protein_id gnl|my_center|LOCUS_00050 7118 8050 gene locus_tag LOCUS_00060 7118 8050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028435.1 protein_id gnl|my_center|LOCUS_00060 9257 8097 gene locus_tag LOCUS_00070 9257 8097 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028434.1 protein_id gnl|my_center|LOCUS_00070 9385 9549 gene locus_tag LOCUS_00080 9385 9549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030869987.1 protein_id gnl|my_center|LOCUS_00080 9696 9851 gene locus_tag LOCUS_00090 9696 9851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976223.1 protein_id gnl|my_center|LOCUS_00090 9931 10605 gene locus_tag LOCUS_00100 gene nadD 9931 10605 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485033.1 protein_id gnl|my_center|LOCUS_00100 10622 12433 gene locus_tag LOCUS_00110 gene pdtA 10622 12433 CDS product polydiglycosylphosphate transferase PdtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976225.1 protein_id gnl|my_center|LOCUS_00110 12511 12984 gene locus_tag LOCUS_00120 gene rsfS 12511 12984 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976226.1 protein_id gnl|my_center|LOCUS_00120 12592 12618 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12975 13652 gene locus_tag LOCUS_00130 12975 13652 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976227.1 protein_id gnl|my_center|LOCUS_00130 13770 13843 gene locus_tag LOCUS_t00010 13770 13843 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 14308 14541 gene locus_tag LOCUS_00140 14308 14541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976229.1 protein_id gnl|my_center|LOCUS_00140 14679 14752 gene locus_tag LOCUS_t00020 14679 14752 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 16512 14878 gene locus_tag LOCUS_00150 16512 14878 CDS product NADH-quinone oxidoreductase subunit NuoF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_175647404.1 protein_id gnl|my_center|LOCUS_00150 14941 14961 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 17828 16509 gene locus_tag LOCUS_00160 17828 16509 CDS product ferric reductase-like transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976231.1 protein_id gnl|my_center|LOCUS_00160 18276 21155 gene locus_tag LOCUS_00170 gene leuS 18276 21155 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976232.1 protein_id gnl|my_center|LOCUS_00170 21309 22094 gene locus_tag LOCUS_00180 21309 22094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028433.1 protein_id gnl|my_center|LOCUS_00180 22167 23039 gene locus_tag LOCUS_00190 22167 23039 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976234.1 protein_id gnl|my_center|LOCUS_00190 22957 22983 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 23333 24346 gene locus_tag LOCUS_00200 23333 24346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 24343 26889 gene locus_tag LOCUS_00210 24343 26889 CDS product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028431.1 protein_id gnl|my_center|LOCUS_00210 26906 27727 gene locus_tag LOCUS_00220 26906 27727 CDS product arylamine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467786.1 protein_id gnl|my_center|LOCUS_00220 27732 27977 gene locus_tag LOCUS_00230 27732 27977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037666679.1 protein_id gnl|my_center|LOCUS_00230 28306 28728 gene locus_tag LOCUS_00240 28306 28728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00240 28725 29321 gene locus_tag LOCUS_00250 28725 29321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00250 29809 29543 gene locus_tag LOCUS_00260 gene rpsT 29809 29543 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976241.1 protein_id gnl|my_center|LOCUS_00260 30019 31887 gene locus_tag LOCUS_00270 gene lepA 30019 31887 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976242.1 protein_id gnl|my_center|LOCUS_00270 32151 34025 gene locus_tag LOCUS_00280 32151 34025 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485037.1 protein_id gnl|my_center|LOCUS_00280 34273 36234 gene locus_tag LOCUS_00290 34273 36234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 36273 37505 gene locus_tag LOCUS_00300 gene hemW 36273 37505 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326185.1 protein_id gnl|my_center|LOCUS_00300 38350 37535 gene locus_tag LOCUS_00310 38350 37535 CDS product DUF3097 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976247.1 protein_id gnl|my_center|LOCUS_00310 39123 38383 gene locus_tag LOCUS_00320 39123 38383 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028425.1 protein_id gnl|my_center|LOCUS_00320 39270 40286 gene locus_tag LOCUS_00330 gene hrcA 39270 40286 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976249.1 protein_id gnl|my_center|LOCUS_00330 40287 41423 gene locus_tag LOCUS_00340 gene dnaJ 40287 41423 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976250.1 protein_id gnl|my_center|LOCUS_00340 41546 42676 gene locus_tag LOCUS_00350 41546 42676 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976251.1 protein_id gnl|my_center|LOCUS_00350 42673 43413 gene locus_tag LOCUS_00360 42673 43413 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976252.1 protein_id gnl|my_center|LOCUS_00360 43446 43838 gene locus_tag LOCUS_00370 43446 43838 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028036.1 protein_id gnl|my_center|LOCUS_00370 43979 44482 gene locus_tag LOCUS_00380 43979 44482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326181.1 protein_id gnl|my_center|LOCUS_00380 44735 47950 gene locus_tag LOCUS_00390 44735 47950 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028423.1 protein_id gnl|my_center|LOCUS_00390 48006 48359 gene locus_tag LOCUS_00400 48006 48359 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976256.1 protein_id gnl|my_center|LOCUS_00400 48366 49271 gene locus_tag LOCUS_00410 48366 49271 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028422.1 protein_id gnl|my_center|LOCUS_00410 49405 49426 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 49491 50306 gene locus_tag LOCUS_00420 49491 50306 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270038.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00420 51654 50389 gene locus_tag LOCUS_00430 51654 50389 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028420.1 protein_id gnl|my_center|LOCUS_00430 51972 53261 gene locus_tag LOCUS_00440 51972 53261 CDS product glucarate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028417.1 protein_id gnl|my_center|LOCUS_00440 53372 54634 gene locus_tag LOCUS_00450 53372 54634 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485041.1 protein_id gnl|my_center|LOCUS_00450 54844 56940 gene locus_tag LOCUS_00460 54844 56940 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259285.1 protein_id gnl|my_center|LOCUS_00460 58214 57261 gene locus_tag LOCUS_00470 gene era 58214 57261 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326176.1 protein_id gnl|my_center|LOCUS_00470 58381 58418 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 58458 59807 gene locus_tag LOCUS_00480 58458 59807 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831524.1 protein_id gnl|my_center|LOCUS_00480 59107 59136 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 59804 60142 gene locus_tag LOCUS_00490 gene glnB 59804 60142 CDS product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414756.1 protein_id gnl|my_center|LOCUS_00490 60514 60152 gene locus_tag LOCUS_00500 60514 60152 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093456125.1 protein_id gnl|my_center|LOCUS_00500 61466 60588 gene locus_tag LOCUS_00510 61466 60588 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485043.1 protein_id gnl|my_center|LOCUS_00510 61557 63035 gene locus_tag LOCUS_00520 61557 63035 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976267.1 protein_id gnl|my_center|LOCUS_00520 63374 63015 gene locus_tag LOCUS_00530 63374 63015 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028411.1 protein_id gnl|my_center|LOCUS_00530 64681 63371 gene locus_tag LOCUS_00540 64681 63371 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412229.1 protein_id gnl|my_center|LOCUS_00540 65186 64689 gene locus_tag LOCUS_00550 gene ybeY 65186 64689 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976270.1 protein_id gnl|my_center|LOCUS_00550 66284 65199 gene locus_tag LOCUS_00560 66284 65199 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976271.1 protein_id gnl|my_center|LOCUS_00560 67694 66438 gene locus_tag LOCUS_00570 67694 66438 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222038.1 protein_id gnl|my_center|LOCUS_00570 69025 67691 gene locus_tag LOCUS_00580 69025 67691 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028409.1 protein_id gnl|my_center|LOCUS_00580 69361 69095 gene locus_tag LOCUS_00590 69361 69095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976273.1 protein_id gnl|my_center|LOCUS_00590 70514 69444 gene locus_tag LOCUS_00600 70514 69444 CDS product M4 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028408.1 protein_id gnl|my_center|LOCUS_00600 70858 72579 gene locus_tag LOCUS_00610 gene leuA 70858 72579 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976275.1 protein_id gnl|my_center|LOCUS_00610 72787 73491 gene locus_tag LOCUS_00620 72787 73491 CDS product TerB family tellurite resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028407.1 protein_id gnl|my_center|LOCUS_00620 74446 73508 gene locus_tag LOCUS_00630 74446 73508 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804461.1 protein_id gnl|my_center|LOCUS_00630 74871 74491 gene locus_tag LOCUS_00640 74871 74491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 75602 74868 gene locus_tag LOCUS_00650 75602 74868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 76880 76383 gene locus_tag LOCUS_00660 76880 76383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 78774 76906 gene locus_tag LOCUS_00670 78774 76906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_00670 79343 78771 gene locus_tag LOCUS_00680 79343 78771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00680 78782 78810 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 81007 80207 gene locus_tag LOCUS_00690 81007 80207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00690 80298 80326 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 81266 81730 gene locus_tag LOCUS_00700 81266 81730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037637500.1 protein_id gnl|my_center|LOCUS_00700 81784 83382 gene locus_tag LOCUS_00710 81784 83382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 83399 83860 gene locus_tag LOCUS_00720 83399 83860 CDS product protein-tyrosine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222796.1 protein_id gnl|my_center|LOCUS_00720 83961 85082 gene locus_tag LOCUS_00730 83961 85082 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027795.1 protein_id gnl|my_center|LOCUS_00730 85282 85079 gene locus_tag LOCUS_00740 85282 85079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 86097 85264 gene locus_tag LOCUS_00750 86097 85264 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028397.1 protein_id gnl|my_center|LOCUS_00750 86210 86425 gene locus_tag LOCUS_00760 86210 86425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 86422 86649 gene locus_tag LOCUS_00770 86422 86649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028395.1 protein_id gnl|my_center|LOCUS_00770 87550 86684 gene locus_tag LOCUS_00780 gene blaBOR 87550 86684 CDS product class A beta-lactamase BOR-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926363.1 protein_id gnl|my_center|LOCUS_00780 87758 88507 gene locus_tag LOCUS_00790 gene recO 87758 88507 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030863758.1 protein_id gnl|my_center|LOCUS_00790 88544 89383 gene locus_tag LOCUS_00800 88544 89383 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976293.1 protein_id gnl|my_center|LOCUS_00800 90681 90262 gene locus_tag LOCUS_00810 90681 90262 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007449657.1 protein_id gnl|my_center|LOCUS_00810 91647 90745 gene locus_tag LOCUS_00820 91647 90745 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028393.1 protein_id gnl|my_center|LOCUS_00820 92504 91647 gene locus_tag LOCUS_00830 92504 91647 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028392.1 protein_id gnl|my_center|LOCUS_00830 93430 92501 gene locus_tag LOCUS_00840 93430 92501 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976297.1 protein_id gnl|my_center|LOCUS_00840 93633 95015 gene locus_tag LOCUS_00850 93633 95015 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976298.1 protein_id gnl|my_center|LOCUS_00850 96153 95089 gene locus_tag LOCUS_00860 96153 95089 CDS product chitinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028391.1 protein_id gnl|my_center|LOCUS_00860 96349 97362 gene locus_tag LOCUS_00870 96349 97362 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397659.1 protein_id gnl|my_center|LOCUS_00870 97379 97978 gene locus_tag LOCUS_00880 97379 97978 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173393.1 protein_id gnl|my_center|LOCUS_00880 98417 97971 gene locus_tag LOCUS_00890 98417 97971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 100088 98655 gene locus_tag LOCUS_00900 100088 98655 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028390.1 protein_id gnl|my_center|LOCUS_00900 100190 100942 gene locus_tag LOCUS_00910 100190 100942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00910 100866 100891 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 100942 101127 gene locus_tag LOCUS_00920 100942 101127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00920 102147 101224 gene locus_tag LOCUS_00930 102147 101224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00930 102151 102178 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 102252 102536 gene locus_tag LOCUS_00940 102252 102536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 102779 103921 gene locus_tag LOCUS_00950 gene dusB 102779 103921 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028387.1 protein_id gnl|my_center|LOCUS_00950 105972 103945 gene locus_tag LOCUS_00960 105972 103945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028386.1 protein_id gnl|my_center|LOCUS_00960 104202 104225 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 108078 106102 gene locus_tag LOCUS_00970 108078 106102 CDS product glycogen debranching N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031702.1 protein_id gnl|my_center|LOCUS_00970 106456 106480 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 109571 108075 gene locus_tag LOCUS_00980 109571 108075 CDS product trehalase family glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031701.1 protein_id gnl|my_center|LOCUS_00980 109693 110931 gene locus_tag LOCUS_00990 109693 110931 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868921.1 protein_id gnl|my_center|LOCUS_00990 110991 111166 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 111492 114212 gene locus_tag LOCUS_01000 gene ppdK 111492 114212 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976309.1 protein_id gnl|my_center|LOCUS_01000 114686 114357 gene locus_tag LOCUS_01010 114686 114357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 114580 114867 gene locus_tag LOCUS_01020 114580 114867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 114928 115860 gene locus_tag LOCUS_01030 114928 115860 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976313.1 protein_id gnl|my_center|LOCUS_01030 115976 117064 gene locus_tag LOCUS_01040 115976 117064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 117431 117081 gene locus_tag LOCUS_01050 gene nirD 117431 117081 CDS product nitrite reductase small subunit NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976316.1 protein_id gnl|my_center|LOCUS_01050 120073 117428 gene locus_tag LOCUS_01060 gene nirB 120073 117428 CDS product nitrite reductase large subunit NirB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028382.1 protein_id gnl|my_center|LOCUS_01060 119073 119108 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 121330 120074 gene locus_tag LOCUS_01070 121330 120074 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028381.1 protein_id gnl|my_center|LOCUS_01070 122057 121440 gene locus_tag LOCUS_01080 122057 121440 CDS product class F sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976324.1 protein_id gnl|my_center|LOCUS_01080 122736 122329 gene locus_tag LOCUS_01090 122736 122329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01090 122353 122381 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 124760 123117 gene locus_tag LOCUS_01100 124760 123117 CDS product M4 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028372.1 protein_id gnl|my_center|LOCUS_01100 127150 124961 gene locus_tag LOCUS_01110 127150 124961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 127983 127255 gene locus_tag LOCUS_01120 127983 127255 CDS product ElyC/SanA/YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976332.1 protein_id gnl|my_center|LOCUS_01120 128198 129043 gene locus_tag LOCUS_01130 128198 129043 CDS product CbiX/SirB N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173943936.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_01130 129285 130640 gene locus_tag LOCUS_01140 129285 130640 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028369.1 protein_id gnl|my_center|LOCUS_01140 130496 130525 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 130817 132082 gene locus_tag LOCUS_01150 130817 132082 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976335.1 protein_id gnl|my_center|LOCUS_01150 132122 134044 gene locus_tag LOCUS_01160 gene dnaG 132122 134044 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976336.1 protein_id gnl|my_center|LOCUS_01160 134903 135478 gene locus_tag LOCUS_01170 134903 135478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01170 134939 134973 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 135879 135529 gene locus_tag LOCUS_01180 135879 135529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01180 137485 135842 gene locus_tag LOCUS_01190 137485 135842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01190 136022 136049 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 139218 137485 gene locus_tag LOCUS_01200 139218 137485 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976341.1 protein_id gnl|my_center|LOCUS_01200 140822 139368 gene locus_tag LOCUS_01210 140822 139368 CDS product FGGY family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976342.1 protein_id gnl|my_center|LOCUS_01210 141258 140947 gene locus_tag LOCUS_01220 141258 140947 CDS product YtxH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326153.1 protein_id gnl|my_center|LOCUS_01220 141406 141479 gene locus_tag LOCUS_t00030 141406 141479 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 141484 141557 gene locus_tag LOCUS_t00040 141484 141557 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 141562 141635 gene locus_tag LOCUS_t00050 141562 141635 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 141640 141713 gene locus_tag LOCUS_t00060 141640 141713 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 141842 141918 gene locus_tag LOCUS_t00070 141842 141918 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 142240 142079 gene locus_tag LOCUS_01230 142240 142079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 143086 142298 gene locus_tag LOCUS_01240 143086 142298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 143411 143593 gene locus_tag LOCUS_01250 143411 143593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 143761 143792 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 143823 144557 gene locus_tag LOCUS_01260 143823 144557 CDS product anti-sigma factor RsbA family regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027235.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01260 145832 144762 gene locus_tag LOCUS_01270 145832 144762 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976353.1 protein_id gnl|my_center|LOCUS_01270 144818 144850 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 146117 149758 gene locus_tag LOCUS_01280 146117 149758 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028358.1 protein_id gnl|my_center|LOCUS_01280 151115 149733 gene locus_tag LOCUS_01290 151115 149733 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028357.1 protein_id gnl|my_center|LOCUS_01290 152553 151108 gene locus_tag LOCUS_01300 152553 151108 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028356.1 protein_id gnl|my_center|LOCUS_01300 152735 153616 gene locus_tag LOCUS_01310 152735 153616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224688.1 protein_id gnl|my_center|LOCUS_01310 154235 153606 gene locus_tag LOCUS_01320 154235 153606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976365.1 protein_id gnl|my_center|LOCUS_01320 154596 154733 gene locus_tag LOCUS_01330 154596 154733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 154737 156044 gene locus_tag LOCUS_01340 154737 156044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 156115 156888 gene locus_tag LOCUS_01350 156115 156888 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976366.1 protein_id gnl|my_center|LOCUS_01350 156885 157739 gene locus_tag LOCUS_01360 156885 157739 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028354.1 protein_id gnl|my_center|LOCUS_01360 159144 157744 gene locus_tag LOCUS_01370 159144 157744 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031044.1 protein_id gnl|my_center|LOCUS_01370 160423 159137 gene locus_tag LOCUS_01380 160423 159137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028352.1 protein_id gnl|my_center|LOCUS_01380 161118 160420 gene locus_tag LOCUS_01390 161118 160420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 164211 161188 gene locus_tag LOCUS_01400 164211 161188 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226283.1 protein_id gnl|my_center|LOCUS_01400 164093 164455 gene locus_tag LOCUS_01410 164093 164455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 164631 165281 gene locus_tag LOCUS_01420 164631 165281 CDS product DUF4360 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028347.1 protein_id gnl|my_center|LOCUS_01420 165369 166784 gene locus_tag LOCUS_01430 165369 166784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 168611 166845 gene locus_tag LOCUS_01440 168611 166845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 168502 168702 gene locus_tag LOCUS_01450 168502 168702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 169763 168771 gene locus_tag LOCUS_01460 169763 168771 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326127.1 protein_id gnl|my_center|LOCUS_01460 169867 169894 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 171289 170045 gene locus_tag LOCUS_01470 gene gguB 171289 170045 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976400.1 protein_id gnl|my_center|LOCUS_01470 172857 171286 gene locus_tag LOCUS_01480 gene gguA 172857 171286 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976401.1 protein_id gnl|my_center|LOCUS_01480 172339 172359 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 174006 172900 gene locus_tag LOCUS_01490 gene chvE 174006 172900 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976402.1 protein_id gnl|my_center|LOCUS_01490 175164 174196 gene locus_tag LOCUS_01500 175164 174196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028332.1 protein_id gnl|my_center|LOCUS_01500 176336 175302 gene locus_tag LOCUS_01510 176336 175302 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976404.1 protein_id gnl|my_center|LOCUS_01510 177496 176333 gene locus_tag LOCUS_01520 177496 176333 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028331.1 protein_id gnl|my_center|LOCUS_01520 178195 177578 gene locus_tag LOCUS_01530 178195 177578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 179210 178545 gene locus_tag LOCUS_01540 179210 178545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 178782 178812 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 179321 180346 gene locus_tag LOCUS_01550 179321 180346 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976409.1 protein_id gnl|my_center|LOCUS_01550 180391 180414 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 181632 180448 gene locus_tag LOCUS_01560 181632 180448 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229381.1 protein_id gnl|my_center|LOCUS_01560 180961 180993 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 181757 182590 gene locus_tag LOCUS_01570 181757 182590 CDS product EI24 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028326.1 protein_id gnl|my_center|LOCUS_01570 183442 182597 gene locus_tag LOCUS_01580 183442 182597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 185273 183666 gene locus_tag LOCUS_01590 185273 183666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 185421 185606 gene locus_tag LOCUS_01600 185421 185606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 186674 185667 gene locus_tag LOCUS_01610 186674 185667 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028324.1 protein_id gnl|my_center|LOCUS_01610 187570 186671 gene locus_tag LOCUS_01620 187570 186671 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976414.1 protein_id gnl|my_center|LOCUS_01620 187863 188333 gene locus_tag LOCUS_01630 187863 188333 CDS product DUF3145 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976415.1 protein_id gnl|my_center|LOCUS_01630 189710 188439 gene locus_tag LOCUS_01640 189710 188439 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028323.1 protein_id gnl|my_center|LOCUS_01640 190065 189817 gene locus_tag LOCUS_01650 190065 189817 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976417.1 protein_id gnl|my_center|LOCUS_01650 191197 190166 gene locus_tag LOCUS_01660 191197 190166 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976418.1 protein_id gnl|my_center|LOCUS_01660 192136 191219 gene locus_tag LOCUS_01670 192136 191219 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028322.1 protein_id gnl|my_center|LOCUS_01670 193431 192226 gene locus_tag LOCUS_01680 gene fasR 193431 192226 CDS product fatty acid biosynthesis transcriptional regulator FasR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028321.1 protein_id gnl|my_center|LOCUS_01680 193529 194206 gene locus_tag LOCUS_01690 193529 194206 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028320.1 protein_id gnl|my_center|LOCUS_01690 195024 194203 gene locus_tag LOCUS_01700 195024 194203 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028315.1 protein_id gnl|my_center|LOCUS_01700 195769 195137 gene locus_tag LOCUS_01710 195769 195137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 195714 196196 gene locus_tag LOCUS_01720 195714 196196 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326123.1 protein_id gnl|my_center|LOCUS_01720 197112 196219 gene locus_tag LOCUS_01730 197112 196219 CDS product DUF4429 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976427.1 protein_id gnl|my_center|LOCUS_01730 198377 197175 gene locus_tag LOCUS_01740 198377 197175 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028312.1 protein_id gnl|my_center|LOCUS_01740 199208 198540 gene locus_tag LOCUS_01750 199208 198540 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028311.1 protein_id gnl|my_center|LOCUS_01750 199331 200947 gene locus_tag LOCUS_01760 199331 200947 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027641.1 protein_id gnl|my_center|LOCUS_01760 202416 201259 gene locus_tag LOCUS_01770 202416 201259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 205210 202463 gene locus_tag LOCUS_01780 gene aceE 205210 202463 CDS product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976432.1 protein_id gnl|my_center|LOCUS_01780 205599 206036 gene locus_tag LOCUS_01790 205599 206036 CDS product DUF3052 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202437260.1 protein_id gnl|my_center|LOCUS_01790 206155 206613 gene locus_tag LOCUS_01800 206155 206613 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976435.1 protein_id gnl|my_center|LOCUS_01800 206727 207302 gene locus_tag LOCUS_01810 206727 207302 CDS product calcium homeostasis/redox stress adaptation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976436.1 protein_id gnl|my_center|LOCUS_01810 207439 208017 gene locus_tag LOCUS_01820 207439 208017 CDS product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976437.1 protein_id gnl|my_center|LOCUS_01820 209111 209284 gene locus_tag LOCUS_01830 209111 209284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01830 209417 210151 gene locus_tag LOCUS_01840 209417 210151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976439.1 protein_id gnl|my_center|LOCUS_01840 211001 210174 gene locus_tag LOCUS_01850 211001 210174 CDS product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976440.1 protein_id gnl|my_center|LOCUS_01850 211200 212366 gene locus_tag LOCUS_01860 211200 212366 CDS product HpcH/HpaI aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028308.1 protein_id gnl|my_center|LOCUS_01860 212375 214822 gene locus_tag LOCUS_01870 212375 214822 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028307.1 protein_id gnl|my_center|LOCUS_01870 214822 215646 gene locus_tag LOCUS_01880 214822 215646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028306.1 protein_id gnl|my_center|LOCUS_01880 215889 215662 gene locus_tag LOCUS_01890 215889 215662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 216237 218651 gene locus_tag LOCUS_01900 216237 218651 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975030.1 protein_id gnl|my_center|LOCUS_01900 218719 220005 gene locus_tag LOCUS_01910 218719 220005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029086.1 protein_id gnl|my_center|LOCUS_01910 220116 221297 gene locus_tag LOCUS_01920 220116 221297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 222623 221331 gene locus_tag LOCUS_01930 222623 221331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028302.1 protein_id gnl|my_center|LOCUS_01930 223606 222836 gene locus_tag LOCUS_01940 223606 222836 CDS product DUF4097 family beta strand repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976449.1 protein_id gnl|my_center|LOCUS_01940 223906 223832 gene locus_tag LOCUS_t00080 223906 223832 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 224295 223897 gene locus_tag LOCUS_01950 224295 223897 CDS product DUF952 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975206.1 protein_id gnl|my_center|LOCUS_01950 224642 224292 gene locus_tag LOCUS_01960 224642 224292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028301.1 protein_id gnl|my_center|LOCUS_01960 224720 225277 gene locus_tag LOCUS_01970 224720 225277 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028300.1 protein_id gnl|my_center|LOCUS_01970 226041 225280 gene locus_tag LOCUS_01980 226041 225280 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083971.1 protein_id gnl|my_center|LOCUS_01980 226115 226339 gene locus_tag LOCUS_01990 226115 226339 CDS product DUF2277 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028299.1 protein_id gnl|my_center|LOCUS_01990 227018 226383 gene locus_tag LOCUS_02000 227018 226383 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976453.1 protein_id gnl|my_center|LOCUS_02000 227564 227154 gene locus_tag LOCUS_02010 227564 227154 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976454.1 protein_id gnl|my_center|LOCUS_02010 227616 227640 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 229474 227798 gene locus_tag LOCUS_02020 229474 227798 CDS product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028298.1 protein_id gnl|my_center|LOCUS_02020 230187 229543 gene locus_tag LOCUS_02030 230187 229543 CDS product HNH endonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976456.1 protein_id gnl|my_center|LOCUS_02030 230664 230942 gene locus_tag LOCUS_02040 230664 230942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02040 230888 230910 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 230933 231268 gene locus_tag LOCUS_02050 230933 231268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02050 231439 232101 gene locus_tag LOCUS_02060 231439 232101 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028296.1 protein_id gnl|my_center|LOCUS_02060 233248 232151 gene locus_tag LOCUS_02070 233248 232151 CDS product peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486742.1 protein_id gnl|my_center|LOCUS_02070 233446 235593 gene locus_tag LOCUS_02080 233446 235593 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028294.1 protein_id gnl|my_center|LOCUS_02080 236118 235597 gene locus_tag LOCUS_02090 236118 235597 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976461.1 protein_id gnl|my_center|LOCUS_02090 236510 236540 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 236663 236926 gene locus_tag LOCUS_02100 236663 236926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02100 236931 237686 gene locus_tag LOCUS_02110 236931 237686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 238144 237650 gene locus_tag LOCUS_02120 238144 237650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 238248 238640 gene locus_tag LOCUS_02130 238248 238640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326109.1 protein_id gnl|my_center|LOCUS_02130 239350 238676 gene locus_tag LOCUS_02140 239350 238676 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976466.1 protein_id gnl|my_center|LOCUS_02140 240829 239435 gene locus_tag LOCUS_02150 gene proP 240829 239435 CDS product glycine betaine/L-proline transporter ProP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028291.1 protein_id gnl|my_center|LOCUS_02150 241295 243436 gene locus_tag LOCUS_02160 241295 243436 CDS product bifunctional glycosyltransferase 87/phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270029.1 protein_id gnl|my_center|LOCUS_02160 244589 243420 gene locus_tag LOCUS_02170 244589 243420 CDS product steroid 3-ketoacyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085491.1 protein_id gnl|my_center|LOCUS_02170 244886 246121 gene locus_tag LOCUS_02180 244886 246121 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020115335.1 protein_id gnl|my_center|LOCUS_02180 246832 246134 gene locus_tag LOCUS_02190 246832 246134 CDS product YoaK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224231.1 protein_id gnl|my_center|LOCUS_02190 247383 246967 gene locus_tag LOCUS_02200 247383 246967 CDS product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037666693.1 protein_id gnl|my_center|LOCUS_02200 248530 247694 gene locus_tag LOCUS_02210 248530 247694 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028282.1 protein_id gnl|my_center|LOCUS_02210 249282 248527 gene locus_tag LOCUS_02220 249282 248527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_02220 249506 249530 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 251466 250357 gene locus_tag LOCUS_02230 251466 250357 CDS product CbiQ family ECF transporter T component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028280.1 protein_id gnl|my_center|LOCUS_02230 252193 251459 gene locus_tag LOCUS_02240 252193 251459 CDS product SCO2322 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028279.1 protein_id gnl|my_center|LOCUS_02240 253437 252190 gene locus_tag LOCUS_02250 253437 252190 CDS product terpene cyclase/mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976492.1 protein_id gnl|my_center|LOCUS_02250 254763 253735 gene locus_tag LOCUS_02260 254763 253735 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173480.1 protein_id gnl|my_center|LOCUS_02260 254185 254223 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 254768 254797 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 254962 256419 gene locus_tag LOCUS_02270 254962 256419 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223303.1 protein_id gnl|my_center|LOCUS_02270 256425 256658 gene locus_tag LOCUS_02280 256425 256658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 257572 256856 gene locus_tag LOCUS_02290 257572 256856 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976494.1 protein_id gnl|my_center|LOCUS_02290 257781 259220 gene locus_tag LOCUS_02300 257781 259220 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028276.1 protein_id gnl|my_center|LOCUS_02300 259214 259990 gene locus_tag LOCUS_02310 259214 259990 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976496.1 protein_id gnl|my_center|LOCUS_02310 259987 261087 gene locus_tag LOCUS_02320 259987 261087 CDS product prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028275.1 protein_id gnl|my_center|LOCUS_02320 260960 260989 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 261421 261128 gene locus_tag LOCUS_02330 261421 261128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976498.1 protein_id gnl|my_center|LOCUS_02330 261588 262151 gene locus_tag LOCUS_02340 261588 262151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 264116 262164 gene locus_tag LOCUS_02350 264116 262164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 263308 263331 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 265260 264271 gene locus_tag LOCUS_02360 265260 264271 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028273.1 protein_id gnl|my_center|LOCUS_02360 265933 265271 gene locus_tag LOCUS_02370 265933 265271 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976501.1 protein_id gnl|my_center|LOCUS_02370 267816 266050 gene locus_tag LOCUS_02380 267816 266050 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225330.1 protein_id gnl|my_center|LOCUS_02380 267416 267442 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 268131 269561 gene locus_tag LOCUS_02390 268131 269561 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976504.1 protein_id gnl|my_center|LOCUS_02390 270238 269606 gene locus_tag LOCUS_02400 270238 269606 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046247814.1 protein_id gnl|my_center|LOCUS_02400 270526 272100 gene locus_tag LOCUS_02410 270526 272100 CDS product alpha-L-arabinofuranosidase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223602.1 protein_id gnl|my_center|LOCUS_02410 273319 272078 gene locus_tag LOCUS_02420 273319 272078 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028268.1 protein_id gnl|my_center|LOCUS_02420 275032 273335 gene locus_tag LOCUS_02430 275032 273335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 274084 274111 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 275539 276321 gene locus_tag LOCUS_02440 275539 276321 CDS product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030871467.1 protein_id gnl|my_center|LOCUS_02440 276353 277429 gene locus_tag LOCUS_02450 276353 277429 CDS product Zn-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027929.1 protein_id gnl|my_center|LOCUS_02450 277464 278408 gene locus_tag LOCUS_02460 277464 278408 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224297.1 protein_id gnl|my_center|LOCUS_02460 278638 278483 gene locus_tag LOCUS_02470 278638 278483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976510.1 protein_id gnl|my_center|LOCUS_02470 280195 278735 gene locus_tag LOCUS_02480 280195 278735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 280393 281250 gene locus_tag LOCUS_02490 280393 281250 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028263.1 protein_id gnl|my_center|LOCUS_02490 281400 281990 gene locus_tag LOCUS_02500 281400 281990 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028262.1 protein_id gnl|my_center|LOCUS_02500 282003 282359 gene locus_tag LOCUS_02510 282003 282359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02510 282259 282284 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 282356 283801 gene locus_tag LOCUS_02520 282356 283801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02520 284435 283776 gene locus_tag LOCUS_02530 gene eda 284435 283776 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028260.1 protein_id gnl|my_center|LOCUS_02530 285296 284514 gene locus_tag LOCUS_02540 gene yaaA 285296 284514 CDS product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976516.1 protein_id gnl|my_center|LOCUS_02540 285891 285310 gene locus_tag LOCUS_02550 285891 285310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028259.1 protein_id gnl|my_center|LOCUS_02550 286664 285888 gene locus_tag LOCUS_02560 286664 285888 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028258.1 protein_id gnl|my_center|LOCUS_02560 286846 287424 gene locus_tag LOCUS_02570 286846 287424 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974892.1 protein_id gnl|my_center|LOCUS_02570 288006 288467 gene locus_tag LOCUS_02580 288006 288467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 288666 289961 gene locus_tag LOCUS_02590 288666 289961 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029191.1 protein_id gnl|my_center|LOCUS_02590 290374 289973 gene locus_tag LOCUS_02600 290374 289973 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973561.1 protein_id gnl|my_center|LOCUS_02600 290480 290938 gene locus_tag LOCUS_02610 290480 290938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 291057 291302 gene locus_tag LOCUS_02620 291057 291302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 291605 291219 gene locus_tag LOCUS_02630 291605 291219 CDS product MazG-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028253.1 protein_id gnl|my_center|LOCUS_02630 292193 291648 gene locus_tag LOCUS_02640 292193 291648 CDS product DoxX family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976524.1 protein_id gnl|my_center|LOCUS_02640 292325 292651 gene locus_tag LOCUS_02650 292325 292651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976525.1 protein_id gnl|my_center|LOCUS_02650 292738 294087 gene locus_tag LOCUS_02660 292738 294087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 295100 294342 gene locus_tag LOCUS_02670 295100 294342 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028252.1 protein_id gnl|my_center|LOCUS_02670 296195 295161 gene locus_tag LOCUS_02680 296195 295161 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168715519.1 protein_id gnl|my_center|LOCUS_02680 296298 297650 gene locus_tag LOCUS_02690 296298 297650 CDS product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028249.1 protein_id gnl|my_center|LOCUS_02690 297590 298777 gene locus_tag LOCUS_02700 297590 298777 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173943938.1 protein_id gnl|my_center|LOCUS_02700 298917 299930 gene locus_tag LOCUS_02710 298917 299930 CDS product small ribosomal subunit Rsm22 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028248.1 protein_id gnl|my_center|LOCUS_02710 300759 299938 gene locus_tag LOCUS_02720 300759 299938 CDS product amidinotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222475.1 protein_id gnl|my_center|LOCUS_02720 301297 302034 gene locus_tag LOCUS_02730 301297 302034 CDS product bifunctional DNA primase/polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976534.1 protein_id gnl|my_center|LOCUS_02730 302968 302066 gene locus_tag LOCUS_02740 302968 302066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270025.1 protein_id gnl|my_center|LOCUS_02740 303899 303027 gene locus_tag LOCUS_02750 303899 303027 CDS product FTR1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976536.1 protein_id gnl|my_center|LOCUS_02750 305214 303904 gene locus_tag LOCUS_02760 gene efeB 305214 303904 CDS product iron uptake transporter deferrochelatase/peroxidase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028245.1 protein_id gnl|my_center|LOCUS_02760 304700 304723 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 306377 305226 gene locus_tag LOCUS_02770 gene efeO 306377 305226 CDS product iron uptake system protein EfeO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028244.1 protein_id gnl|my_center|LOCUS_02770 306535 307368 gene locus_tag LOCUS_02780 306535 307368 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028237.1 protein_id gnl|my_center|LOCUS_02780 308105 307458 gene locus_tag LOCUS_02790 308105 307458 CDS product biliverdin-producing heme oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028236.1 protein_id gnl|my_center|LOCUS_02790 308996 308139 gene locus_tag LOCUS_02800 gene map 308996 308139 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976546.1 protein_id gnl|my_center|LOCUS_02800 309057 309290 gene locus_tag LOCUS_02810 309057 309290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976547.1 protein_id gnl|my_center|LOCUS_02810 310103 309507 gene locus_tag LOCUS_02820 310103 309507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028233.1 protein_id gnl|my_center|LOCUS_02820 310266 310979 gene locus_tag LOCUS_02830 gene npdG 310266 310979 CDS product NADPH-dependent F420 reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028232.1 protein_id gnl|my_center|LOCUS_02830 311044 311235 gene locus_tag LOCUS_02840 311044 311235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326075.1 protein_id gnl|my_center|LOCUS_02840 312082 311225 gene locus_tag LOCUS_02850 312082 311225 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976552.1 protein_id gnl|my_center|LOCUS_02850 312213 315878 gene locus_tag LOCUS_02860 312213 315878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 316789 315962 gene locus_tag LOCUS_02870 316789 315962 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976554.1 protein_id gnl|my_center|LOCUS_02870 317835 316786 gene locus_tag LOCUS_02880 317835 316786 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976555.1 protein_id gnl|my_center|LOCUS_02880 318885 318019 gene locus_tag LOCUS_02890 gene panB 318885 318019 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976556.1 protein_id gnl|my_center|LOCUS_02890 319132 320679 gene locus_tag LOCUS_02900 319132 320679 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030040.1 protein_id gnl|my_center|LOCUS_02900 320755 321393 gene locus_tag LOCUS_02910 320755 321393 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400977.1 protein_id gnl|my_center|LOCUS_02910 321592 322641 gene locus_tag LOCUS_02920 gene vanJ 321592 322641 CDS product teicoplanin resistance protein VanJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029107.1 protein_id gnl|my_center|LOCUS_02920 322651 323331 gene locus_tag LOCUS_02930 322651 323331 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228116.1 protein_id gnl|my_center|LOCUS_02930 323727 323341 gene locus_tag LOCUS_02940 323727 323341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 323862 324725 gene locus_tag LOCUS_02950 323862 324725 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028397.1 protein_id gnl|my_center|LOCUS_02950 324697 324897 gene locus_tag LOCUS_02960 324697 324897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 325022 325936 gene locus_tag LOCUS_02970 325022 325936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 325933 326724 gene locus_tag LOCUS_02980 325933 326724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 328799 326742 gene locus_tag LOCUS_02990 328799 326742 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729965.1 protein_id gnl|my_center|LOCUS_02990 328941 329822 gene locus_tag LOCUS_03000 328941 329822 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_078880017.1 protein_id gnl|my_center|LOCUS_03000 331828 329891 gene locus_tag LOCUS_03010 331828 329891 CDS product S53 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223434.1 protein_id gnl|my_center|LOCUS_03010 332778 332077 gene locus_tag LOCUS_03020 332778 332077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 333509 332775 gene locus_tag LOCUS_03030 333509 332775 CDS product DUF3105 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028218.1 protein_id gnl|my_center|LOCUS_03030 333671 334150 gene locus_tag LOCUS_03040 gene nsrR 333671 334150 CDS product nitric oxide-sensing transcriptional repressor NsrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031657.1 protein_id gnl|my_center|LOCUS_03040 335446 334262 gene locus_tag LOCUS_03050 335446 334262 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971715.1 protein_id gnl|my_center|LOCUS_03050 335781 337142 gene locus_tag LOCUS_03060 gene glnA 335781 337142 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976572.1 protein_id gnl|my_center|LOCUS_03060 337176 338366 gene locus_tag LOCUS_03070 337176 338366 CDS product PP2C family protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225630519.1 protein_id gnl|my_center|LOCUS_03070 338523 338293 gene locus_tag LOCUS_03080 338523 338293 CDS product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029810.1 protein_id gnl|my_center|LOCUS_03080 339395 338520 gene locus_tag LOCUS_03090 339395 338520 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486778.1 protein_id gnl|my_center|LOCUS_03090 340346 339510 gene locus_tag LOCUS_03100 340346 339510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 340903 340346 gene locus_tag LOCUS_03110 340903 340346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 341081 342754 gene locus_tag LOCUS_03120 341081 342754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055616012.1 protein_id gnl|my_center|LOCUS_03120 342848 345988 gene locus_tag LOCUS_03130 342848 345988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 342997 343022 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 344704 344728 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 345149 345183 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 346901 346092 gene locus_tag LOCUS_03140 346901 346092 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028214.1 protein_id gnl|my_center|LOCUS_03140 348034 346976 gene locus_tag LOCUS_03150 348034 346976 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976582.1 protein_id gnl|my_center|LOCUS_03150 348365 349639 gene locus_tag LOCUS_03160 348365 349639 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976583.1 protein_id gnl|my_center|LOCUS_03160 349729 350733 gene locus_tag LOCUS_03170 349729 350733 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976584.1 protein_id gnl|my_center|LOCUS_03170 350747 351658 gene locus_tag LOCUS_03180 350747 351658 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976585.1 protein_id gnl|my_center|LOCUS_03180 351812 353503 gene locus_tag LOCUS_03190 351812 353503 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028213.1 protein_id gnl|my_center|LOCUS_03190 353796 355178 gene locus_tag LOCUS_03200 353796 355178 CDS product carbohydrate-binding module family 20 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486988.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03200 355309 356787 gene locus_tag LOCUS_03210 355309 356787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 356648 356671 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 357862 356762 gene locus_tag LOCUS_03220 357862 356762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 358642 364095 gene locus_tag LOCUS_03230 gene pulA 358642 364095 CDS product pullulanase-type alpha-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486784.1 protein_id gnl|my_center|LOCUS_03230 359171 359203 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 364131 364487 gene locus_tag LOCUS_03240 364131 364487 CDS product 5-carboxymethyl-2-hydroxymuconate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976590.1 protein_id gnl|my_center|LOCUS_03240 365198 364533 gene locus_tag LOCUS_03250 365198 364533 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976592.1 protein_id gnl|my_center|LOCUS_03250 365307 365329 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 365651 366049 gene locus_tag LOCUS_03260 365651 366049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 366577 367227 gene locus_tag LOCUS_03270 366577 367227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 367804 367304 gene locus_tag LOCUS_03280 367804 367304 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486788.1 protein_id gnl|my_center|LOCUS_03280 367964 368362 gene locus_tag LOCUS_03290 367964 368362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 370035 368443 gene locus_tag LOCUS_03300 370035 368443 CDS product DUF1996 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028205.1 protein_id gnl|my_center|LOCUS_03300 369321 369341 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 371207 370209 gene locus_tag LOCUS_03310 371207 370209 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191849145.1 protein_id gnl|my_center|LOCUS_03310 371946 371305 gene locus_tag LOCUS_03320 371946 371305 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028201.1 protein_id gnl|my_center|LOCUS_03320 373322 372294 gene locus_tag LOCUS_03330 373322 372294 CDS product glutamine synthetase beta-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028199.1 protein_id gnl|my_center|LOCUS_03330 374360 373605 gene locus_tag LOCUS_03340 374360 373605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224437.1 protein_id gnl|my_center|LOCUS_03340 375034 374480 gene locus_tag LOCUS_03350 375034 374480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 375019 375333 gene locus_tag LOCUS_03360 375019 375333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976610.1 protein_id gnl|my_center|LOCUS_03360 376706 375522 gene locus_tag LOCUS_03370 376706 375522 CDS product winged helix DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028195.1 protein_id gnl|my_center|LOCUS_03370 376946 377224 gene locus_tag LOCUS_03380 376946 377224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 377811 377227 gene locus_tag LOCUS_03390 377811 377227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028194.1 protein_id gnl|my_center|LOCUS_03390 377893 377918 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 378033 378251 gene locus_tag LOCUS_03400 378033 378251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 378435 378827 gene locus_tag LOCUS_03410 378435 378827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 379188 378931 gene locus_tag LOCUS_03420 379188 378931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173668721.1 protein_id gnl|my_center|LOCUS_03420 379378 379626 gene locus_tag LOCUS_03430 379378 379626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 381150 379720 gene locus_tag LOCUS_03440 gene glnA 381150 379720 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976617.1 protein_id gnl|my_center|LOCUS_03440 380138 380158 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 381376 381825 gene locus_tag LOCUS_03450 381376 381825 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976618.1 protein_id gnl|my_center|LOCUS_03450 382637 381936 gene locus_tag LOCUS_03460 382637 381936 CDS product DUF4191 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976619.1 protein_id gnl|my_center|LOCUS_03460 382910 382710 gene locus_tag LOCUS_03470 382910 382710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028192.1 protein_id gnl|my_center|LOCUS_03470 384144 383179 gene locus_tag LOCUS_03480 gene lipA 384144 383179 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976621.1 protein_id gnl|my_center|LOCUS_03480 385093 384275 gene locus_tag LOCUS_03490 gene lipB 385093 384275 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976622.1 protein_id gnl|my_center|LOCUS_03490 385200 386978 gene locus_tag LOCUS_03500 385200 386978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 388474 387056 gene locus_tag LOCUS_03510 388474 387056 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028190.1 protein_id gnl|my_center|LOCUS_03510 389597 388701 gene locus_tag LOCUS_03520 389597 388701 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870932.1 protein_id gnl|my_center|LOCUS_03520 389670 390164 gene locus_tag LOCUS_03530 389670 390164 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037667418.1 protein_id gnl|my_center|LOCUS_03530 391338 390154 gene locus_tag LOCUS_03540 391338 390154 CDS product MarP family serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136209493.1 protein_id gnl|my_center|LOCUS_03540 391590 392357 gene locus_tag LOCUS_03550 391590 392357 CDS product peptidoglycan recognition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028187.1 protein_id gnl|my_center|LOCUS_03550 392929 392408 gene locus_tag LOCUS_03560 392929 392408 CDS product DUF4240 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870944.1 protein_id gnl|my_center|LOCUS_03560 393984 392983 gene locus_tag LOCUS_03570 393984 392983 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976631.1 protein_id gnl|my_center|LOCUS_03570 396766 394064 gene locus_tag LOCUS_03580 gene aceE 396766 394064 CDS product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976632.1 protein_id gnl|my_center|LOCUS_03580 398040 397417 gene locus_tag LOCUS_03590 398040 397417 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976633.1 protein_id gnl|my_center|LOCUS_03590 400109 398274 gene locus_tag LOCUS_03600 400109 398274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_03600 401561 400173 gene locus_tag LOCUS_03610 gene lpdA 401561 400173 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030873385.1 protein_id gnl|my_center|LOCUS_03610 403356 401815 gene locus_tag LOCUS_03620 403356 401815 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028182.1 protein_id gnl|my_center|LOCUS_03620 401945 401969 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 404205 403633 gene locus_tag LOCUS_03630 404205 403633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 405158 404358 gene locus_tag LOCUS_03640 405158 404358 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028180.1 protein_id gnl|my_center|LOCUS_03640 405239 406012 gene locus_tag LOCUS_03650 405239 406012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028179.1 protein_id gnl|my_center|LOCUS_03650 406736 406038 gene locus_tag LOCUS_03660 406736 406038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030880.1 protein_id gnl|my_center|LOCUS_03660 408543 406747 gene locus_tag LOCUS_03670 408543 406747 CDS product phosphatidylglycerol lysyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030881.1 protein_id gnl|my_center|LOCUS_03670 409174 408599 gene locus_tag LOCUS_03680 409174 408599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03680 409225 409255 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 410015 411097 gene locus_tag LOCUS_03690 410015 411097 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229109.1 protein_id gnl|my_center|LOCUS_03690 412363 411161 gene locus_tag LOCUS_03700 412363 411161 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030869456.1 protein_id gnl|my_center|LOCUS_03700 412491 412709 gene locus_tag LOCUS_03710 412491 412709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976644.1 protein_id gnl|my_center|LOCUS_03710 414152 413040 gene locus_tag LOCUS_03720 414152 413040 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028175.1 protein_id gnl|my_center|LOCUS_03720 414947 414195 gene locus_tag LOCUS_03730 414947 414195 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028174.1 protein_id gnl|my_center|LOCUS_03730 415800 414967 gene locus_tag LOCUS_03740 415800 414967 CDS product DUF3043 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028173.1 protein_id gnl|my_center|LOCUS_03740 415070 415095 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 415877 416758 gene locus_tag LOCUS_03750 415877 416758 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063739112.1 protein_id gnl|my_center|LOCUS_03750 416788 417066 gene locus_tag LOCUS_03760 416788 417066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976649.1 protein_id gnl|my_center|LOCUS_03760 417153 418394 gene locus_tag LOCUS_03770 417153 418394 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976650.1 protein_id gnl|my_center|LOCUS_03770 418391 419071 gene locus_tag LOCUS_03780 418391 419071 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976651.1 protein_id gnl|my_center|LOCUS_03780 419264 421186 gene locus_tag LOCUS_03790 419264 421186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03790 420659 420682 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 421068 421096 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 421135 422409 gene locus_tag LOCUS_03800 421135 422409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03800 423702 422509 gene locus_tag LOCUS_03810 gene nadA 423702 422509 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030869444.1 protein_id gnl|my_center|LOCUS_03810 424035 423736 gene locus_tag LOCUS_03820 424035 423736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 424004 424360 gene locus_tag LOCUS_03830 424004 424360 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976654.1 protein_id gnl|my_center|LOCUS_03830 426357 424474 gene locus_tag LOCUS_03840 426357 424474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 426130 426162 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 426742 426530 gene locus_tag LOCUS_03850 426742 426530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976656.1 protein_id gnl|my_center|LOCUS_03850 426872 427846 gene locus_tag LOCUS_03860 426872 427846 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326033.1 protein_id gnl|my_center|LOCUS_03860 429257 427872 gene locus_tag LOCUS_03870 429257 427872 CDS product cysteine desulfurase/sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028169.1 protein_id gnl|my_center|LOCUS_03870 429519 430478 gene locus_tag LOCUS_03880 gene coxB 429519 430478 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028168.1 protein_id gnl|my_center|LOCUS_03880 430475 432211 gene locus_tag LOCUS_03890 gene ctaD 430475 432211 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976660.1 protein_id gnl|my_center|LOCUS_03890 432208 432606 gene locus_tag LOCUS_03900 432208 432606 CDS product cytochrome c oxidase subunit 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976661.1 protein_id gnl|my_center|LOCUS_03900 432744 434018 gene locus_tag LOCUS_03910 432744 434018 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976662.1 protein_id gnl|my_center|LOCUS_03910 434506 434105 gene locus_tag LOCUS_03920 434506 434105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976663.1 protein_id gnl|my_center|LOCUS_03920 434718 435338 gene locus_tag LOCUS_03930 434718 435338 CDS product heme-copper oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976664.1 protein_id gnl|my_center|LOCUS_03930 435400 436209 gene locus_tag LOCUS_03940 435400 436209 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976665.1 protein_id gnl|my_center|LOCUS_03940 436206 437270 gene locus_tag LOCUS_03950 436206 437270 CDS product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976666.1 protein_id gnl|my_center|LOCUS_03950 437267 438925 gene locus_tag LOCUS_03960 437267 438925 CDS product cytochrome bc complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028167.1 protein_id gnl|my_center|LOCUS_03960 439073 440137 gene locus_tag LOCUS_03970 gene trpD 439073 440137 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028166.1 protein_id gnl|my_center|LOCUS_03970 440543 441904 gene locus_tag LOCUS_03980 440543 441904 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028165.1 protein_id gnl|my_center|LOCUS_03980 442234 441953 gene locus_tag LOCUS_03990 442234 441953 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976675.1 protein_id gnl|my_center|LOCUS_03990 442962 442231 gene locus_tag LOCUS_04000 442962 442231 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028161.1 protein_id gnl|my_center|LOCUS_04000 443141 443380 gene locus_tag LOCUS_04010 443141 443380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976677.1 protein_id gnl|my_center|LOCUS_04010 443445 444791 gene locus_tag LOCUS_04020 443445 444791 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028160.1 protein_id gnl|my_center|LOCUS_04020 445066 446124 gene locus_tag LOCUS_04030 445066 446124 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028159.1 protein_id gnl|my_center|LOCUS_04030 445505 445528 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 446376 447413 gene locus_tag LOCUS_04040 446376 447413 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976680.1 protein_id gnl|my_center|LOCUS_04040 447768 447792 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 447795 448661 gene locus_tag LOCUS_04050 447795 448661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04050 449898 448618 gene locus_tag LOCUS_04060 449898 448618 CDS product glycosyltransferase family 87 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326026.1 protein_id gnl|my_center|LOCUS_04060 450060 451202 gene locus_tag LOCUS_04070 450060 451202 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486225.1 protein_id gnl|my_center|LOCUS_04070 451293 452915 gene locus_tag LOCUS_04080 451293 452915 CDS product GMC oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229262.1 protein_id gnl|my_center|LOCUS_04080 454731 452935 gene locus_tag LOCUS_04090 454731 452935 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028155.1 protein_id gnl|my_center|LOCUS_04090 454991 455788 gene locus_tag LOCUS_04100 454991 455788 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028154.1 protein_id gnl|my_center|LOCUS_04100 455936 456376 gene locus_tag LOCUS_04110 455936 456376 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976686.1 protein_id gnl|my_center|LOCUS_04110 456456 457625 gene locus_tag LOCUS_04120 456456 457625 CDS product ArsA-related P-loop ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976687.1 protein_id gnl|my_center|LOCUS_04120 457704 458222 gene locus_tag LOCUS_04130 457704 458222 CDS product carbon catabolit repression protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028152.1 protein_id gnl|my_center|LOCUS_04130 458343 459296 gene locus_tag LOCUS_04140 458343 459296 CDS product ROK family glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976689.1 protein_id gnl|my_center|LOCUS_04140 459440 460189 gene locus_tag LOCUS_04150 459440 460189 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976690.1 protein_id gnl|my_center|LOCUS_04150 461020 460214 gene locus_tag LOCUS_04160 461020 460214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976691.1 protein_id gnl|my_center|LOCUS_04160 461792 461013 gene locus_tag LOCUS_04170 461792 461013 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028151.1 protein_id gnl|my_center|LOCUS_04170 461960 462736 gene locus_tag LOCUS_04180 461960 462736 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167469516.1 protein_id gnl|my_center|LOCUS_04180 462799 463980 gene locus_tag LOCUS_04190 462799 463980 CDS product DUF5931 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976694.1 protein_id gnl|my_center|LOCUS_04190 463977 464639 gene locus_tag LOCUS_04200 463977 464639 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976695.1 protein_id gnl|my_center|LOCUS_04200 464855 465883 gene locus_tag LOCUS_04210 464855 465883 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976696.1 protein_id gnl|my_center|LOCUS_04210 465901 466941 gene locus_tag LOCUS_04220 465901 466941 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976697.1 protein_id gnl|my_center|LOCUS_04220 468722 466893 gene locus_tag LOCUS_04230 468722 466893 CDS product phenazine-specific anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028148.1 protein_id gnl|my_center|LOCUS_04230 468736 468760 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 469212 470405 gene locus_tag LOCUS_04240 469212 470405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 470480 471826 gene locus_tag LOCUS_04250 470480 471826 CDS product 3-deoxy-7-phosphoheptulonate synthase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976701.1 protein_id gnl|my_center|LOCUS_04250 471999 472241 gene locus_tag LOCUS_04260 471999 472241 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976702.1 protein_id gnl|my_center|LOCUS_04260 472744 472265 gene locus_tag LOCUS_04270 gene bfr 472744 472265 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976703.1 protein_id gnl|my_center|LOCUS_04270 472901 473557 gene locus_tag LOCUS_04280 472901 473557 CDS product sulfite oxidase-like oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976704.1 protein_id gnl|my_center|LOCUS_04280 474448 473567 gene locus_tag LOCUS_04290 474448 473567 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976705.1 protein_id gnl|my_center|LOCUS_04290 476434 474461 gene locus_tag LOCUS_04300 gene pknB 476434 474461 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486214.1 protein_id gnl|my_center|LOCUS_04300 477352 476558 gene locus_tag LOCUS_04310 477352 476558 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976707.1 protein_id gnl|my_center|LOCUS_04310 477556 477356 gene locus_tag LOCUS_04320 gene thiS 477556 477356 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976708.1 protein_id gnl|my_center|LOCUS_04320 478719 477553 gene locus_tag LOCUS_04330 gene thiO 478719 477553 CDS product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421597.1 protein_id gnl|my_center|LOCUS_04330 478983 480251 gene locus_tag LOCUS_04340 478983 480251 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486236.1 protein_id gnl|my_center|LOCUS_04340 480089 480127 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 480378 480743 gene locus_tag LOCUS_04350 480378 480743 CDS product Rv2175c family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805032.1 protein_id gnl|my_center|LOCUS_04350 480853 481404 gene locus_tag LOCUS_04360 480853 481404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04360 481239 481267 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 481773 482651 gene locus_tag LOCUS_04370 gene metF 481773 482651 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028143.1 protein_id gnl|my_center|LOCUS_04370 482708 483739 gene locus_tag LOCUS_04380 482708 483739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028142.1 protein_id gnl|my_center|LOCUS_04380 482831 482851 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 485267 483750 gene locus_tag LOCUS_04390 485267 483750 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028141.1 protein_id gnl|my_center|LOCUS_04390 486354 485707 gene locus_tag LOCUS_04400 486354 485707 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028140.1 protein_id gnl|my_center|LOCUS_04400 486664 486401 gene locus_tag LOCUS_04410 486664 486401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_04410 488523 486712 gene locus_tag LOCUS_04420 488523 486712 CDS product YhgE/Pip domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227921.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04420 486721 486758 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 489286 488495 gene locus_tag LOCUS_04430 489286 488495 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897054.1 protein_id gnl|my_center|LOCUS_04430 489481 490077 gene locus_tag LOCUS_04440 489481 490077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 490220 490981 gene locus_tag LOCUS_04450 490220 490981 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028138.1 protein_id gnl|my_center|LOCUS_04450 491087 491644 gene locus_tag LOCUS_04460 491087 491644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 494039 491721 gene locus_tag LOCUS_04470 494039 491721 CDS product DUF3488 and transglutaminase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486200.1 protein_id gnl|my_center|LOCUS_04470 494074 494104 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 495584 494163 gene locus_tag LOCUS_04480 495584 494163 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486197.1 protein_id gnl|my_center|LOCUS_04480 496618 495584 gene locus_tag LOCUS_04490 496618 495584 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976721.1 protein_id gnl|my_center|LOCUS_04490 497398 496853 gene locus_tag LOCUS_04500 497398 496853 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976722.1 protein_id gnl|my_center|LOCUS_04500 497849 498778 gene locus_tag LOCUS_04510 gene rsmH 497849 498778 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976723.1 protein_id gnl|my_center|LOCUS_04510 498792 499490 gene locus_tag LOCUS_04520 498792 499490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 499496 501451 gene locus_tag LOCUS_04530 gene ftsI 499496 501451 CDS product cell division protein FtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028132.1 protein_id gnl|my_center|LOCUS_04530 501648 503168 gene locus_tag LOCUS_04540 501648 503168 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028131.1 protein_id gnl|my_center|LOCUS_04540 503197 504612 gene locus_tag LOCUS_04550 503197 504612 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976727.1 protein_id gnl|my_center|LOCUS_04550 504609 505682 gene locus_tag LOCUS_04560 gene mraY 504609 505682 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976728.1 protein_id gnl|my_center|LOCUS_04560 505679 507115 gene locus_tag LOCUS_04570 gene murD 505679 507115 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976729.1 protein_id gnl|my_center|LOCUS_04570 507194 508624 gene locus_tag LOCUS_04580 gene ftsW 507194 508624 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976730.1 protein_id gnl|my_center|LOCUS_04580 508631 509719 gene locus_tag LOCUS_04590 gene murG 508631 509719 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976731.1 protein_id gnl|my_center|LOCUS_04590 509747 510550 gene locus_tag LOCUS_04600 gene ftsQ 509747 510550 CDS product cell division protein FtsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976732.1 protein_id gnl|my_center|LOCUS_04600 510829 512028 gene locus_tag LOCUS_04610 gene ftsZ 510829 512028 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976733.1 protein_id gnl|my_center|LOCUS_04610 512025 512756 gene locus_tag LOCUS_04620 gene pgeF 512025 512756 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028130.1 protein_id gnl|my_center|LOCUS_04620 512763 513482 gene locus_tag LOCUS_04630 512763 513482 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028129.1 protein_id gnl|my_center|LOCUS_04630 513550 514242 gene locus_tag LOCUS_04640 gene sepF 513550 514242 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976736.1 protein_id gnl|my_center|LOCUS_04640 514293 514583 gene locus_tag LOCUS_04650 514293 514583 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976737.1 protein_id gnl|my_center|LOCUS_04650 514636 515766 gene locus_tag LOCUS_04660 gene divIVA 514636 515766 CDS product apical growth/hyphal branching protein DivIVA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976738.1 protein_id gnl|my_center|LOCUS_04660 516014 516036 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 519239 516108 gene locus_tag LOCUS_04670 gene ileS 519239 516108 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976739.1 protein_id gnl|my_center|LOCUS_04670 519845 520984 gene locus_tag LOCUS_04680 519845 520984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 521105 521737 gene locus_tag LOCUS_04690 gene lspA 521105 521737 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028127.1 protein_id gnl|my_center|LOCUS_04690 521819 522763 gene locus_tag LOCUS_04700 521819 522763 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976742.1 protein_id gnl|my_center|LOCUS_04700 522760 523227 gene locus_tag LOCUS_04710 522760 523227 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189283762.1 protein_id gnl|my_center|LOCUS_04710 523318 524904 gene locus_tag LOCUS_04720 523318 524904 CDS product Na+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028126.1 protein_id gnl|my_center|LOCUS_04720 524942 525748 gene locus_tag LOCUS_04730 524942 525748 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229957.1 protein_id gnl|my_center|LOCUS_04730 526931 525759 gene locus_tag LOCUS_04740 526931 525759 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976745.1 protein_id gnl|my_center|LOCUS_04740 527067 527657 gene locus_tag LOCUS_04750 527067 527657 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976746.1 protein_id gnl|my_center|LOCUS_04750 529332 527662 gene locus_tag LOCUS_04760 529332 527662 CDS product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014996.1 protein_id gnl|my_center|LOCUS_04760 530238 529426 gene locus_tag LOCUS_04770 530238 529426 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976748.1 protein_id gnl|my_center|LOCUS_04770 531005 530301 gene locus_tag LOCUS_04780 531005 530301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976749.1 protein_id gnl|my_center|LOCUS_04780 532400 531075 gene locus_tag LOCUS_04790 532400 531075 CDS product DUF2252 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976750.1 protein_id gnl|my_center|LOCUS_04790 532637 536176 gene locus_tag LOCUS_04800 gene dnaE 532637 536176 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976751.1 protein_id gnl|my_center|LOCUS_04800 536454 536281 gene locus_tag LOCUS_04810 536454 536281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 536678 537889 gene locus_tag LOCUS_04820 536678 537889 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028124.1 protein_id gnl|my_center|LOCUS_04820 538109 539125 gene locus_tag LOCUS_04830 538109 539125 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028123.1 protein_id gnl|my_center|LOCUS_04830 539214 540038 gene locus_tag LOCUS_04840 539214 540038 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109031846.1 protein_id gnl|my_center|LOCUS_04840 540085 540792 gene locus_tag LOCUS_04850 540085 540792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028121.1 protein_id gnl|my_center|LOCUS_04850 541467 540967 gene locus_tag LOCUS_04860 gene ybaK 541467 540967 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976757.1 protein_id gnl|my_center|LOCUS_04860 542220 541480 gene locus_tag LOCUS_04870 542220 541480 CDS product LON peptidase substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028120.1 protein_id gnl|my_center|LOCUS_04870 543314 542232 gene locus_tag LOCUS_04880 543314 542232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028119.1 protein_id gnl|my_center|LOCUS_04880 545013 543424 gene locus_tag LOCUS_04890 545013 543424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028118.1 protein_id gnl|my_center|LOCUS_04890 545173 546498 gene locus_tag LOCUS_04900 gene hisD 545173 546498 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028117.1 protein_id gnl|my_center|LOCUS_04900 546495 547610 gene locus_tag LOCUS_04910 546495 547610 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976762.1 protein_id gnl|my_center|LOCUS_04910 547607 548209 gene locus_tag LOCUS_04920 gene hisB 547607 548209 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976763.1 protein_id gnl|my_center|LOCUS_04920 548206 548370 gene locus_tag LOCUS_04930 548206 548370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 548367 549014 gene locus_tag LOCUS_04940 gene hisH 548367 549014 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976765.1 protein_id gnl|my_center|LOCUS_04940 549014 549742 gene locus_tag LOCUS_04950 gene priA 549014 549742 CDS product bifunctional 1-(5-phosphoribosyl)-5-((5-phosphoribosylamino)methylideneamino)imidazole-4-carboxamide isomerase/phosphoribosylanthranilate isomerase PriA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976766.1 protein_id gnl|my_center|LOCUS_04950 549739 550131 gene locus_tag LOCUS_04960 549739 550131 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976767.1 protein_id gnl|my_center|LOCUS_04960 550182 550937 gene locus_tag LOCUS_04970 gene hisF 550182 550937 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976768.1 protein_id gnl|my_center|LOCUS_04970 551906 551250 gene locus_tag LOCUS_04980 551906 551250 CDS product TIGR03085 family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028115.1 protein_id gnl|my_center|LOCUS_04980 551513 551533 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 551990 552391 gene locus_tag LOCUS_04990 gene hisI 551990 552391 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976772.1 protein_id gnl|my_center|LOCUS_04990 552403 553881 gene locus_tag LOCUS_05000 552403 553881 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976773.1 protein_id gnl|my_center|LOCUS_05000 554222 553896 gene locus_tag LOCUS_05010 554222 553896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 554262 554909 gene locus_tag LOCUS_05020 554262 554909 CDS product TIGR02234 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028113.1 protein_id gnl|my_center|LOCUS_05020 555050 555298 gene locus_tag LOCUS_05030 555050 555298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028112.1 protein_id gnl|my_center|LOCUS_05030 555515 555904 gene locus_tag LOCUS_05040 555515 555904 CDS product DUF2752 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028111.1 protein_id gnl|my_center|LOCUS_05040 556097 556906 gene locus_tag LOCUS_05050 gene trpC 556097 556906 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028110.1 protein_id gnl|my_center|LOCUS_05050 556929 557135 gene locus_tag LOCUS_05060 556929 557135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976778.1 protein_id gnl|my_center|LOCUS_05060 557207 558490 gene locus_tag LOCUS_05070 gene trpB 557207 558490 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976779.1 protein_id gnl|my_center|LOCUS_05070 558487 559305 gene locus_tag LOCUS_05080 gene trpA 558487 559305 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976780.1 protein_id gnl|my_center|LOCUS_05080 559380 560153 gene locus_tag LOCUS_05090 559380 560153 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168715374.1 protein_id gnl|my_center|LOCUS_05090 560262 561266 gene locus_tag LOCUS_05100 gene lgt 560262 561266 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976782.1 protein_id gnl|my_center|LOCUS_05100 562262 561381 gene locus_tag LOCUS_05110 562262 561381 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028109.1 protein_id gnl|my_center|LOCUS_05110 563419 562259 gene locus_tag LOCUS_05120 563419 562259 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041861981.1 protein_id gnl|my_center|LOCUS_05120 564936 563566 gene locus_tag LOCUS_05130 564936 563566 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028108.1 protein_id gnl|my_center|LOCUS_05130 566138 564924 gene locus_tag LOCUS_05140 566138 564924 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028107.1 protein_id gnl|my_center|LOCUS_05140 567295 566147 gene locus_tag LOCUS_05150 567295 566147 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028106.1 protein_id gnl|my_center|LOCUS_05150 568560 567292 gene locus_tag LOCUS_05160 568560 567292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 568839 569633 gene locus_tag LOCUS_05170 568839 569633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 569348 569378 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 570078 574610 gene locus_tag LOCUS_05180 gene gltB 570078 574610 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028104.1 protein_id gnl|my_center|LOCUS_05180 572129 572149 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 574603 576066 gene locus_tag LOCUS_05190 574603 576066 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976791.1 protein_id gnl|my_center|LOCUS_05190 576181 576906 gene locus_tag LOCUS_05200 576181 576906 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325987.1 protein_id gnl|my_center|LOCUS_05200 577960 576986 gene locus_tag LOCUS_05210 577960 576986 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113158.1 protein_id gnl|my_center|LOCUS_05210 579099 577960 gene locus_tag LOCUS_05220 579099 577960 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225245.1 protein_id gnl|my_center|LOCUS_05220 579173 579967 gene locus_tag LOCUS_05230 579173 579967 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225241.1 protein_id gnl|my_center|LOCUS_05230 579994 580629 gene locus_tag LOCUS_05240 579994 580629 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064806.1 protein_id gnl|my_center|LOCUS_05240 580653 581810 gene locus_tag LOCUS_05250 580653 581810 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225240.1 protein_id gnl|my_center|LOCUS_05250 583004 581946 gene locus_tag LOCUS_05260 583004 581946 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419324.1 protein_id gnl|my_center|LOCUS_05260 583786 583004 gene locus_tag LOCUS_05270 583786 583004 CDS product CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225237.1 protein_id gnl|my_center|LOCUS_05270 584631 583783 gene locus_tag LOCUS_05280 584631 583783 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225236.1 protein_id gnl|my_center|LOCUS_05280 585380 584637 gene locus_tag LOCUS_05290 585380 584637 CDS product enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225235.1 protein_id gnl|my_center|LOCUS_05290 585521 586252 gene locus_tag LOCUS_05300 585521 586252 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005072792.1 protein_id gnl|my_center|LOCUS_05300 586249 587241 gene locus_tag LOCUS_05310 586249 587241 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092227.1 protein_id gnl|my_center|LOCUS_05310 588237 587251 gene locus_tag LOCUS_05320 588237 587251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028100.1 protein_id gnl|my_center|LOCUS_05320 588124 588609 gene locus_tag LOCUS_05330 588124 588609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 589413 591914 gene locus_tag LOCUS_05340 gene pepN 589413 591914 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189283751.1 protein_id gnl|my_center|LOCUS_05340 592092 592925 gene locus_tag LOCUS_05350 592092 592925 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230013.1 protein_id gnl|my_center|LOCUS_05350 593077 594534 gene locus_tag LOCUS_05360 593077 594534 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028098.1 protein_id gnl|my_center|LOCUS_05360 594531 595967 gene locus_tag LOCUS_05370 594531 595967 CDS product SidA/IucD/PvdA family monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976800.1 protein_id gnl|my_center|LOCUS_05370 597783 596029 gene locus_tag LOCUS_05380 597783 596029 CDS product 5'-nucleotidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028097.1 protein_id gnl|my_center|LOCUS_05380 597686 597883 gene locus_tag LOCUS_05390 597686 597883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 597975 598700 gene locus_tag LOCUS_05400 597975 598700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 598850 600286 gene locus_tag LOCUS_05410 gene pyk 598850 600286 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028096.1 protein_id gnl|my_center|LOCUS_05410 600609 600295 gene locus_tag LOCUS_05420 600609 600295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 600665 601102 gene locus_tag LOCUS_05430 600665 601102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 601241 601158 gene locus_tag LOCUS_t00090 601241 601158 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 601343 602017 gene locus_tag LOCUS_05440 601343 602017 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976804.1 protein_id gnl|my_center|LOCUS_05440 602812 602096 gene locus_tag LOCUS_05450 602812 602096 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028095.1 protein_id gnl|my_center|LOCUS_05450 603816 602809 gene locus_tag LOCUS_05460 603816 602809 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976806.1 protein_id gnl|my_center|LOCUS_05460 605662 603824 gene locus_tag LOCUS_05470 605662 603824 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028094.1 protein_id gnl|my_center|LOCUS_05470 606600 605668 gene locus_tag LOCUS_05480 606600 605668 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028093.1 protein_id gnl|my_center|LOCUS_05480 607941 606712 gene locus_tag LOCUS_05490 607941 606712 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976809.1 protein_id gnl|my_center|LOCUS_05490 608867 608229 gene locus_tag LOCUS_05500 608867 608229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028091.1 protein_id gnl|my_center|LOCUS_05500 609232 608858 gene locus_tag LOCUS_05510 609232 608858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 609810 609322 gene locus_tag LOCUS_05520 609810 609322 CDS product hotdog fold thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976812.1 protein_id gnl|my_center|LOCUS_05520 612155 609876 gene locus_tag LOCUS_05530 612155 609876 CDS product FdhF/YdeP family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028088.1 protein_id gnl|my_center|LOCUS_05530 612356 615397 gene locus_tag LOCUS_05540 gene polA 612356 615397 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467407.1 protein_id gnl|my_center|LOCUS_05540 614670 614697 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 615501 615899 gene locus_tag LOCUS_05550 615501 615899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 617094 616156 gene locus_tag LOCUS_05560 617094 616156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 617402 619171 gene locus_tag LOCUS_05570 617402 619171 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028087.1 protein_id gnl|my_center|LOCUS_05570 619320 619454 gene locus_tag LOCUS_05580 619320 619454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 619523 620515 gene locus_tag LOCUS_05590 619523 620515 CDS product DUF3068 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229285.1 protein_id gnl|my_center|LOCUS_05590 623101 620543 gene locus_tag LOCUS_05600 gene hrpB 623101 620543 CDS product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223186.1 protein_id gnl|my_center|LOCUS_05600 624005 623106 gene locus_tag LOCUS_05610 624005 623106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 624321 625811 gene locus_tag LOCUS_05620 gene rpsA 624321 625811 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976820.1 protein_id gnl|my_center|LOCUS_05620 625954 625981 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 626045 626983 gene locus_tag LOCUS_05630 626045 626983 CDS product PAC2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976821.1 protein_id gnl|my_center|LOCUS_05630 627029 627628 gene locus_tag LOCUS_05640 gene coaE 627029 627628 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976822.1 protein_id gnl|my_center|LOCUS_05640 627678 628058 gene locus_tag LOCUS_05650 627678 628058 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976823.1 protein_id gnl|my_center|LOCUS_05650 628341 628075 gene locus_tag LOCUS_05660 628341 628075 CDS product DUF6343 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325978.1 protein_id gnl|my_center|LOCUS_05660 628793 629170 gene locus_tag LOCUS_05670 628793 629170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05670 628799 628823 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 629293 629745 gene locus_tag LOCUS_05680 629293 629745 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028083.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05680 630356 629778 gene locus_tag LOCUS_05690 630356 629778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 630445 631155 gene locus_tag LOCUS_05700 630445 631155 CDS product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976828.1 protein_id gnl|my_center|LOCUS_05700 631193 632155 gene locus_tag LOCUS_05710 gene pip 631193 632155 CDS product prolyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028082.1 protein_id gnl|my_center|LOCUS_05710 632554 632156 gene locus_tag LOCUS_05720 632554 632156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 633889 632591 gene locus_tag LOCUS_05730 633889 632591 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227644.1 protein_id gnl|my_center|LOCUS_05730 634836 633886 gene locus_tag LOCUS_05740 634836 633886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 636380 634863 gene locus_tag LOCUS_05750 636380 634863 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484988.1 protein_id gnl|my_center|LOCUS_05750 638560 636416 gene locus_tag LOCUS_05760 638560 636416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 640298 638565 gene locus_tag LOCUS_05770 640298 638565 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227925.1 protein_id gnl|my_center|LOCUS_05770 640556 640750 gene locus_tag LOCUS_05780 640556 640750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976837.1 protein_id gnl|my_center|LOCUS_05780 642791 640839 gene locus_tag LOCUS_05790 642791 640839 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230344.1 protein_id gnl|my_center|LOCUS_05790 643450 642980 gene locus_tag LOCUS_05800 643450 642980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136209006.1 protein_id gnl|my_center|LOCUS_05800 644169 643441 gene locus_tag LOCUS_05810 644169 643441 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028075.1 protein_id gnl|my_center|LOCUS_05810 644507 645367 gene locus_tag LOCUS_05820 644507 645367 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976840.1 protein_id gnl|my_center|LOCUS_05820 645368 645658 gene locus_tag LOCUS_05830 645368 645658 CDS product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976841.1 protein_id gnl|my_center|LOCUS_05830 645760 646590 gene locus_tag LOCUS_05840 645760 646590 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031037.1 protein_id gnl|my_center|LOCUS_05840 648152 646665 gene locus_tag LOCUS_05850 648152 646665 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028074.1 protein_id gnl|my_center|LOCUS_05850 648938 648294 gene locus_tag LOCUS_05860 648938 648294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 649153 649803 gene locus_tag LOCUS_05870 649153 649803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976844.1 protein_id gnl|my_center|LOCUS_05870 649811 650620 gene locus_tag LOCUS_05880 649811 650620 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976846.1 protein_id gnl|my_center|LOCUS_05880 651545 650655 gene locus_tag LOCUS_05890 651545 650655 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976847.1 protein_id gnl|my_center|LOCUS_05890 652549 651644 gene locus_tag LOCUS_05900 652549 651644 CDS product pseudouridine-5'-phosphate glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976848.1 protein_id gnl|my_center|LOCUS_05900 652550 653077 gene locus_tag LOCUS_05910 652550 653077 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030866702.1 protein_id gnl|my_center|LOCUS_05910 653777 653142 gene locus_tag LOCUS_05920 653777 653142 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028072.1 protein_id gnl|my_center|LOCUS_05920 654749 653868 gene locus_tag LOCUS_05930 654749 653868 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028071.1 protein_id gnl|my_center|LOCUS_05930 655036 655905 gene locus_tag LOCUS_05940 655036 655905 CDS product MHYT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028070.1 protein_id gnl|my_center|LOCUS_05940 655946 658114 gene locus_tag LOCUS_05950 gene uvrB 655946 658114 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028069.1 protein_id gnl|my_center|LOCUS_05950 658289 658867 gene locus_tag LOCUS_05960 658289 658867 CDS product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976854.1 protein_id gnl|my_center|LOCUS_05960 658956 661064 gene locus_tag LOCUS_05970 658956 661064 CDS product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028068.1 protein_id gnl|my_center|LOCUS_05970 661337 662326 gene locus_tag LOCUS_05980 661337 662326 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976856.1 protein_id gnl|my_center|LOCUS_05980 662367 663467 gene locus_tag LOCUS_05990 662367 663467 CDS product ionic transporter y4hA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976857.1 protein_id gnl|my_center|LOCUS_05990 664805 663501 gene locus_tag LOCUS_06000 664805 663501 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522316.1 protein_id gnl|my_center|LOCUS_06000 664956 665429 gene locus_tag LOCUS_06010 gene aroQ 664956 665429 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976858.1 protein_id gnl|my_center|LOCUS_06010 666301 665645 gene locus_tag LOCUS_06020 666301 665645 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976859.1 protein_id gnl|my_center|LOCUS_06020 666739 666383 gene locus_tag LOCUS_06030 666739 666383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06030 666762 666787 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 667330 670338 gene locus_tag LOCUS_06040 gene uvrA 667330 670338 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028066.1 protein_id gnl|my_center|LOCUS_06040 671379 670468 gene locus_tag LOCUS_06050 671379 670468 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028065.1 protein_id gnl|my_center|LOCUS_06050 672428 671376 gene locus_tag LOCUS_06060 672428 671376 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028064.1 protein_id gnl|my_center|LOCUS_06060 672650 673075 gene locus_tag LOCUS_06070 672650 673075 CDS product Rieske (2Fe-2S) protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976864.1 protein_id gnl|my_center|LOCUS_06070 674076 673129 gene locus_tag LOCUS_06080 674076 673129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976865.1 protein_id gnl|my_center|LOCUS_06080 674439 676580 gene locus_tag LOCUS_06090 gene uvrC 674439 676580 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028063.1 protein_id gnl|my_center|LOCUS_06090 676679 677578 gene locus_tag LOCUS_06100 gene rapZ 676679 677578 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093455885.1 protein_id gnl|my_center|LOCUS_06100 677575 678669 gene locus_tag LOCUS_06110 gene yvcK 677575 678669 CDS product uridine diphosphate-N-acetylglucosamine-binding protein YvcK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028061.1 protein_id gnl|my_center|LOCUS_06110 678660 679649 gene locus_tag LOCUS_06120 gene whiA 678660 679649 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976869.1 protein_id gnl|my_center|LOCUS_06120 680156 682987 gene locus_tag LOCUS_06130 680156 682987 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028058.1 protein_id gnl|my_center|LOCUS_06130 683235 684242 gene locus_tag LOCUS_06140 gene gap 683235 684242 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976871.1 protein_id gnl|my_center|LOCUS_06140 684396 685607 gene locus_tag LOCUS_06150 684396 685607 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028057.1 protein_id gnl|my_center|LOCUS_06150 685614 686390 gene locus_tag LOCUS_06160 gene tpiA 685614 686390 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976873.1 protein_id gnl|my_center|LOCUS_06160 686512 686748 gene locus_tag LOCUS_06170 gene secG 686512 686748 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325957.1 protein_id gnl|my_center|LOCUS_06170 686955 687290 gene locus_tag LOCUS_06180 686955 687290 CDS product RNA polymerase-binding protein RbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976875.1 protein_id gnl|my_center|LOCUS_06180 687429 688700 gene locus_tag LOCUS_06190 687429 688700 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222135.1 protein_id gnl|my_center|LOCUS_06190 688767 690419 gene locus_tag LOCUS_06200 gene pgi 688767 690419 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028056.1 protein_id gnl|my_center|LOCUS_06200 >Feature sequence002 102 746 gene locus_tag LOCUS_06210 102 746 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975504.1 protein_id gnl|my_center|LOCUS_06210 852 1532 gene locus_tag LOCUS_06220 852 1532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028915.1 protein_id gnl|my_center|LOCUS_06220 1599 2831 gene locus_tag LOCUS_06230 1599 2831 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028914.1 protein_id gnl|my_center|LOCUS_06230 2773 3954 gene locus_tag LOCUS_06240 2773 3954 CDS product acetoin utilization protein AcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326515.1 protein_id gnl|my_center|LOCUS_06240 4067 4903 gene locus_tag LOCUS_06250 4067 4903 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028912.1 protein_id gnl|my_center|LOCUS_06250 5000 5245 gene locus_tag LOCUS_06260 5000 5245 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004984898.1 protein_id gnl|my_center|LOCUS_06260 5680 6741 gene locus_tag LOCUS_06270 5680 6741 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975510.1 protein_id gnl|my_center|LOCUS_06270 6756 7862 gene locus_tag LOCUS_06280 6756 7862 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975511.1 protein_id gnl|my_center|LOCUS_06280 9224 7932 gene locus_tag LOCUS_06290 9224 7932 CDS product DUF5667 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162495181.1 protein_id gnl|my_center|LOCUS_06290 9731 9480 gene locus_tag LOCUS_06300 9731 9480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06300 9799 10422 gene locus_tag LOCUS_06310 9799 10422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 9834 9864 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11579 10704 gene locus_tag LOCUS_06320 11579 10704 CDS product HAD-IB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037666589.1 protein_id gnl|my_center|LOCUS_06320 11766 12050 gene locus_tag LOCUS_06330 11766 12050 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030145241.1 protein_id gnl|my_center|LOCUS_06330 12502 13158 gene locus_tag LOCUS_06340 12502 13158 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975516.1 protein_id gnl|my_center|LOCUS_06340 13155 14939 gene locus_tag LOCUS_06350 13155 14939 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028907.1 protein_id gnl|my_center|LOCUS_06350 14932 15891 gene locus_tag LOCUS_06360 gene hemC 14932 15891 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975518.1 protein_id gnl|my_center|LOCUS_06360 15984 17594 gene locus_tag LOCUS_06370 15984 17594 CDS product bifunctional uroporphyrinogen-III C-methyltransferase/uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975519.1 protein_id gnl|my_center|LOCUS_06370 16651 16742 gene locus_tag LOCUS_t00100 16651 16742 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 17638 17994 gene locus_tag LOCUS_06380 17638 17994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 18145 19518 gene locus_tag LOCUS_06390 18145 19518 CDS product carboxylesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029563.1 protein_id gnl|my_center|LOCUS_06390 20069 19530 gene locus_tag LOCUS_06400 20069 19530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 20245 20754 gene locus_tag LOCUS_06410 20245 20754 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892804.1 protein_id gnl|my_center|LOCUS_06410 20754 21455 gene locus_tag LOCUS_06420 20754 21455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 22204 21524 gene locus_tag LOCUS_06430 22204 21524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 22770 22204 gene locus_tag LOCUS_06440 22770 22204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 23186 24178 gene locus_tag LOCUS_06450 gene hemB 23186 24178 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028903.1 protein_id gnl|my_center|LOCUS_06450 24402 24142 gene locus_tag LOCUS_06460 24402 24142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 25361 24600 gene locus_tag LOCUS_06470 25361 24600 CDS product DUF4232 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109034961.1 protein_id gnl|my_center|LOCUS_06470 25577 26857 gene locus_tag LOCUS_06480 25577 26857 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028900.1 protein_id gnl|my_center|LOCUS_06480 28768 27005 gene locus_tag LOCUS_06490 gene argS 28768 27005 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028896.1 protein_id gnl|my_center|LOCUS_06490 28979 30721 gene locus_tag LOCUS_06500 gene lysS 28979 30721 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975532.1 protein_id gnl|my_center|LOCUS_06500 32029 30785 gene locus_tag LOCUS_06510 32029 30785 CDS product DUF2637 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028895.1 protein_id gnl|my_center|LOCUS_06510 33029 32139 gene locus_tag LOCUS_06520 33029 32139 CDS product DUF3558 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173668737.1 protein_id gnl|my_center|LOCUS_06520 34064 33162 gene locus_tag LOCUS_06530 34064 33162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975534.1 protein_id gnl|my_center|LOCUS_06530 34273 34557 gene locus_tag LOCUS_06540 34273 34557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06540 34554 35504 gene locus_tag LOCUS_06550 34554 35504 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028892.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06550 35714 35541 gene locus_tag LOCUS_06560 35714 35541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 36490 35714 gene locus_tag LOCUS_06570 36490 35714 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975536.1 protein_id gnl|my_center|LOCUS_06570 36934 36596 gene locus_tag LOCUS_06580 36934 36596 CDS product YnfA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028891.1 protein_id gnl|my_center|LOCUS_06580 37012 38292 gene locus_tag LOCUS_06590 37012 38292 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027428.1 protein_id gnl|my_center|LOCUS_06590 38780 39538 gene locus_tag LOCUS_06600 38780 39538 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225546.1 protein_id gnl|my_center|LOCUS_06600 39539 41017 gene locus_tag LOCUS_06610 39539 41017 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225545.1 protein_id gnl|my_center|LOCUS_06610 42860 41064 gene locus_tag LOCUS_06620 42860 41064 CDS product phosphatidylglycerol lysyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030881.1 protein_id gnl|my_center|LOCUS_06620 43479 43168 gene locus_tag LOCUS_06630 43479 43168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 43702 46098 gene locus_tag LOCUS_06640 43702 46098 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030980.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06640 45810 45832 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 46322 46861 gene locus_tag LOCUS_06650 46322 46861 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973941.1 protein_id gnl|my_center|LOCUS_06650 46858 47544 gene locus_tag LOCUS_06660 46858 47544 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973942.1 protein_id gnl|my_center|LOCUS_06660 47541 49793 gene locus_tag LOCUS_06670 47541 49793 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230975.1 protein_id gnl|my_center|LOCUS_06670 49928 51163 gene locus_tag LOCUS_06680 49928 51163 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742129.1 protein_id gnl|my_center|LOCUS_06680 50644 50664 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 51703 51266 gene locus_tag LOCUS_06690 51703 51266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974483.1 protein_id gnl|my_center|LOCUS_06690 51924 51694 gene locus_tag LOCUS_06700 51924 51694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 52236 53558 gene locus_tag LOCUS_06710 gene hemL 52236 53558 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029675.1 protein_id gnl|my_center|LOCUS_06710 53555 54274 gene locus_tag LOCUS_06720 53555 54274 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974480.1 protein_id gnl|my_center|LOCUS_06720 54525 55841 gene locus_tag LOCUS_06730 54525 55841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029676.1 protein_id gnl|my_center|LOCUS_06730 55908 56573 gene locus_tag LOCUS_06740 55908 56573 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029677.1 protein_id gnl|my_center|LOCUS_06740 56580 57341 gene locus_tag LOCUS_06750 56580 57341 CDS product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974477.1 protein_id gnl|my_center|LOCUS_06750 57411 57450 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 57616 59208 gene locus_tag LOCUS_06760 57616 59208 CDS product cytochrome c biogenesis protein ResB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029679.1 protein_id gnl|my_center|LOCUS_06760 58719 58742 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 59205 60308 gene locus_tag LOCUS_06770 gene ccsB 59205 60308 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029680.1 protein_id gnl|my_center|LOCUS_06770 60374 60775 gene locus_tag LOCUS_06780 60374 60775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 61069 60788 gene locus_tag LOCUS_06790 61069 60788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 61156 62613 gene locus_tag LOCUS_06800 61156 62613 CDS product menaquinone biosynthesis decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974459.1 protein_id gnl|my_center|LOCUS_06800 62610 63512 gene locus_tag LOCUS_06810 62610 63512 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029692.1 protein_id gnl|my_center|LOCUS_06810 63611 64255 gene locus_tag LOCUS_06820 63611 64255 CDS product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974457.1 protein_id gnl|my_center|LOCUS_06820 64343 64798 gene locus_tag LOCUS_06830 64343 64798 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974456.1 protein_id gnl|my_center|LOCUS_06830 64847 66010 gene locus_tag LOCUS_06840 gene mqnE 64847 66010 CDS product aminofutalosine synthase MqnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974455.1 protein_id gnl|my_center|LOCUS_06840 66007 66705 gene locus_tag LOCUS_06850 66007 66705 CDS product UdgX family uracil-DNA binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974454.1 protein_id gnl|my_center|LOCUS_06850 66722 67246 gene locus_tag LOCUS_06860 66722 67246 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029694.1 protein_id gnl|my_center|LOCUS_06860 67349 67639 gene locus_tag LOCUS_06870 67349 67639 CDS product DUF4229 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974452.1 protein_id gnl|my_center|LOCUS_06870 67860 68453 gene locus_tag LOCUS_06880 67860 68453 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029695.1 protein_id gnl|my_center|LOCUS_06880 69380 68463 gene locus_tag LOCUS_06890 69380 68463 CDS product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029696.1 protein_id gnl|my_center|LOCUS_06890 70742 69384 gene locus_tag LOCUS_06900 70742 69384 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029697.1 protein_id gnl|my_center|LOCUS_06900 70830 72116 gene locus_tag LOCUS_06910 70830 72116 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974447.1 protein_id gnl|my_center|LOCUS_06910 72394 74358 gene locus_tag LOCUS_06920 72394 74358 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029698.1 protein_id gnl|my_center|LOCUS_06920 74812 74609 gene locus_tag LOCUS_06930 74812 74609 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974443.1 protein_id gnl|my_center|LOCUS_06930 75184 76035 gene locus_tag LOCUS_06940 75184 76035 CDS product menaquinone biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974442.1 protein_id gnl|my_center|LOCUS_06940 76537 76073 gene locus_tag LOCUS_06950 76537 76073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 76628 76659 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 76678 77964 gene locus_tag LOCUS_06960 76678 77964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06960 78043 79257 gene locus_tag LOCUS_06970 gene mqnC 78043 79257 CDS product cyclic dehypoxanthinyl futalosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029726.1 protein_id gnl|my_center|LOCUS_06970 79265 79714 gene locus_tag LOCUS_06980 79265 79714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 79947 79726 gene locus_tag LOCUS_06990 79947 79726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06990 80711 79944 gene locus_tag LOCUS_07000 80711 79944 CDS product chitinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029728.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07000 79965 79996 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 80992 81192 gene locus_tag LOCUS_07010 80992 81192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 81268 81915 gene locus_tag LOCUS_07020 81268 81915 CDS product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974389.1 protein_id gnl|my_center|LOCUS_07020 82615 82280 gene locus_tag LOCUS_07030 82615 82280 CDS product PASTA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029730.1 protein_id gnl|my_center|LOCUS_07030 83230 82742 gene locus_tag LOCUS_07040 83230 82742 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029731.1 protein_id gnl|my_center|LOCUS_07040 83347 84639 gene locus_tag LOCUS_07050 83347 84639 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974386.1 protein_id gnl|my_center|LOCUS_07050 85450 84872 gene locus_tag LOCUS_07060 85450 84872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 85657 85460 gene locus_tag LOCUS_07070 85657 85460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 86515 85706 gene locus_tag LOCUS_07080 86515 85706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 87066 86605 gene locus_tag LOCUS_07090 87066 86605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229068.1 protein_id gnl|my_center|LOCUS_07090 87831 87394 gene locus_tag LOCUS_07100 87831 87394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 88280 87888 gene locus_tag LOCUS_07110 88280 87888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 88336 88360 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 89840 89481 gene locus_tag LOCUS_07120 89840 89481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 90609 90340 gene locus_tag LOCUS_07130 90609 90340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 90864 90637 gene locus_tag LOCUS_07140 90864 90637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 91770 91018 gene locus_tag LOCUS_07150 91770 91018 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029732.1 protein_id gnl|my_center|LOCUS_07150 92649 93008 gene locus_tag LOCUS_07160 92649 93008 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974383.1 protein_id gnl|my_center|LOCUS_07160 93024 93578 gene locus_tag LOCUS_07170 93024 93578 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006133126.1 protein_id gnl|my_center|LOCUS_07170 93575 94339 gene locus_tag LOCUS_07180 93575 94339 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029733.1 protein_id gnl|my_center|LOCUS_07180 94498 95694 gene locus_tag LOCUS_07190 94498 95694 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029734.1 protein_id gnl|my_center|LOCUS_07190 95691 96569 gene locus_tag LOCUS_07200 gene nuoE 95691 96569 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974380.1 protein_id gnl|my_center|LOCUS_07200 96566 97912 gene locus_tag LOCUS_07210 gene nuoF 96566 97912 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974379.1 protein_id gnl|my_center|LOCUS_07210 98669 97839 gene locus_tag LOCUS_07220 98669 97839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 98863 98887 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 99029 100438 gene locus_tag LOCUS_07230 99029 100438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07230 100435 101796 gene locus_tag LOCUS_07240 gene nuoH 100435 101796 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029736.1 protein_id gnl|my_center|LOCUS_07240 101789 102391 gene locus_tag LOCUS_07250 gene nuoI 101789 102391 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327003.1 protein_id gnl|my_center|LOCUS_07250 102388 103230 gene locus_tag LOCUS_07260 102388 103230 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029738.1 protein_id gnl|my_center|LOCUS_07260 103227 103553 gene locus_tag LOCUS_07270 gene nuoK 103227 103553 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974374.1 protein_id gnl|my_center|LOCUS_07270 103465 103491 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 103569 107120 gene locus_tag LOCUS_07280 103569 107120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 105126 105153 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 107117 108766 gene locus_tag LOCUS_07290 gene nuoN 107117 108766 CDS product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974371.1 protein_id gnl|my_center|LOCUS_07290 108976 110967 gene locus_tag LOCUS_07300 gene recQ 108976 110967 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029740.1 protein_id gnl|my_center|LOCUS_07300 112132 110972 gene locus_tag LOCUS_07310 112132 110972 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031785.1 protein_id gnl|my_center|LOCUS_07310 112148 112846 gene locus_tag LOCUS_07320 112148 112846 CDS product TetR/AcrR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971520.1 protein_id gnl|my_center|LOCUS_07320 113831 112893 gene locus_tag LOCUS_07330 113831 112893 CDS product M56 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029742.1 protein_id gnl|my_center|LOCUS_07330 115403 114192 gene locus_tag LOCUS_07340 gene fahA 115403 114192 CDS product fumarylacetoacetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029743.1 protein_id gnl|my_center|LOCUS_07340 115603 116868 gene locus_tag LOCUS_07350 115603 116868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028535.1 protein_id gnl|my_center|LOCUS_07350 116962 117825 gene locus_tag LOCUS_07360 116962 117825 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974366.1 protein_id gnl|my_center|LOCUS_07360 118301 117819 gene locus_tag LOCUS_07370 118301 117819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 119124 120134 gene locus_tag LOCUS_07380 119124 120134 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974364.1 protein_id gnl|my_center|LOCUS_07380 120374 121585 gene locus_tag LOCUS_07390 120374 121585 CDS product outer membrane lipoprotein carrier protein LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974363.1 protein_id gnl|my_center|LOCUS_07390 121645 122652 gene locus_tag LOCUS_07400 121645 122652 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974362.1 protein_id gnl|my_center|LOCUS_07400 122639 123514 gene locus_tag LOCUS_07410 122639 123514 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030867471.1 protein_id gnl|my_center|LOCUS_07410 124130 123519 gene locus_tag LOCUS_07420 124130 123519 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029745.1 protein_id gnl|my_center|LOCUS_07420 125246 124242 gene locus_tag LOCUS_07430 125246 124242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 125383 125219 gene locus_tag LOCUS_07440 125383 125219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 125538 126422 gene locus_tag LOCUS_07450 125538 126422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 126917 126438 gene locus_tag LOCUS_07460 126917 126438 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974357.1 protein_id gnl|my_center|LOCUS_07460 127985 126999 gene locus_tag LOCUS_07470 gene rarD 127985 126999 CDS product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029749.1 protein_id gnl|my_center|LOCUS_07470 128994 128119 gene locus_tag LOCUS_07480 128994 128119 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974354.1 protein_id gnl|my_center|LOCUS_07480 128288 128308 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 129085 129516 gene locus_tag LOCUS_07490 129085 129516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 130615 129536 gene locus_tag LOCUS_07500 130615 129536 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029750.1 protein_id gnl|my_center|LOCUS_07500 132536 130608 gene locus_tag LOCUS_07510 132536 130608 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108988152.1 protein_id gnl|my_center|LOCUS_07510 133462 132803 gene locus_tag LOCUS_07520 133462 132803 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974351.1 protein_id gnl|my_center|LOCUS_07520 135065 133701 gene locus_tag LOCUS_07530 135065 133701 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029752.1 protein_id gnl|my_center|LOCUS_07530 134063 134089 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 136777 135578 gene locus_tag LOCUS_07540 136777 135578 CDS product sensor domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029753.1 protein_id gnl|my_center|LOCUS_07540 136979 137398 gene locus_tag LOCUS_07550 136979 137398 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974348.1 protein_id gnl|my_center|LOCUS_07550 137389 138099 gene locus_tag LOCUS_07560 137389 138099 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486629.1 protein_id gnl|my_center|LOCUS_07560 138096 139127 gene locus_tag LOCUS_07570 138096 139127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07570 139124 140092 gene locus_tag LOCUS_07580 139124 140092 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029756.1 protein_id gnl|my_center|LOCUS_07580 140092 140697 gene locus_tag LOCUS_07590 140092 140697 CDS product NADH-quinone oxidoreductase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974344.1 protein_id gnl|my_center|LOCUS_07590 140694 141299 gene locus_tag LOCUS_07600 140694 141299 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974343.1 protein_id gnl|my_center|LOCUS_07600 141299 141691 gene locus_tag LOCUS_07610 gene nuoK 141299 141691 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029757.1 protein_id gnl|my_center|LOCUS_07610 142011 141658 gene locus_tag LOCUS_07620 142011 141658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 142302 142323 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 142346 143704 gene locus_tag LOCUS_07630 142346 143704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07630 143711 145285 gene locus_tag LOCUS_07640 143711 145285 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029759.1 protein_id gnl|my_center|LOCUS_07640 145282 146805 gene locus_tag LOCUS_07650 145282 146805 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029760.1 protein_id gnl|my_center|LOCUS_07650 147082 147945 gene locus_tag LOCUS_07660 gene htpX 147082 147945 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974338.1 protein_id gnl|my_center|LOCUS_07660 147942 148334 gene locus_tag LOCUS_07670 147942 148334 CDS product YccF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029761.1 protein_id gnl|my_center|LOCUS_07670 149853 148585 gene locus_tag LOCUS_07680 149853 148585 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029762.1 protein_id gnl|my_center|LOCUS_07680 150052 150318 gene locus_tag LOCUS_07690 150052 150318 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029763.1 protein_id gnl|my_center|LOCUS_07690 150905 150417 gene locus_tag LOCUS_07700 150905 150417 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974333.1 protein_id gnl|my_center|LOCUS_07700 152702 151332 gene locus_tag LOCUS_07710 152702 151332 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029764.1 protein_id gnl|my_center|LOCUS_07710 152952 152764 gene locus_tag LOCUS_07720 152952 152764 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029765.1 protein_id gnl|my_center|LOCUS_07720 154918 153440 gene locus_tag LOCUS_07730 154918 153440 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029766.1 protein_id gnl|my_center|LOCUS_07730 155130 154921 gene locus_tag LOCUS_07740 155130 154921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07740 155148 155173 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 156640 155777 gene locus_tag LOCUS_07750 156640 155777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 157211 156723 gene locus_tag LOCUS_07760 157211 156723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 159543 157420 gene locus_tag LOCUS_07770 159543 157420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 161184 159547 gene locus_tag LOCUS_07780 161184 159547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 161600 161262 gene locus_tag LOCUS_07790 161600 161262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029773.1 protein_id gnl|my_center|LOCUS_07790 162490 161600 gene locus_tag LOCUS_07800 162490 161600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 162768 162487 gene locus_tag LOCUS_07810 162768 162487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 163034 162765 gene locus_tag LOCUS_07820 163034 162765 CDS product DUF6284 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029776.1 protein_id gnl|my_center|LOCUS_07820 163741 164499 gene locus_tag LOCUS_07830 163741 164499 CDS product DUF5919 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229650.1 protein_id gnl|my_center|LOCUS_07830 164502 164975 gene locus_tag LOCUS_07840 164502 164975 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030185.1 protein_id gnl|my_center|LOCUS_07840 165529 164963 gene locus_tag LOCUS_07850 165529 164963 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_137208463.1 protein_id gnl|my_center|LOCUS_07850 165992 165531 gene locus_tag LOCUS_07860 165992 165531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 166645 166139 gene locus_tag LOCUS_07870 166645 166139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 167576 166665 gene locus_tag LOCUS_07880 167576 166665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 168377 169117 gene locus_tag LOCUS_07890 168377 169117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 169086 170267 gene locus_tag LOCUS_07900 169086 170267 CDS product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003911735.1 protein_id gnl|my_center|LOCUS_07900 171349 170948 gene locus_tag LOCUS_07910 171349 170948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 171275 171454 gene locus_tag LOCUS_07920 171275 171454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 171918 171709 gene locus_tag LOCUS_07930 171918 171709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 171805 172632 gene locus_tag LOCUS_07940 171805 172632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07940 172466 172488 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 173404 173024 gene locus_tag LOCUS_07950 173404 173024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 174152 173820 gene locus_tag LOCUS_07960 174152 173820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 175039 174602 gene locus_tag LOCUS_07970 175039 174602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 176115 175459 gene locus_tag LOCUS_07980 176115 175459 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029782.1 protein_id gnl|my_center|LOCUS_07980 177538 176234 gene locus_tag LOCUS_07990 177538 176234 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029783.1 protein_id gnl|my_center|LOCUS_07990 177753 177826 gene locus_tag LOCUS_t00110 177753 177826 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 177872 177945 gene locus_tag LOCUS_t00120 177872 177945 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 178034 178198 gene locus_tag LOCUS_08000 gene rpmG 178034 178198 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948671.1 protein_id gnl|my_center|LOCUS_08000 178350 178802 gene locus_tag LOCUS_08010 178350 178802 CDS product MaoC family dehydratase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029784.1 protein_id gnl|my_center|LOCUS_08010 179027 179290 gene locus_tag LOCUS_08020 179027 179290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_08020 179397 179957 gene locus_tag LOCUS_08030 179397 179957 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974323.1 protein_id gnl|my_center|LOCUS_08030 180056 181522 gene locus_tag LOCUS_08040 180056 181522 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029787.1 protein_id gnl|my_center|LOCUS_08040 181349 181372 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 181889 182926 gene locus_tag LOCUS_08050 181889 182926 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270166.1 protein_id gnl|my_center|LOCUS_08050 183652 182978 gene locus_tag LOCUS_08060 183652 182978 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222251.1 protein_id gnl|my_center|LOCUS_08060 183730 184329 gene locus_tag LOCUS_08070 183730 184329 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222250.1 protein_id gnl|my_center|LOCUS_08070 185464 184400 gene locus_tag LOCUS_08080 185464 184400 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974319.1 protein_id gnl|my_center|LOCUS_08080 187104 185590 gene locus_tag LOCUS_08090 187104 185590 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029790.1 protein_id gnl|my_center|LOCUS_08090 187078 187151 gene locus_tag LOCUS_t00130 187078 187151 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 187258 187545 gene locus_tag LOCUS_08100 gene secE 187258 187545 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974317.1 protein_id gnl|my_center|LOCUS_08100 187627 188475 gene locus_tag LOCUS_08110 gene nusG 187627 188475 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029791.1 protein_id gnl|my_center|LOCUS_08110 188645 189079 gene locus_tag LOCUS_08120 gene rplK 188645 189079 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974315.1 protein_id gnl|my_center|LOCUS_08120 189188 189913 gene locus_tag LOCUS_08130 gene rplA 189188 189913 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974314.1 protein_id gnl|my_center|LOCUS_08130 190253 190017 gene locus_tag LOCUS_08140 190253 190017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 190162 190977 gene locus_tag LOCUS_08150 190162 190977 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974313.1 protein_id gnl|my_center|LOCUS_08150 191256 191786 gene locus_tag LOCUS_08160 gene rplJ 191256 191786 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974311.1 protein_id gnl|my_center|LOCUS_08160 191904 192290 gene locus_tag LOCUS_08170 gene rplL 191904 192290 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974310.1 protein_id gnl|my_center|LOCUS_08170 192469 192669 gene locus_tag LOCUS_08180 192469 192669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 192935 196420 gene locus_tag LOCUS_08190 gene rpoB 192935 196420 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029792.1 protein_id gnl|my_center|LOCUS_08190 196517 200416 gene locus_tag LOCUS_08200 196517 200416 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974308.1 protein_id gnl|my_center|LOCUS_08200 201850 200498 gene locus_tag LOCUS_08210 201850 200498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 201218 201247 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 203279 201918 gene locus_tag LOCUS_08220 203279 201918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 205531 203309 gene locus_tag LOCUS_08230 205531 203309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 206352 205528 gene locus_tag LOCUS_08240 206352 205528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 207260 206553 gene locus_tag LOCUS_08250 207260 206553 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043781894.1 protein_id gnl|my_center|LOCUS_08250 207673 208044 gene locus_tag LOCUS_08260 gene rpsL 207673 208044 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948652.1 protein_id gnl|my_center|LOCUS_08260 208047 208517 gene locus_tag LOCUS_08270 gene rpsG 208047 208517 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974303.1 protein_id gnl|my_center|LOCUS_08270 209181 209419 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 209600 210739 gene locus_tag LOCUS_08280 209600 210739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 210905 212098 gene locus_tag LOCUS_08290 gene tuf 210905 212098 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029795.1 protein_id gnl|my_center|LOCUS_08290 212295 212660 gene locus_tag LOCUS_08300 212295 212660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 212701 214725 gene locus_tag LOCUS_08310 212701 214725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 214950 215255 gene locus_tag LOCUS_08320 214950 215255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 215432 215986 gene locus_tag LOCUS_08330 215432 215986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 215986 217290 gene locus_tag LOCUS_08340 215986 217290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 216984 217008 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 217697 218860 gene locus_tag LOCUS_08350 gene mycP 217697 218860 CDS product type VII secretion-associated serine protease mycosin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030423.1 protein_id gnl|my_center|LOCUS_08350 219587 219198 gene locus_tag LOCUS_08360 219587 219198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 219859 220434 gene locus_tag LOCUS_08370 219859 220434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 220765 221094 gene locus_tag LOCUS_08380 220765 221094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 221408 221851 gene locus_tag LOCUS_08390 221408 221851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 221861 223711 gene locus_tag LOCUS_08400 221861 223711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 223551 223583 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 223752 224315 gene locus_tag LOCUS_08410 223752 224315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 224375 224566 gene locus_tag LOCUS_08420 224375 224566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 224563 225147 gene locus_tag LOCUS_08430 224563 225147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 225304 225331 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 225422 226807 gene locus_tag LOCUS_08440 gene gdhA 225422 226807 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974280.1 protein_id gnl|my_center|LOCUS_08440 227578 227886 gene locus_tag LOCUS_08450 gene rpsJ 227578 227886 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948644.1 protein_id gnl|my_center|LOCUS_08450 227905 228549 gene locus_tag LOCUS_08460 gene rplC 227905 228549 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974267.1 protein_id gnl|my_center|LOCUS_08460 228558 229214 gene locus_tag LOCUS_08470 gene rplD 228558 229214 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974266.1 protein_id gnl|my_center|LOCUS_08470 229214 229633 gene locus_tag LOCUS_08480 gene rplW 229214 229633 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974265.1 protein_id gnl|my_center|LOCUS_08480 229672 230532 gene locus_tag LOCUS_08490 gene rplB 229672 230532 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974264.1 protein_id gnl|my_center|LOCUS_08490 229742 229765 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 230545 230826 gene locus_tag LOCUS_08500 gene rpsS 230545 230826 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974263.1 protein_id gnl|my_center|LOCUS_08500 230868 231215 gene locus_tag LOCUS_08510 gene rplV 230868 231215 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974262.1 protein_id gnl|my_center|LOCUS_08510 231215 232045 gene locus_tag LOCUS_08520 gene rpsC 231215 232045 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974261.1 protein_id gnl|my_center|LOCUS_08520 232051 232470 gene locus_tag LOCUS_08530 gene rplP 232051 232470 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974260.1 protein_id gnl|my_center|LOCUS_08530 232470 232694 gene locus_tag LOCUS_08540 gene rpmC 232470 232694 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974259.1 protein_id gnl|my_center|LOCUS_08540 232694 232981 gene locus_tag LOCUS_08550 gene rpsQ 232694 232981 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974258.1 protein_id gnl|my_center|LOCUS_08550 233113 233481 gene locus_tag LOCUS_08560 gene rplN 233113 233481 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974257.1 protein_id gnl|my_center|LOCUS_08560 233484 233807 gene locus_tag LOCUS_08570 gene rplX 233484 233807 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974256.1 protein_id gnl|my_center|LOCUS_08570 233807 234364 gene locus_tag LOCUS_08580 gene rplE 233807 234364 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974255.1 protein_id gnl|my_center|LOCUS_08580 234361 234555 gene locus_tag LOCUS_08590 234361 234555 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948630.1 protein_id gnl|my_center|LOCUS_08590 234769 235167 gene locus_tag LOCUS_08600 gene rpsH 234769 235167 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974254.1 protein_id gnl|my_center|LOCUS_08600 235192 235731 gene locus_tag LOCUS_08610 gene rplF 235192 235731 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974253.1 protein_id gnl|my_center|LOCUS_08610 235735 236145 gene locus_tag LOCUS_08620 gene rplR 235735 236145 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974252.1 protein_id gnl|my_center|LOCUS_08620 235970 235996 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 236187 236792 gene locus_tag LOCUS_08630 gene rpsE 236187 236792 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974251.1 protein_id gnl|my_center|LOCUS_08630 236795 236977 gene locus_tag LOCUS_08640 gene rpmD 236795 236977 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974250.1 protein_id gnl|my_center|LOCUS_08640 236980 237435 gene locus_tag LOCUS_08650 gene rplO 236980 237435 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974249.1 protein_id gnl|my_center|LOCUS_08650 237616 238929 gene locus_tag LOCUS_08660 gene secY 237616 238929 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974248.1 protein_id gnl|my_center|LOCUS_08660 238929 239591 gene locus_tag LOCUS_08670 238929 239591 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029826.1 protein_id gnl|my_center|LOCUS_08670 239726 240562 gene locus_tag LOCUS_08680 gene map 239726 240562 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029827.1 protein_id gnl|my_center|LOCUS_08680 240724 240945 gene locus_tag LOCUS_08690 gene infA 240724 240945 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948620.1 protein_id gnl|my_center|LOCUS_08690 241339 241719 gene locus_tag LOCUS_08700 gene rpsM 241339 241719 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974244.1 protein_id gnl|my_center|LOCUS_08700 241789 242193 gene locus_tag LOCUS_08710 gene rpsK 241789 242193 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948617.1 protein_id gnl|my_center|LOCUS_08710 242346 243368 gene locus_tag LOCUS_08720 242346 243368 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003966937.1 protein_id gnl|my_center|LOCUS_08720 243531 244037 gene locus_tag LOCUS_08730 gene rplQ 243531 244037 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974243.1 protein_id gnl|my_center|LOCUS_08730 244122 244976 gene locus_tag LOCUS_08740 gene truA 244122 244976 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974242.1 protein_id gnl|my_center|LOCUS_08740 245087 246415 gene locus_tag LOCUS_08750 245087 246415 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975759.1 protein_id gnl|my_center|LOCUS_08750 246420 247250 gene locus_tag LOCUS_08760 246420 247250 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895306.1 protein_id gnl|my_center|LOCUS_08760 248183 247308 gene locus_tag LOCUS_08770 248183 247308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029828.1 protein_id gnl|my_center|LOCUS_08770 248529 248972 gene locus_tag LOCUS_08780 gene rplM 248529 248972 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974239.1 protein_id gnl|my_center|LOCUS_08780 249015 249527 gene locus_tag LOCUS_08790 gene rpsI 249015 249527 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974238.1 protein_id gnl|my_center|LOCUS_08790 249690 251048 gene locus_tag LOCUS_08800 gene glmM 249690 251048 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974237.1 protein_id gnl|my_center|LOCUS_08800 252007 251045 gene locus_tag LOCUS_08810 252007 251045 CDS product DUF389 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466857.1 protein_id gnl|my_center|LOCUS_08810 253043 252054 gene locus_tag LOCUS_08820 gene coaA 253043 252054 CDS product type I pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974235.1 protein_id gnl|my_center|LOCUS_08820 253297 254079 gene locus_tag LOCUS_08830 253297 254079 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029831.1 protein_id gnl|my_center|LOCUS_08830 254185 256032 gene locus_tag LOCUS_08840 gene glmS 254185 256032 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974233.1 protein_id gnl|my_center|LOCUS_08840 256092 256685 gene locus_tag LOCUS_08850 256092 256685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 256857 256666 gene locus_tag LOCUS_08860 256857 256666 CDS product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976062.1 protein_id gnl|my_center|LOCUS_08860 257717 256866 gene locus_tag LOCUS_08870 gene whiJ 257717 256866 CDS product transcriptional regulator WhiJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029721.1 protein_id gnl|my_center|LOCUS_08870 257743 258375 gene locus_tag LOCUS_08880 257743 258375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 257969 257993 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 258543 260669 gene locus_tag LOCUS_08890 258543 260669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 260691 261347 gene locus_tag LOCUS_08900 260691 261347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 261386 261757 gene locus_tag LOCUS_08910 261386 261757 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974229.1 protein_id gnl|my_center|LOCUS_08910 263561 261777 gene locus_tag LOCUS_08920 263561 261777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 263844 265277 gene locus_tag LOCUS_08930 263844 265277 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029833.1 protein_id gnl|my_center|LOCUS_08930 265682 266914 gene locus_tag LOCUS_08940 gene alr 265682 266914 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029835.1 protein_id gnl|my_center|LOCUS_08940 266937 268169 gene locus_tag LOCUS_08950 266937 268169 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327056.1 protein_id gnl|my_center|LOCUS_08950 268174 268656 gene locus_tag LOCUS_08960 gene tsaE 268174 268656 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029837.1 protein_id gnl|my_center|LOCUS_08960 268774 268998 gene locus_tag LOCUS_08970 268774 268998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029838.1 protein_id gnl|my_center|LOCUS_08970 269198 269224 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 269977 269435 gene locus_tag LOCUS_08980 269977 269435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974224.1 protein_id gnl|my_center|LOCUS_08980 270156 270809 gene locus_tag LOCUS_08990 gene tsaB 270156 270809 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029839.1 protein_id gnl|my_center|LOCUS_08990 270806 271417 gene locus_tag LOCUS_09000 gene rimI 270806 271417 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029840.1 protein_id gnl|my_center|LOCUS_09000 271410 272534 gene locus_tag LOCUS_09010 gene tsaD 271410 272534 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029841.1 protein_id gnl|my_center|LOCUS_09010 272531 272797 gene locus_tag LOCUS_09020 272531 272797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029842.1 protein_id gnl|my_center|LOCUS_09020 272870 272942 gene locus_tag LOCUS_t00140 272870 272942 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 273112 273543 gene locus_tag LOCUS_09030 273112 273543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 274270 273503 gene locus_tag LOCUS_09040 274270 273503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_09040 273777 273807 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 276038 274161 gene locus_tag LOCUS_09050 276038 274161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09050 274468 274504 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 276989 276084 gene locus_tag LOCUS_09060 276989 276084 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972114.1 protein_id gnl|my_center|LOCUS_09060 277899 276994 gene locus_tag LOCUS_09070 277899 276994 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972115.1 protein_id gnl|my_center|LOCUS_09070 279206 277896 gene locus_tag LOCUS_09080 279206 277896 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972116.1 protein_id gnl|my_center|LOCUS_09080 279323 280351 gene locus_tag LOCUS_09090 279323 280351 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029843.1 protein_id gnl|my_center|LOCUS_09090 280549 280905 gene locus_tag LOCUS_09100 280549 280905 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974216.1 protein_id gnl|my_center|LOCUS_09100 280992 282314 gene locus_tag LOCUS_09110 280992 282314 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029845.1 protein_id gnl|my_center|LOCUS_09110 282532 282389 gene locus_tag LOCUS_09120 282532 282389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09120 282486 283055 gene locus_tag LOCUS_09130 282486 283055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 282546 282591 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 283745 284710 gene locus_tag LOCUS_09140 283745 284710 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486593.1 protein_id gnl|my_center|LOCUS_09140 284830 285675 gene locus_tag LOCUS_09150 284830 285675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 285677 285901 gene locus_tag LOCUS_09160 285677 285901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 286091 286312 gene locus_tag LOCUS_09170 286091 286312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 286486 286794 gene locus_tag LOCUS_09180 gene groES 286486 286794 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974211.1 protein_id gnl|my_center|LOCUS_09180 286913 288538 gene locus_tag LOCUS_09190 gene groL 286913 288538 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974210.1 protein_id gnl|my_center|LOCUS_09190 289456 288749 gene locus_tag LOCUS_09200 289456 288749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 290310 289537 gene locus_tag LOCUS_09210 290310 289537 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029850.1 protein_id gnl|my_center|LOCUS_09210 291133 290468 gene locus_tag LOCUS_09220 291133 290468 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189284363.1 protein_id gnl|my_center|LOCUS_09220 291218 292135 gene locus_tag LOCUS_09230 291218 292135 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029852.1 protein_id gnl|my_center|LOCUS_09230 292600 292268 gene locus_tag LOCUS_09240 292600 292268 CDS product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974205.1 protein_id gnl|my_center|LOCUS_09240 292982 293593 gene locus_tag LOCUS_09250 292982 293593 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948568.1 protein_id gnl|my_center|LOCUS_09250 294326 294913 gene locus_tag LOCUS_09260 294326 294913 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974204.1 protein_id gnl|my_center|LOCUS_09260 295088 296590 gene locus_tag LOCUS_09270 gene guaB 295088 296590 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974203.1 protein_id gnl|my_center|LOCUS_09270 296709 297857 gene locus_tag LOCUS_09280 296709 297857 CDS product GuaB3 family IMP dehydrogenase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974202.1 protein_id gnl|my_center|LOCUS_09280 296976 296999 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 299629 298421 gene locus_tag LOCUS_09290 299629 298421 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974201.1 protein_id gnl|my_center|LOCUS_09290 300927 299962 gene locus_tag LOCUS_09300 300927 299962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 300454 300480 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 300793 300820 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 300827 301684 gene locus_tag LOCUS_09310 300827 301684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09310 301909 304173 gene locus_tag LOCUS_09320 301909 304173 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029854.1 protein_id gnl|my_center|LOCUS_09320 304337 306181 gene locus_tag LOCUS_09330 304337 306181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09330 305891 305916 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 306070 307086 gene locus_tag LOCUS_09340 306070 307086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09340 307271 308974 gene locus_tag LOCUS_09350 307271 308974 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486587.1 protein_id gnl|my_center|LOCUS_09350 309072 310766 gene locus_tag LOCUS_09360 309072 310766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 310842 311813 gene locus_tag LOCUS_09370 310842 311813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09370 311612 311637 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 311810 312568 gene locus_tag LOCUS_09380 311810 312568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09380 312724 314337 gene locus_tag LOCUS_09390 312724 314337 CDS product succinic semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029859.1 protein_id gnl|my_center|LOCUS_09390 314374 316206 gene locus_tag LOCUS_09400 314374 316206 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029860.1 protein_id gnl|my_center|LOCUS_09400 317023 316742 gene locus_tag LOCUS_09410 317023 316742 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486583.1 protein_id gnl|my_center|LOCUS_09410 317408 318982 gene locus_tag LOCUS_09420 gene guaA 317408 318982 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974187.1 protein_id gnl|my_center|LOCUS_09420 319479 319003 gene locus_tag LOCUS_09430 319479 319003 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486580.1 protein_id gnl|my_center|LOCUS_09430 319626 320420 gene locus_tag LOCUS_09440 319626 320420 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974185.1 protein_id gnl|my_center|LOCUS_09440 320609 321886 gene locus_tag LOCUS_09450 320609 321886 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029864.1 protein_id gnl|my_center|LOCUS_09450 322148 322172 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 322230 322601 gene locus_tag LOCUS_09460 322230 322601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09460 322922 322680 gene locus_tag LOCUS_09470 322922 322680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 324465 322909 gene locus_tag LOCUS_09480 324465 322909 CDS product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029865.1 protein_id gnl|my_center|LOCUS_09480 324710 325999 gene locus_tag LOCUS_09490 324710 325999 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974180.1 protein_id gnl|my_center|LOCUS_09490 325999 326760 gene locus_tag LOCUS_09500 325999 326760 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029866.1 protein_id gnl|my_center|LOCUS_09500 327890 326820 gene locus_tag LOCUS_09510 327890 326820 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029867.1 protein_id gnl|my_center|LOCUS_09510 328339 328692 gene locus_tag LOCUS_09520 328339 328692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327076.1 protein_id gnl|my_center|LOCUS_09520 329653 328670 gene locus_tag LOCUS_09530 329653 328670 CDS product tellurite resistance/C4-dicarboxylate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974176.1 protein_id gnl|my_center|LOCUS_09530 331012 329780 gene locus_tag LOCUS_09540 331012 329780 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029869.1 protein_id gnl|my_center|LOCUS_09540 331233 333716 gene locus_tag LOCUS_09550 gene pcrA 331233 333716 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029870.1 protein_id gnl|my_center|LOCUS_09550 335253 333808 gene locus_tag LOCUS_09560 335253 333808 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029871.1 protein_id gnl|my_center|LOCUS_09560 336342 335476 gene locus_tag LOCUS_09570 336342 335476 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029872.1 protein_id gnl|my_center|LOCUS_09570 336987 337403 gene locus_tag LOCUS_09580 336987 337403 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974171.1 protein_id gnl|my_center|LOCUS_09580 339109 337478 gene locus_tag LOCUS_09590 339109 337478 CDS product DUF5691 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029873.1 protein_id gnl|my_center|LOCUS_09590 339961 339365 gene locus_tag LOCUS_09600 339961 339365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09600 339919 339943 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 340873 342060 gene locus_tag LOCUS_09610 340873 342060 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029875.1 protein_id gnl|my_center|LOCUS_09610 342333 344648 gene locus_tag LOCUS_09620 342333 344648 CDS product DUF5682 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029876.1 protein_id gnl|my_center|LOCUS_09620 344675 345895 gene locus_tag LOCUS_09630 344675 345895 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162495359.1 protein_id gnl|my_center|LOCUS_09630 346038 347144 gene locus_tag LOCUS_09640 346038 347144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029878.1 protein_id gnl|my_center|LOCUS_09640 347921 347952 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 347978 348895 gene locus_tag LOCUS_09650 347978 348895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09650 348917 349801 gene locus_tag LOCUS_09660 gene sucD 348917 349801 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974163.1 protein_id gnl|my_center|LOCUS_09660 350738 349908 gene locus_tag LOCUS_09670 350738 349908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 350832 352301 gene locus_tag LOCUS_09680 350832 352301 CDS product DUF6350 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029881.1 protein_id gnl|my_center|LOCUS_09680 352069 352099 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 352279 352692 gene locus_tag LOCUS_09690 352279 352692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 353003 352701 gene locus_tag LOCUS_09700 353003 352701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09700 353015 353066 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 353496 353524 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 353868 354497 gene locus_tag LOCUS_09710 gene purN 353868 354497 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974158.1 protein_id gnl|my_center|LOCUS_09710 354494 356059 gene locus_tag LOCUS_09720 gene purH 354494 356059 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029883.1 protein_id gnl|my_center|LOCUS_09720 356710 356159 gene locus_tag LOCUS_09730 356710 356159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 356988 357842 gene locus_tag LOCUS_09740 356988 357842 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974148.1 protein_id gnl|my_center|LOCUS_09740 357832 358335 gene locus_tag LOCUS_09750 357832 358335 CDS product DUF3017 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974147.1 protein_id gnl|my_center|LOCUS_09750 358603 359064 gene locus_tag LOCUS_09760 358603 359064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 359195 360166 gene locus_tag LOCUS_09770 359195 360166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 360537 361526 gene locus_tag LOCUS_09780 360537 361526 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974145.1 protein_id gnl|my_center|LOCUS_09780 361656 362654 gene locus_tag LOCUS_09790 361656 362654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 364060 362549 gene locus_tag LOCUS_09800 364060 362549 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224406.1 protein_id gnl|my_center|LOCUS_09800 364155 365123 gene locus_tag LOCUS_09810 364155 365123 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730248.1 protein_id gnl|my_center|LOCUS_09810 365232 366980 gene locus_tag LOCUS_09820 365232 366980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 366560 366648 gene locus_tag LOCUS_t00150 366560 366648 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 366964 367323 gene locus_tag LOCUS_09830 366964 367323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 367754 368506 gene locus_tag LOCUS_09840 367754 368506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 368684 370210 gene locus_tag LOCUS_09850 368684 370210 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029892.1 protein_id gnl|my_center|LOCUS_09850 370324 371874 gene locus_tag LOCUS_09860 370324 371874 CDS product GMC family oxidoreductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974143.1 protein_id gnl|my_center|LOCUS_09860 371874 373010 gene locus_tag LOCUS_09870 371874 373010 CDS product glycine betaine/L-proline ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029893.1 protein_id gnl|my_center|LOCUS_09870 373010 374968 gene locus_tag LOCUS_09880 373010 374968 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029894.1 protein_id gnl|my_center|LOCUS_09880 374970 375935 gene locus_tag LOCUS_09890 374970 375935 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029895.1 protein_id gnl|my_center|LOCUS_09890 376193 375936 gene locus_tag LOCUS_09900 376193 375936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 376230 376670 gene locus_tag LOCUS_09910 376230 376670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 377235 376822 gene locus_tag LOCUS_09920 377235 376822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 377446 378294 gene locus_tag LOCUS_09930 377446 378294 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973979.1 protein_id gnl|my_center|LOCUS_09930 378304 378495 gene locus_tag LOCUS_09940 378304 378495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973980.1 protein_id gnl|my_center|LOCUS_09940 378844 379212 gene locus_tag LOCUS_09950 378844 379212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 379694 379188 gene locus_tag LOCUS_09960 379694 379188 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029897.1 protein_id gnl|my_center|LOCUS_09960 379742 381166 gene locus_tag LOCUS_09970 379742 381166 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029898.1 protein_id gnl|my_center|LOCUS_09970 382072 381212 gene locus_tag LOCUS_09980 382072 381212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030873.1 protein_id gnl|my_center|LOCUS_09980 383358 382153 gene locus_tag LOCUS_09990 gene rocD 383358 382153 CDS product ornithine--oxo-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977608.1 protein_id gnl|my_center|LOCUS_09990 383641 385089 gene locus_tag LOCUS_10000 383641 385089 CDS product glycine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974134.1 protein_id gnl|my_center|LOCUS_10000 385791 385114 gene locus_tag LOCUS_10010 385791 385114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029899.1 protein_id gnl|my_center|LOCUS_10010 385949 386962 gene locus_tag LOCUS_10020 gene trpS 385949 386962 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974132.1 protein_id gnl|my_center|LOCUS_10020 387133 387726 gene locus_tag LOCUS_10030 387133 387726 CDS product 2'-5' RNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029900.1 protein_id gnl|my_center|LOCUS_10030 388529 387753 gene locus_tag LOCUS_10040 388529 387753 CDS product decaprenylphospho-beta-D-erythro-pentofuranosid-2-ulose 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974130.1 protein_id gnl|my_center|LOCUS_10040 388615 389529 gene locus_tag LOCUS_10050 388615 389529 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974125.1 protein_id gnl|my_center|LOCUS_10050 390754 389477 gene locus_tag LOCUS_10060 390754 389477 CDS product DUF5136 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486558.1 protein_id gnl|my_center|LOCUS_10060 390846 391085 gene locus_tag LOCUS_10070 390846 391085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 391110 391379 gene locus_tag LOCUS_10080 391110 391379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 391533 393089 gene locus_tag LOCUS_10090 391533 393089 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973111.1 protein_id gnl|my_center|LOCUS_10090 394605 393094 gene locus_tag LOCUS_10100 gene phoR 394605 393094 CDS product sensory box histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403870.1 protein_id gnl|my_center|LOCUS_10100 395323 394640 gene locus_tag LOCUS_10110 395323 394640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 394695 394726 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 395477 397921 gene locus_tag LOCUS_10120 395477 397921 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030282.1 protein_id gnl|my_center|LOCUS_10120 398507 397893 gene locus_tag LOCUS_10130 398507 397893 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029906.1 protein_id gnl|my_center|LOCUS_10130 399347 398598 gene locus_tag LOCUS_10140 399347 398598 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029905.1 protein_id gnl|my_center|LOCUS_10140 399896 399357 gene locus_tag LOCUS_10150 399896 399357 CDS product DCC1-like thiol-disulfide oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974120.1 protein_id gnl|my_center|LOCUS_10150 400300 399893 gene locus_tag LOCUS_10160 400300 399893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974119.1 protein_id gnl|my_center|LOCUS_10160 400621 400439 gene locus_tag LOCUS_10170 400621 400439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10170 400872 400576 gene locus_tag LOCUS_10180 400872 400576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10180 400676 400698 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 401265 401627 gene locus_tag LOCUS_10190 401265 401627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 402470 401697 gene locus_tag LOCUS_10200 402470 401697 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974116.1 protein_id gnl|my_center|LOCUS_10200 404224 402470 gene locus_tag LOCUS_10210 gene sdhA 404224 402470 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974115.1 protein_id gnl|my_center|LOCUS_10210 404729 404250 gene locus_tag LOCUS_10220 404729 404250 CDS product succinate dehydrogenase hydrophobic membrane anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029907.1 protein_id gnl|my_center|LOCUS_10220 405067 404735 gene locus_tag LOCUS_10230 gene sdhC 405067 404735 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974113.1 protein_id gnl|my_center|LOCUS_10230 405467 405264 gene locus_tag LOCUS_10240 405467 405264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 405966 407612 gene locus_tag LOCUS_10250 405966 407612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 407777 408337 gene locus_tag LOCUS_10260 407777 408337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029911.1 protein_id gnl|my_center|LOCUS_10260 408504 408911 gene locus_tag LOCUS_10270 408504 408911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974108.1 protein_id gnl|my_center|LOCUS_10270 411806 409047 gene locus_tag LOCUS_10280 411806 409047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 412154 412693 gene locus_tag LOCUS_10290 412154 412693 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046247785.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10290 412658 412680 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 412828 413607 gene locus_tag LOCUS_10300 412828 413607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 413899 414561 gene locus_tag LOCUS_10310 413899 414561 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974105.1 protein_id gnl|my_center|LOCUS_10310 414561 415706 gene locus_tag LOCUS_10320 414561 415706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 417051 416026 gene locus_tag LOCUS_10330 417051 416026 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029915.1 protein_id gnl|my_center|LOCUS_10330 417150 418730 gene locus_tag LOCUS_10340 417150 418730 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974103.1 protein_id gnl|my_center|LOCUS_10340 418799 419404 gene locus_tag LOCUS_10350 418799 419404 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029906.1 protein_id gnl|my_center|LOCUS_10350 419941 419432 gene locus_tag LOCUS_10360 419941 419432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10360 420723 419917 gene locus_tag LOCUS_10370 420723 419917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10370 419992 420017 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 422107 420770 gene locus_tag LOCUS_10380 422107 420770 CDS product alpha-2,8-polysialyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029922.1 protein_id gnl|my_center|LOCUS_10380 423081 422104 gene locus_tag LOCUS_10390 423081 422104 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974094.1 protein_id gnl|my_center|LOCUS_10390 423317 424612 gene locus_tag LOCUS_10400 423317 424612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029923.1 protein_id gnl|my_center|LOCUS_10400 424548 424576 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 424680 425924 gene locus_tag LOCUS_10410 424680 425924 CDS product N-acylneuraminate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029924.1 protein_id gnl|my_center|LOCUS_10410 425937 426875 gene locus_tag LOCUS_10420 425937 426875 CDS product N-acetylneuraminate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974091.1 protein_id gnl|my_center|LOCUS_10420 426887 428065 gene locus_tag LOCUS_10430 426887 428065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974090.1 protein_id gnl|my_center|LOCUS_10430 428325 429563 gene locus_tag LOCUS_10440 428325 429563 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029925.1 protein_id gnl|my_center|LOCUS_10440 429589 430047 gene locus_tag LOCUS_10450 429589 430047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 430038 431108 gene locus_tag LOCUS_10460 430038 431108 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974087.1 protein_id gnl|my_center|LOCUS_10460 431551 431207 gene locus_tag LOCUS_10470 431551 431207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 431866 432921 gene locus_tag LOCUS_10480 431866 432921 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974087.1 protein_id gnl|my_center|LOCUS_10480 434035 433094 gene locus_tag LOCUS_10490 434035 433094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 434468 434154 gene locus_tag LOCUS_10500 434468 434154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 434185 434206 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 434460 434786 gene locus_tag LOCUS_10510 434460 434786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 434783 435913 gene locus_tag LOCUS_10520 434783 435913 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029927.1 protein_id gnl|my_center|LOCUS_10520 435910 437172 gene locus_tag LOCUS_10530 435910 437172 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029928.1 protein_id gnl|my_center|LOCUS_10530 437169 437600 gene locus_tag LOCUS_10540 437169 437600 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974083.1 protein_id gnl|my_center|LOCUS_10540 437670 438953 gene locus_tag LOCUS_10550 437670 438953 CDS product thymidine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030872150.1 protein_id gnl|my_center|LOCUS_10550 439050 439637 gene locus_tag LOCUS_10560 439050 439637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 439662 440042 gene locus_tag LOCUS_10570 439662 440042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 440942 439926 gene locus_tag LOCUS_10580 440942 439926 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974078.1 protein_id gnl|my_center|LOCUS_10580 442424 441111 gene locus_tag LOCUS_10590 442424 441111 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029933.1 protein_id gnl|my_center|LOCUS_10590 442521 443426 gene locus_tag LOCUS_10600 442521 443426 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029934.1 protein_id gnl|my_center|LOCUS_10600 444269 443508 gene locus_tag LOCUS_10610 444269 443508 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029936.1 protein_id gnl|my_center|LOCUS_10610 444384 445547 gene locus_tag LOCUS_10620 444384 445547 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974072.1 protein_id gnl|my_center|LOCUS_10620 445676 446023 gene locus_tag LOCUS_10630 445676 446023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029937.1 protein_id gnl|my_center|LOCUS_10630 446319 446119 gene locus_tag LOCUS_10640 446319 446119 CDS product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974070.1 protein_id gnl|my_center|LOCUS_10640 446973 446383 gene locus_tag LOCUS_10650 446973 446383 CDS product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029938.1 protein_id gnl|my_center|LOCUS_10650 447642 447034 gene locus_tag LOCUS_10660 447642 447034 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974068.1 protein_id gnl|my_center|LOCUS_10660 448886 447639 gene locus_tag LOCUS_10670 448886 447639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10670 448496 448528 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 448920 448941 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 449987 449301 gene locus_tag LOCUS_10680 gene afsQ1 449987 449301 CDS product two-component system response regulator AfsQ1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974066.1 protein_id gnl|my_center|LOCUS_10680 450277 451023 gene locus_tag LOCUS_10690 450277 451023 CDS product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327117.1 protein_id gnl|my_center|LOCUS_10690 451843 451199 gene locus_tag LOCUS_10700 451843 451199 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189397579.1 protein_id gnl|my_center|LOCUS_10700 451971 452471 gene locus_tag LOCUS_10710 451971 452471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029941.1 protein_id gnl|my_center|LOCUS_10710 453395 452442 gene locus_tag LOCUS_10720 453395 452442 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168715428.1 protein_id gnl|my_center|LOCUS_10720 454824 453388 gene locus_tag LOCUS_10730 454824 453388 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029944.1 protein_id gnl|my_center|LOCUS_10730 455801 454830 gene locus_tag LOCUS_10740 gene deoC 455801 454830 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029945.1 protein_id gnl|my_center|LOCUS_10740 455924 456655 gene locus_tag LOCUS_10750 455924 456655 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029946.1 protein_id gnl|my_center|LOCUS_10750 458385 456754 gene locus_tag LOCUS_10760 458385 456754 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162495362.1 protein_id gnl|my_center|LOCUS_10760 459505 458630 gene locus_tag LOCUS_10770 459505 458630 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974056.1 protein_id gnl|my_center|LOCUS_10770 459842 459564 gene locus_tag LOCUS_10780 459842 459564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 460331 459894 gene locus_tag LOCUS_10790 460331 459894 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974055.1 protein_id gnl|my_center|LOCUS_10790 460439 461230 gene locus_tag LOCUS_10800 460439 461230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10800 460557 460583 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 461030 461052 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 461146 461937 gene locus_tag LOCUS_10810 461146 461937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10810 462147 463085 gene locus_tag LOCUS_10820 462147 463085 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029949.1 protein_id gnl|my_center|LOCUS_10820 464943 463171 gene locus_tag LOCUS_10830 464943 463171 CDS product biotin carboxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029950.1 protein_id gnl|my_center|LOCUS_10830 465333 465914 gene locus_tag LOCUS_10840 465333 465914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 466565 465945 gene locus_tag LOCUS_10850 466565 465945 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974050.1 protein_id gnl|my_center|LOCUS_10850 467372 467244 gene locus_tag LOCUS_10860 467372 467244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974049.1 protein_id gnl|my_center|LOCUS_10860 467715 467509 gene locus_tag LOCUS_10870 467715 467509 CDS product acyl-CoA carboxylase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974048.1 protein_id gnl|my_center|LOCUS_10870 469326 467725 gene locus_tag LOCUS_10880 469326 467725 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029952.1 protein_id gnl|my_center|LOCUS_10880 469437 470348 gene locus_tag LOCUS_10890 469437 470348 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029953.1 protein_id gnl|my_center|LOCUS_10890 469755 469781 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 470689 471825 gene locus_tag LOCUS_10900 470689 471825 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029954.1 protein_id gnl|my_center|LOCUS_10900 472542 471838 gene locus_tag LOCUS_10910 472542 471838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029955.1 protein_id gnl|my_center|LOCUS_10910 472759 473553 gene locus_tag LOCUS_10920 472759 473553 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029956.1 protein_id gnl|my_center|LOCUS_10920 473644 474795 gene locus_tag LOCUS_10930 473644 474795 CDS product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870180.1 protein_id gnl|my_center|LOCUS_10930 474895 476433 gene locus_tag LOCUS_10940 gene hutH 474895 476433 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974041.1 protein_id gnl|my_center|LOCUS_10940 476868 476509 gene locus_tag LOCUS_10950 476868 476509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 476729 476758 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 477282 478526 gene locus_tag LOCUS_10960 477282 478526 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029959.1 protein_id gnl|my_center|LOCUS_10960 478820 481240 gene locus_tag LOCUS_10970 478820 481240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 480637 480667 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 481182 482174 gene locus_tag LOCUS_10980 481182 482174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 483203 482295 gene locus_tag LOCUS_10990 483203 482295 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029967.1 protein_id gnl|my_center|LOCUS_10990 483087 483362 gene locus_tag LOCUS_11000 483087 483362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 483404 484444 gene locus_tag LOCUS_11010 483404 484444 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974028.1 protein_id gnl|my_center|LOCUS_11010 484661 485659 gene locus_tag LOCUS_11020 484661 485659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 486132 485638 gene locus_tag LOCUS_11030 486132 485638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 487415 486297 gene locus_tag LOCUS_11040 487415 486297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974019.1 protein_id gnl|my_center|LOCUS_11040 487544 488698 gene locus_tag LOCUS_11050 487544 488698 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870223.1 protein_id gnl|my_center|LOCUS_11050 488997 488749 gene locus_tag LOCUS_11060 488997 488749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974017.1 protein_id gnl|my_center|LOCUS_11060 489553 489050 gene locus_tag LOCUS_11070 489553 489050 CDS product sigma factor-like helix-turn-helix DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974016.1 protein_id gnl|my_center|LOCUS_11070 490211 489714 gene locus_tag LOCUS_11080 490211 489714 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037666375.1 protein_id gnl|my_center|LOCUS_11080 490388 491617 gene locus_tag LOCUS_11090 gene ilvA 490388 491617 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029975.1 protein_id gnl|my_center|LOCUS_11090 491860 492900 gene locus_tag LOCUS_11100 491860 492900 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029976.1 protein_id gnl|my_center|LOCUS_11100 492743 492763 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 492897 493697 gene locus_tag LOCUS_11110 492897 493697 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974012.1 protein_id gnl|my_center|LOCUS_11110 494279 493779 gene locus_tag LOCUS_11120 gene greA 494279 493779 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974011.1 protein_id gnl|my_center|LOCUS_11120 494853 494455 gene locus_tag LOCUS_11130 494853 494455 CDS product DUF4307 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974010.1 protein_id gnl|my_center|LOCUS_11130 495055 495933 gene locus_tag LOCUS_11140 gene mca 495055 495933 CDS product mycothiol conjugate amidase Mca inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007444314.1 protein_id gnl|my_center|LOCUS_11140 495948 496184 gene locus_tag LOCUS_11150 495948 496184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974008.1 protein_id gnl|my_center|LOCUS_11150 499463 496263 gene locus_tag LOCUS_11160 499463 496263 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270179.1 protein_id gnl|my_center|LOCUS_11160 499649 501682 gene locus_tag LOCUS_11170 499649 501682 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974002.1 protein_id gnl|my_center|LOCUS_11170 502438 501701 gene locus_tag LOCUS_11180 502438 501701 CDS product Mut7-C RNAse domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974001.1 protein_id gnl|my_center|LOCUS_11180 503114 502473 gene locus_tag LOCUS_11190 503114 502473 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487124.1 protein_id gnl|my_center|LOCUS_11190 504730 503111 gene locus_tag LOCUS_11200 504730 503111 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025727111.1 protein_id gnl|my_center|LOCUS_11200 505571 504858 gene locus_tag LOCUS_11210 505571 504858 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029984.1 protein_id gnl|my_center|LOCUS_11210 505657 505689 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 505894 507717 gene locus_tag LOCUS_11220 505894 507717 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973998.1 protein_id gnl|my_center|LOCUS_11220 507923 508099 gene locus_tag LOCUS_11230 507923 508099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 508673 508110 gene locus_tag LOCUS_11240 508673 508110 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929688.1 protein_id gnl|my_center|LOCUS_11240 509290 508835 gene locus_tag LOCUS_11250 509290 508835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973994.1 protein_id gnl|my_center|LOCUS_11250 508849 508871 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 510652 509417 gene locus_tag LOCUS_11260 510652 509417 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973993.1 protein_id gnl|my_center|LOCUS_11260 509819 509842 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 510784 512169 gene locus_tag LOCUS_11270 510784 512169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 512279 513175 gene locus_tag LOCUS_11280 512279 513175 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029986.1 protein_id gnl|my_center|LOCUS_11280 514906 513263 gene locus_tag LOCUS_11290 514906 513263 CDS product D-aminoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029987.1 protein_id gnl|my_center|LOCUS_11290 516180 514915 gene locus_tag LOCUS_11300 516180 514915 CDS product amino acid deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973990.1 protein_id gnl|my_center|LOCUS_11300 516401 517456 gene locus_tag LOCUS_11310 516401 517456 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029988.1 protein_id gnl|my_center|LOCUS_11310 517453 518226 gene locus_tag LOCUS_11320 517453 518226 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973988.1 protein_id gnl|my_center|LOCUS_11320 518297 518325 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 518489 518662 gene locus_tag LOCUS_11330 518489 518662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11330 518785 520260 gene locus_tag LOCUS_11340 518785 520260 CDS product gluconate:H+ symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029989.1 protein_id gnl|my_center|LOCUS_11340 520323 520934 gene locus_tag LOCUS_11350 520323 520934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973985.1 protein_id gnl|my_center|LOCUS_11350 521397 521089 gene locus_tag LOCUS_11360 521397 521089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 521692 521405 gene locus_tag LOCUS_11370 521692 521405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 523515 521812 gene locus_tag LOCUS_11380 523515 521812 CDS product glycoside hydrolase family 18 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029996.1 protein_id gnl|my_center|LOCUS_11380 523930 524694 gene locus_tag LOCUS_11390 523930 524694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029997.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11390 524645 524679 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 524945 525652 gene locus_tag LOCUS_11400 gene cpaB 524945 525652 CDS product Flp pilus assembly protein CpaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973972.1 protein_id gnl|my_center|LOCUS_11400 525665 526927 gene locus_tag LOCUS_11410 525665 526927 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973971.1 protein_id gnl|my_center|LOCUS_11410 526924 527370 gene locus_tag LOCUS_11420 526924 527370 CDS product septum formation initiator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973970.1 protein_id gnl|my_center|LOCUS_11420 527372 527836 gene locus_tag LOCUS_11430 527372 527836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 527860 529197 gene locus_tag LOCUS_11440 527860 529197 CDS product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973968.1 protein_id gnl|my_center|LOCUS_11440 529233 530174 gene locus_tag LOCUS_11450 529233 530174 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030000.1 protein_id gnl|my_center|LOCUS_11450 530208 531095 gene locus_tag LOCUS_11460 530208 531095 CDS product DUF5936 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030001.1 protein_id gnl|my_center|LOCUS_11460 531115 532740 gene locus_tag LOCUS_11470 531115 532740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 532807 533721 gene locus_tag LOCUS_11480 gene absA2 532807 533721 CDS product two component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028838.1 protein_id gnl|my_center|LOCUS_11480 533870 534733 gene locus_tag LOCUS_11490 533870 534733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 533985 534015 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 534765 535340 gene locus_tag LOCUS_11500 534765 535340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030004.1 protein_id gnl|my_center|LOCUS_11500 535351 535992 gene locus_tag LOCUS_11510 535351 535992 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030005.1 protein_id gnl|my_center|LOCUS_11510 536171 538459 gene locus_tag LOCUS_11520 536171 538459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 538535 539239 gene locus_tag LOCUS_11530 538535 539239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 539236 539766 gene locus_tag LOCUS_11540 539236 539766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 540144 539779 gene locus_tag LOCUS_11550 540144 539779 CDS product DUF192 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487141.1 protein_id gnl|my_center|LOCUS_11550 540281 541024 gene locus_tag LOCUS_11560 540281 541024 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029725.1 protein_id gnl|my_center|LOCUS_11560 541175 542014 gene locus_tag LOCUS_11570 541175 542014 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030011.1 protein_id gnl|my_center|LOCUS_11570 542770 543543 gene locus_tag LOCUS_11580 542770 543543 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167441465.1 protein_id gnl|my_center|LOCUS_11580 543913 545238 gene locus_tag LOCUS_11590 543913 545238 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973949.1 protein_id gnl|my_center|LOCUS_11590 545669 545313 gene locus_tag LOCUS_11600 545669 545313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 545699 546394 gene locus_tag LOCUS_11610 545699 546394 CDS product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973948.1 protein_id gnl|my_center|LOCUS_11610 546524 547795 gene locus_tag LOCUS_11620 546524 547795 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030013.1 protein_id gnl|my_center|LOCUS_11620 547729 547759 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 548432 547899 gene locus_tag LOCUS_11630 548432 547899 CDS product alkyl hydroperoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973946.1 protein_id gnl|my_center|LOCUS_11630 548991 548437 gene locus_tag LOCUS_11640 548991 548437 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973945.1 protein_id gnl|my_center|LOCUS_11640 549125 550075 gene locus_tag LOCUS_11650 549125 550075 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973944.1 protein_id gnl|my_center|LOCUS_11650 552824 550515 gene locus_tag LOCUS_11660 552824 550515 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327169.1 protein_id gnl|my_center|LOCUS_11660 553582 552893 gene locus_tag LOCUS_11670 553582 552893 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973942.1 protein_id gnl|my_center|LOCUS_11670 554112 553579 gene locus_tag LOCUS_11680 554112 553579 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973941.1 protein_id gnl|my_center|LOCUS_11680 554481 554218 gene locus_tag LOCUS_11690 554481 554218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 555461 554478 gene locus_tag LOCUS_11700 555461 554478 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973939.1 protein_id gnl|my_center|LOCUS_11700 555705 558095 gene locus_tag LOCUS_11710 555705 558095 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973938.1 protein_id gnl|my_center|LOCUS_11710 560566 558194 gene locus_tag LOCUS_11720 560566 558194 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487155.1 protein_id gnl|my_center|LOCUS_11720 561599 560742 gene locus_tag LOCUS_11730 561599 560742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 561140 561171 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 563058 561673 gene locus_tag LOCUS_11740 563058 561673 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030018.1 protein_id gnl|my_center|LOCUS_11740 564845 563175 gene locus_tag LOCUS_11750 564845 563175 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327174.1 protein_id gnl|my_center|LOCUS_11750 565038 565733 gene locus_tag LOCUS_11760 565038 565733 CDS product DUF1707 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030020.1 protein_id gnl|my_center|LOCUS_11760 565837 566211 gene locus_tag LOCUS_11770 565837 566211 CDS product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030021.1 protein_id gnl|my_center|LOCUS_11770 567369 566335 gene locus_tag LOCUS_11780 gene glpX 567369 566335 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973930.1 protein_id gnl|my_center|LOCUS_11780 567536 568021 gene locus_tag LOCUS_11790 567536 568021 CDS product DUF4245 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973929.1 protein_id gnl|my_center|LOCUS_11790 568341 568099 gene locus_tag LOCUS_11800 568341 568099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 569583 568351 gene locus_tag LOCUS_11810 gene xseA 569583 568351 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030027.1 protein_id gnl|my_center|LOCUS_11810 569662 570678 gene locus_tag LOCUS_11820 569662 570678 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973920.1 protein_id gnl|my_center|LOCUS_11820 570726 571472 gene locus_tag LOCUS_11830 570726 571472 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973919.1 protein_id gnl|my_center|LOCUS_11830 572000 571638 gene locus_tag LOCUS_11840 572000 571638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11840 572008 572041 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 572446 573534 gene locus_tag LOCUS_11850 gene ychF 572446 573534 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973917.1 protein_id gnl|my_center|LOCUS_11850 573944 578263 gene locus_tag LOCUS_11860 573944 578263 CDS product LamG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184834092.1 protein_id gnl|my_center|LOCUS_11860 578394 585287 gene locus_tag LOCUS_11870 578394 585287 CDS product RHS repeat-associated core domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109036422.1 protein_id gnl|my_center|LOCUS_11870 585296 586021 gene locus_tag LOCUS_11880 585296 586021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 587670 586081 gene locus_tag LOCUS_11890 587670 586081 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972641.1 protein_id gnl|my_center|LOCUS_11890 588581 587787 gene locus_tag LOCUS_11900 588581 587787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 588917 589237 gene locus_tag LOCUS_11910 588917 589237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 589234 591660 gene locus_tag LOCUS_11920 589234 591660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 591851 593098 gene locus_tag LOCUS_11930 591851 593098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 593153 593767 gene locus_tag LOCUS_11940 593153 593767 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228651.1 protein_id gnl|my_center|LOCUS_11940 595047 593791 gene locus_tag LOCUS_11950 595047 593791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 596857 595070 gene locus_tag LOCUS_11960 596857 595070 CDS product fatty acyl-AMP ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551762.1 protein_id gnl|my_center|LOCUS_11960 595469 595495 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 597932 597327 gene locus_tag LOCUS_11970 597932 597327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 598123 598335 gene locus_tag LOCUS_11980 598123 598335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 598390 600129 gene locus_tag LOCUS_11990 598390 600129 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184547.1 protein_id gnl|my_center|LOCUS_11990 600148 600429 gene locus_tag LOCUS_12000 600148 600429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 600429 601226 gene locus_tag LOCUS_12010 600429 601226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 601301 602059 gene locus_tag LOCUS_12020 601301 602059 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063807391.1 protein_id gnl|my_center|LOCUS_12020 602088 602918 gene locus_tag LOCUS_12030 602088 602918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 603016 603285 gene locus_tag LOCUS_12040 603016 603285 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973889.1 protein_id gnl|my_center|LOCUS_12040 603282 604046 gene locus_tag LOCUS_12050 603282 604046 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227250.1 protein_id gnl|my_center|LOCUS_12050 604046 604441 gene locus_tag LOCUS_12060 604046 604441 CDS product SchA/CurD-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227245.1 protein_id gnl|my_center|LOCUS_12060 604438 604899 gene locus_tag LOCUS_12070 604438 604899 CDS product DUF1772 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086670558.1 protein_id gnl|my_center|LOCUS_12070 605416 605502 gene locus_tag LOCUS_t00160 605416 605502 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 605855 605472 gene locus_tag LOCUS_12080 605855 605472 CDS product SchA/CurD-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227245.1 protein_id gnl|my_center|LOCUS_12080 606025 606360 gene locus_tag LOCUS_12090 606025 606360 CDS product TcmI family type II polyketide cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227257.1 protein_id gnl|my_center|LOCUS_12090 606357 606791 gene locus_tag LOCUS_12100 606357 606791 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973653.1 protein_id gnl|my_center|LOCUS_12100 606788 608077 gene locus_tag LOCUS_12110 606788 608077 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227255.1 protein_id gnl|my_center|LOCUS_12110 608074 609315 gene locus_tag LOCUS_12120 608074 609315 CDS product ketosynthase chain-length factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_182663097.1 protein_id gnl|my_center|LOCUS_12120 609351 609815 gene locus_tag LOCUS_12130 609351 609815 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973657.1 protein_id gnl|my_center|LOCUS_12130 609823 610284 gene locus_tag LOCUS_12140 609823 610284 CDS product DUF1772 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227251.1 protein_id gnl|my_center|LOCUS_12140 610321 611076 gene locus_tag LOCUS_12150 610321 611076 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227250.1 protein_id gnl|my_center|LOCUS_12150 611076 611390 gene locus_tag LOCUS_12160 611076 611390 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227249.1 protein_id gnl|my_center|LOCUS_12160 611380 611709 gene locus_tag LOCUS_12170 611380 611709 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227248.1 protein_id gnl|my_center|LOCUS_12170 611786 612649 gene locus_tag LOCUS_12180 611786 612649 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227244.1 protein_id gnl|my_center|LOCUS_12180 612720 614369 gene locus_tag LOCUS_12190 612720 614369 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062821440.1 protein_id gnl|my_center|LOCUS_12190 614202 614225 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 614366 614728 gene locus_tag LOCUS_12200 614366 614728 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227249.1 protein_id gnl|my_center|LOCUS_12200 614782 616368 gene locus_tag LOCUS_12210 614782 616368 CDS product multicopper oxidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013995.1 protein_id gnl|my_center|LOCUS_12210 618295 616442 gene locus_tag LOCUS_12220 gene asnB 618295 616442 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223784.1 protein_id gnl|my_center|LOCUS_12220 619967 618336 gene locus_tag LOCUS_12230 619967 618336 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227261.1 protein_id gnl|my_center|LOCUS_12230 >Feature sequence003 1 357 gene locus_tag LOCUS_12240 1 357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 387 1775 gene locus_tag LOCUS_12250 387 1775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031593.1 protein_id gnl|my_center|LOCUS_12250 1780 4011 gene locus_tag LOCUS_12260 gene glgB 1780 4011 CDS product 1,4-alpha-glucan branching enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031592.1 protein_id gnl|my_center|LOCUS_12260 4130 5239 gene locus_tag LOCUS_12270 4130 5239 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031591.1 protein_id gnl|my_center|LOCUS_12270 5497 5264 gene locus_tag LOCUS_12280 5497 5264 CDS product DUF6480 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971811.1 protein_id gnl|my_center|LOCUS_12280 5650 7557 gene locus_tag LOCUS_12290 5650 7557 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031590.1 protein_id gnl|my_center|LOCUS_12290 7558 7587 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7711 7875 gene locus_tag LOCUS_12300 7711 7875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 7879 8151 gene locus_tag LOCUS_12310 7879 8151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973513.1 protein_id gnl|my_center|LOCUS_12310 8242 8676 gene locus_tag LOCUS_12320 8242 8676 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971813.1 protein_id gnl|my_center|LOCUS_12320 9288 8701 gene locus_tag LOCUS_12330 9288 8701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 9695 9324 gene locus_tag LOCUS_12340 9695 9324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 9802 9827 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10222 9839 gene locus_tag LOCUS_12350 10222 9839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 10502 14779 gene locus_tag LOCUS_12360 10502 14779 CDS product HAMP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031589.1 protein_id gnl|my_center|LOCUS_12360 14808 17258 gene locus_tag LOCUS_12370 14808 17258 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031588.1 protein_id gnl|my_center|LOCUS_12370 17369 18253 gene locus_tag LOCUS_12380 17369 18253 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036279.1 protein_id gnl|my_center|LOCUS_12380 18380 18781 gene locus_tag LOCUS_12390 18380 18781 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971816.1 protein_id gnl|my_center|LOCUS_12390 18925 19824 gene locus_tag LOCUS_12400 18925 19824 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971817.1 protein_id gnl|my_center|LOCUS_12400 19821 20246 gene locus_tag LOCUS_12410 19821 20246 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971818.1 protein_id gnl|my_center|LOCUS_12410 20246 20686 gene locus_tag LOCUS_12420 20246 20686 CDS product anti-sigma regulatory factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036370.1 protein_id gnl|my_center|LOCUS_12420 20686 21993 gene locus_tag LOCUS_12430 20686 21993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 21990 23738 gene locus_tag LOCUS_12440 21990 23738 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031586.1 protein_id gnl|my_center|LOCUS_12440 24066 25451 gene locus_tag LOCUS_12450 24066 25451 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030866777.1 protein_id gnl|my_center|LOCUS_12450 25535 27784 gene locus_tag LOCUS_12460 25535 27784 CDS product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168715412.1 protein_id gnl|my_center|LOCUS_12460 28276 27845 gene locus_tag LOCUS_12470 28276 27845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971824.1 protein_id gnl|my_center|LOCUS_12470 29181 28348 gene locus_tag LOCUS_12480 29181 28348 CDS product DUF1206 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031583.1 protein_id gnl|my_center|LOCUS_12480 29715 29326 gene locus_tag LOCUS_12490 29715 29326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 30628 29720 gene locus_tag LOCUS_12500 30628 29720 CDS product SigB/SigF/SigG family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031582.1 protein_id gnl|my_center|LOCUS_12500 31292 30840 gene locus_tag LOCUS_12510 31292 30840 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031581.1 protein_id gnl|my_center|LOCUS_12510 31564 31595 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 31942 31967 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 31987 33279 gene locus_tag LOCUS_12520 31987 33279 CDS product ornithine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971830.1 protein_id gnl|my_center|LOCUS_12520 33562 34017 gene locus_tag LOCUS_12530 33562 34017 CDS product cyclic nucleotide-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971831.1 protein_id gnl|my_center|LOCUS_12530 35422 34034 gene locus_tag LOCUS_12540 35422 34034 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031580.1 protein_id gnl|my_center|LOCUS_12540 35951 35523 gene locus_tag LOCUS_12550 35951 35523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12550 35994 36021 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 36238 37152 gene locus_tag LOCUS_12560 36238 37152 CDS product LysR family transcriptional regulator ArgP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971834.1 protein_id gnl|my_center|LOCUS_12560 37871 37149 gene locus_tag LOCUS_12570 37871 37149 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031801.1 protein_id gnl|my_center|LOCUS_12570 38046 39266 gene locus_tag LOCUS_12580 38046 39266 CDS product saccharopine dehydrogenase NADP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031800.1 protein_id gnl|my_center|LOCUS_12580 39413 39667 gene locus_tag LOCUS_12590 39413 39667 CDS product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971835.1 protein_id gnl|my_center|LOCUS_12590 40190 39732 gene locus_tag LOCUS_12600 40190 39732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 42130 40280 gene locus_tag LOCUS_12610 42130 40280 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229334.1 protein_id gnl|my_center|LOCUS_12610 42822 42127 gene locus_tag LOCUS_12620 42822 42127 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229333.1 protein_id gnl|my_center|LOCUS_12620 43368 42841 gene locus_tag LOCUS_12630 43368 42841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12630 43516 43544 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 45246 43795 gene locus_tag LOCUS_12640 45246 43795 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029546.1 protein_id gnl|my_center|LOCUS_12640 45438 45788 gene locus_tag LOCUS_12650 45438 45788 CDS product DUF488 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031578.1 protein_id gnl|my_center|LOCUS_12650 47746 46073 gene locus_tag LOCUS_12660 47746 46073 CDS product FAD-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031577.1 protein_id gnl|my_center|LOCUS_12660 48453 47764 gene locus_tag LOCUS_12670 48453 47764 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270392.1 protein_id gnl|my_center|LOCUS_12670 48586 49218 gene locus_tag LOCUS_12680 48586 49218 CDS product alpha-ketoglutarate-dependent dioxygenase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971839.1 protein_id gnl|my_center|LOCUS_12680 49317 50063 gene locus_tag LOCUS_12690 49317 50063 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031575.1 protein_id gnl|my_center|LOCUS_12690 50098 51330 gene locus_tag LOCUS_12700 50098 51330 CDS product DUF4032 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971841.1 protein_id gnl|my_center|LOCUS_12700 52280 51333 gene locus_tag LOCUS_12710 52280 51333 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030866806.1 protein_id gnl|my_center|LOCUS_12710 52424 54100 gene locus_tag LOCUS_12720 52424 54100 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971843.1 protein_id gnl|my_center|LOCUS_12720 54097 55593 gene locus_tag LOCUS_12730 54097 55593 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031573.1 protein_id gnl|my_center|LOCUS_12730 55590 55940 gene locus_tag LOCUS_12740 55590 55940 CDS product UBP-type zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971845.1 protein_id gnl|my_center|LOCUS_12740 57041 56013 gene locus_tag LOCUS_12750 57041 56013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 57838 57023 gene locus_tag LOCUS_12760 57838 57023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 57161 57192 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 58152 59426 gene locus_tag LOCUS_12770 58152 59426 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189701214.1 protein_id gnl|my_center|LOCUS_12770 58989 59012 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 59495 60142 gene locus_tag LOCUS_12780 59495 60142 CDS product AIM24 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971849.1 protein_id gnl|my_center|LOCUS_12780 60255 61322 gene locus_tag LOCUS_12790 60255 61322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 61328 62455 gene locus_tag LOCUS_12800 61328 62455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12800 62187 62214 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 62506 63465 gene locus_tag LOCUS_12810 62506 63465 CDS product threonine/serine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031570.1 protein_id gnl|my_center|LOCUS_12810 63710 65311 gene locus_tag LOCUS_12820 63710 65311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 65404 66354 gene locus_tag LOCUS_12830 65404 66354 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031568.1 protein_id gnl|my_center|LOCUS_12830 66411 66437 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 66501 66941 gene locus_tag LOCUS_12840 66501 66941 CDS product SsgA family sporulation/cell division regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971854.1 protein_id gnl|my_center|LOCUS_12840 67351 66926 gene locus_tag LOCUS_12850 67351 66926 CDS product DUF6328 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971855.1 protein_id gnl|my_center|LOCUS_12850 67573 67944 gene locus_tag LOCUS_12860 67573 67944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031567.1 protein_id gnl|my_center|LOCUS_12860 68964 67981 gene locus_tag LOCUS_12870 68964 67981 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031566.1 protein_id gnl|my_center|LOCUS_12870 70182 68977 gene locus_tag LOCUS_12880 70182 68977 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031565.1 protein_id gnl|my_center|LOCUS_12880 70529 70915 gene locus_tag LOCUS_12890 70529 70915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 70950 71774 gene locus_tag LOCUS_12900 70950 71774 CDS product tyrosinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976100.1 protein_id gnl|my_center|LOCUS_12900 72369 71836 gene locus_tag LOCUS_12910 72369 71836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12910 72374 72399 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 73398 72601 gene locus_tag LOCUS_12920 73398 72601 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031563.1 protein_id gnl|my_center|LOCUS_12920 73587 74609 gene locus_tag LOCUS_12930 73587 74609 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877764.1 protein_id gnl|my_center|LOCUS_12930 75210 74728 gene locus_tag LOCUS_12940 75210 74728 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031562.1 protein_id gnl|my_center|LOCUS_12940 75398 76036 gene locus_tag LOCUS_12950 75398 76036 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971862.1 protein_id gnl|my_center|LOCUS_12950 76038 76640 gene locus_tag LOCUS_12960 76038 76640 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971863.1 protein_id gnl|my_center|LOCUS_12960 77154 76690 gene locus_tag LOCUS_12970 77154 76690 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031561.1 protein_id gnl|my_center|LOCUS_12970 77759 77304 gene locus_tag LOCUS_12980 77759 77304 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971866.1 protein_id gnl|my_center|LOCUS_12980 79251 77893 gene locus_tag LOCUS_12990 79251 77893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 79425 81545 gene locus_tag LOCUS_13000 79425 81545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 80827 80857 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 84188 81849 gene locus_tag LOCUS_13010 84188 81849 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030872986.1 protein_id gnl|my_center|LOCUS_13010 84667 84296 gene locus_tag LOCUS_13020 84667 84296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971870.1 protein_id gnl|my_center|LOCUS_13020 85026 85409 gene locus_tag LOCUS_13030 85026 85409 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031557.1 protein_id gnl|my_center|LOCUS_13030 85647 85429 gene locus_tag LOCUS_13040 85647 85429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13040 85796 86566 gene locus_tag LOCUS_13050 85796 86566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 85829 85853 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 86578 87477 gene locus_tag LOCUS_13060 86578 87477 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971873.1 protein_id gnl|my_center|LOCUS_13060 87540 88055 gene locus_tag LOCUS_13070 87540 88055 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031555.1 protein_id gnl|my_center|LOCUS_13070 89122 88037 gene locus_tag LOCUS_13080 89122 88037 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031554.1 protein_id gnl|my_center|LOCUS_13080 89613 89218 gene locus_tag LOCUS_13090 89613 89218 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031553.1 protein_id gnl|my_center|LOCUS_13090 90652 89723 gene locus_tag LOCUS_13100 90652 89723 CDS product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030856.1 protein_id gnl|my_center|LOCUS_13100 91056 90649 gene locus_tag LOCUS_13110 91056 90649 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030855.1 protein_id gnl|my_center|LOCUS_13110 91189 91905 gene locus_tag LOCUS_13120 91189 91905 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085274.1 protein_id gnl|my_center|LOCUS_13120 93304 91934 gene locus_tag LOCUS_13130 93304 91934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 94279 93386 gene locus_tag LOCUS_13140 94279 93386 CDS product chitinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031550.1 protein_id gnl|my_center|LOCUS_13140 95691 94432 gene locus_tag LOCUS_13150 95691 94432 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226524.1 protein_id gnl|my_center|LOCUS_13150 96047 95691 gene locus_tag LOCUS_13160 96047 95691 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226523.1 protein_id gnl|my_center|LOCUS_13160 96146 97198 gene locus_tag LOCUS_13170 96146 97198 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729551.1 protein_id gnl|my_center|LOCUS_13170 97396 97232 gene locus_tag LOCUS_13180 97396 97232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976837.1 protein_id gnl|my_center|LOCUS_13180 99604 97514 gene locus_tag LOCUS_13190 99604 97514 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027382.1 protein_id gnl|my_center|LOCUS_13190 100140 99736 gene locus_tag LOCUS_13200 100140 99736 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978019.1 protein_id gnl|my_center|LOCUS_13200 100206 100236 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 100744 100283 gene locus_tag LOCUS_13210 100744 100283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 102240 100780 gene locus_tag LOCUS_13220 102240 100780 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225277.1 protein_id gnl|my_center|LOCUS_13220 102345 103529 gene locus_tag LOCUS_13230 102345 103529 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224850.1 protein_id gnl|my_center|LOCUS_13230 103641 106373 gene locus_tag LOCUS_13240 103641 106373 CDS product carbohydrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205661056.1 protein_id gnl|my_center|LOCUS_13240 107890 106436 gene locus_tag LOCUS_13250 107890 106436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 108110 108376 gene locus_tag LOCUS_13260 108110 108376 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971884.1 protein_id gnl|my_center|LOCUS_13260 108575 108405 gene locus_tag LOCUS_13270 108575 108405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 110136 108931 gene locus_tag LOCUS_13280 110136 108931 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224092.1 protein_id gnl|my_center|LOCUS_13280 108976 109007 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 109723 109743 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 111336 110347 gene locus_tag LOCUS_13290 111336 110347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 112230 111355 gene locus_tag LOCUS_13300 112230 111355 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088051.1 protein_id gnl|my_center|LOCUS_13300 113153 112461 gene locus_tag LOCUS_13310 gene chpB 113153 112461 CDS product LAXTG-anchored chaplin ChpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031547.1 protein_id gnl|my_center|LOCUS_13310 113448 115064 gene locus_tag LOCUS_13320 113448 115064 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031546.1 protein_id gnl|my_center|LOCUS_13320 117024 115153 gene locus_tag LOCUS_13330 gene asnB 117024 115153 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223784.1 protein_id gnl|my_center|LOCUS_13330 115329 115358 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 117338 118438 gene locus_tag LOCUS_13340 117338 118438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971889.1 protein_id gnl|my_center|LOCUS_13340 118503 119540 gene locus_tag LOCUS_13350 118503 119540 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031545.1 protein_id gnl|my_center|LOCUS_13350 119981 119568 gene locus_tag LOCUS_13360 119981 119568 CDS product SsgA family sporulation/cell division regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972274.1 protein_id gnl|my_center|LOCUS_13360 120316 121734 gene locus_tag LOCUS_13370 120316 121734 CDS product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031544.1 protein_id gnl|my_center|LOCUS_13370 123228 121735 gene locus_tag LOCUS_13380 123228 121735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031543.1 protein_id gnl|my_center|LOCUS_13380 123465 124598 gene locus_tag LOCUS_13390 123465 124598 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971893.1 protein_id gnl|my_center|LOCUS_13390 125354 127339 gene locus_tag LOCUS_13400 125354 127339 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031541.1 protein_id gnl|my_center|LOCUS_13400 127942 127415 gene locus_tag LOCUS_13410 127942 127415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031540.1 protein_id gnl|my_center|LOCUS_13410 128928 128002 gene locus_tag LOCUS_13420 128928 128002 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971898.1 protein_id gnl|my_center|LOCUS_13420 129369 129058 gene locus_tag LOCUS_13430 129369 129058 CDS product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971899.1 protein_id gnl|my_center|LOCUS_13430 130550 129384 gene locus_tag LOCUS_13440 130550 129384 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224426.1 protein_id gnl|my_center|LOCUS_13440 131617 130547 gene locus_tag LOCUS_13450 131617 130547 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419199.1 protein_id gnl|my_center|LOCUS_13450 132564 131614 gene locus_tag LOCUS_13460 132564 131614 CDS product OB-fold nucleic acid binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224428.1 protein_id gnl|my_center|LOCUS_13460 133472 132609 gene locus_tag LOCUS_13470 133472 132609 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224429.1 protein_id gnl|my_center|LOCUS_13470 133604 135250 gene locus_tag LOCUS_13480 133604 135250 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742163.1 protein_id gnl|my_center|LOCUS_13480 134210 134236 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 136181 135342 gene locus_tag LOCUS_13490 136181 135342 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031538.1 protein_id gnl|my_center|LOCUS_13490 136334 137464 gene locus_tag LOCUS_13500 136334 137464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13500 137099 137148 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 137361 137663 gene locus_tag LOCUS_13510 137361 137663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13510 138222 137644 gene locus_tag LOCUS_13520 138222 137644 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870827.1 protein_id gnl|my_center|LOCUS_13520 139758 138259 gene locus_tag LOCUS_13530 139758 138259 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031537.1 protein_id gnl|my_center|LOCUS_13530 140068 141390 gene locus_tag LOCUS_13540 gene ccrA 140068 141390 CDS product crotonyl-CoA carboxylase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223473.1 protein_id gnl|my_center|LOCUS_13540 141638 142180 gene locus_tag LOCUS_13550 141638 142180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 142285 142545 gene locus_tag LOCUS_13560 142285 142545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 143441 142458 gene locus_tag LOCUS_13570 143441 142458 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235191074.1 protein_id gnl|my_center|LOCUS_13570 146878 143531 gene locus_tag LOCUS_13580 146878 143531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 150296 147063 gene locus_tag LOCUS_13590 150296 147063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13590 147384 147405 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 152087 150348 gene locus_tag LOCUS_13600 152087 150348 CDS product fatty acyl-AMP ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226325.1 protein_id gnl|my_center|LOCUS_13600 152344 153750 gene locus_tag LOCUS_13610 152344 153750 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225224.1 protein_id gnl|my_center|LOCUS_13610 154601 153867 gene locus_tag LOCUS_13620 154601 153867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 156640 154973 gene locus_tag LOCUS_13630 156640 154973 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083171434.1 protein_id gnl|my_center|LOCUS_13630 157746 156637 gene locus_tag LOCUS_13640 157746 156637 CDS product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085883.1 protein_id gnl|my_center|LOCUS_13640 158180 160066 gene locus_tag LOCUS_13650 158180 160066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 160165 161748 gene locus_tag LOCUS_13660 160165 161748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 161582 161608 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 161786 164407 gene locus_tag LOCUS_13670 161786 164407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 164439 166061 gene locus_tag LOCUS_13680 164439 166061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 166055 168004 gene locus_tag LOCUS_13690 166055 168004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 168281 168090 gene locus_tag LOCUS_13700 168281 168090 CDS product DUF2795 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065544.1 protein_id gnl|my_center|LOCUS_13700 169945 168377 gene locus_tag LOCUS_13710 169945 168377 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162483874.1 protein_id gnl|my_center|LOCUS_13710 171264 170008 gene locus_tag LOCUS_13720 171264 170008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13720 172229 171261 gene locus_tag LOCUS_13730 172229 171261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13730 171514 171536 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 173184 172294 gene locus_tag LOCUS_13740 173184 172294 CDS product oxygenase MpaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971907.1 protein_id gnl|my_center|LOCUS_13740 174369 173191 gene locus_tag LOCUS_13750 174369 173191 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897303.1 protein_id gnl|my_center|LOCUS_13750 174886 174503 gene locus_tag LOCUS_13760 174886 174503 CDS product four-helix bundle copper-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971908.1 protein_id gnl|my_center|LOCUS_13760 175011 175415 gene locus_tag LOCUS_13770 175011 175415 CDS product ChaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727919.1 protein_id gnl|my_center|LOCUS_13770 175477 175842 gene locus_tag LOCUS_13780 175477 175842 CDS product DUF6479 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031532.1 protein_id gnl|my_center|LOCUS_13780 175927 176280 gene locus_tag LOCUS_13790 175927 176280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 176459 177985 gene locus_tag LOCUS_13800 176459 177985 CDS product ubiquinol-cytochrome c reductase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031531.1 protein_id gnl|my_center|LOCUS_13800 178443 177934 gene locus_tag LOCUS_13810 178443 177934 CDS product cytochrome c oxidase subunit 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971910.1 protein_id gnl|my_center|LOCUS_13810 180041 178440 gene locus_tag LOCUS_13820 gene ctaD 180041 178440 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971911.1 protein_id gnl|my_center|LOCUS_13820 180226 180416 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 180534 181253 gene locus_tag LOCUS_13830 180534 181253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031647.1 protein_id gnl|my_center|LOCUS_13830 181350 181841 gene locus_tag LOCUS_13840 181350 181841 CDS product DUF1360 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027590.1 protein_id gnl|my_center|LOCUS_13840 181984 182976 gene locus_tag LOCUS_13850 gene dhaK 181984 182976 CDS product dihydroxyacetone kinase subunit DhaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972071.1 protein_id gnl|my_center|LOCUS_13850 183029 183628 gene locus_tag LOCUS_13860 gene dhaL 183029 183628 CDS product dihydroxyacetone kinase subunit DhaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031416.1 protein_id gnl|my_center|LOCUS_13860 183630 184040 gene locus_tag LOCUS_13870 183630 184040 CDS product PTS fructose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164277346.1 protein_id gnl|my_center|LOCUS_13870 184776 184060 gene locus_tag LOCUS_13880 184776 184060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_13880 185202 186203 gene locus_tag LOCUS_13890 185202 186203 CDS product fibronectin type III domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031414.1 protein_id gnl|my_center|LOCUS_13890 186744 186367 gene locus_tag LOCUS_13900 186744 186367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 186662 186898 gene locus_tag LOCUS_13910 186662 186898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 187483 186932 gene locus_tag LOCUS_13920 187483 186932 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972077.1 protein_id gnl|my_center|LOCUS_13920 187764 187516 gene locus_tag LOCUS_13930 187764 187516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13930 189554 187767 gene locus_tag LOCUS_13940 189554 187767 CDS product NADPH-dependent 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031412.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13940 187837 187859 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 190088 189717 gene locus_tag LOCUS_13950 190088 189717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031411.1 protein_id gnl|my_center|LOCUS_13950 190359 192437 gene locus_tag LOCUS_13960 190359 192437 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031409.1 protein_id gnl|my_center|LOCUS_13960 193314 192490 gene locus_tag LOCUS_13970 193314 192490 CDS product putative protein N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031408.1 protein_id gnl|my_center|LOCUS_13970 193467 193952 gene locus_tag LOCUS_13980 193467 193952 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972083.1 protein_id gnl|my_center|LOCUS_13980 194719 193916 gene locus_tag LOCUS_13990 194719 193916 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466913.1 protein_id gnl|my_center|LOCUS_13990 195642 194716 gene locus_tag LOCUS_14000 195642 194716 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015533.1 protein_id gnl|my_center|LOCUS_14000 195958 196542 gene locus_tag LOCUS_14010 195958 196542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972086.1 protein_id gnl|my_center|LOCUS_14010 196650 197618 gene locus_tag LOCUS_14020 196650 197618 CDS product acetylxylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972087.1 protein_id gnl|my_center|LOCUS_14020 197728 198894 gene locus_tag LOCUS_14030 197728 198894 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224733.1 protein_id gnl|my_center|LOCUS_14030 199047 199820 gene locus_tag LOCUS_14040 199047 199820 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972088.1 protein_id gnl|my_center|LOCUS_14040 200573 199848 gene locus_tag LOCUS_14050 200573 199848 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972089.1 protein_id gnl|my_center|LOCUS_14050 200877 202031 gene locus_tag LOCUS_14060 gene rho 200877 202031 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972093.1 protein_id gnl|my_center|LOCUS_14060 202241 203356 gene locus_tag LOCUS_14070 202241 203356 CDS product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162483876.1 protein_id gnl|my_center|LOCUS_14070 204306 203374 gene locus_tag LOCUS_14080 204306 203374 CDS product glutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972095.1 protein_id gnl|my_center|LOCUS_14080 205753 204344 gene locus_tag LOCUS_14090 gene aspA 205753 204344 CDS product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224033.1 protein_id gnl|my_center|LOCUS_14090 206818 205802 gene locus_tag LOCUS_14100 206818 205802 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224034.1 protein_id gnl|my_center|LOCUS_14100 207621 206869 gene locus_tag LOCUS_14110 207621 206869 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224036.1 protein_id gnl|my_center|LOCUS_14110 208581 207745 gene locus_tag LOCUS_14120 208581 207745 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972097.1 protein_id gnl|my_center|LOCUS_14120 209029 208661 gene locus_tag LOCUS_14130 gene crcB 209029 208661 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031399.1 protein_id gnl|my_center|LOCUS_14130 209406 209026 gene locus_tag LOCUS_14140 209406 209026 CDS product DUF190 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972099.1 protein_id gnl|my_center|LOCUS_14140 209867 209403 gene locus_tag LOCUS_14150 209867 209403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 211029 210058 gene locus_tag LOCUS_14160 211029 210058 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228739.1 protein_id gnl|my_center|LOCUS_14160 211387 211100 gene locus_tag LOCUS_14170 211387 211100 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327912.1 protein_id gnl|my_center|LOCUS_14170 211526 211948 gene locus_tag LOCUS_14180 211526 211948 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226694.1 protein_id gnl|my_center|LOCUS_14180 212047 212436 gene locus_tag LOCUS_14190 212047 212436 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972102.1 protein_id gnl|my_center|LOCUS_14190 212880 212473 gene locus_tag LOCUS_14200 212880 212473 CDS product SseB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972103.1 protein_id gnl|my_center|LOCUS_14200 213438 213109 gene locus_tag LOCUS_14210 213438 213109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 213585 213899 gene locus_tag LOCUS_14220 213585 213899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14220 215442 213913 gene locus_tag LOCUS_14230 gene glpK 215442 213913 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226254.1 protein_id gnl|my_center|LOCUS_14230 216304 215489 gene locus_tag LOCUS_14240 216304 215489 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226255.1 protein_id gnl|my_center|LOCUS_14240 216402 216827 gene locus_tag LOCUS_14250 216402 216827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 216998 218449 gene locus_tag LOCUS_14260 216998 218449 CDS product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114861.1 protein_id gnl|my_center|LOCUS_14260 218569 219723 gene locus_tag LOCUS_14270 218569 219723 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031359.1 protein_id gnl|my_center|LOCUS_14270 220555 219740 gene locus_tag LOCUS_14280 220555 219740 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224187.1 protein_id gnl|my_center|LOCUS_14280 220618 221334 gene locus_tag LOCUS_14290 220618 221334 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027419.1 protein_id gnl|my_center|LOCUS_14290 221455 222483 gene locus_tag LOCUS_14300 221455 222483 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731571.1 protein_id gnl|my_center|LOCUS_14300 223329 222550 gene locus_tag LOCUS_14310 223329 222550 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839946.1 protein_id gnl|my_center|LOCUS_14310 224561 223356 gene locus_tag LOCUS_14320 224561 223356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 223468 223496 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 225637 224558 gene locus_tag LOCUS_14330 225637 224558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 226944 225616 gene locus_tag LOCUS_14340 226944 225616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 225746 225768 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 226402 226422 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 227901 226993 gene locus_tag LOCUS_14350 227901 226993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 227161 227181 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 229694 227958 gene locus_tag LOCUS_14360 229694 227958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 227972 228136 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 241335 229732 gene locus_tag LOCUS_14370 241335 229732 CDS product type I polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030787.1 protein_id gnl|my_center|LOCUS_14370 229833 229866 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 243247 241523 gene locus_tag LOCUS_14380 243247 241523 CDS product fatty acyl-AMP ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928895.1 protein_id gnl|my_center|LOCUS_14380 243697 244191 gene locus_tag LOCUS_14390 243697 244191 CDS product lamin tail domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109036335.1 protein_id gnl|my_center|LOCUS_14390 245203 244271 gene locus_tag LOCUS_14400 245203 244271 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173668747.1 protein_id gnl|my_center|LOCUS_14400 245573 245319 gene locus_tag LOCUS_14410 245573 245319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 246011 248572 gene locus_tag LOCUS_14420 246011 248572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 248587 251850 gene locus_tag LOCUS_14430 248587 251850 CDS product amino acid adenylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228027.1 protein_id gnl|my_center|LOCUS_14430 251905 252918 gene locus_tag LOCUS_14440 251905 252918 CDS product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113096.1 protein_id gnl|my_center|LOCUS_14440 252915 254033 gene locus_tag LOCUS_14450 gene sbnB 252915 254033 CDS product 2,3-diaminopropionate biosynthesis protein SbnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225889.1 protein_id gnl|my_center|LOCUS_14450 254072 255160 gene locus_tag LOCUS_14460 gene sbnA 254072 255160 CDS product 2,3-diaminopropionate biosynthesis protein SbnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226627.1 protein_id gnl|my_center|LOCUS_14460 256912 255191 gene locus_tag LOCUS_14470 256912 255191 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031655.1 protein_id gnl|my_center|LOCUS_14470 257523 257065 gene locus_tag LOCUS_14480 257523 257065 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971719.1 protein_id gnl|my_center|LOCUS_14480 260212 257969 gene locus_tag LOCUS_14490 260212 257969 CDS product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189811864.1 protein_id gnl|my_center|LOCUS_14490 260397 261809 gene locus_tag LOCUS_14500 260397 261809 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484585.1 protein_id gnl|my_center|LOCUS_14500 261328 261351 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 264067 261950 gene locus_tag LOCUS_14510 264067 261950 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027517.1 protein_id gnl|my_center|LOCUS_14510 264950 264150 gene locus_tag LOCUS_14520 264950 264150 CDS product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027518.1 protein_id gnl|my_center|LOCUS_14520 265484 265005 gene locus_tag LOCUS_14530 265484 265005 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977815.1 protein_id gnl|my_center|LOCUS_14530 266370 265549 gene locus_tag LOCUS_14540 266370 265549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14540 266411 266433 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 267917 267342 gene locus_tag LOCUS_14550 267917 267342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 268056 268089 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 268196 268570 gene locus_tag LOCUS_14560 268196 268570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 269281 268739 gene locus_tag LOCUS_14570 269281 268739 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977812.1 protein_id gnl|my_center|LOCUS_14570 270156 269386 gene locus_tag LOCUS_14580 270156 269386 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030873288.1 protein_id gnl|my_center|LOCUS_14580 270211 271425 gene locus_tag LOCUS_14590 270211 271425 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484591.1 protein_id gnl|my_center|LOCUS_14590 272767 271451 gene locus_tag LOCUS_14600 272767 271451 CDS product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027524.1 protein_id gnl|my_center|LOCUS_14600 271510 271530 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 272730 272936 gene locus_tag LOCUS_14610 272730 272936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 273139 273576 gene locus_tag LOCUS_14620 273139 273576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977808.1 protein_id gnl|my_center|LOCUS_14620 273618 274442 gene locus_tag LOCUS_14630 273618 274442 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027526.1 protein_id gnl|my_center|LOCUS_14630 274685 275215 gene locus_tag LOCUS_14640 274685 275215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027527.1 protein_id gnl|my_center|LOCUS_14640 275370 276473 gene locus_tag LOCUS_14650 275370 276473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14650 276378 276403 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 276425 277834 gene locus_tag LOCUS_14660 276425 277834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14660 279642 277804 gene locus_tag LOCUS_14670 279642 277804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14670 279553 279581 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 279681 280301 gene locus_tag LOCUS_14680 279681 280301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 280503 281330 gene locus_tag LOCUS_14690 280503 281330 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977803.1 protein_id gnl|my_center|LOCUS_14690 281403 281870 gene locus_tag LOCUS_14700 281403 281870 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977802.1 protein_id gnl|my_center|LOCUS_14700 281871 281900 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 283134 282007 gene locus_tag LOCUS_14710 283134 282007 CDS product PLP-dependent cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977801.1 protein_id gnl|my_center|LOCUS_14710 283433 283756 gene locus_tag LOCUS_14720 283433 283756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 283983 284492 gene locus_tag LOCUS_14730 283983 284492 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173668703.1 protein_id gnl|my_center|LOCUS_14730 285035 284739 gene locus_tag LOCUS_14740 285035 284739 CDS product SHOCT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977796.1 protein_id gnl|my_center|LOCUS_14740 285215 285793 gene locus_tag LOCUS_14750 285215 285793 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030864677.1 protein_id gnl|my_center|LOCUS_14750 285855 286406 gene locus_tag LOCUS_14760 285855 286406 CDS product DUF4865 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027533.1 protein_id gnl|my_center|LOCUS_14760 286400 287323 gene locus_tag LOCUS_14770 286400 287323 CDS product phosphotriesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027534.1 protein_id gnl|my_center|LOCUS_14770 289020 287782 gene locus_tag LOCUS_14780 289020 287782 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027535.1 protein_id gnl|my_center|LOCUS_14780 289707 289057 gene locus_tag LOCUS_14790 289707 289057 CDS product alpha-ketoglutarate-dependent dioxygenase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027536.1 protein_id gnl|my_center|LOCUS_14790 289792 290949 gene locus_tag LOCUS_14800 289792 290949 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270458.1 protein_id gnl|my_center|LOCUS_14800 291888 290974 gene locus_tag LOCUS_14810 291888 290974 CDS product class II fructose-bisphosphate aldolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030498.1 protein_id gnl|my_center|LOCUS_14810 292799 291918 gene locus_tag LOCUS_14820 292799 291918 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007446839.1 protein_id gnl|my_center|LOCUS_14820 292920 293699 gene locus_tag LOCUS_14830 292920 293699 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027539.1 protein_id gnl|my_center|LOCUS_14830 293789 293811 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 294201 293818 gene locus_tag LOCUS_14840 294201 293818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 294501 295004 gene locus_tag LOCUS_14850 294501 295004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 295147 295719 gene locus_tag LOCUS_14860 gene ywaE 295147 295719 CDS product tyrZ transcriptional regulator YwaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243598.1 protein_id gnl|my_center|LOCUS_14860 296435 295767 gene locus_tag LOCUS_14870 296435 295767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14870 296335 296360 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 298071 296581 gene locus_tag LOCUS_14880 298071 296581 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064138.1 protein_id gnl|my_center|LOCUS_14880 299601 298144 gene locus_tag LOCUS_14890 299601 298144 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392306.1 protein_id gnl|my_center|LOCUS_14890 300576 299722 gene locus_tag LOCUS_14900 300576 299722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 301450 300605 gene locus_tag LOCUS_14910 301450 300605 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214882.1 protein_id gnl|my_center|LOCUS_14910 302395 301466 gene locus_tag LOCUS_14920 302395 301466 CDS product 3,4-dihydroxyphenylacetate 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523563.1 protein_id gnl|my_center|LOCUS_14920 303851 302388 gene locus_tag LOCUS_14930 gene hpaE 303851 302388 CDS product 5-carboxymethyl-2-hydroxymuconate semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528544.1 protein_id gnl|my_center|LOCUS_14930 304692 303886 gene locus_tag LOCUS_14940 304692 303886 CDS product acetoacetate decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943037.1 protein_id gnl|my_center|LOCUS_14940 305913 304705 gene locus_tag LOCUS_14950 305913 304705 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165781113.1 protein_id gnl|my_center|LOCUS_14950 306105 305917 gene locus_tag LOCUS_14960 306105 305917 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898093.1 protein_id gnl|my_center|LOCUS_14960 306459 307814 gene locus_tag LOCUS_14970 gene glnA 306459 307814 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903540.1 protein_id gnl|my_center|LOCUS_14970 307834 309192 gene locus_tag LOCUS_14980 307834 309192 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020115335.1 protein_id gnl|my_center|LOCUS_14980 309291 310511 gene locus_tag LOCUS_14990 309291 310511 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027555.1 protein_id gnl|my_center|LOCUS_14990 313327 310796 gene locus_tag LOCUS_15000 313327 310796 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031722.1 protein_id gnl|my_center|LOCUS_15000 313386 314228 gene locus_tag LOCUS_15010 313386 314228 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027556.1 protein_id gnl|my_center|LOCUS_15010 314917 314252 gene locus_tag LOCUS_15020 314917 314252 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027558.1 protein_id gnl|my_center|LOCUS_15020 316035 314914 gene locus_tag LOCUS_15030 316035 314914 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027559.1 protein_id gnl|my_center|LOCUS_15030 317059 316370 gene locus_tag LOCUS_15040 317059 316370 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230648.1 protein_id gnl|my_center|LOCUS_15040 317250 317666 gene locus_tag LOCUS_15050 317250 317666 CDS product nitroreductase family deazaflavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230647.1 protein_id gnl|my_center|LOCUS_15050 318879 317656 gene locus_tag LOCUS_15060 318879 317656 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977757.1 protein_id gnl|my_center|LOCUS_15060 319126 320478 gene locus_tag LOCUS_15070 319126 320478 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977756.1 protein_id gnl|my_center|LOCUS_15070 322293 321169 gene locus_tag LOCUS_15080 322293 321169 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977755.1 protein_id gnl|my_center|LOCUS_15080 322584 322405 gene locus_tag LOCUS_15090 322584 322405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977754.1 protein_id gnl|my_center|LOCUS_15090 322844 324925 gene locus_tag LOCUS_15100 322844 324925 CDS product NPCBM/NEW2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026988.1 protein_id gnl|my_center|LOCUS_15100 325903 324947 gene locus_tag LOCUS_15110 325903 324947 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027561.1 protein_id gnl|my_center|LOCUS_15110 326111 327181 gene locus_tag LOCUS_15120 326111 327181 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977752.1 protein_id gnl|my_center|LOCUS_15120 328587 327208 gene locus_tag LOCUS_15130 328587 327208 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027563.1 protein_id gnl|my_center|LOCUS_15130 329668 328706 gene locus_tag LOCUS_15140 329668 328706 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027564.1 protein_id gnl|my_center|LOCUS_15140 330502 329723 gene locus_tag LOCUS_15150 330502 329723 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027565.1 protein_id gnl|my_center|LOCUS_15150 331239 330730 gene locus_tag LOCUS_15160 331239 330730 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977747.1 protein_id gnl|my_center|LOCUS_15160 331810 331484 gene locus_tag LOCUS_15170 331810 331484 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977746.1 protein_id gnl|my_center|LOCUS_15170 332153 332875 gene locus_tag LOCUS_15180 332153 332875 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977745.1 protein_id gnl|my_center|LOCUS_15180 333527 332934 gene locus_tag LOCUS_15190 333527 332934 CDS product transglutaminase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162495104.1 protein_id gnl|my_center|LOCUS_15190 334187 333780 gene locus_tag LOCUS_15200 334187 333780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 335388 334318 gene locus_tag LOCUS_15210 335388 334318 CDS product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027566.1 protein_id gnl|my_center|LOCUS_15210 336140 335385 gene locus_tag LOCUS_15220 336140 335385 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325632.1 protein_id gnl|my_center|LOCUS_15220 337519 336182 gene locus_tag LOCUS_15230 337519 336182 CDS product DUF6421 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977741.1 protein_id gnl|my_center|LOCUS_15230 338040 338690 gene locus_tag LOCUS_15240 338040 338690 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027567.1 protein_id gnl|my_center|LOCUS_15240 339279 338707 gene locus_tag LOCUS_15250 339279 338707 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027568.1 protein_id gnl|my_center|LOCUS_15250 339351 339752 gene locus_tag LOCUS_15260 339351 339752 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977738.1 protein_id gnl|my_center|LOCUS_15260 339845 340609 gene locus_tag LOCUS_15270 339845 340609 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325634.1 protein_id gnl|my_center|LOCUS_15270 341389 340613 gene locus_tag LOCUS_15280 341389 340613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 343065 341386 gene locus_tag LOCUS_15290 343065 341386 CDS product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037897270.1 protein_id gnl|my_center|LOCUS_15290 343104 343129 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 343291 343893 gene locus_tag LOCUS_15300 343291 343893 CDS product DUF5134 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027575.1 protein_id gnl|my_center|LOCUS_15300 343750 343773 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 344019 344954 gene locus_tag LOCUS_15310 344019 344954 CDS product M56 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027576.1 protein_id gnl|my_center|LOCUS_15310 345232 345265 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 345291 345758 gene locus_tag LOCUS_15320 345291 345758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15320 345792 346490 gene locus_tag LOCUS_15330 345792 346490 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027577.1 protein_id gnl|my_center|LOCUS_15330 346896 347573 gene locus_tag LOCUS_15340 346896 347573 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977728.1 protein_id gnl|my_center|LOCUS_15340 347738 349090 gene locus_tag LOCUS_15350 347738 349090 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257411.1 protein_id gnl|my_center|LOCUS_15350 353970 349642 gene locus_tag LOCUS_15360 353970 349642 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028388.1 protein_id gnl|my_center|LOCUS_15360 354711 353980 gene locus_tag LOCUS_15370 354711 353980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 354593 354979 gene locus_tag LOCUS_15380 354593 354979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 354976 355584 gene locus_tag LOCUS_15390 354976 355584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 356355 355606 gene locus_tag LOCUS_15400 356355 355606 CDS product PaaX family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173668803.1 protein_id gnl|my_center|LOCUS_15400 356428 358122 gene locus_tag LOCUS_15410 356428 358122 CDS product DNA alkylation response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027581.1 protein_id gnl|my_center|LOCUS_15410 358843 358193 gene locus_tag LOCUS_15420 358843 358193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026904.1 protein_id gnl|my_center|LOCUS_15420 359070 360203 gene locus_tag LOCUS_15430 359070 360203 CDS product sialidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484633.1 protein_id gnl|my_center|LOCUS_15430 360200 361099 gene locus_tag LOCUS_15440 360200 361099 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027583.1 protein_id gnl|my_center|LOCUS_15440 361096 362088 gene locus_tag LOCUS_15450 361096 362088 CDS product BadF/BadG/BcrA/BcrD ATPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027584.1 protein_id gnl|my_center|LOCUS_15450 362328 363209 gene locus_tag LOCUS_15460 362328 363209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027585.1 protein_id gnl|my_center|LOCUS_15460 364340 363303 gene locus_tag LOCUS_15470 364340 363303 CDS product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977714.1 protein_id gnl|my_center|LOCUS_15470 365958 364423 gene locus_tag LOCUS_15480 365958 364423 CDS product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027586.1 protein_id gnl|my_center|LOCUS_15480 366140 366616 gene locus_tag LOCUS_15490 366140 366616 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977712.1 protein_id gnl|my_center|LOCUS_15490 367501 366653 gene locus_tag LOCUS_15500 367501 366653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 367534 367968 gene locus_tag LOCUS_15510 367534 367968 CDS product DUF5997 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977708.1 protein_id gnl|my_center|LOCUS_15510 369273 368119 gene locus_tag LOCUS_15520 369273 368119 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027597.1 protein_id gnl|my_center|LOCUS_15520 371416 369266 gene locus_tag LOCUS_15530 371416 369266 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027598.1 protein_id gnl|my_center|LOCUS_15530 372405 371413 gene locus_tag LOCUS_15540 372405 371413 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027599.1 protein_id gnl|my_center|LOCUS_15540 373079 372402 gene locus_tag LOCUS_15550 373079 372402 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027600.1 protein_id gnl|my_center|LOCUS_15550 373012 373041 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 373348 373941 gene locus_tag LOCUS_15560 gene xdhR 373348 373941 CDS product purine salvage operon transcriptional regulator XdhR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977696.1 protein_id gnl|my_center|LOCUS_15560 374056 374898 gene locus_tag LOCUS_15570 374056 374898 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049878082.1 protein_id gnl|my_center|LOCUS_15570 375748 375326 gene locus_tag LOCUS_15580 375748 375326 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977690.1 protein_id gnl|my_center|LOCUS_15580 375808 376911 gene locus_tag LOCUS_15590 375808 376911 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027605.1 protein_id gnl|my_center|LOCUS_15590 378012 377128 gene locus_tag LOCUS_15600 gene mltG 378012 377128 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027606.1 protein_id gnl|my_center|LOCUS_15600 379858 378056 gene locus_tag LOCUS_15610 379858 378056 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977687.1 protein_id gnl|my_center|LOCUS_15610 379976 380431 gene locus_tag LOCUS_15620 379976 380431 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027607.1 protein_id gnl|my_center|LOCUS_15620 381245 380487 gene locus_tag LOCUS_15630 381245 380487 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027608.1 protein_id gnl|my_center|LOCUS_15630 381483 383354 gene locus_tag LOCUS_15640 381483 383354 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030253.1 protein_id gnl|my_center|LOCUS_15640 383351 385222 gene locus_tag LOCUS_15650 383351 385222 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027610.1 protein_id gnl|my_center|LOCUS_15650 385523 385996 gene locus_tag LOCUS_15660 385523 385996 CDS product DUF5709 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027611.1 protein_id gnl|my_center|LOCUS_15660 386063 386341 gene locus_tag LOCUS_15670 386063 386341 CDS product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027612.1 protein_id gnl|my_center|LOCUS_15670 387195 386401 gene locus_tag LOCUS_15680 387195 386401 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977680.1 protein_id gnl|my_center|LOCUS_15680 387341 389854 gene locus_tag LOCUS_15690 387341 389854 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027613.1 protein_id gnl|my_center|LOCUS_15690 389895 390761 gene locus_tag LOCUS_15700 389895 390761 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027614.1 protein_id gnl|my_center|LOCUS_15700 391671 390772 gene locus_tag LOCUS_15710 391671 390772 CDS product DUF6397 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027615.1 protein_id gnl|my_center|LOCUS_15710 392209 391796 gene locus_tag LOCUS_15720 392209 391796 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977676.1 protein_id gnl|my_center|LOCUS_15720 392303 392731 gene locus_tag LOCUS_15730 392303 392731 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027616.1 protein_id gnl|my_center|LOCUS_15730 393355 392753 gene locus_tag LOCUS_15740 393355 392753 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027617.1 protein_id gnl|my_center|LOCUS_15740 393986 393573 gene locus_tag LOCUS_15750 393986 393573 CDS product DUF742 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977673.1 protein_id gnl|my_center|LOCUS_15750 394448 394008 gene locus_tag LOCUS_15760 394448 394008 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977672.1 protein_id gnl|my_center|LOCUS_15760 396991 394445 gene locus_tag LOCUS_15770 396991 394445 CDS product nitrate- and nitrite sensing domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027618.1 protein_id gnl|my_center|LOCUS_15770 397823 397050 gene locus_tag LOCUS_15780 397823 397050 CDS product MHYT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484657.1 protein_id gnl|my_center|LOCUS_15780 397966 398574 gene locus_tag LOCUS_15790 397966 398574 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027620.1 protein_id gnl|my_center|LOCUS_15790 399568 398636 gene locus_tag LOCUS_15800 399568 398636 CDS product oxygenase MpaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027621.1 protein_id gnl|my_center|LOCUS_15800 399306 399329 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 399662 399961 gene locus_tag LOCUS_15810 399662 399961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_150469750.1 protein_id gnl|my_center|LOCUS_15810 400097 401005 gene locus_tag LOCUS_15820 400097 401005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027623.1 protein_id gnl|my_center|LOCUS_15820 401192 402598 gene locus_tag LOCUS_15830 401192 402598 CDS product tannase/feruloyl esterase family alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227742.1 protein_id gnl|my_center|LOCUS_15830 402803 402621 gene locus_tag LOCUS_15840 402803 402621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325661.1 protein_id gnl|my_center|LOCUS_15840 404030 402975 gene locus_tag LOCUS_15850 404030 402975 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029216.1 protein_id gnl|my_center|LOCUS_15850 405397 404231 gene locus_tag LOCUS_15860 gene xylA 405397 404231 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977662.1 protein_id gnl|my_center|LOCUS_15860 405594 407039 gene locus_tag LOCUS_15870 gene xylB 405594 407039 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027626.1 protein_id gnl|my_center|LOCUS_15870 407269 408477 gene locus_tag LOCUS_15880 407269 408477 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977660.1 protein_id gnl|my_center|LOCUS_15880 408772 409785 gene locus_tag LOCUS_15890 408772 409785 CDS product acetamidase/formamidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895776.1 protein_id gnl|my_center|LOCUS_15890 409840 410439 gene locus_tag LOCUS_15900 409840 410439 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977659.1 protein_id gnl|my_center|LOCUS_15900 410534 411400 gene locus_tag LOCUS_15910 410534 411400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15910 411297 411318 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 411360 411860 gene locus_tag LOCUS_15920 411360 411860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15920 412002 413531 gene locus_tag LOCUS_15930 412002 413531 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027628.1 protein_id gnl|my_center|LOCUS_15930 413241 413265 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 413622 415289 gene locus_tag LOCUS_15940 413622 415289 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065424.1 protein_id gnl|my_center|LOCUS_15940 415286 416077 gene locus_tag LOCUS_15950 415286 416077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 416170 417537 gene locus_tag LOCUS_15960 416170 417537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 418042 417596 gene locus_tag LOCUS_15970 418042 417596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030827.1 protein_id gnl|my_center|LOCUS_15970 418571 418074 gene locus_tag LOCUS_15980 418571 418074 CDS product SHOCT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030828.1 protein_id gnl|my_center|LOCUS_15980 419334 418672 gene locus_tag LOCUS_15990 419334 418672 CDS product HdeD family acid-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029402.1 protein_id gnl|my_center|LOCUS_15990 419556 420119 gene locus_tag LOCUS_16000 419556 420119 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030831.1 protein_id gnl|my_center|LOCUS_16000 420335 420138 gene locus_tag LOCUS_16010 420335 420138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030833.1 protein_id gnl|my_center|LOCUS_16010 421026 420481 gene locus_tag LOCUS_16020 421026 420481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 423815 421023 gene locus_tag LOCUS_16030 423815 421023 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030835.1 protein_id gnl|my_center|LOCUS_16030 424237 426318 gene locus_tag LOCUS_16040 424237 426318 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030059.1 protein_id gnl|my_center|LOCUS_16040 426449 426808 gene locus_tag LOCUS_16050 426449 426808 CDS product DUF779 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027643.1 protein_id gnl|my_center|LOCUS_16050 426884 428182 gene locus_tag LOCUS_16060 426884 428182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 428414 428220 gene locus_tag LOCUS_16070 428414 428220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977636.1 protein_id gnl|my_center|LOCUS_16070 429624 428551 gene locus_tag LOCUS_16080 429624 428551 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027646.1 protein_id gnl|my_center|LOCUS_16080 430814 429621 gene locus_tag LOCUS_16090 430814 429621 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027647.1 protein_id gnl|my_center|LOCUS_16090 431788 430811 gene locus_tag LOCUS_16100 431788 430811 CDS product NADPH:quinone oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977632.1 protein_id gnl|my_center|LOCUS_16100 432455 431871 gene locus_tag LOCUS_16110 432455 431871 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027648.1 protein_id gnl|my_center|LOCUS_16110 432534 433574 gene locus_tag LOCUS_16120 432534 433574 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027649.1 protein_id gnl|my_center|LOCUS_16120 433604 435142 gene locus_tag LOCUS_16130 433604 435142 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027650.1 protein_id gnl|my_center|LOCUS_16130 435333 435064 gene locus_tag LOCUS_16140 435333 435064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 435319 435723 gene locus_tag LOCUS_16150 435319 435723 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977628.1 protein_id gnl|my_center|LOCUS_16150 435805 437193 gene locus_tag LOCUS_16160 435805 437193 CDS product NADP-dependent succinic semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027651.1 protein_id gnl|my_center|LOCUS_16160 437219 437458 gene locus_tag LOCUS_16170 437219 437458 CDS product DUF6213 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977626.1 protein_id gnl|my_center|LOCUS_16170 437646 437576 gene locus_tag LOCUS_t00170 437646 437576 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 438173 439180 gene locus_tag LOCUS_16180 438173 439180 CDS product 1,3,6,8-tetrahydroxynaphthalene synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027653.1 protein_id gnl|my_center|LOCUS_16180 439177 440391 gene locus_tag LOCUS_16190 439177 440391 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977624.1 protein_id gnl|my_center|LOCUS_16190 440399 440917 gene locus_tag LOCUS_16200 440399 440917 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027654.1 protein_id gnl|my_center|LOCUS_16200 442267 441041 gene locus_tag LOCUS_16210 442267 441041 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977622.1 protein_id gnl|my_center|LOCUS_16210 442437 443081 gene locus_tag LOCUS_16220 442437 443081 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977621.1 protein_id gnl|my_center|LOCUS_16220 443943 443290 gene locus_tag LOCUS_16230 gene def 443943 443290 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325677.1 protein_id gnl|my_center|LOCUS_16230 443994 445232 gene locus_tag LOCUS_16240 443994 445232 CDS product MurT ligase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977619.1 protein_id gnl|my_center|LOCUS_16240 445253 445981 gene locus_tag LOCUS_16250 445253 445981 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977618.1 protein_id gnl|my_center|LOCUS_16250 446174 446200 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 446276 447301 gene locus_tag LOCUS_16260 446276 447301 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977617.1 protein_id gnl|my_center|LOCUS_16260 447438 448388 gene locus_tag LOCUS_16270 447438 448388 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977616.1 protein_id gnl|my_center|LOCUS_16270 448482 448652 gene locus_tag LOCUS_16280 448482 448652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325678.1 protein_id gnl|my_center|LOCUS_16280 449874 448669 gene locus_tag LOCUS_16290 449874 448669 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037667486.1 protein_id gnl|my_center|LOCUS_16290 450635 449871 gene locus_tag LOCUS_16300 450635 449871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16300 450682 450715 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 450743 451315 gene locus_tag LOCUS_16310 450743 451315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 451993 451634 gene locus_tag LOCUS_16320 451993 451634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977612.1 protein_id gnl|my_center|LOCUS_16320 452762 452007 gene locus_tag LOCUS_16330 452762 452007 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977611.1 protein_id gnl|my_center|LOCUS_16330 452850 453353 gene locus_tag LOCUS_16340 452850 453353 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977610.1 protein_id gnl|my_center|LOCUS_16340 453478 454287 gene locus_tag LOCUS_16350 453478 454287 CDS product arginine deiminase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977609.1 protein_id gnl|my_center|LOCUS_16350 454287 455507 gene locus_tag LOCUS_16360 gene rocD 454287 455507 CDS product ornithine--oxo-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977608.1 protein_id gnl|my_center|LOCUS_16360 455983 455564 gene locus_tag LOCUS_16370 455983 455564 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000199006.1 protein_id gnl|my_center|LOCUS_16370 456166 456468 gene locus_tag LOCUS_16380 456166 456468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 456994 456488 gene locus_tag LOCUS_16390 456994 456488 CDS product DUF4396 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466680.1 protein_id gnl|my_center|LOCUS_16390 457769 457116 gene locus_tag LOCUS_16400 457769 457116 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141508.1 protein_id gnl|my_center|LOCUS_16400 458019 458744 gene locus_tag LOCUS_16410 458019 458744 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977603.1 protein_id gnl|my_center|LOCUS_16410 460466 458868 gene locus_tag LOCUS_16420 460466 458868 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027660.1 protein_id gnl|my_center|LOCUS_16420 461405 460632 gene locus_tag LOCUS_16430 461405 460632 CDS product urease accessory protein UreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027661.1 protein_id gnl|my_center|LOCUS_16430 462093 461410 gene locus_tag LOCUS_16440 gene ureG 462093 461410 CDS product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977599.1 protein_id gnl|my_center|LOCUS_16440 462897 462223 gene locus_tag LOCUS_16450 462897 462223 CDS product urease accessory UreF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027662.1 protein_id gnl|my_center|LOCUS_16450 464647 462926 gene locus_tag LOCUS_16460 464647 462926 CDS product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977597.1 protein_id gnl|my_center|LOCUS_16460 464951 464640 gene locus_tag LOCUS_16470 464951 464640 CDS product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977596.1 protein_id gnl|my_center|LOCUS_16470 465266 464964 gene locus_tag LOCUS_16480 465266 464964 CDS product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977595.1 protein_id gnl|my_center|LOCUS_16480 465450 465605 gene locus_tag LOCUS_16490 465450 465605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 466159 466632 gene locus_tag LOCUS_16500 466159 466632 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977591.1 protein_id gnl|my_center|LOCUS_16500 467110 466646 gene locus_tag LOCUS_16510 467110 466646 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027663.1 protein_id gnl|my_center|LOCUS_16510 467325 468203 gene locus_tag LOCUS_16520 467325 468203 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977589.1 protein_id gnl|my_center|LOCUS_16520 468213 468452 gene locus_tag LOCUS_16530 468213 468452 CDS product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224345.1 protein_id gnl|my_center|LOCUS_16530 469634 468507 gene locus_tag LOCUS_16540 469634 468507 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977587.1 protein_id gnl|my_center|LOCUS_16540 469782 471041 gene locus_tag LOCUS_16550 gene bioB 469782 471041 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027664.1 protein_id gnl|my_center|LOCUS_16550 471034 472323 gene locus_tag LOCUS_16560 471034 472323 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027665.1 protein_id gnl|my_center|LOCUS_16560 472325 473068 gene locus_tag LOCUS_16570 gene bioD 472325 473068 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027666.1 protein_id gnl|my_center|LOCUS_16570 473657 473019 gene locus_tag LOCUS_16580 473657 473019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 473809 473830 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 474254 473880 gene locus_tag LOCUS_16590 474254 473880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027668.1 protein_id gnl|my_center|LOCUS_16590 474510 474259 gene locus_tag LOCUS_16600 474510 474259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977581.1 protein_id gnl|my_center|LOCUS_16600 474697 475965 gene locus_tag LOCUS_16610 474697 475965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 475970 478537 gene locus_tag LOCUS_16620 475970 478537 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028773.1 protein_id gnl|my_center|LOCUS_16620 478635 479060 gene locus_tag LOCUS_16630 478635 479060 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027669.1 protein_id gnl|my_center|LOCUS_16630 479244 480626 gene locus_tag LOCUS_16640 479244 480626 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027670.1 protein_id gnl|my_center|LOCUS_16640 480623 481636 gene locus_tag LOCUS_16650 480623 481636 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977578.1 protein_id gnl|my_center|LOCUS_16650 482538 482444 gene locus_tag LOCUS_t00180 482538 482444 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 482610 484058 gene locus_tag LOCUS_16660 gene purB 482610 484058 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027671.1 protein_id gnl|my_center|LOCUS_16660 484112 484603 gene locus_tag LOCUS_16670 gene mug 484112 484603 CDS product G/U mismatch-specific DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027672.1 protein_id gnl|my_center|LOCUS_16670 485228 484782 gene locus_tag LOCUS_16680 485228 484782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027673.1 protein_id gnl|my_center|LOCUS_16680 485370 486527 gene locus_tag LOCUS_16690 485370 486527 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977569.1 protein_id gnl|my_center|LOCUS_16690 487395 486634 gene locus_tag LOCUS_16700 487395 486634 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027677.1 protein_id gnl|my_center|LOCUS_16700 488481 487609 gene locus_tag LOCUS_16710 488481 487609 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977567.1 protein_id gnl|my_center|LOCUS_16710 488623 489453 gene locus_tag LOCUS_16720 488623 489453 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484721.1 protein_id gnl|my_center|LOCUS_16720 489438 489670 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cgacggcagccgccgaccgc 490614 492074 gene locus_tag LOCUS_16730 490614 492074 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027697.1 protein_id gnl|my_center|LOCUS_16730 492211 493554 gene locus_tag LOCUS_16740 492211 493554 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027701.1 protein_id gnl|my_center|LOCUS_16740 494821 493616 gene locus_tag LOCUS_16750 494821 493616 CDS product PLP-dependent transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027702.1 protein_id gnl|my_center|LOCUS_16750 494893 495429 gene locus_tag LOCUS_16760 494893 495429 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977536.1 protein_id gnl|my_center|LOCUS_16760 495473 497164 gene locus_tag LOCUS_16770 495473 497164 CDS product DUF885 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027703.1 protein_id gnl|my_center|LOCUS_16770 497691 497221 gene locus_tag LOCUS_16780 497691 497221 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027704.1 protein_id gnl|my_center|LOCUS_16780 497786 498232 gene locus_tag LOCUS_16790 497786 498232 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977532.1 protein_id gnl|my_center|LOCUS_16790 501243 498253 gene locus_tag LOCUS_16800 501243 498253 CDS product SMC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027705.1 protein_id gnl|my_center|LOCUS_16800 502513 501326 gene locus_tag LOCUS_16810 502513 501326 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977530.1 protein_id gnl|my_center|LOCUS_16810 501330 501353 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 503257 502631 gene locus_tag LOCUS_16820 503257 502631 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027706.1 protein_id gnl|my_center|LOCUS_16820 503861 503316 gene locus_tag LOCUS_16830 503861 503316 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393763.1 protein_id gnl|my_center|LOCUS_16830 504999 503944 gene locus_tag LOCUS_16840 504999 503944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 505175 505585 gene locus_tag LOCUS_16850 505175 505585 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027708.1 protein_id gnl|my_center|LOCUS_16850 505789 506544 gene locus_tag LOCUS_16860 505789 506544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16860 506371 506407 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 506459 507463 gene locus_tag LOCUS_16870 506459 507463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16870 507899 507552 gene locus_tag LOCUS_16880 507899 507552 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977520.1 protein_id gnl|my_center|LOCUS_16880 508117 507908 gene locus_tag LOCUS_16890 508117 507908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 508172 509062 gene locus_tag LOCUS_16900 508172 509062 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027713.1 protein_id gnl|my_center|LOCUS_16900 509650 509096 gene locus_tag LOCUS_16910 509650 509096 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027714.1 protein_id gnl|my_center|LOCUS_16910 510313 509741 gene locus_tag LOCUS_16920 510313 509741 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977517.1 protein_id gnl|my_center|LOCUS_16920 510407 511264 gene locus_tag LOCUS_16930 510407 511264 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027715.1 protein_id gnl|my_center|LOCUS_16930 512239 511349 gene locus_tag LOCUS_16940 512239 511349 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977515.1 protein_id gnl|my_center|LOCUS_16940 512331 512858 gene locus_tag LOCUS_16950 512331 512858 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977514.1 protein_id gnl|my_center|LOCUS_16950 513563 512910 gene locus_tag LOCUS_16960 513563 512910 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977513.1 protein_id gnl|my_center|LOCUS_16960 514882 513632 gene locus_tag LOCUS_16970 514882 513632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 515462 515869 gene locus_tag LOCUS_16980 515462 515869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16980 516275 515823 gene locus_tag LOCUS_16990 516275 515823 CDS product DUF4442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977512.1 protein_id gnl|my_center|LOCUS_16990 516426 517436 gene locus_tag LOCUS_17000 516426 517436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027716.1 protein_id gnl|my_center|LOCUS_17000 518303 517458 gene locus_tag LOCUS_17010 518303 517458 CDS product fused MFS/spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027718.1 protein_id gnl|my_center|LOCUS_17010 519575 518406 gene locus_tag LOCUS_17020 gene tuf 519575 518406 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977508.1 protein_id gnl|my_center|LOCUS_17020 520643 519921 gene locus_tag LOCUS_17030 520643 519921 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977507.1 protein_id gnl|my_center|LOCUS_17030 520693 521478 gene locus_tag LOCUS_17040 520693 521478 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027720.1 protein_id gnl|my_center|LOCUS_17040 522771 521521 gene locus_tag LOCUS_17050 522771 521521 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027721.1 protein_id gnl|my_center|LOCUS_17050 522827 523297 gene locus_tag LOCUS_17060 522827 523297 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027722.1 protein_id gnl|my_center|LOCUS_17060 523426 523605 gene locus_tag LOCUS_17070 523426 523605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977493.1 protein_id gnl|my_center|LOCUS_17070 524488 523748 gene locus_tag LOCUS_17080 524488 523748 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977492.1 protein_id gnl|my_center|LOCUS_17080 524405 525175 gene locus_tag LOCUS_17090 524405 525175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 525281 526855 gene locus_tag LOCUS_17100 gene lnt 525281 526855 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027728.1 protein_id gnl|my_center|LOCUS_17100 527684 526773 gene locus_tag LOCUS_17110 527684 526773 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093455728.1 protein_id gnl|my_center|LOCUS_17110 528882 527695 gene locus_tag LOCUS_17120 528882 527695 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027730.1 protein_id gnl|my_center|LOCUS_17120 528998 529606 gene locus_tag LOCUS_17130 528998 529606 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977488.1 protein_id gnl|my_center|LOCUS_17130 529635 530147 gene locus_tag LOCUS_17140 529635 530147 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977487.1 protein_id gnl|my_center|LOCUS_17140 530286 530753 gene locus_tag LOCUS_17150 530286 530753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046247768.1 protein_id gnl|my_center|LOCUS_17150 531524 531009 gene locus_tag LOCUS_17160 531524 531009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027732.1 protein_id gnl|my_center|LOCUS_17160 532300 531617 gene locus_tag LOCUS_17170 gene ung 532300 531617 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977484.1 protein_id gnl|my_center|LOCUS_17170 533968 532391 gene locus_tag LOCUS_17180 533968 532391 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325733.1 protein_id gnl|my_center|LOCUS_17180 534968 534201 gene locus_tag LOCUS_17190 534968 534201 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027733.1 protein_id gnl|my_center|LOCUS_17190 535742 534981 gene locus_tag LOCUS_17200 gene fabG 535742 534981 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027734.1 protein_id gnl|my_center|LOCUS_17200 536317 535868 gene locus_tag LOCUS_17210 536317 535868 CDS product DUF3037 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027736.1 protein_id gnl|my_center|LOCUS_17210 537078 536314 gene locus_tag LOCUS_17220 537078 536314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977478.1 protein_id gnl|my_center|LOCUS_17220 537210 537689 gene locus_tag LOCUS_17230 537210 537689 CDS product Rieske (2Fe-2S) protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977470.1 protein_id gnl|my_center|LOCUS_17230 538332 537676 gene locus_tag LOCUS_17240 538332 537676 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104261.1 protein_id gnl|my_center|LOCUS_17240 538498 538965 gene locus_tag LOCUS_17250 538498 538965 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484772.1 protein_id gnl|my_center|LOCUS_17250 539239 539063 gene locus_tag LOCUS_17260 539239 539063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17260 539328 540071 gene locus_tag LOCUS_17270 539328 540071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 539361 539388 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 540068 541186 gene locus_tag LOCUS_17280 540068 541186 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226734.1 protein_id gnl|my_center|LOCUS_17280 542707 541376 gene locus_tag LOCUS_17290 542707 541376 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027746.1 protein_id gnl|my_center|LOCUS_17290 542743 543480 gene locus_tag LOCUS_17300 542743 543480 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977465.1 protein_id gnl|my_center|LOCUS_17300 543290 543316 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 544525 543566 gene locus_tag LOCUS_17310 544525 543566 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027747.1 protein_id gnl|my_center|LOCUS_17310 545015 544710 gene locus_tag LOCUS_17320 545015 544710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 545020 545276 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 546532 545918 gene locus_tag LOCUS_17330 546532 545918 CDS product Clp protease N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977462.1 protein_id gnl|my_center|LOCUS_17330 546758 547186 gene locus_tag LOCUS_17340 546758 547186 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005058565.1 protein_id gnl|my_center|LOCUS_17340 547918 547283 gene locus_tag LOCUS_17350 547918 547283 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027749.1 protein_id gnl|my_center|LOCUS_17350 549092 548874 gene locus_tag LOCUS_17360 549092 548874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 549796 549494 gene locus_tag LOCUS_17370 549796 549494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 550522 549863 gene locus_tag LOCUS_17380 550522 549863 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222893.1 protein_id gnl|my_center|LOCUS_17380 552642 550522 gene locus_tag LOCUS_17390 552642 550522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 553319 553074 gene locus_tag LOCUS_17400 553319 553074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 553203 553523 gene locus_tag LOCUS_17410 553203 553523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 553917 554192 gene locus_tag LOCUS_17420 553917 554192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 554461 554282 gene locus_tag LOCUS_17430 554461 554282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 554414 554665 gene locus_tag LOCUS_17440 554414 554665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 554873 555436 gene locus_tag LOCUS_17450 554873 555436 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975987.1 protein_id gnl|my_center|LOCUS_17450 555482 556315 gene locus_tag LOCUS_17460 555482 556315 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027752.1 protein_id gnl|my_center|LOCUS_17460 557153 556350 gene locus_tag LOCUS_17470 557153 556350 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027753.1 protein_id gnl|my_center|LOCUS_17470 558805 557288 gene locus_tag LOCUS_17480 558805 557288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977453.1 protein_id gnl|my_center|LOCUS_17480 559399 559983 gene locus_tag LOCUS_17490 559399 559983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325749.1 protein_id gnl|my_center|LOCUS_17490 560330 560611 gene locus_tag LOCUS_17500 560330 560611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 562286 560706 gene locus_tag LOCUS_17510 562286 560706 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161269931.1 protein_id gnl|my_center|LOCUS_17510 562472 563029 gene locus_tag LOCUS_17520 562472 563029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 563281 565545 gene locus_tag LOCUS_17530 563281 565545 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225976.1 protein_id gnl|my_center|LOCUS_17530 565142 565167 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 565594 565626 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 565945 566781 gene locus_tag LOCUS_17540 gene modA 565945 566781 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029176.1 protein_id gnl|my_center|LOCUS_17540 566778 567626 gene locus_tag LOCUS_17550 566778 567626 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029177.1 protein_id gnl|my_center|LOCUS_17550 567702 568793 gene locus_tag LOCUS_17560 567702 568793 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029178.1 protein_id gnl|my_center|LOCUS_17560 571683 568921 gene locus_tag LOCUS_17570 gene gcvP 571683 568921 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027754.1 protein_id gnl|my_center|LOCUS_17570 569681 569710 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 571739 571772 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 572254 572655 gene locus_tag LOCUS_17580 572254 572655 CDS product PRC-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173668708.1 protein_id gnl|my_center|LOCUS_17580 574183 572774 gene locus_tag LOCUS_17590 574183 572774 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027755.1 protein_id gnl|my_center|LOCUS_17590 574793 574293 gene locus_tag LOCUS_17600 574793 574293 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079363.1 protein_id gnl|my_center|LOCUS_17600 575575 575138 gene locus_tag LOCUS_17610 575575 575138 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977444.1 protein_id gnl|my_center|LOCUS_17610 576473 575736 gene locus_tag LOCUS_17620 576473 575736 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027756.1 protein_id gnl|my_center|LOCUS_17620 577350 576526 gene locus_tag LOCUS_17630 577350 576526 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027757.1 protein_id gnl|my_center|LOCUS_17630 579232 577541 gene locus_tag LOCUS_17640 579232 577541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 579570 579238 gene locus_tag LOCUS_17650 579570 579238 CDS product small basic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977440.1 protein_id gnl|my_center|LOCUS_17650 580403 579567 gene locus_tag LOCUS_17660 580403 579567 CDS product DUF881 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977439.1 protein_id gnl|my_center|LOCUS_17660 583043 580608 gene locus_tag LOCUS_17670 583043 580608 CDS product mannose-1-phosphate guanyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027759.1 protein_id gnl|my_center|LOCUS_17670 583827 583219 gene locus_tag LOCUS_17680 583827 583219 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_221514425.1 protein_id gnl|my_center|LOCUS_17680 >Feature sequence004 61 660 gene locus_tag LOCUS_17690 61 660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 714 1073 gene locus_tag LOCUS_17700 gene hypA 714 1073 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258629.1 protein_id gnl|my_center|LOCUS_17700 2264 1182 gene locus_tag LOCUS_17710 gene hypE 2264 1182 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909296.1 protein_id gnl|my_center|LOCUS_17710 3450 2257 gene locus_tag LOCUS_17720 gene hypD 3450 2257 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258618.1 protein_id gnl|my_center|LOCUS_17720 3779 3447 gene locus_tag LOCUS_17730 3779 3447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 6186 3826 gene locus_tag LOCUS_17740 gene hypF 6186 3826 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894095.1 protein_id gnl|my_center|LOCUS_17740 6959 6183 gene locus_tag LOCUS_17750 gene hypB 6959 6183 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258628.1 protein_id gnl|my_center|LOCUS_17750 7625 7023 gene locus_tag LOCUS_17760 7625 7023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 9331 7622 gene locus_tag LOCUS_17770 9331 7622 CDS product hydrogenase maturation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089664.1 protein_id gnl|my_center|LOCUS_17770 9610 9398 gene locus_tag LOCUS_17780 9610 9398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 9769 10137 gene locus_tag LOCUS_17790 gene rpfE 9769 10137 CDS product resuscitation-promoting factor protein RpfE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971684.1 protein_id gnl|my_center|LOCUS_17790 10843 10241 gene locus_tag LOCUS_17800 10843 10241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 11421 10867 gene locus_tag LOCUS_17810 11421 10867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17810 11561 11598 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12760 11960 gene locus_tag LOCUS_17820 12760 11960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17820 12768 13814 gene locus_tag LOCUS_17830 12768 13814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 12793 12823 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 13721 14338 gene locus_tag LOCUS_17840 13721 14338 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978194.1 protein_id gnl|my_center|LOCUS_17840 14335 15939 gene locus_tag LOCUS_17850 14335 15939 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027283.1 protein_id gnl|my_center|LOCUS_17850 16478 15951 gene locus_tag LOCUS_17860 16478 15951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485905.1 protein_id gnl|my_center|LOCUS_17860 18963 16684 gene locus_tag LOCUS_17870 gene catB 18963 16684 CDS product catalase CatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978196.1 protein_id gnl|my_center|LOCUS_17870 19426 20148 gene locus_tag LOCUS_17880 19426 20148 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031622.1 protein_id gnl|my_center|LOCUS_17880 20145 20450 gene locus_tag LOCUS_17890 20145 20450 CDS product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971765.1 protein_id gnl|my_center|LOCUS_17890 20447 21211 gene locus_tag LOCUS_17900 20447 21211 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031621.1 protein_id gnl|my_center|LOCUS_17900 21422 21886 gene locus_tag LOCUS_17910 21422 21886 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223074.1 protein_id gnl|my_center|LOCUS_17910 21883 22785 gene locus_tag LOCUS_17920 21883 22785 CDS product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226372.1 protein_id gnl|my_center|LOCUS_17920 24266 22839 gene locus_tag LOCUS_17930 24266 22839 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092177.1 protein_id gnl|my_center|LOCUS_17930 24732 25208 gene locus_tag LOCUS_17940 24732 25208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 25467 26159 gene locus_tag LOCUS_17950 25467 26159 CDS product GAF and ANTAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031654.1 protein_id gnl|my_center|LOCUS_17950 26424 29129 gene locus_tag LOCUS_17960 26424 29129 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191848896.1 protein_id gnl|my_center|LOCUS_17960 29352 31991 gene locus_tag LOCUS_17970 29352 31991 CDS product SpoIIE family protein phosphatase/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186009676.1 protein_id gnl|my_center|LOCUS_17970 32148 32990 gene locus_tag LOCUS_17980 gene csnA 32148 32990 CDS product chitosanase CsnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027289.1 protein_id gnl|my_center|LOCUS_17980 33323 33087 gene locus_tag LOCUS_17990 33323 33087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228349.1 protein_id gnl|my_center|LOCUS_17990 35269 33407 gene locus_tag LOCUS_18000 35269 33407 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225751.1 protein_id gnl|my_center|LOCUS_18000 35715 35748 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 35939 37342 gene locus_tag LOCUS_18010 gene sthA 35939 37342 CDS product Si-specific NAD(P)(+) transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091308313.1 protein_id gnl|my_center|LOCUS_18010 37873 37385 gene locus_tag LOCUS_18020 37873 37385 CDS product DUF5709 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027314.1 protein_id gnl|my_center|LOCUS_18020 39153 37993 gene locus_tag LOCUS_18030 39153 37993 CDS product HoxN/HupN/NixA family nickel/cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414559.1 protein_id gnl|my_center|LOCUS_18030 40602 39310 gene locus_tag LOCUS_18040 40602 39310 CDS product Dyp-type peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229345.1 protein_id gnl|my_center|LOCUS_18040 42796 40739 gene locus_tag LOCUS_18050 42796 40739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 43125 43793 gene locus_tag LOCUS_18060 43125 43793 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184762868.1 protein_id gnl|my_center|LOCUS_18060 43790 44392 gene locus_tag LOCUS_18070 43790 44392 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030853.1 protein_id gnl|my_center|LOCUS_18070 44398 45096 gene locus_tag LOCUS_18080 44398 45096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18080 46068 45121 gene locus_tag LOCUS_18090 46068 45121 CDS product lysylphosphatidylglycerol synthase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031375.1 protein_id gnl|my_center|LOCUS_18090 46986 46081 gene locus_tag LOCUS_18100 46986 46081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 47081 47114 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 47884 48285 gene locus_tag LOCUS_18110 47884 48285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 48282 49175 gene locus_tag LOCUS_18120 48282 49175 CDS product M56 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978223.1 protein_id gnl|my_center|LOCUS_18120 51530 49188 gene locus_tag LOCUS_18130 51530 49188 CDS product glycosyl hydrolase family 65 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027316.1 protein_id gnl|my_center|LOCUS_18130 52288 51527 gene locus_tag LOCUS_18140 52288 51527 CDS product beta-phosphoglucomutase family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978139.1 protein_id gnl|my_center|LOCUS_18140 52404 53072 gene locus_tag LOCUS_18150 52404 53072 CDS product nucleoside/nucleotide kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230842.1 protein_id gnl|my_center|LOCUS_18150 53088 54920 gene locus_tag LOCUS_18160 53088 54920 CDS product phospholipid carrier-dependent glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225853.1 protein_id gnl|my_center|LOCUS_18160 55331 54933 gene locus_tag LOCUS_18170 55331 54933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 55499 56422 gene locus_tag LOCUS_18180 55499 56422 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978137.1 protein_id gnl|my_center|LOCUS_18180 56838 57221 gene locus_tag LOCUS_18190 56838 57221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325234.1 protein_id gnl|my_center|LOCUS_18190 57286 57306 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 57479 59926 gene locus_tag LOCUS_18200 57479 59926 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226366.1 protein_id gnl|my_center|LOCUS_18200 60641 60150 gene locus_tag LOCUS_18210 60641 60150 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978135.1 protein_id gnl|my_center|LOCUS_18210 61593 60739 gene locus_tag LOCUS_18220 61593 60739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 62515 61667 gene locus_tag LOCUS_18230 62515 61667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325235.1 protein_id gnl|my_center|LOCUS_18230 62674 63459 gene locus_tag LOCUS_18240 62674 63459 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027318.1 protein_id gnl|my_center|LOCUS_18240 63912 63697 gene locus_tag LOCUS_18250 63912 63697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 65333 63897 gene locus_tag LOCUS_18260 65333 63897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 65658 68486 gene locus_tag LOCUS_18270 65658 68486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031530.1 protein_id gnl|my_center|LOCUS_18270 69312 68560 gene locus_tag LOCUS_18280 69312 68560 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000255354.1 protein_id gnl|my_center|LOCUS_18280 70530 69352 gene locus_tag LOCUS_18290 70530 69352 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027320.1 protein_id gnl|my_center|LOCUS_18290 70803 72119 gene locus_tag LOCUS_18300 70803 72119 CDS product S1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027321.1 protein_id gnl|my_center|LOCUS_18300 72563 72255 gene locus_tag LOCUS_18310 72563 72255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 73280 72585 gene locus_tag LOCUS_18320 73280 72585 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978125.1 protein_id gnl|my_center|LOCUS_18320 74182 73394 gene locus_tag LOCUS_18330 74182 73394 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027324.1 protein_id gnl|my_center|LOCUS_18330 74234 74806 gene locus_tag LOCUS_18340 74234 74806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978123.1 protein_id gnl|my_center|LOCUS_18340 75450 74821 gene locus_tag LOCUS_18350 75450 74821 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978121.1 protein_id gnl|my_center|LOCUS_18350 76565 75450 gene locus_tag LOCUS_18360 76565 75450 CDS product S-(hydroxymethyl)mycothiol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027326.1 protein_id gnl|my_center|LOCUS_18360 75807 75842 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 76871 77236 gene locus_tag LOCUS_18370 76871 77236 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978117.1 protein_id gnl|my_center|LOCUS_18370 77224 77469 gene locus_tag LOCUS_18380 77224 77469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 78251 77589 gene locus_tag LOCUS_18390 78251 77589 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027327.1 protein_id gnl|my_center|LOCUS_18390 78438 79712 gene locus_tag LOCUS_18400 78438 79712 CDS product YncE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027328.1 protein_id gnl|my_center|LOCUS_18400 80006 79824 gene locus_tag LOCUS_18410 80006 79824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 80081 80380 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 81642 80578 gene locus_tag LOCUS_18420 81642 80578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 82306 81977 gene locus_tag LOCUS_18430 82306 81977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 82586 83131 gene locus_tag LOCUS_18440 82586 83131 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223763.1 protein_id gnl|my_center|LOCUS_18440 83027 83053 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 83128 85521 gene locus_tag LOCUS_18450 83128 85521 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223764.1 protein_id gnl|my_center|LOCUS_18450 85518 86372 gene locus_tag LOCUS_18460 85518 86372 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223765.1 protein_id gnl|my_center|LOCUS_18460 86645 86737 gene locus_tag LOCUS_t00190 86645 86737 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 87269 88498 gene locus_tag LOCUS_18470 87269 88498 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223761.1 protein_id gnl|my_center|LOCUS_18470 88568 89674 gene locus_tag LOCUS_18480 88568 89674 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223762.1 protein_id gnl|my_center|LOCUS_18480 89703 90443 gene locus_tag LOCUS_18490 89703 90443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 92189 90750 gene locus_tag LOCUS_18500 92189 90750 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224828.1 protein_id gnl|my_center|LOCUS_18500 92768 92259 gene locus_tag LOCUS_18510 92768 92259 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027329.1 protein_id gnl|my_center|LOCUS_18510 92877 93338 gene locus_tag LOCUS_18520 92877 93338 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027124.1 protein_id gnl|my_center|LOCUS_18520 93364 94890 gene locus_tag LOCUS_18530 93364 94890 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228500.1 protein_id gnl|my_center|LOCUS_18530 94897 95481 gene locus_tag LOCUS_18540 94897 95481 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978113.1 protein_id gnl|my_center|LOCUS_18540 95670 95494 gene locus_tag LOCUS_18550 95670 95494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978111.1 protein_id gnl|my_center|LOCUS_18550 95794 97047 gene locus_tag LOCUS_18560 95794 97047 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005118518.1 protein_id gnl|my_center|LOCUS_18560 97506 97090 gene locus_tag LOCUS_18570 97506 97090 CDS product DUF6479 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326645.1 protein_id gnl|my_center|LOCUS_18570 97797 97510 gene locus_tag LOCUS_18580 97797 97510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 100366 97910 gene locus_tag LOCUS_18590 100366 97910 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027330.1 protein_id gnl|my_center|LOCUS_18590 100500 102644 gene locus_tag LOCUS_18600 100500 102644 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031735.1 protein_id gnl|my_center|LOCUS_18600 104318 102840 gene locus_tag LOCUS_18610 104318 102840 CDS product S1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027331.1 protein_id gnl|my_center|LOCUS_18610 104937 105152 gene locus_tag LOCUS_18620 104937 105152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978108.1 protein_id gnl|my_center|LOCUS_18620 105304 106110 gene locus_tag LOCUS_18630 105304 106110 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978107.1 protein_id gnl|my_center|LOCUS_18630 106200 108365 gene locus_tag LOCUS_18640 106200 108365 CDS product NHLP family bacteriocin export ABC transporter peptidase/permease/ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027333.1 protein_id gnl|my_center|LOCUS_18640 108367 111183 gene locus_tag LOCUS_18650 108367 111183 CDS product NHLP bacteriocin export ABC transporter permease/ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027334.1 protein_id gnl|my_center|LOCUS_18650 111243 112238 gene locus_tag LOCUS_18660 111243 112238 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027335.1 protein_id gnl|my_center|LOCUS_18660 112303 112542 gene locus_tag LOCUS_18670 112303 112542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 112614 113627 gene locus_tag LOCUS_18680 112614 113627 CDS product iron-containing redox enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027336.1 protein_id gnl|my_center|LOCUS_18680 113686 114339 gene locus_tag LOCUS_18690 113686 114339 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325244.1 protein_id gnl|my_center|LOCUS_18690 114320 114535 gene locus_tag LOCUS_18700 114320 114535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18700 115181 114747 gene locus_tag LOCUS_18710 115181 114747 CDS product protease inhibitor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978099.1 protein_id gnl|my_center|LOCUS_18710 115541 116266 gene locus_tag LOCUS_18720 115541 116266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 116329 116835 gene locus_tag LOCUS_18730 116329 116835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18730 116752 116780 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 116781 117527 gene locus_tag LOCUS_18740 116781 117527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18740 119136 117532 gene locus_tag LOCUS_18750 119136 117532 CDS product RICIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027339.1 protein_id gnl|my_center|LOCUS_18750 119675 119298 gene locus_tag LOCUS_18760 119675 119298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978453.1 protein_id gnl|my_center|LOCUS_18760 119933 119679 gene locus_tag LOCUS_18770 119933 119679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 120374 122749 gene locus_tag LOCUS_18780 120374 122749 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484486.1 protein_id gnl|my_center|LOCUS_18780 123338 122790 gene locus_tag LOCUS_18790 123338 122790 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284042.1 protein_id gnl|my_center|LOCUS_18790 123386 124957 gene locus_tag LOCUS_18800 123386 124957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 125125 125835 gene locus_tag LOCUS_18810 125125 125835 CDS product DUF4232 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027343.1 protein_id gnl|my_center|LOCUS_18810 125991 127193 gene locus_tag LOCUS_18820 125991 127193 CDS product ArsB/NhaD family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104175.1 protein_id gnl|my_center|LOCUS_18820 127232 127882 gene locus_tag LOCUS_18830 127232 127882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 130486 127895 gene locus_tag LOCUS_18840 130486 127895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 131756 130788 gene locus_tag LOCUS_18850 131756 130788 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930069.1 protein_id gnl|my_center|LOCUS_18850 132194 132481 gene locus_tag LOCUS_18860 132194 132481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 132236 132258 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 133080 132538 gene locus_tag LOCUS_18870 133080 132538 CDS product flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027345.1 protein_id gnl|my_center|LOCUS_18870 133571 133110 gene locus_tag LOCUS_18880 133571 133110 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027346.1 protein_id gnl|my_center|LOCUS_18880 134365 133685 gene locus_tag LOCUS_18890 134365 133685 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831492.1 protein_id gnl|my_center|LOCUS_18890 134434 135375 gene locus_tag LOCUS_18900 134434 135375 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222877.1 protein_id gnl|my_center|LOCUS_18900 135556 135356 gene locus_tag LOCUS_18910 135556 135356 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027347.1 protein_id gnl|my_center|LOCUS_18910 136774 135569 gene locus_tag LOCUS_18920 136774 135569 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027348.1 protein_id gnl|my_center|LOCUS_18920 136722 137060 gene locus_tag LOCUS_18930 136722 137060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 137057 137695 gene locus_tag LOCUS_18940 137057 137695 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467104.1 protein_id gnl|my_center|LOCUS_18940 137825 138340 gene locus_tag LOCUS_18950 137825 138340 CDS product nitroreductase family deazaflavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978086.1 protein_id gnl|my_center|LOCUS_18950 139571 138489 gene locus_tag LOCUS_18960 139571 138489 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325249.1 protein_id gnl|my_center|LOCUS_18960 139604 140656 gene locus_tag LOCUS_18970 139604 140656 CDS product glutathione S-transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978084.1 protein_id gnl|my_center|LOCUS_18970 140621 140653 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 140692 140991 gene locus_tag LOCUS_18980 140692 140991 CDS product DUF4235 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978083.1 protein_id gnl|my_center|LOCUS_18980 142451 141504 gene locus_tag LOCUS_18990 142451 141504 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_213089171.1 protein_id gnl|my_center|LOCUS_18990 142523 143473 gene locus_tag LOCUS_19000 142523 143473 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978080.1 protein_id gnl|my_center|LOCUS_19000 143702 144082 gene locus_tag LOCUS_19010 143702 144082 CDS product anti-sigma factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978079.1 protein_id gnl|my_center|LOCUS_19010 145112 144132 gene locus_tag LOCUS_19020 145112 144132 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027351.1 protein_id gnl|my_center|LOCUS_19020 145328 145990 gene locus_tag LOCUS_19030 145328 145990 CDS product DUF4230 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027353.1 protein_id gnl|my_center|LOCUS_19030 147762 145978 gene locus_tag LOCUS_19040 147762 145978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 148121 147762 gene locus_tag LOCUS_19050 148121 147762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 148869 148129 gene locus_tag LOCUS_19060 148869 148129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 149132 148866 gene locus_tag LOCUS_19070 149132 148866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 149577 149125 gene locus_tag LOCUS_19080 149577 149125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 149756 149574 gene locus_tag LOCUS_19090 149756 149574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 149953 150528 gene locus_tag LOCUS_19100 149953 150528 CDS product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978074.1 protein_id gnl|my_center|LOCUS_19100 150657 151910 gene locus_tag LOCUS_19110 150657 151910 CDS product glycoside hydrolase family 16 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027355.1 protein_id gnl|my_center|LOCUS_19110 152172 151936 gene locus_tag LOCUS_19120 152172 151936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978072.1 protein_id gnl|my_center|LOCUS_19120 153234 152218 gene locus_tag LOCUS_19130 153234 152218 CDS product DNA topoisomerase IB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226137.1 protein_id gnl|my_center|LOCUS_19130 154057 153245 gene locus_tag LOCUS_19140 154057 153245 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226107.1 protein_id gnl|my_center|LOCUS_19140 154173 155246 gene locus_tag LOCUS_19150 154173 155246 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030869314.1 protein_id gnl|my_center|LOCUS_19150 155047 154965 gene locus_tag LOCUS_t00200 155047 154965 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 155306 155962 gene locus_tag LOCUS_19160 155306 155962 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225121.1 protein_id gnl|my_center|LOCUS_19160 156092 157315 gene locus_tag LOCUS_19170 156092 157315 CDS product aromatic acid exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484495.1 protein_id gnl|my_center|LOCUS_19170 157636 158607 gene locus_tag LOCUS_19180 157636 158607 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227729.1 protein_id gnl|my_center|LOCUS_19180 159536 158700 gene locus_tag LOCUS_19190 159536 158700 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768991.1 protein_id gnl|my_center|LOCUS_19190 159760 160677 gene locus_tag LOCUS_19200 159760 160677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19200 160518 160546 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 160659 160817 gene locus_tag LOCUS_19210 160659 160817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19210 161099 160842 gene locus_tag LOCUS_19220 161099 160842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027359.1 protein_id gnl|my_center|LOCUS_19220 161733 161185 gene locus_tag LOCUS_19230 161733 161185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 161214 161237 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 161687 162037 gene locus_tag LOCUS_19240 161687 162037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 162719 162372 gene locus_tag LOCUS_19250 162719 162372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 162624 163094 gene locus_tag LOCUS_19260 162624 163094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 162834 162865 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 163185 164051 gene locus_tag LOCUS_19270 163185 164051 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976840.1 protein_id gnl|my_center|LOCUS_19270 164054 164338 gene locus_tag LOCUS_19280 164054 164338 CDS product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976841.1 protein_id gnl|my_center|LOCUS_19280 164428 165237 gene locus_tag LOCUS_19290 164428 165237 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978338.1 protein_id gnl|my_center|LOCUS_19290 165654 165253 gene locus_tag LOCUS_19300 165654 165253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19300 168188 165849 gene locus_tag LOCUS_19310 168188 165849 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225184.1 protein_id gnl|my_center|LOCUS_19310 168521 169444 gene locus_tag LOCUS_19320 168521 169444 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977187.1 protein_id gnl|my_center|LOCUS_19320 169505 169792 gene locus_tag LOCUS_19330 169505 169792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 170536 171501 gene locus_tag LOCUS_19340 170536 171501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 171835 171494 gene locus_tag LOCUS_19350 171835 171494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19350 172742 171996 gene locus_tag LOCUS_19360 172742 171996 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408460.1 protein_id gnl|my_center|LOCUS_19360 172814 174148 gene locus_tag LOCUS_19370 172814 174148 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899017.1 protein_id gnl|my_center|LOCUS_19370 174145 174981 gene locus_tag LOCUS_19380 174145 174981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408760.1 protein_id gnl|my_center|LOCUS_19380 176717 176385 gene locus_tag LOCUS_19390 176717 176385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 177335 176988 gene locus_tag LOCUS_19400 177335 176988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 177642 177484 gene locus_tag LOCUS_19410 177642 177484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 179173 177887 gene locus_tag LOCUS_19420 179173 177887 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027360.1 protein_id gnl|my_center|LOCUS_19420 179410 179904 gene locus_tag LOCUS_19430 179410 179904 CDS product FBP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978065.1 protein_id gnl|my_center|LOCUS_19430 179957 181210 gene locus_tag LOCUS_19440 179957 181210 CDS product aromatic acid exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030869305.1 protein_id gnl|my_center|LOCUS_19440 181304 182395 gene locus_tag LOCUS_19450 181304 182395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027361.1 protein_id gnl|my_center|LOCUS_19450 182527 183786 gene locus_tag LOCUS_19460 182527 183786 CDS product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173668699.1 protein_id gnl|my_center|LOCUS_19460 184473 183754 gene locus_tag LOCUS_19470 184473 183754 CDS product DUF2470 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027363.1 protein_id gnl|my_center|LOCUS_19470 185190 184576 gene locus_tag LOCUS_19480 185190 184576 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164275233.1 protein_id gnl|my_center|LOCUS_19480 185281 186822 gene locus_tag LOCUS_19490 185281 186822 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027365.1 protein_id gnl|my_center|LOCUS_19490 187641 186784 gene locus_tag LOCUS_19500 187641 186784 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027366.1 protein_id gnl|my_center|LOCUS_19500 188383 187688 gene locus_tag LOCUS_19510 188383 187688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19510 188408 188433 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 189390 188647 gene locus_tag LOCUS_19520 189390 188647 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978056.1 protein_id gnl|my_center|LOCUS_19520 190774 189473 gene locus_tag LOCUS_19530 190774 189473 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027368.1 protein_id gnl|my_center|LOCUS_19530 191925 190873 gene locus_tag LOCUS_19540 191925 190873 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978054.1 protein_id gnl|my_center|LOCUS_19540 191791 191817 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 192091 192477 gene locus_tag LOCUS_19550 192091 192477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 192519 193274 gene locus_tag LOCUS_19560 192519 193274 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027371.1 protein_id gnl|my_center|LOCUS_19560 193271 194749 gene locus_tag LOCUS_19570 193271 194749 CDS product LutB/LldF family L-lactate oxidation iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027372.1 protein_id gnl|my_center|LOCUS_19570 194746 195417 gene locus_tag LOCUS_19580 194746 195417 CDS product LUD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978042.1 protein_id gnl|my_center|LOCUS_19580 195995 195408 gene locus_tag LOCUS_19590 195995 195408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 196995 196036 gene locus_tag LOCUS_19600 196995 196036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 197666 196992 gene locus_tag LOCUS_19610 197666 196992 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229696.1 protein_id gnl|my_center|LOCUS_19610 198343 197663 gene locus_tag LOCUS_19620 198343 197663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 199076 198480 gene locus_tag LOCUS_19630 199076 198480 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224808.1 protein_id gnl|my_center|LOCUS_19630 198981 199004 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 199229 200086 gene locus_tag LOCUS_19640 199229 200086 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224865.1 protein_id gnl|my_center|LOCUS_19640 200083 201483 gene locus_tag LOCUS_19650 200083 201483 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224866.1 protein_id gnl|my_center|LOCUS_19650 202224 201523 gene locus_tag LOCUS_19660 202224 201523 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223216.1 protein_id gnl|my_center|LOCUS_19660 202724 202359 gene locus_tag LOCUS_19670 202724 202359 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978039.1 protein_id gnl|my_center|LOCUS_19670 202912 203805 gene locus_tag LOCUS_19680 202912 203805 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031688.1 protein_id gnl|my_center|LOCUS_19680 204549 203866 gene locus_tag LOCUS_19690 204549 203866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 204941 204678 gene locus_tag LOCUS_19700 204941 204678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 206011 204938 gene locus_tag LOCUS_19710 206011 204938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 205191 205221 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 207793 206015 gene locus_tag LOCUS_19720 207793 206015 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227542.1 protein_id gnl|my_center|LOCUS_19720 209621 207849 gene locus_tag LOCUS_19730 209621 207849 CDS product thiamine pyrophosphate-requiring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225166.1 protein_id gnl|my_center|LOCUS_19730 212787 209713 gene locus_tag LOCUS_19740 212787 209713 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228347.1 protein_id gnl|my_center|LOCUS_19740 214534 213065 gene locus_tag LOCUS_19750 214534 213065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 216215 214542 gene locus_tag LOCUS_19760 216215 214542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 216496 216849 gene locus_tag LOCUS_19770 216496 216849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 221971 216860 gene locus_tag LOCUS_19780 221971 216860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 223668 222592 gene locus_tag LOCUS_19790 223668 222592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 224554 223760 gene locus_tag LOCUS_19800 224554 223760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 224631 225698 gene locus_tag LOCUS_19810 224631 225698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 225695 226117 gene locus_tag LOCUS_19820 225695 226117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 226852 226139 gene locus_tag LOCUS_19830 226852 226139 CDS product DUF2993 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974808.1 protein_id gnl|my_center|LOCUS_19830 227671 226997 gene locus_tag LOCUS_19840 227671 226997 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229023.1 protein_id gnl|my_center|LOCUS_19840 227822 229483 gene locus_tag LOCUS_19850 227822 229483 CDS product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731564.1 protein_id gnl|my_center|LOCUS_19850 229480 230412 gene locus_tag LOCUS_19860 229480 230412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19860 230352 230376 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 230432 230950 gene locus_tag LOCUS_19870 230432 230950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19870 230947 232158 gene locus_tag LOCUS_19880 230947 232158 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085032097.1 protein_id gnl|my_center|LOCUS_19880 232601 232341 gene locus_tag LOCUS_19890 232601 232341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 232509 232973 gene locus_tag LOCUS_19900 232509 232973 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229692.1 protein_id gnl|my_center|LOCUS_19900 233744 233025 gene locus_tag LOCUS_19910 233744 233025 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020640423.1 protein_id gnl|my_center|LOCUS_19910 234612 233761 gene locus_tag LOCUS_19920 234612 233761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 234367 234393 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 234848 235201 gene locus_tag LOCUS_19930 234848 235201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 235622 235137 gene locus_tag LOCUS_19940 235622 235137 CDS product DUF3291 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640509.1 protein_id gnl|my_center|LOCUS_19940 236296 235655 gene locus_tag LOCUS_19950 236296 235655 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971473.1 protein_id gnl|my_center|LOCUS_19950 235761 235790 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 236545 238917 gene locus_tag LOCUS_19960 236545 238917 CDS product immune inhibitor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028663.1 protein_id gnl|my_center|LOCUS_19960 240249 239284 gene locus_tag LOCUS_19970 240249 239284 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027413.1 protein_id gnl|my_center|LOCUS_19970 240690 240712 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 241792 240860 gene locus_tag LOCUS_19980 241792 240860 CDS product M56 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978223.1 protein_id gnl|my_center|LOCUS_19980 242254 241799 gene locus_tag LOCUS_19990 242254 241799 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027265.1 protein_id gnl|my_center|LOCUS_19990 242458 242315 gene locus_tag LOCUS_20000 242458 242315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 242613 243188 gene locus_tag LOCUS_20010 242613 243188 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027414.1 protein_id gnl|my_center|LOCUS_20010 244764 243298 gene locus_tag LOCUS_20020 244764 243298 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027415.1 protein_id gnl|my_center|LOCUS_20020 244872 245258 gene locus_tag LOCUS_20030 gene trxA 244872 245258 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027416.1 protein_id gnl|my_center|LOCUS_20030 245443 246582 gene locus_tag LOCUS_20040 245443 246582 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031842.1 protein_id gnl|my_center|LOCUS_20040 247304 246606 gene locus_tag LOCUS_20050 247304 246606 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027418.1 protein_id gnl|my_center|LOCUS_20050 247466 248029 gene locus_tag LOCUS_20060 247466 248029 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977971.1 protein_id gnl|my_center|LOCUS_20060 248198 249178 gene locus_tag LOCUS_20070 248198 249178 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228674.1 protein_id gnl|my_center|LOCUS_20070 249343 251520 gene locus_tag LOCUS_20080 249343 251520 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484486.1 protein_id gnl|my_center|LOCUS_20080 251221 251247 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 252691 251606 gene locus_tag LOCUS_20090 252691 251606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_20090 253201 254628 gene locus_tag LOCUS_20100 253201 254628 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222347.1 protein_id gnl|my_center|LOCUS_20100 255125 254697 gene locus_tag LOCUS_20110 255125 254697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030561.1 protein_id gnl|my_center|LOCUS_20110 255862 255170 gene locus_tag LOCUS_20120 255862 255170 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413588.1 protein_id gnl|my_center|LOCUS_20120 255983 256429 gene locus_tag LOCUS_20130 255983 256429 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027436.1 protein_id gnl|my_center|LOCUS_20130 257314 256496 gene locus_tag LOCUS_20140 257314 256496 CDS product TIGR02452 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030869145.1 protein_id gnl|my_center|LOCUS_20140 257613 258950 gene locus_tag LOCUS_20150 gene egtA 257613 258950 CDS product ergothioneine biosynthesis glutamate--cysteine ligase EgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027438.1 protein_id gnl|my_center|LOCUS_20150 258947 260332 gene locus_tag LOCUS_20160 gene egtB 258947 260332 CDS product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027439.1 protein_id gnl|my_center|LOCUS_20160 260332 261135 gene locus_tag LOCUS_20170 gene egtC 260332 261135 CDS product ergothioneine biosynthesis protein EgtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027440.1 protein_id gnl|my_center|LOCUS_20170 261132 262094 gene locus_tag LOCUS_20180 gene egtD 261132 262094 CDS product L-histidine N(alpha)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027441.1 protein_id gnl|my_center|LOCUS_20180 263406 262147 gene locus_tag LOCUS_20190 263406 262147 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027442.1 protein_id gnl|my_center|LOCUS_20190 263619 263894 gene locus_tag LOCUS_20200 263619 263894 CDS product dodecin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325534.1 protein_id gnl|my_center|LOCUS_20200 264129 263899 gene locus_tag LOCUS_20210 264129 263899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 264117 264350 gene locus_tag LOCUS_20220 264117 264350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 264394 265392 gene locus_tag LOCUS_20230 264394 265392 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027444.1 protein_id gnl|my_center|LOCUS_20230 265427 267781 gene locus_tag LOCUS_20240 265427 267781 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027445.1 protein_id gnl|my_center|LOCUS_20240 268588 267758 gene locus_tag LOCUS_20250 268588 267758 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027447.1 protein_id gnl|my_center|LOCUS_20250 269424 268630 gene locus_tag LOCUS_20260 269424 268630 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977938.1 protein_id gnl|my_center|LOCUS_20260 270402 269653 gene locus_tag LOCUS_20270 270402 269653 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027448.1 protein_id gnl|my_center|LOCUS_20270 272348 270399 gene locus_tag LOCUS_20280 272348 270399 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977936.1 protein_id gnl|my_center|LOCUS_20280 273021 272350 gene locus_tag LOCUS_20290 273021 272350 CDS product succinate dehydrogenase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325539.1 protein_id gnl|my_center|LOCUS_20290 273531 273115 gene locus_tag LOCUS_20300 273531 273115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 273666 273690 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 273722 274054 gene locus_tag LOCUS_20310 273722 274054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20310 276285 275395 gene locus_tag LOCUS_20320 276285 275395 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027450.1 protein_id gnl|my_center|LOCUS_20320 276418 277242 gene locus_tag LOCUS_20330 276418 277242 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977932.1 protein_id gnl|my_center|LOCUS_20330 279470 277335 gene locus_tag LOCUS_20340 gene rmdA 279470 277335 CDS product cyclic Di-GMP phosphodiesterase RmdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027451.1 protein_id gnl|my_center|LOCUS_20340 280279 279467 gene locus_tag LOCUS_20350 280279 279467 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027452.1 protein_id gnl|my_center|LOCUS_20350 281358 280510 gene locus_tag LOCUS_20360 281358 280510 CDS product SCO0930 family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027453.1 protein_id gnl|my_center|LOCUS_20360 281291 281482 gene locus_tag LOCUS_20370 281291 281482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 281841 281554 gene locus_tag LOCUS_20380 281841 281554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 282288 281857 gene locus_tag LOCUS_20390 282288 281857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 282365 283129 gene locus_tag LOCUS_20400 282365 283129 CDS product DUF4239 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977928.1 protein_id gnl|my_center|LOCUS_20400 283332 283787 gene locus_tag LOCUS_20410 283332 283787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 283956 284249 gene locus_tag LOCUS_20420 283956 284249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 285137 284229 gene locus_tag LOCUS_20430 285137 284229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 285513 286172 gene locus_tag LOCUS_20440 285513 286172 CDS product class F sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027455.1 protein_id gnl|my_center|LOCUS_20440 287048 286221 gene locus_tag LOCUS_20450 287048 286221 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868999.1 protein_id gnl|my_center|LOCUS_20450 290435 287166 gene locus_tag LOCUS_20460 gene lysX 290435 287166 CDS product bifunctional lysylphosphatidylglycerol synthetase/lysine--tRNA ligase LysX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877820.1 protein_id gnl|my_center|LOCUS_20460 290647 291051 gene locus_tag LOCUS_20470 290647 291051 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977923.1 protein_id gnl|my_center|LOCUS_20470 291363 292832 gene locus_tag LOCUS_20480 291363 292832 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027457.1 protein_id gnl|my_center|LOCUS_20480 292533 292556 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 293641 292829 gene locus_tag LOCUS_20490 293641 292829 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484565.1 protein_id gnl|my_center|LOCUS_20490 293711 294184 gene locus_tag LOCUS_20500 293711 294184 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027459.1 protein_id gnl|my_center|LOCUS_20500 295396 294191 gene locus_tag LOCUS_20510 295396 294191 CDS product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977919.1 protein_id gnl|my_center|LOCUS_20510 295525 296190 gene locus_tag LOCUS_20520 295525 296190 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977918.1 protein_id gnl|my_center|LOCUS_20520 296325 296840 gene locus_tag LOCUS_20530 296325 296840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977917.1 protein_id gnl|my_center|LOCUS_20530 296983 297642 gene locus_tag LOCUS_20540 296983 297642 CDS product zf-HC2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977916.1 protein_id gnl|my_center|LOCUS_20540 298542 297679 gene locus_tag LOCUS_20550 298542 297679 CDS product Fpg/Nei family DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027460.1 protein_id gnl|my_center|LOCUS_20550 300697 298610 gene locus_tag LOCUS_20560 300697 298610 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975145.1 protein_id gnl|my_center|LOCUS_20560 300787 302208 gene locus_tag LOCUS_20570 300787 302208 CDS product lipase maturation factor family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977913.1 protein_id gnl|my_center|LOCUS_20570 302219 302656 gene locus_tag LOCUS_20580 302219 302656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 303143 302691 gene locus_tag LOCUS_20590 303143 302691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 306239 303213 gene locus_tag LOCUS_20600 306239 303213 CDS product glycoside hydrolase family 38 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027462.1 protein_id gnl|my_center|LOCUS_20600 308329 306275 gene locus_tag LOCUS_20610 308329 306275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 309612 308326 gene locus_tag LOCUS_20620 309612 308326 CDS product cellulase family glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027463.1 protein_id gnl|my_center|LOCUS_20620 310562 309645 gene locus_tag LOCUS_20630 310562 309645 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027464.1 protein_id gnl|my_center|LOCUS_20630 311461 310559 gene locus_tag LOCUS_20640 311461 310559 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977909.1 protein_id gnl|my_center|LOCUS_20640 312762 311470 gene locus_tag LOCUS_20650 312762 311470 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977908.1 protein_id gnl|my_center|LOCUS_20650 312996 314042 gene locus_tag LOCUS_20660 312996 314042 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027465.1 protein_id gnl|my_center|LOCUS_20660 315335 314136 gene locus_tag LOCUS_20670 315335 314136 CDS product flotillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228114.1 protein_id gnl|my_center|LOCUS_20670 315661 315350 gene locus_tag LOCUS_20680 315661 315350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 315806 317056 gene locus_tag LOCUS_20690 315806 317056 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406369.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20690 316988 317016 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 317740 317258 gene locus_tag LOCUS_20700 317740 317258 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027466.1 protein_id gnl|my_center|LOCUS_20700 317968 317795 gene locus_tag LOCUS_20710 317968 317795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027467.1 protein_id gnl|my_center|LOCUS_20710 318532 318296 gene locus_tag LOCUS_20720 318532 318296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 320106 318607 gene locus_tag LOCUS_20730 320106 318607 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977903.1 protein_id gnl|my_center|LOCUS_20730 320126 320153 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 321646 320285 gene locus_tag LOCUS_20740 321646 320285 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027469.1 protein_id gnl|my_center|LOCUS_20740 324141 321820 gene locus_tag LOCUS_20750 324141 321820 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027470.1 protein_id gnl|my_center|LOCUS_20750 324373 324750 gene locus_tag LOCUS_20760 324373 324750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 326027 324813 gene locus_tag LOCUS_20770 gene glgC 326027 324813 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027472.1 protein_id gnl|my_center|LOCUS_20770 324921 324946 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 327230 326079 gene locus_tag LOCUS_20780 gene glgA 327230 326079 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027473.1 protein_id gnl|my_center|LOCUS_20780 327872 327270 gene locus_tag LOCUS_20790 327872 327270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 327986 328022 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 328310 329380 gene locus_tag LOCUS_20800 328310 329380 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027482.1 protein_id gnl|my_center|LOCUS_20800 330625 329396 gene locus_tag LOCUS_20810 330625 329396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 331009 332448 gene locus_tag LOCUS_20820 gene gndA 331009 332448 CDS product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027484.1 protein_id gnl|my_center|LOCUS_20820 333014 332604 gene locus_tag LOCUS_20830 333014 332604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 333800 333135 gene locus_tag LOCUS_20840 333800 333135 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977883.1 protein_id gnl|my_center|LOCUS_20840 334155 333808 gene locus_tag LOCUS_20850 334155 333808 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977882.1 protein_id gnl|my_center|LOCUS_20850 334622 334200 gene locus_tag LOCUS_20860 334622 334200 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027487.1 protein_id gnl|my_center|LOCUS_20860 335440 335048 gene locus_tag LOCUS_20870 335440 335048 CDS product DUF2267 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977706.1 protein_id gnl|my_center|LOCUS_20870 336281 335781 gene locus_tag LOCUS_20880 336281 335781 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034855332.1 protein_id gnl|my_center|LOCUS_20880 338144 336330 gene locus_tag LOCUS_20890 338144 336330 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921422.1 protein_id gnl|my_center|LOCUS_20890 338407 338144 gene locus_tag LOCUS_20900 338407 338144 CDS product UBP-type zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144139.1 protein_id gnl|my_center|LOCUS_20900 338859 338413 gene locus_tag LOCUS_20910 gene trxA 338859 338413 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228708.1 protein_id gnl|my_center|LOCUS_20910 341495 338856 gene locus_tag LOCUS_20920 gene clpB 341495 338856 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365401.1 protein_id gnl|my_center|LOCUS_20920 341860 341486 gene locus_tag LOCUS_20930 341860 341486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 342795 341857 gene locus_tag LOCUS_20940 342795 341857 CDS product DnaJ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943043.1 protein_id gnl|my_center|LOCUS_20940 343386 342802 gene locus_tag LOCUS_20950 gene gprE 343386 342802 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228714.1 protein_id gnl|my_center|LOCUS_20950 345301 343397 gene locus_tag LOCUS_20960 gene dnaK 345301 343397 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144248.1 protein_id gnl|my_center|LOCUS_20960 345574 345383 gene locus_tag LOCUS_20970 345574 345383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 346725 346276 gene locus_tag LOCUS_20980 346725 346276 CDS product DUF1931 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228706.1 protein_id gnl|my_center|LOCUS_20980 346978 347292 gene locus_tag LOCUS_20990 346978 347292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 347527 348465 gene locus_tag LOCUS_21000 347527 348465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 348462 349637 gene locus_tag LOCUS_21010 348462 349637 CDS product zinc-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140737.1 protein_id gnl|my_center|LOCUS_21010 349881 349690 gene locus_tag LOCUS_21020 349881 349690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 350463 350143 gene locus_tag LOCUS_21030 350463 350143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 352571 350790 gene locus_tag LOCUS_21040 352571 350790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 353576 352914 gene locus_tag LOCUS_21050 353576 352914 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029782.1 protein_id gnl|my_center|LOCUS_21050 353841 354959 gene locus_tag LOCUS_21060 353841 354959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225426.1 protein_id gnl|my_center|LOCUS_21060 355166 356302 gene locus_tag LOCUS_21070 355166 356302 CDS product glutathione-independent formaldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405501.1 protein_id gnl|my_center|LOCUS_21070 356534 358795 gene locus_tag LOCUS_21080 356534 358795 CDS product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729167.1 protein_id gnl|my_center|LOCUS_21080 359820 359236 gene locus_tag LOCUS_21090 359820 359236 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326304.1 protein_id gnl|my_center|LOCUS_21090 359957 360823 gene locus_tag LOCUS_21100 359957 360823 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975986.1 protein_id gnl|my_center|LOCUS_21100 361627 360944 gene locus_tag LOCUS_21110 361627 360944 CDS product DUF305 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486466.1 protein_id gnl|my_center|LOCUS_21110 362157 361735 gene locus_tag LOCUS_21120 362157 361735 CDS product DUF6153 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029668.1 protein_id gnl|my_center|LOCUS_21120 362300 362482 gene locus_tag LOCUS_21130 362300 362482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 362479 363657 gene locus_tag LOCUS_21140 362479 363657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 364493 363711 gene locus_tag LOCUS_21150 364493 363711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 363830 363854 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 364511 364732 gene locus_tag LOCUS_21160 364511 364732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 364729 365949 gene locus_tag LOCUS_21170 364729 365949 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091317270.1 protein_id gnl|my_center|LOCUS_21170 368170 366026 gene locus_tag LOCUS_21180 368170 366026 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031735.1 protein_id gnl|my_center|LOCUS_21180 368723 368391 gene locus_tag LOCUS_21190 368723 368391 CDS product DUF3140 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978015.1 protein_id gnl|my_center|LOCUS_21190 368959 368729 gene locus_tag LOCUS_21200 368959 368729 CDS product DUF2945 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978014.1 protein_id gnl|my_center|LOCUS_21200 369544 369290 gene locus_tag LOCUS_21210 369544 369290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 369879 369541 gene locus_tag LOCUS_21220 369879 369541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 370286 371884 gene locus_tag LOCUS_21230 370286 371884 CDS product oleate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084107.1 protein_id gnl|my_center|LOCUS_21230 372001 372765 gene locus_tag LOCUS_21240 372001 372765 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403433.1 protein_id gnl|my_center|LOCUS_21240 372978 374066 gene locus_tag LOCUS_21250 372978 374066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972141.1 protein_id gnl|my_center|LOCUS_21250 373319 373339 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 374082 375623 gene locus_tag LOCUS_21260 374082 375623 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031371.1 protein_id gnl|my_center|LOCUS_21260 375836 376954 gene locus_tag LOCUS_21270 375836 376954 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031370.1 protein_id gnl|my_center|LOCUS_21270 377408 379627 gene locus_tag LOCUS_21280 377408 379627 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031369.1 protein_id gnl|my_center|LOCUS_21280 379817 380668 gene locus_tag LOCUS_21290 379817 380668 CDS product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031368.1 protein_id gnl|my_center|LOCUS_21290 380730 381755 gene locus_tag LOCUS_21300 380730 381755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21300 381490 381517 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 381649 382035 gene locus_tag LOCUS_21310 381649 382035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21310 382536 382069 gene locus_tag LOCUS_21320 382536 382069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031366.1 protein_id gnl|my_center|LOCUS_21320 383108 382533 gene locus_tag LOCUS_21330 383108 382533 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174854968.1 protein_id gnl|my_center|LOCUS_21330 384604 383168 gene locus_tag LOCUS_21340 384604 383168 CDS product S8/S53 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972149.1 protein_id gnl|my_center|LOCUS_21340 384769 387351 gene locus_tag LOCUS_21350 384769 387351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 389286 387400 gene locus_tag LOCUS_21360 389286 387400 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031364.1 protein_id gnl|my_center|LOCUS_21360 389364 390449 gene locus_tag LOCUS_21370 389364 390449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031363.1 protein_id gnl|my_center|LOCUS_21370 390440 390814 gene locus_tag LOCUS_21380 390440 390814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 391156 391082 gene locus_tag LOCUS_t00210 391156 391082 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 391158 391196 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 391800 391276 gene locus_tag LOCUS_21390 391800 391276 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225820.1 protein_id gnl|my_center|LOCUS_21390 391999 392484 gene locus_tag LOCUS_21400 391999 392484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 392666 393601 gene locus_tag LOCUS_21410 392666 393601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 394215 393703 gene locus_tag LOCUS_21420 394215 393703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027067.1 protein_id gnl|my_center|LOCUS_21420 394391 394735 gene locus_tag LOCUS_21430 394391 394735 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109028770.1 protein_id gnl|my_center|LOCUS_21430 395929 394889 gene locus_tag LOCUS_21440 395929 394889 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031357.1 protein_id gnl|my_center|LOCUS_21440 396068 397246 gene locus_tag LOCUS_21450 396068 397246 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031356.1 protein_id gnl|my_center|LOCUS_21450 397254 398102 gene locus_tag LOCUS_21460 397254 398102 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975713.1 protein_id gnl|my_center|LOCUS_21460 398199 399203 gene locus_tag LOCUS_21470 398199 399203 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487216.1 protein_id gnl|my_center|LOCUS_21470 401159 399243 gene locus_tag LOCUS_21480 401159 399243 CDS product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484240.1 protein_id gnl|my_center|LOCUS_21480 402476 401196 gene locus_tag LOCUS_21490 402476 401196 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112974.1 protein_id gnl|my_center|LOCUS_21490 403227 402622 gene locus_tag LOCUS_21500 403227 402622 CDS product GPP34 family phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027096.1 protein_id gnl|my_center|LOCUS_21500 404309 403407 gene locus_tag LOCUS_21510 404309 403407 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031353.1 protein_id gnl|my_center|LOCUS_21510 405303 404314 gene locus_tag LOCUS_21520 405303 404314 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031352.1 protein_id gnl|my_center|LOCUS_21520 406388 405309 gene locus_tag LOCUS_21530 406388 405309 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270370.1 protein_id gnl|my_center|LOCUS_21530 407398 406385 gene locus_tag LOCUS_21540 407398 406385 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031350.1 protein_id gnl|my_center|LOCUS_21540 407690 408688 gene locus_tag LOCUS_21550 gene iolC 407690 408688 CDS product 5-dehydro-2-deoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972167.1 protein_id gnl|my_center|LOCUS_21550 408741 409640 gene locus_tag LOCUS_21560 408741 409640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031349.1 protein_id gnl|my_center|LOCUS_21560 409637 410626 gene locus_tag LOCUS_21570 gene iolB 409637 410626 CDS product 5-deoxy-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031348.1 protein_id gnl|my_center|LOCUS_21570 410634 412508 gene locus_tag LOCUS_21580 gene iolD 410634 412508 CDS product 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729994.1 protein_id gnl|my_center|LOCUS_21580 412569 413354 gene locus_tag LOCUS_21590 412569 413354 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972171.1 protein_id gnl|my_center|LOCUS_21590 413483 413409 gene locus_tag LOCUS_t00220 413483 413409 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 413485 413516 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 413613 414152 gene locus_tag LOCUS_21600 413613 414152 CDS product DUF309 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972173.1 protein_id gnl|my_center|LOCUS_21600 414169 414993 gene locus_tag LOCUS_21610 gene cobF 414169 414993 CDS product precorrin-6A synthase (deacetylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031346.1 protein_id gnl|my_center|LOCUS_21610 415760 415014 gene locus_tag LOCUS_21620 415760 415014 CDS product cobalt-precorrin-6A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975552.1 protein_id gnl|my_center|LOCUS_21620 416660 415845 gene locus_tag LOCUS_21630 416660 415845 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484635.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_21630 417568 416672 gene locus_tag LOCUS_21640 417568 416672 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027594.1 protein_id gnl|my_center|LOCUS_21640 418426 417578 gene locus_tag LOCUS_21650 418426 417578 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325650.1 protein_id gnl|my_center|LOCUS_21650 418594 419772 gene locus_tag LOCUS_21660 418594 419772 CDS product galactosyldiacylglycerol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484813.1 protein_id gnl|my_center|LOCUS_21660 420182 419769 gene locus_tag LOCUS_21670 420182 419769 CDS product RpiB/LacA/LacB family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027656.1 protein_id gnl|my_center|LOCUS_21670 421776 420568 gene locus_tag LOCUS_21680 421776 420568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 422346 421885 gene locus_tag LOCUS_21690 422346 421885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 422462 422620 gene locus_tag LOCUS_21700 422462 422620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 423309 422662 gene locus_tag LOCUS_21710 423309 422662 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031344.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21710 423390 423414 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 425076 423562 gene locus_tag LOCUS_21720 425076 423562 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972177.1 protein_id gnl|my_center|LOCUS_21720 426380 425193 gene locus_tag LOCUS_21730 426380 425193 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972178.1 protein_id gnl|my_center|LOCUS_21730 426503 427342 gene locus_tag LOCUS_21740 426503 427342 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031343.1 protein_id gnl|my_center|LOCUS_21740 427467 427715 gene locus_tag LOCUS_21750 gene whiB1 427467 427715 CDS product transcriptional regulator WhiB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416884.1 protein_id gnl|my_center|LOCUS_21750 427712 428194 gene locus_tag LOCUS_21760 427712 428194 CDS product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973268.1 protein_id gnl|my_center|LOCUS_21760 428243 428596 gene locus_tag LOCUS_21770 428243 428596 CDS product DUF3140 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972181.1 protein_id gnl|my_center|LOCUS_21770 428593 429246 gene locus_tag LOCUS_21780 428593 429246 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031342.1 protein_id gnl|my_center|LOCUS_21780 429510 430064 gene locus_tag LOCUS_21790 429510 430064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 430114 430803 gene locus_tag LOCUS_21800 430114 430803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 431740 430829 gene locus_tag LOCUS_21810 431740 430829 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819430.1 protein_id gnl|my_center|LOCUS_21810 430962 430991 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 431937 432749 gene locus_tag LOCUS_21820 431937 432749 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978338.1 protein_id gnl|my_center|LOCUS_21820 432811 434211 gene locus_tag LOCUS_21830 gene glnA3 432811 434211 CDS product gamma-glutamylpolyamine synthetase GlnA3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031340.1 protein_id gnl|my_center|LOCUS_21830 434211 435383 gene locus_tag LOCUS_21840 434211 435383 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031339.1 protein_id gnl|my_center|LOCUS_21840 435418 435945 gene locus_tag LOCUS_21850 435418 435945 CDS product NUDIX hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870383.1 protein_id gnl|my_center|LOCUS_21850 436040 436882 gene locus_tag LOCUS_21860 436040 436882 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192698.1 protein_id gnl|my_center|LOCUS_21860 437160 437086 gene locus_tag LOCUS_t00230 437160 437086 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 438684 437266 gene locus_tag LOCUS_21870 438684 437266 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031193.1 protein_id gnl|my_center|LOCUS_21870 439133 438765 gene locus_tag LOCUS_21880 439133 438765 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037666054.1 protein_id gnl|my_center|LOCUS_21880 439766 439155 gene locus_tag LOCUS_21890 439766 439155 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031191.1 protein_id gnl|my_center|LOCUS_21890 440799 439897 gene locus_tag LOCUS_21900 440799 439897 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972197.1 protein_id gnl|my_center|LOCUS_21900 442057 440864 gene locus_tag LOCUS_21910 442057 440864 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972198.1 protein_id gnl|my_center|LOCUS_21910 442414 442100 gene locus_tag LOCUS_21920 442414 442100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21920 442512 443279 gene locus_tag LOCUS_21930 442512 443279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 442549 442573 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 444003 443299 gene locus_tag LOCUS_21940 444003 443299 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972200.1 protein_id gnl|my_center|LOCUS_21940 444629 444000 gene locus_tag LOCUS_21950 444629 444000 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327875.1 protein_id gnl|my_center|LOCUS_21950 444984 444607 gene locus_tag LOCUS_21960 444984 444607 CDS product DUF742 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031189.1 protein_id gnl|my_center|LOCUS_21960 445415 444981 gene locus_tag LOCUS_21970 445415 444981 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972203.1 protein_id gnl|my_center|LOCUS_21970 447567 445519 gene locus_tag LOCUS_21980 447567 445519 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031188.1 protein_id gnl|my_center|LOCUS_21980 448991 448116 gene locus_tag LOCUS_21990 448991 448116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 449631 449652 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 449683 449904 gene locus_tag LOCUS_22000 449683 449904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 451118 449952 gene locus_tag LOCUS_22010 451118 449952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 450207 450229 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 451256 451840 gene locus_tag LOCUS_22020 451256 451840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 451955 453160 gene locus_tag LOCUS_22030 451955 453160 CDS product Glu/Leu/Phe/Val dehydrogenase dimerization domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223248.1 protein_id gnl|my_center|LOCUS_22030 453250 453864 gene locus_tag LOCUS_22040 453250 453864 CDS product TetR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972222.1 protein_id gnl|my_center|LOCUS_22040 454737 453952 gene locus_tag LOCUS_22050 454737 453952 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972223.1 protein_id gnl|my_center|LOCUS_22050 455803 454898 gene locus_tag LOCUS_22060 455803 454898 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031172.1 protein_id gnl|my_center|LOCUS_22060 456131 455787 gene locus_tag LOCUS_22070 456131 455787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 456384 457181 gene locus_tag LOCUS_22080 456384 457181 CDS product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972225.1 protein_id gnl|my_center|LOCUS_22080 457338 457219 gene locus_tag LOCUS_22090 457338 457219 CDS product DUF6126 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031171.1 protein_id gnl|my_center|LOCUS_22090 457775 457335 gene locus_tag LOCUS_22100 457775 457335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22100 457829 457850 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 459479 458097 gene locus_tag LOCUS_22110 459479 458097 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031169.1 protein_id gnl|my_center|LOCUS_22110 461395 459476 gene locus_tag LOCUS_22120 gene dxs 461395 459476 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031168.1 protein_id gnl|my_center|LOCUS_22120 >Feature sequence005 61 663 gene locus_tag LOCUS_22130 61 663 CDS product DUF5947 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225634.1 protein_id gnl|my_center|LOCUS_22130 689 895 gene locus_tag LOCUS_22140 689 895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 970 1125 gene locus_tag LOCUS_22150 970 1125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 1182 1418 gene locus_tag LOCUS_22160 1182 1418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 2464 1388 gene locus_tag LOCUS_22170 2464 1388 CDS product PP2C family protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029660.1 protein_id gnl|my_center|LOCUS_22170 2632 3123 gene locus_tag LOCUS_22180 2632 3123 CDS product nitroreductase family deazaflavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031504.1 protein_id gnl|my_center|LOCUS_22180 3528 4439 gene locus_tag LOCUS_22190 3528 4439 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189282703.1 protein_id gnl|my_center|LOCUS_22190 4503 5378 gene locus_tag LOCUS_22200 4503 5378 CDS product RNA polymerase sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978261.1 protein_id gnl|my_center|LOCUS_22200 6438 5449 gene locus_tag LOCUS_22210 6438 5449 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888889.1 protein_id gnl|my_center|LOCUS_22210 6683 7144 gene locus_tag LOCUS_22220 6683 7144 CDS product DUF1269 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990599.1 protein_id gnl|my_center|LOCUS_22220 7201 7494 gene locus_tag LOCUS_22230 7201 7494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 8230 7529 gene locus_tag LOCUS_22240 8230 7529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 7725 7754 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8481 10052 gene locus_tag LOCUS_22250 8481 10052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22250 9958 9988 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10027 11190 gene locus_tag LOCUS_22260 10027 11190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22260 11561 11199 gene locus_tag LOCUS_22270 11561 11199 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975218.1 protein_id gnl|my_center|LOCUS_22270 12108 11767 gene locus_tag LOCUS_22280 12108 11767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978181.1 protein_id gnl|my_center|LOCUS_22280 12332 13069 gene locus_tag LOCUS_22290 12332 13069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005115937.1 protein_id gnl|my_center|LOCUS_22290 13184 14824 gene locus_tag LOCUS_22300 gene pgm 13184 14824 CDS product phosphoglucomutase (alpha-D-glucose-1,6-bisphosphate-dependent) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971701.1 protein_id gnl|my_center|LOCUS_22300 15386 14895 gene locus_tag LOCUS_22310 15386 14895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 15603 17936 gene locus_tag LOCUS_22320 15603 17936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 18746 18039 gene locus_tag LOCUS_22330 18746 18039 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037896947.1 protein_id gnl|my_center|LOCUS_22330 18906 19841 gene locus_tag LOCUS_22340 18906 19841 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030857.1 protein_id gnl|my_center|LOCUS_22340 19838 20680 gene locus_tag LOCUS_22350 19838 20680 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030858.1 protein_id gnl|my_center|LOCUS_22350 20699 22000 gene locus_tag LOCUS_22360 20699 22000 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189923413.1 protein_id gnl|my_center|LOCUS_22360 21997 22665 gene locus_tag LOCUS_22370 21997 22665 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030860.1 protein_id gnl|my_center|LOCUS_22370 23670 22741 gene locus_tag LOCUS_22380 23670 22741 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222519.1 protein_id gnl|my_center|LOCUS_22380 26114 23832 gene locus_tag LOCUS_22390 26114 23832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 27690 26251 gene locus_tag LOCUS_22400 27690 26251 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030990.1 protein_id gnl|my_center|LOCUS_22400 28076 27861 gene locus_tag LOCUS_22410 28076 27861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 28987 28166 gene locus_tag LOCUS_22420 28987 28166 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030363.1 protein_id gnl|my_center|LOCUS_22420 30119 29079 gene locus_tag LOCUS_22430 30119 29079 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031660.1 protein_id gnl|my_center|LOCUS_22430 30244 30936 gene locus_tag LOCUS_22440 gene snpA 30244 30936 CDS product snapalysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971712.1 protein_id gnl|my_center|LOCUS_22440 31278 31117 gene locus_tag LOCUS_22450 31278 31117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 31264 31626 gene locus_tag LOCUS_22460 31264 31626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 32689 31832 gene locus_tag LOCUS_22470 32689 31832 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135794525.1 protein_id gnl|my_center|LOCUS_22470 32574 32789 gene locus_tag LOCUS_22480 32574 32789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 33063 33212 gene locus_tag LOCUS_22490 33063 33212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 33645 33289 gene locus_tag LOCUS_22500 33645 33289 CDS product PRC-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978264.1 protein_id gnl|my_center|LOCUS_22500 33844 34260 gene locus_tag LOCUS_22510 33844 34260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 34510 36336 gene locus_tag LOCUS_22520 34510 36336 CDS product bifunctional metallophosphatase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029468.1 protein_id gnl|my_center|LOCUS_22520 36482 36261 gene locus_tag LOCUS_22530 36482 36261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 36509 38185 gene locus_tag LOCUS_22540 36509 38185 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004544143.1 protein_id gnl|my_center|LOCUS_22540 36865 36885 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 39619 38228 gene locus_tag LOCUS_22550 39619 38228 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966601.1 protein_id gnl|my_center|LOCUS_22550 40992 39616 gene locus_tag LOCUS_22560 40992 39616 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030088.1 protein_id gnl|my_center|LOCUS_22560 42098 41412 gene locus_tag LOCUS_22570 gene folE 42098 41412 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072479192.1 protein_id gnl|my_center|LOCUS_22570 42171 43028 gene locus_tag LOCUS_22580 42171 43028 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971473.1 protein_id gnl|my_center|LOCUS_22580 43155 44393 gene locus_tag LOCUS_22590 43155 44393 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898087.1 protein_id gnl|my_center|LOCUS_22590 44435 45625 gene locus_tag LOCUS_22600 44435 45625 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401972.1 protein_id gnl|my_center|LOCUS_22600 46611 45691 gene locus_tag LOCUS_22610 46611 45691 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313724.1 protein_id gnl|my_center|LOCUS_22610 46894 47304 gene locus_tag LOCUS_22620 46894 47304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 47409 48494 gene locus_tag LOCUS_22630 47409 48494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 48570 48806 gene locus_tag LOCUS_22640 48570 48806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 49010 48858 gene locus_tag LOCUS_22650 49010 48858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22650 49021 49042 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 50563 49925 gene locus_tag LOCUS_22660 50563 49925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 51497 50661 gene locus_tag LOCUS_22670 51497 50661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031647.1 protein_id gnl|my_center|LOCUS_22670 51670 51494 gene locus_tag LOCUS_22680 51670 51494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 52068 51697 gene locus_tag LOCUS_22690 52068 51697 CDS product sensory rhodopsin transducer inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015456573.1 protein_id gnl|my_center|LOCUS_22690 52793 52233 gene locus_tag LOCUS_22700 52793 52233 CDS product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971771.1 protein_id gnl|my_center|LOCUS_22700 53036 54682 gene locus_tag LOCUS_22710 53036 54682 CDS product ubiquinol-cytochrome c reductase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031531.1 protein_id gnl|my_center|LOCUS_22710 55201 54734 gene locus_tag LOCUS_22720 55201 54734 CDS product SPW repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971883.1 protein_id gnl|my_center|LOCUS_22720 55723 55331 gene locus_tag LOCUS_22730 55723 55331 CDS product cytochrome c oxidase subunit 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971910.1 protein_id gnl|my_center|LOCUS_22730 57273 55720 gene locus_tag LOCUS_22740 gene ctaD 57273 55720 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971911.1 protein_id gnl|my_center|LOCUS_22740 58978 57455 gene locus_tag LOCUS_22750 58978 57455 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461820.1 protein_id gnl|my_center|LOCUS_22750 59570 60922 gene locus_tag LOCUS_22760 59570 60922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22760 60564 60591 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 60813 61394 gene locus_tag LOCUS_22770 60813 61394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22770 61394 62548 gene locus_tag LOCUS_22780 61394 62548 CDS product enolase C-terminal domain-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031648.1 protein_id gnl|my_center|LOCUS_22780 62574 65747 gene locus_tag LOCUS_22790 62574 65747 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228347.1 protein_id gnl|my_center|LOCUS_22790 65845 66537 gene locus_tag LOCUS_22800 65845 66537 CDS product adenosylcobinamide amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031658.1 protein_id gnl|my_center|LOCUS_22800 68022 66544 gene locus_tag LOCUS_22810 68022 66544 CDS product glutamate-cysteine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031712.1 protein_id gnl|my_center|LOCUS_22810 68208 69362 gene locus_tag LOCUS_22820 68208 69362 CDS product PP2C family protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225630519.1 protein_id gnl|my_center|LOCUS_22820 69948 69445 gene locus_tag LOCUS_22830 69948 69445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 70090 70587 gene locus_tag LOCUS_22840 70090 70587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 70584 73007 gene locus_tag LOCUS_22850 70584 73007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 74044 72995 gene locus_tag LOCUS_22860 gene hisC 74044 72995 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029330.1 protein_id gnl|my_center|LOCUS_22860 75067 74048 gene locus_tag LOCUS_22870 75067 74048 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase III C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727696.1 protein_id gnl|my_center|LOCUS_22870 75720 75064 gene locus_tag LOCUS_22880 75720 75064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110697.1 protein_id gnl|my_center|LOCUS_22880 77443 75689 gene locus_tag LOCUS_22890 77443 75689 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005098174.1 protein_id gnl|my_center|LOCUS_22890 78435 77440 gene locus_tag LOCUS_22900 78435 77440 CDS product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529113.1 protein_id gnl|my_center|LOCUS_22900 80485 78632 gene locus_tag LOCUS_22910 80485 78632 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003908534.1 protein_id gnl|my_center|LOCUS_22910 81870 80482 gene locus_tag LOCUS_22920 81870 80482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 82553 81867 gene locus_tag LOCUS_22930 82553 81867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 83662 82643 gene locus_tag LOCUS_22940 83662 82643 CDS product DUF5914 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026912.1 protein_id gnl|my_center|LOCUS_22940 83973 83659 gene locus_tag LOCUS_22950 83973 83659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 84051 84073 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 86335 84803 gene locus_tag LOCUS_22960 gene crtI 86335 84803 CDS product phytoene desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026910.1 protein_id gnl|my_center|LOCUS_22960 86858 86568 gene locus_tag LOCUS_22970 86858 86568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 87165 87070 gene locus_tag LOCUS_t00240 87165 87070 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 87379 87404 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 87468 88013 gene locus_tag LOCUS_22980 87468 88013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22980 88010 88759 gene locus_tag LOCUS_22990 88010 88759 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026914.1 protein_id gnl|my_center|LOCUS_22990 88756 90354 gene locus_tag LOCUS_23000 88756 90354 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225919.1 protein_id gnl|my_center|LOCUS_23000 90463 91332 gene locus_tag LOCUS_23010 90463 91332 CDS product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405636.1 protein_id gnl|my_center|LOCUS_23010 91451 91885 gene locus_tag LOCUS_23020 91451 91885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020639415.1 protein_id gnl|my_center|LOCUS_23020 92603 91932 gene locus_tag LOCUS_23030 92603 91932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 94595 92631 gene locus_tag LOCUS_23040 94595 92631 CDS product RiPP maturation radical SAM C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084777.1 protein_id gnl|my_center|LOCUS_23040 94818 94696 gene locus_tag LOCUS_23050 94818 94696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 96758 94902 gene locus_tag LOCUS_23060 96758 94902 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_142567766.1 protein_id gnl|my_center|LOCUS_23060 98157 96751 gene locus_tag LOCUS_23070 98157 96751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 99420 98509 gene locus_tag LOCUS_23080 99420 98509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 100187 99858 gene locus_tag LOCUS_23090 100187 99858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030669.1 protein_id gnl|my_center|LOCUS_23090 100230 100262 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 101799 100303 gene locus_tag LOCUS_23100 101799 100303 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221981.1 protein_id gnl|my_center|LOCUS_23100 101933 102934 gene locus_tag LOCUS_23110 101933 102934 CDS product DUF5937 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284397.1 protein_id gnl|my_center|LOCUS_23110 103013 103798 gene locus_tag LOCUS_23120 103013 103798 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227110.1 protein_id gnl|my_center|LOCUS_23120 105176 103764 gene locus_tag LOCUS_23130 105176 103764 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403984.1 protein_id gnl|my_center|LOCUS_23130 105395 105886 gene locus_tag LOCUS_23140 105395 105886 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223809.1 protein_id gnl|my_center|LOCUS_23140 105970 106587 gene locus_tag LOCUS_23150 105970 106587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150 107227 106790 gene locus_tag LOCUS_23160 107227 106790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 107211 107540 gene locus_tag LOCUS_23170 107211 107540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 107656 107949 gene locus_tag LOCUS_23180 107656 107949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 107936 108169 gene locus_tag LOCUS_23190 107936 108169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 110402 108186 gene locus_tag LOCUS_23200 110402 108186 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229633.1 protein_id gnl|my_center|LOCUS_23200 110504 111163 gene locus_tag LOCUS_23210 110504 111163 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965307.1 protein_id gnl|my_center|LOCUS_23210 111160 111921 gene locus_tag LOCUS_23220 111160 111921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 112911 111940 gene locus_tag LOCUS_23230 112911 111940 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027243.1 protein_id gnl|my_center|LOCUS_23230 113196 113504 gene locus_tag LOCUS_23240 113196 113504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23240 113996 113553 gene locus_tag LOCUS_23250 113996 113553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 114405 114103 gene locus_tag LOCUS_23260 114405 114103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 114563 116038 gene locus_tag LOCUS_23270 114563 116038 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027415.1 protein_id gnl|my_center|LOCUS_23270 116614 116183 gene locus_tag LOCUS_23280 116614 116183 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225300.1 protein_id gnl|my_center|LOCUS_23280 116732 117301 gene locus_tag LOCUS_23290 116732 117301 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731396.1 protein_id gnl|my_center|LOCUS_23290 117592 120321 gene locus_tag LOCUS_23300 117592 120321 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836868.1 protein_id gnl|my_center|LOCUS_23300 120318 121985 gene locus_tag LOCUS_23310 120318 121985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 121970 123055 gene locus_tag LOCUS_23320 121970 123055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 123052 124041 gene locus_tag LOCUS_23330 123052 124041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 124057 125100 gene locus_tag LOCUS_23340 124057 125100 CDS product ScbA/BarX family gamma-butyrolactone biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190059139.1 protein_id gnl|my_center|LOCUS_23340 125097 126005 gene locus_tag LOCUS_23350 125097 126005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 126002 126655 gene locus_tag LOCUS_23360 126002 126655 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222235.1 protein_id gnl|my_center|LOCUS_23360 126782 127126 gene locus_tag LOCUS_23370 126782 127126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 127877 127233 gene locus_tag LOCUS_23380 127877 127233 CDS product ScbR family autoregulator-binding transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039544.1 protein_id gnl|my_center|LOCUS_23380 128626 127994 gene locus_tag LOCUS_23390 128626 127994 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039548.1 protein_id gnl|my_center|LOCUS_23390 128890 130053 gene locus_tag LOCUS_23400 128890 130053 CDS product ScbA/BarX family gamma-butyrolactone biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062723274.1 protein_id gnl|my_center|LOCUS_23400 130050 131195 gene locus_tag LOCUS_23410 130050 131195 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161700479.1 protein_id gnl|my_center|LOCUS_23410 131383 132177 gene locus_tag LOCUS_23420 131383 132177 CDS product HAD-IB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051901260.1 protein_id gnl|my_center|LOCUS_23420 132235 132966 gene locus_tag LOCUS_23430 132235 132966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 132927 132951 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 132980 133279 gene locus_tag LOCUS_23440 132980 133279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_23440 133437 134714 gene locus_tag LOCUS_23450 133437 134714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 134880 135449 gene locus_tag LOCUS_23460 134880 135449 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479987.1 protein_id gnl|my_center|LOCUS_23460 136314 135619 gene locus_tag LOCUS_23470 136314 135619 CDS product TetR/AcrR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971520.1 protein_id gnl|my_center|LOCUS_23470 136417 137793 gene locus_tag LOCUS_23480 136417 137793 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408499.1 protein_id gnl|my_center|LOCUS_23480 139040 138000 gene locus_tag LOCUS_23490 139040 138000 CDS product clavaminate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028519.1 protein_id gnl|my_center|LOCUS_23490 140185 139046 gene locus_tag LOCUS_23500 140185 139046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 141225 140182 gene locus_tag LOCUS_23510 gene asd 141225 140182 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000414849.1 protein_id gnl|my_center|LOCUS_23510 142283 141222 gene locus_tag LOCUS_23520 142283 141222 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529130.1 protein_id gnl|my_center|LOCUS_23520 141913 141933 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 143292 142348 gene locus_tag LOCUS_23530 143292 142348 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087218.1 protein_id gnl|my_center|LOCUS_23530 144665 143289 gene locus_tag LOCUS_23540 144665 143289 CDS product methylaspartate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226582.1 protein_id gnl|my_center|LOCUS_23540 145156 144695 gene locus_tag LOCUS_23550 145156 144695 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226581.1 protein_id gnl|my_center|LOCUS_23550 146171 145272 gene locus_tag LOCUS_23560 146171 145272 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963352.1 protein_id gnl|my_center|LOCUS_23560 146897 146406 gene locus_tag LOCUS_23570 146897 146406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 147063 147434 gene locus_tag LOCUS_23580 147063 147434 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016728.1 protein_id gnl|my_center|LOCUS_23580 147837 147454 gene locus_tag LOCUS_23590 147837 147454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23590 148115 148582 gene locus_tag LOCUS_23600 148115 148582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 149652 148684 gene locus_tag LOCUS_23610 149652 148684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23610 149993 149649 gene locus_tag LOCUS_23620 149993 149649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23620 150779 150093 gene locus_tag LOCUS_23630 150779 150093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 150808 153138 gene locus_tag LOCUS_23640 150808 153138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 150815 150845 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 154464 153121 gene locus_tag LOCUS_23650 154464 153121 CDS product FAD-binding monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228608.1 protein_id gnl|my_center|LOCUS_23650 154738 154517 gene locus_tag LOCUS_23660 154738 154517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 155915 154722 gene locus_tag LOCUS_23670 155915 154722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23670 156289 155912 gene locus_tag LOCUS_23680 156289 155912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 156322 156347 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 157777 156770 gene locus_tag LOCUS_23690 157777 156770 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977764.1 protein_id gnl|my_center|LOCUS_23690 157929 158315 gene locus_tag LOCUS_23700 157929 158315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 158009 158036 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 159507 158299 gene locus_tag LOCUS_23710 159507 158299 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046247588.1 protein_id gnl|my_center|LOCUS_23710 161081 159504 gene locus_tag LOCUS_23720 161081 159504 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027406.1 protein_id gnl|my_center|LOCUS_23720 161219 161596 gene locus_tag LOCUS_23730 161219 161596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 161593 162024 gene locus_tag LOCUS_23740 161593 162024 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229349.1 protein_id gnl|my_center|LOCUS_23740 162301 162441 gene locus_tag LOCUS_23750 162301 162441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 163054 162503 gene locus_tag LOCUS_23760 163054 162503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 164374 163139 gene locus_tag LOCUS_23770 164374 163139 CDS product epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726720.1 protein_id gnl|my_center|LOCUS_23770 165037 164486 gene locus_tag LOCUS_23780 165037 164486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23780 166927 165299 gene locus_tag LOCUS_23790 166927 165299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 166513 166543 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 167061 167411 gene locus_tag LOCUS_23800 167061 167411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111477.1 protein_id gnl|my_center|LOCUS_23800 168350 167463 gene locus_tag LOCUS_23810 168350 167463 CDS product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226056.1 protein_id gnl|my_center|LOCUS_23810 168465 169289 gene locus_tag LOCUS_23820 168465 169289 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227458.1 protein_id gnl|my_center|LOCUS_23820 170658 169399 gene locus_tag LOCUS_23830 170658 169399 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029191.1 protein_id gnl|my_center|LOCUS_23830 171939 170971 gene locus_tag LOCUS_23840 171939 170971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 172327 172097 gene locus_tag LOCUS_23850 172327 172097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23850 172438 172470 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 172830 174365 gene locus_tag LOCUS_23860 172830 174365 CDS product glycosyl hydrolase family 18 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030596.1 protein_id gnl|my_center|LOCUS_23860 173900 173920 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 174875 174507 gene locus_tag LOCUS_23870 174875 174507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 175435 174866 gene locus_tag LOCUS_23880 175435 174866 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031671.1 protein_id gnl|my_center|LOCUS_23880 175925 175467 gene locus_tag LOCUS_23890 175925 175467 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031523.1 protein_id gnl|my_center|LOCUS_23890 176344 177072 gene locus_tag LOCUS_23900 176344 177072 CDS product lytic polysaccharide monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031524.1 protein_id gnl|my_center|LOCUS_23900 178051 177395 gene locus_tag LOCUS_23910 178051 177395 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974101.1 protein_id gnl|my_center|LOCUS_23910 178123 179511 gene locus_tag LOCUS_23920 178123 179511 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029917.1 protein_id gnl|my_center|LOCUS_23920 179942 182785 gene locus_tag LOCUS_23930 179942 182785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 183521 182895 gene locus_tag LOCUS_23940 183521 182895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030751.1 protein_id gnl|my_center|LOCUS_23940 183861 183658 gene locus_tag LOCUS_23950 183861 183658 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975194.1 protein_id gnl|my_center|LOCUS_23950 184078 184920 gene locus_tag LOCUS_23960 184078 184920 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776954.1 protein_id gnl|my_center|LOCUS_23960 185728 185749 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 185752 186381 gene locus_tag LOCUS_23970 185752 186381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 186378 187601 gene locus_tag LOCUS_23980 186378 187601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 188189 187824 gene locus_tag LOCUS_23990 188189 187824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23990 188313 188340 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 188425 189186 gene locus_tag LOCUS_24000 188425 189186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 189295 191379 gene locus_tag LOCUS_24010 189295 191379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 191927 193642 gene locus_tag LOCUS_24020 191927 193642 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486658.1 protein_id gnl|my_center|LOCUS_24020 193761 194096 gene locus_tag LOCUS_24030 193761 194096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24030 197493 194161 gene locus_tag LOCUS_24040 197493 194161 CDS product pyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112417.1 protein_id gnl|my_center|LOCUS_24040 198497 197490 gene locus_tag LOCUS_24050 198497 197490 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766899.1 protein_id gnl|my_center|LOCUS_24050 200256 198574 gene locus_tag LOCUS_24060 200256 198574 CDS product SMI1/KNR4 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031791.1 protein_id gnl|my_center|LOCUS_24060 200939 200292 gene locus_tag LOCUS_24070 200939 200292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 201047 201628 gene locus_tag LOCUS_24080 201047 201628 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031718.1 protein_id gnl|my_center|LOCUS_24080 201642 202190 gene locus_tag LOCUS_24090 201642 202190 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031717.1 protein_id gnl|my_center|LOCUS_24090 203446 202211 gene locus_tag LOCUS_24100 203446 202211 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296732.1 protein_id gnl|my_center|LOCUS_24100 203605 203787 gene locus_tag LOCUS_24110 203605 203787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24110 203891 204265 gene locus_tag LOCUS_24120 203891 204265 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971536.1 protein_id gnl|my_center|LOCUS_24120 205419 204220 gene locus_tag LOCUS_24130 205419 204220 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223896.1 protein_id gnl|my_center|LOCUS_24130 206063 205458 gene locus_tag LOCUS_24140 206063 205458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 206211 206594 gene locus_tag LOCUS_24150 206211 206594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 206549 206983 gene locus_tag LOCUS_24160 206549 206983 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730705.1 protein_id gnl|my_center|LOCUS_24160 207745 207050 gene locus_tag LOCUS_24170 207745 207050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 208240 208455 gene locus_tag LOCUS_24180 208240 208455 CDS product DUF4177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223931.1 protein_id gnl|my_center|LOCUS_24180 212120 208542 gene locus_tag LOCUS_24190 212120 208542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 212702 212274 gene locus_tag LOCUS_24200 212702 212274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24200 214078 213248 gene locus_tag LOCUS_24210 214078 213248 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027137.1 protein_id gnl|my_center|LOCUS_24210 214784 214248 gene locus_tag LOCUS_24220 214784 214248 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971687.1 protein_id gnl|my_center|LOCUS_24220 214928 216163 gene locus_tag LOCUS_24230 214928 216163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24230 216594 217571 gene locus_tag LOCUS_24240 216594 217571 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249899.1 protein_id gnl|my_center|LOCUS_24240 218529 217675 gene locus_tag LOCUS_24250 218529 217675 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028933.1 protein_id gnl|my_center|LOCUS_24250 218655 220181 gene locus_tag LOCUS_24260 218655 220181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055616012.1 protein_id gnl|my_center|LOCUS_24260 220283 221620 gene locus_tag LOCUS_24270 220283 221620 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031724.1 protein_id gnl|my_center|LOCUS_24270 222864 221647 gene locus_tag LOCUS_24280 222864 221647 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027238.1 protein_id gnl|my_center|LOCUS_24280 223084 223536 gene locus_tag LOCUS_24290 223084 223536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 224631 223540 gene locus_tag LOCUS_24300 224631 223540 CDS product Ku protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027236.1 protein_id gnl|my_center|LOCUS_24300 224898 225845 gene locus_tag LOCUS_24310 224898 225845 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223295.1 protein_id gnl|my_center|LOCUS_24310 225842 226243 gene locus_tag LOCUS_24320 225842 226243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24320 226150 227331 gene locus_tag LOCUS_24330 226150 227331 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223296.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24330 226196 226230 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 227336 230134 gene locus_tag LOCUS_24340 227336 230134 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223297.1 protein_id gnl|my_center|LOCUS_24340 230182 230868 gene locus_tag LOCUS_24350 230182 230868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 230307 230330 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 230911 233562 gene locus_tag LOCUS_24360 gene ppsA 230911 233562 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201372230.1 protein_id gnl|my_center|LOCUS_24360 233293 233316 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 233677 235134 gene locus_tag LOCUS_24370 233677 235134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027710.1 protein_id gnl|my_center|LOCUS_24370 235221 236492 gene locus_tag LOCUS_24380 235221 236492 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977524.1 protein_id gnl|my_center|LOCUS_24380 236489 237904 gene locus_tag LOCUS_24390 236489 237904 CDS product VWA-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162495330.1 protein_id gnl|my_center|LOCUS_24390 236723 236746 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 238632 237937 gene locus_tag LOCUS_24400 238632 237937 CDS product TetR/AcrR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225212.1 protein_id gnl|my_center|LOCUS_24400 238854 239465 gene locus_tag LOCUS_24410 238854 239465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 239485 240285 gene locus_tag LOCUS_24420 239485 240285 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899260.1 protein_id gnl|my_center|LOCUS_24420 240558 241559 gene locus_tag LOCUS_24430 240558 241559 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228234.1 protein_id gnl|my_center|LOCUS_24430 242698 241586 gene locus_tag LOCUS_24440 242698 241586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24440 243363 242695 gene locus_tag LOCUS_24450 243363 242695 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228133.1 protein_id gnl|my_center|LOCUS_24450 243650 244867 gene locus_tag LOCUS_24460 243650 244867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 247419 244921 gene locus_tag LOCUS_24470 247419 244921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24470 248800 247427 gene locus_tag LOCUS_24480 248800 247427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24480 247472 247493 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 249350 248985 gene locus_tag LOCUS_24490 249350 248985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24490 249295 249621 gene locus_tag LOCUS_24500 249295 249621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24500 249825 250544 gene locus_tag LOCUS_24510 249825 250544 CDS product endo alpha-1,4 polygalactosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027189.1 protein_id gnl|my_center|LOCUS_24510 251552 250590 gene locus_tag LOCUS_24520 251552 250590 CDS product aldo/keto reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776829.1 protein_id gnl|my_center|LOCUS_24520 251571 251596 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 252177 251731 gene locus_tag LOCUS_24530 252177 251731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 252814 252275 gene locus_tag LOCUS_24540 252814 252275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 253312 252830 gene locus_tag LOCUS_24550 253312 252830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 253774 253436 gene locus_tag LOCUS_24560 253774 253436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 254566 253988 gene locus_tag LOCUS_24570 254566 253988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 255181 254843 gene locus_tag LOCUS_24580 255181 254843 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029168.1 protein_id gnl|my_center|LOCUS_24580 256479 255181 gene locus_tag LOCUS_24590 256479 255181 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029167.1 protein_id gnl|my_center|LOCUS_24590 257279 256476 gene locus_tag LOCUS_24600 257279 256476 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091316930.1 protein_id gnl|my_center|LOCUS_24600 257326 257353 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 257459 258841 gene locus_tag LOCUS_24610 257459 258841 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027384.1 protein_id gnl|my_center|LOCUS_24610 259393 258887 gene locus_tag LOCUS_24620 259393 258887 CDS product tryptophan-rich sensory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036969.1 protein_id gnl|my_center|LOCUS_24620 259879 259424 gene locus_tag LOCUS_24630 259879 259424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027385.1 protein_id gnl|my_center|LOCUS_24630 260554 259946 gene locus_tag LOCUS_24640 260554 259946 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230001.1 protein_id gnl|my_center|LOCUS_24640 262081 260564 gene locus_tag LOCUS_24650 262081 260564 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030862091.1 protein_id gnl|my_center|LOCUS_24650 262271 262669 gene locus_tag LOCUS_24660 262271 262669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 263391 264359 gene locus_tag LOCUS_24670 gene dcyD 263391 264359 CDS product D-cysteine desulfhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365903.1 protein_id gnl|my_center|LOCUS_24670 264799 264446 gene locus_tag LOCUS_24680 264799 264446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24680 266039 264954 gene locus_tag LOCUS_24690 266039 264954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 265996 266256 gene locus_tag LOCUS_24700 265996 266256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 267099 266353 gene locus_tag LOCUS_24710 267099 266353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24710 267775 268872 gene locus_tag LOCUS_24720 267775 268872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 268280 268306 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 269012 269044 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 269154 271097 gene locus_tag LOCUS_24730 269154 271097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 271444 271881 gene locus_tag LOCUS_24740 271444 271881 CDS product protease inhibitor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978099.1 protein_id gnl|my_center|LOCUS_24740 272331 273137 gene locus_tag LOCUS_24750 272331 273137 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921271.1 protein_id gnl|my_center|LOCUS_24750 273482 274201 gene locus_tag LOCUS_24760 273482 274201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24760 274225 275367 gene locus_tag LOCUS_24770 274225 275367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 275323 275357 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 275381 276703 gene locus_tag LOCUS_24780 275381 276703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 277206 277532 gene locus_tag LOCUS_24790 277206 277532 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974275.1 protein_id gnl|my_center|LOCUS_24790 278015 277608 gene locus_tag LOCUS_24800 278015 277608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 278172 278005 gene locus_tag LOCUS_24810 278172 278005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 278243 278279 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 278495 278902 gene locus_tag LOCUS_24820 278495 278902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 279291 280685 gene locus_tag LOCUS_24830 279291 280685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24830 281808 280816 gene locus_tag LOCUS_24840 281808 280816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 280938 280964 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 282939 281821 gene locus_tag LOCUS_24850 282939 281821 CDS product phosphatidylinositol-specific phospholipase C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230297.1 protein_id gnl|my_center|LOCUS_24850 284281 283025 gene locus_tag LOCUS_24860 284281 283025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24860 284386 285555 gene locus_tag LOCUS_24870 284386 285555 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005059698.1 protein_id gnl|my_center|LOCUS_24870 288130 285611 gene locus_tag LOCUS_24880 288130 285611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24880 289293 288127 gene locus_tag LOCUS_24890 289293 288127 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263739.1 protein_id gnl|my_center|LOCUS_24890 290426 289290 gene locus_tag LOCUS_24900 290426 289290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 291712 290423 gene locus_tag LOCUS_24910 291712 290423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 292971 291709 gene locus_tag LOCUS_24920 292971 291709 CDS product phenylacetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878570.1 protein_id gnl|my_center|LOCUS_24920 293417 295018 gene locus_tag LOCUS_24930 293417 295018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 295332 295793 gene locus_tag LOCUS_24940 295332 295793 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226161.1 protein_id gnl|my_center|LOCUS_24940 297679 295814 gene locus_tag LOCUS_24950 297679 295814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 296447 296471 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 298467 299603 gene locus_tag LOCUS_24960 298467 299603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24960 299940 299722 gene locus_tag LOCUS_24970 299940 299722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 300512 300060 gene locus_tag LOCUS_24980 300512 300060 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227042.1 protein_id gnl|my_center|LOCUS_24980 300855 301592 gene locus_tag LOCUS_24990 300855 301592 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225375.1 protein_id gnl|my_center|LOCUS_24990 302381 301878 gene locus_tag LOCUS_25000 302381 301878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25000 302734 302904 gene locus_tag LOCUS_25010 302734 302904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972469.1 protein_id gnl|my_center|LOCUS_25010 303369 303145 gene locus_tag LOCUS_25020 303369 303145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020 303515 303542 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 304047 304340 gene locus_tag LOCUS_25030 304047 304340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25030 305191 304433 gene locus_tag LOCUS_25040 305191 304433 CDS product TipAS antibiotic-recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230943.1 protein_id gnl|my_center|LOCUS_25040 306269 305340 gene locus_tag LOCUS_25050 306269 305340 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027182.1 protein_id gnl|my_center|LOCUS_25050 306346 306801 gene locus_tag LOCUS_25060 306346 306801 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027181.1 protein_id gnl|my_center|LOCUS_25060 307003 308532 gene locus_tag LOCUS_25070 307003 308532 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020644771.1 protein_id gnl|my_center|LOCUS_25070 309058 308471 gene locus_tag LOCUS_25080 309058 308471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 310258 309173 gene locus_tag LOCUS_25090 310258 309173 CDS product DUF5937 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028949.1 protein_id gnl|my_center|LOCUS_25090 310358 311674 gene locus_tag LOCUS_25100 310358 311674 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226215.1 protein_id gnl|my_center|LOCUS_25100 312014 311778 gene locus_tag LOCUS_25110 312014 311778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25110 312378 312172 gene locus_tag LOCUS_25120 312378 312172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25120 312453 312641 gene locus_tag LOCUS_25130 312453 312641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25130 313278 312847 gene locus_tag LOCUS_25140 313278 312847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25140 315864 313555 gene locus_tag LOCUS_25150 315864 313555 CDS product glycosyl hydrolase family 18 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030560.1 protein_id gnl|my_center|LOCUS_25150 317864 316302 gene locus_tag LOCUS_25160 317864 316302 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181592.1 protein_id gnl|my_center|LOCUS_25160 318303 319160 gene locus_tag LOCUS_25170 318303 319160 CDS product oxaloacetate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814441.1 protein_id gnl|my_center|LOCUS_25170 319175 319423 gene locus_tag LOCUS_25180 319175 319423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 319924 319622 gene locus_tag LOCUS_25190 319924 319622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25190 319820 320068 gene locus_tag LOCUS_25200 319820 320068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25200 320646 320056 gene locus_tag LOCUS_25210 320646 320056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25210 321266 320658 gene locus_tag LOCUS_25220 321266 320658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25220 321838 321275 gene locus_tag LOCUS_25230 321838 321275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25230 329986 321869 gene locus_tag LOCUS_25240 329986 321869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 329536 329565 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 331152 330229 gene locus_tag LOCUS_25250 331152 330229 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486386.1 protein_id gnl|my_center|LOCUS_25250 331265 331690 gene locus_tag LOCUS_25260 331265 331690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25260 332194 331808 gene locus_tag LOCUS_25270 332194 331808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25270 332487 332191 gene locus_tag LOCUS_25280 332487 332191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25280 332655 332852 gene locus_tag LOCUS_25290 332655 332852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 333481 333011 gene locus_tag LOCUS_25300 333481 333011 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975419.1 protein_id gnl|my_center|LOCUS_25300 333048 333071 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 333590 334549 gene locus_tag LOCUS_25310 333590 334549 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106518184.1 protein_id gnl|my_center|LOCUS_25310 334902 335159 gene locus_tag LOCUS_25320 334902 335159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25320 336173 335214 gene locus_tag LOCUS_25330 336173 335214 CDS product redoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005088757.1 protein_id gnl|my_center|LOCUS_25330 336547 336281 gene locus_tag LOCUS_25340 336547 336281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25340 337960 336755 gene locus_tag LOCUS_25350 337960 336755 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977624.1 protein_id gnl|my_center|LOCUS_25350 338958 337960 gene locus_tag LOCUS_25360 338958 337960 CDS product DUF1259 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901513.1 protein_id gnl|my_center|LOCUS_25360 339601 339095 gene locus_tag LOCUS_25370 339601 339095 CDS product DUF1772 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028548.1 protein_id gnl|my_center|LOCUS_25370 339776 340762 gene locus_tag LOCUS_25380 339776 340762 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485415.1 protein_id gnl|my_center|LOCUS_25380 340876 341793 gene locus_tag LOCUS_25390 340876 341793 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228428.1 protein_id gnl|my_center|LOCUS_25390 342599 341892 gene locus_tag LOCUS_25400 342599 341892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25400 343059 343559 gene locus_tag LOCUS_25410 343059 343559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25410 343569 343919 gene locus_tag LOCUS_25420 343569 343919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 343916 344194 gene locus_tag LOCUS_25430 343916 344194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25430 344398 345558 gene locus_tag LOCUS_25440 344398 345558 CDS product spore photoproduct lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971741.1 protein_id gnl|my_center|LOCUS_25440 346174 345644 gene locus_tag LOCUS_25450 346174 345644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25450 347837 346263 gene locus_tag LOCUS_25460 347837 346263 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135359439.1 protein_id gnl|my_center|LOCUS_25460 348040 348062 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 349300 348071 gene locus_tag LOCUS_25470 349300 348071 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110188.1 protein_id gnl|my_center|LOCUS_25470 349692 350255 gene locus_tag LOCUS_25480 349692 350255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 350437 351009 gene locus_tag LOCUS_25490 350437 351009 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486994.1 protein_id gnl|my_center|LOCUS_25490 351736 351077 gene locus_tag LOCUS_25500 351736 351077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 351890 352384 gene locus_tag LOCUS_25510 351890 352384 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974608.1 protein_id gnl|my_center|LOCUS_25510 352381 352848 gene locus_tag LOCUS_25520 352381 352848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974607.1 protein_id gnl|my_center|LOCUS_25520 353078 352878 gene locus_tag LOCUS_25530 353078 352878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25530 353004 353789 gene locus_tag LOCUS_25540 353004 353789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 353825 354103 gene locus_tag LOCUS_25550 353825 354103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25550 355384 354170 gene locus_tag LOCUS_25560 355384 354170 CDS product glycoside hydrolase family 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905400.1 protein_id gnl|my_center|LOCUS_25560 355866 356693 gene locus_tag LOCUS_25570 355866 356693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25570 356713 359238 gene locus_tag LOCUS_25580 356713 359238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25580 359377 360621 gene locus_tag LOCUS_25590 359377 360621 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975925.1 protein_id gnl|my_center|LOCUS_25590 361447 360626 gene locus_tag LOCUS_25600 361447 360626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225794.1 protein_id gnl|my_center|LOCUS_25600 362333 361473 gene locus_tag LOCUS_25610 362333 361473 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230706.1 protein_id gnl|my_center|LOCUS_25610 362465 363187 gene locus_tag LOCUS_25620 362465 363187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 363892 363227 gene locus_tag LOCUS_25630 363892 363227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25630 365184 363889 gene locus_tag LOCUS_25640 365184 363889 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228999.1 protein_id gnl|my_center|LOCUS_25640 365373 366131 gene locus_tag LOCUS_25650 365373 366131 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090547.1 protein_id gnl|my_center|LOCUS_25650 366128 366916 gene locus_tag LOCUS_25660 366128 366916 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090548.1 protein_id gnl|my_center|LOCUS_25660 366922 367803 gene locus_tag LOCUS_25670 366922 367803 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090549.1 protein_id gnl|my_center|LOCUS_25670 367800 368927 gene locus_tag LOCUS_25680 367800 368927 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069456654.1 protein_id gnl|my_center|LOCUS_25680 368924 370210 gene locus_tag LOCUS_25690 368924 370210 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921556.1 protein_id gnl|my_center|LOCUS_25690 371113 370304 gene locus_tag LOCUS_25700 371113 370304 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966527.1 protein_id gnl|my_center|LOCUS_25700 371753 371106 gene locus_tag LOCUS_25710 371753 371106 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731343.1 protein_id gnl|my_center|LOCUS_25710 371900 373072 gene locus_tag LOCUS_25720 371900 373072 CDS product PucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015171.1 protein_id gnl|my_center|LOCUS_25720 373195 373554 gene locus_tag LOCUS_25730 373195 373554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 373345 373369 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 373478 375652 gene locus_tag LOCUS_25740 373478 375652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25740 377371 375755 gene locus_tag LOCUS_25750 377371 375755 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977000.1 protein_id gnl|my_center|LOCUS_25750 377778 377368 gene locus_tag LOCUS_25760 377778 377368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 378183 377917 gene locus_tag LOCUS_25770 378183 377917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 378660 378211 gene locus_tag LOCUS_25780 378660 378211 CDS product DUF1772 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030667.1 protein_id gnl|my_center|LOCUS_25780 378751 379329 gene locus_tag LOCUS_25790 378751 379329 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030666.1 protein_id gnl|my_center|LOCUS_25790 379572 379868 gene locus_tag LOCUS_25800 379572 379868 CDS product zinc-ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029116.1 protein_id gnl|my_center|LOCUS_25800 380077 380727 gene locus_tag LOCUS_25810 380077 380727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 380936 381790 gene locus_tag LOCUS_25820 380936 381790 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977140.1 protein_id gnl|my_center|LOCUS_25820 383276 381846 gene locus_tag LOCUS_25830 383276 381846 CDS product Ni/Fe hydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895383.1 protein_id gnl|my_center|LOCUS_25830 383111 383134 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 384064 383273 gene locus_tag LOCUS_25840 384064 383273 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895384.1 protein_id gnl|my_center|LOCUS_25840 384872 384066 gene locus_tag LOCUS_25850 384872 384066 CDS product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174519602.1 protein_id gnl|my_center|LOCUS_25850 385342 384869 gene locus_tag LOCUS_25860 385342 384869 CDS product cyclic nucleotide-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030862045.1 protein_id gnl|my_center|LOCUS_25860 386508 385339 gene locus_tag LOCUS_25870 386508 385339 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042510581.1 protein_id gnl|my_center|LOCUS_25870 387173 386604 gene locus_tag LOCUS_25880 387173 386604 CDS product hydrogenase maturation protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895382.1 protein_id gnl|my_center|LOCUS_25880 388839 387247 gene locus_tag LOCUS_25890 388839 387247 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026894.1 protein_id gnl|my_center|LOCUS_25890 389740 388832 gene locus_tag LOCUS_25900 389740 388832 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978666.1 protein_id gnl|my_center|LOCUS_25900 389962 390489 gene locus_tag LOCUS_25910 389962 390489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25910 390796 393639 gene locus_tag LOCUS_25920 390796 393639 CDS product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061075.1 protein_id gnl|my_center|LOCUS_25920 393636 394295 gene locus_tag LOCUS_25930 393636 394295 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973145.1 protein_id gnl|my_center|LOCUS_25930 394292 394948 gene locus_tag LOCUS_25940 394292 394948 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973146.1 protein_id gnl|my_center|LOCUS_25940 395211 396080 gene locus_tag LOCUS_25950 395211 396080 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026921.1 protein_id gnl|my_center|LOCUS_25950 397184 396132 gene locus_tag LOCUS_25960 397184 396132 CDS product class I fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868908.1 protein_id gnl|my_center|LOCUS_25960 397295 398248 gene locus_tag LOCUS_25970 397295 398248 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030866806.1 protein_id gnl|my_center|LOCUS_25970 399307 398282 gene locus_tag LOCUS_25980 399307 398282 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976696.1 protein_id gnl|my_center|LOCUS_25980 399667 400260 gene locus_tag LOCUS_25990 399667 400260 CDS product HdeD family acid-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029402.1 protein_id gnl|my_center|LOCUS_25990 400331 401212 gene locus_tag LOCUS_26000 400331 401212 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978666.1 protein_id gnl|my_center|LOCUS_26000 401696 401430 gene locus_tag LOCUS_26010 401696 401430 CDS product DUF1876 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408522.1 protein_id gnl|my_center|LOCUS_26010 402124 401714 gene locus_tag LOCUS_26020 402124 401714 CDS product DUF302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026896.1 protein_id gnl|my_center|LOCUS_26020 402732 402145 gene locus_tag LOCUS_26030 402732 402145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026904.1 protein_id gnl|my_center|LOCUS_26030 402290 402319 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 403356 402901 gene locus_tag LOCUS_26040 403356 402901 CDS product cyclic nucleotide-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030862045.1 protein_id gnl|my_center|LOCUS_26040 403732 404310 gene locus_tag LOCUS_26050 403732 404310 CDS product fasciclin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030872.1 protein_id gnl|my_center|LOCUS_26050 404672 404702 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 404868 406382 gene locus_tag LOCUS_26060 404868 406382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26060 406781 407164 gene locus_tag LOCUS_26070 406781 407164 CDS product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978701.1 protein_id gnl|my_center|LOCUS_26070 409146 407365 gene locus_tag LOCUS_26080 409146 407365 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257843.1 protein_id gnl|my_center|LOCUS_26080 407568 407722 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 410227 409148 gene locus_tag LOCUS_26090 410227 409148 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209606051.1 protein_id gnl|my_center|LOCUS_26090 411249 410224 gene locus_tag LOCUS_26100 gene pdhA 411249 410224 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943082.1 protein_id gnl|my_center|LOCUS_26100 413084 411246 gene locus_tag LOCUS_26110 gene acsA 413084 411246 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399030.1 protein_id gnl|my_center|LOCUS_26110 413374 413174 gene locus_tag LOCUS_26120 413374 413174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26120 413608 414234 gene locus_tag LOCUS_26130 413608 414234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26130 414792 414334 gene locus_tag LOCUS_26140 414792 414334 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396390.1 protein_id gnl|my_center|LOCUS_26140 415695 414817 gene locus_tag LOCUS_26150 415695 414817 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227298.1 protein_id gnl|my_center|LOCUS_26150 416071 415679 gene locus_tag LOCUS_26160 416071 415679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26160 416464 416865 gene locus_tag LOCUS_26170 416464 416865 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895387.1 protein_id gnl|my_center|LOCUS_26170 416938 418041 gene locus_tag LOCUS_26180 416938 418041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26180 418045 419577 gene locus_tag LOCUS_26190 418045 419577 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533079.1 protein_id gnl|my_center|LOCUS_26190 419800 419588 gene locus_tag LOCUS_26200 419800 419588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26200 419748 420230 gene locus_tag LOCUS_26210 419748 420230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26210 420700 422070 gene locus_tag LOCUS_26220 420700 422070 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976921.1 protein_id gnl|my_center|LOCUS_26220 422156 423118 gene locus_tag LOCUS_26230 422156 423118 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976920.1 protein_id gnl|my_center|LOCUS_26230 423115 424011 gene locus_tag LOCUS_26240 423115 424011 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028038.1 protein_id gnl|my_center|LOCUS_26240 424226 425260 gene locus_tag LOCUS_26250 424226 425260 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729196.1 protein_id gnl|my_center|LOCUS_26250 425472 426281 gene locus_tag LOCUS_26260 425472 426281 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222653.1 protein_id gnl|my_center|LOCUS_26260 426281 427048 gene locus_tag LOCUS_26270 426281 427048 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027577.1 protein_id gnl|my_center|LOCUS_26270 426854 426880 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 428908 427256 gene locus_tag LOCUS_26280 428908 427256 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972134.1 protein_id gnl|my_center|LOCUS_26280 429795 428962 gene locus_tag LOCUS_26290 429795 428962 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013847.1 protein_id gnl|my_center|LOCUS_26290 430721 429792 gene locus_tag LOCUS_26300 430721 429792 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013848.1 protein_id gnl|my_center|LOCUS_26300 432166 430868 gene locus_tag LOCUS_26310 432166 430868 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013850.1 protein_id gnl|my_center|LOCUS_26310 432517 433539 gene locus_tag LOCUS_26320 432517 433539 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054086.1 protein_id gnl|my_center|LOCUS_26320 >Feature sequence006 66 746 gene locus_tag LOCUS_26330 66 746 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030865145.1 protein_id gnl|my_center|LOCUS_26330 788 863 gene locus_tag LOCUS_t00250 788 863 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1132 914 gene locus_tag LOCUS_26340 1132 914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26340 3564 1030 gene locus_tag LOCUS_26350 3564 1030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26350 1577 1599 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4045 9591 gene locus_tag LOCUS_26360 4045 9591 CDS product HAMP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030433.1 protein_id gnl|my_center|LOCUS_26360 9884 10564 gene locus_tag LOCUS_26370 9884 10564 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030434.1 protein_id gnl|my_center|LOCUS_26370 10739 13531 gene locus_tag LOCUS_26380 10739 13531 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973274.1 protein_id gnl|my_center|LOCUS_26380 13856 14704 gene locus_tag LOCUS_26390 13856 14704 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973273.1 protein_id gnl|my_center|LOCUS_26390 14881 14908 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 14929 16296 gene locus_tag LOCUS_26400 gene rimO 14929 16296 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973272.1 protein_id gnl|my_center|LOCUS_26400 16293 17243 gene locus_tag LOCUS_26410 16293 17243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26410 17240 17803 gene locus_tag LOCUS_26420 17240 17803 CDS product CinA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030436.1 protein_id gnl|my_center|LOCUS_26420 17913 18287 gene locus_tag LOCUS_26430 17913 18287 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973269.1 protein_id gnl|my_center|LOCUS_26430 18521 19072 gene locus_tag LOCUS_26440 18521 19072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26440 19784 19020 gene locus_tag LOCUS_26450 19784 19020 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389019.1 protein_id gnl|my_center|LOCUS_26450 20662 19817 gene locus_tag LOCUS_26460 20662 19817 CDS product Fpg/Nei family DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030437.1 protein_id gnl|my_center|LOCUS_26460 25943 20988 gene locus_tag LOCUS_26470 25943 20988 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030438.1 protein_id gnl|my_center|LOCUS_26470 26053 27072 gene locus_tag LOCUS_26480 26053 27072 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115566.1 protein_id gnl|my_center|LOCUS_26480 27081 27779 gene locus_tag LOCUS_26490 27081 27779 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973261.1 protein_id gnl|my_center|LOCUS_26490 27776 28084 gene locus_tag LOCUS_26500 27776 28084 CDS product AzlD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973260.1 protein_id gnl|my_center|LOCUS_26500 28262 28515 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 28779 28805 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 29221 29415 gene locus_tag LOCUS_26510 29221 29415 CDS product DUF3046 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973258.1 protein_id gnl|my_center|LOCUS_26510 29457 30779 gene locus_tag LOCUS_26520 29457 30779 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030441.1 protein_id gnl|my_center|LOCUS_26520 31742 30795 gene locus_tag LOCUS_26530 31742 30795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26530 31914 33032 gene locus_tag LOCUS_26540 gene recA 31914 33032 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030442.1 protein_id gnl|my_center|LOCUS_26540 33035 34087 gene locus_tag LOCUS_26550 33035 34087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 34537 34139 gene locus_tag LOCUS_26560 34537 34139 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973252.1 protein_id gnl|my_center|LOCUS_26560 34926 34534 gene locus_tag LOCUS_26570 34926 34534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26570 34820 35227 gene locus_tag LOCUS_26580 34820 35227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26580 35178 35204 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 37068 35446 gene locus_tag LOCUS_26590 37068 35446 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030445.1 protein_id gnl|my_center|LOCUS_26590 38104 37223 gene locus_tag LOCUS_26600 38104 37223 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030446.1 protein_id gnl|my_center|LOCUS_26600 38766 38101 gene locus_tag LOCUS_26610 38766 38101 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973248.1 protein_id gnl|my_center|LOCUS_26610 39677 38844 gene locus_tag LOCUS_26620 39677 38844 CDS product glutamate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030447.1 protein_id gnl|my_center|LOCUS_26620 40557 39781 gene locus_tag LOCUS_26630 40557 39781 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973246.1 protein_id gnl|my_center|LOCUS_26630 40877 40554 gene locus_tag LOCUS_26640 40877 40554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26640 40845 41537 gene locus_tag LOCUS_26650 40845 41537 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973245.1 protein_id gnl|my_center|LOCUS_26650 41553 42971 gene locus_tag LOCUS_26660 41553 42971 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224238.1 protein_id gnl|my_center|LOCUS_26660 44053 43055 gene locus_tag LOCUS_26670 44053 43055 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030449.1 protein_id gnl|my_center|LOCUS_26670 44184 44600 gene locus_tag LOCUS_26680 44184 44600 CDS product MazG nucleotide pyrophosphohydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046247567.1 protein_id gnl|my_center|LOCUS_26680 45829 44606 gene locus_tag LOCUS_26690 45829 44606 CDS product glycosyltransferase family 87 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486603.1 protein_id gnl|my_center|LOCUS_26690 45782 45703 gene locus_tag LOCUS_t00260 45782 45703 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 45995 50722 gene locus_tag LOCUS_26700 45995 50722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26700 50910 52358 gene locus_tag LOCUS_26710 gene miaB 50910 52358 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030453.1 protein_id gnl|my_center|LOCUS_26710 52450 53202 gene locus_tag LOCUS_26720 52450 53202 CDS product class III extradiol dioxygenase subunit B-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030454.1 protein_id gnl|my_center|LOCUS_26720 53581 53288 gene locus_tag LOCUS_26730 53581 53288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26730 53948 53604 gene locus_tag LOCUS_26740 53948 53604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26740 54132 55070 gene locus_tag LOCUS_26750 gene miaA 54132 55070 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030456.1 protein_id gnl|my_center|LOCUS_26750 55178 55795 gene locus_tag LOCUS_26760 55178 55795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327425.1 protein_id gnl|my_center|LOCUS_26760 55891 56760 gene locus_tag LOCUS_26770 gene dapF 55891 56760 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030458.1 protein_id gnl|my_center|LOCUS_26770 57061 59280 gene locus_tag LOCUS_26780 57061 59280 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030459.1 protein_id gnl|my_center|LOCUS_26780 58739 58771 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 59469 60953 gene locus_tag LOCUS_26790 59469 60953 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030460.1 protein_id gnl|my_center|LOCUS_26790 61077 62567 gene locus_tag LOCUS_26800 gene hflX 61077 62567 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030461.1 protein_id gnl|my_center|LOCUS_26800 63892 62654 gene locus_tag LOCUS_26810 63892 62654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973224.1 protein_id gnl|my_center|LOCUS_26810 64227 65651 gene locus_tag LOCUS_26820 64227 65651 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011319592.1 protein_id gnl|my_center|LOCUS_26820 65702 67627 gene locus_tag LOCUS_26830 65702 67627 CDS product IucA/IucC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485565.1 protein_id gnl|my_center|LOCUS_26830 67651 68565 gene locus_tag LOCUS_26840 67651 68565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26840 68645 70630 gene locus_tag LOCUS_26850 68645 70630 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030465.1 protein_id gnl|my_center|LOCUS_26850 72089 71310 gene locus_tag LOCUS_26860 gene lexA 72089 71310 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030466.1 protein_id gnl|my_center|LOCUS_26860 72831 72502 gene locus_tag LOCUS_26870 72831 72502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26870 72806 73258 gene locus_tag LOCUS_26880 72806 73258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26880 73421 76315 gene locus_tag LOCUS_26890 73421 76315 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030467.1 protein_id gnl|my_center|LOCUS_26890 76966 76433 gene locus_tag LOCUS_26900 76966 76433 CDS product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030468.1 protein_id gnl|my_center|LOCUS_26900 77123 77728 gene locus_tag LOCUS_26910 77123 77728 CDS product YdbC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973215.1 protein_id gnl|my_center|LOCUS_26910 77853 78521 gene locus_tag LOCUS_26920 77853 78521 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973214.1 protein_id gnl|my_center|LOCUS_26920 78525 79439 gene locus_tag LOCUS_26930 78525 79439 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973213.1 protein_id gnl|my_center|LOCUS_26930 81123 79570 gene locus_tag LOCUS_26940 81123 79570 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030470.1 protein_id gnl|my_center|LOCUS_26940 81329 81952 gene locus_tag LOCUS_26950 81329 81952 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406104.1 protein_id gnl|my_center|LOCUS_26950 82036 82737 gene locus_tag LOCUS_26960 82036 82737 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030471.1 protein_id gnl|my_center|LOCUS_26960 82806 83447 gene locus_tag LOCUS_26970 82806 83447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030472.1 protein_id gnl|my_center|LOCUS_26970 84554 83976 gene locus_tag LOCUS_26980 84554 83976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973208.1 protein_id gnl|my_center|LOCUS_26980 84577 84608 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 87101 84858 gene locus_tag LOCUS_26990 87101 84858 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030473.1 protein_id gnl|my_center|LOCUS_26990 85191 85221 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 87232 88776 gene locus_tag LOCUS_27000 87232 88776 CDS product DUF4192 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030474.1 protein_id gnl|my_center|LOCUS_27000 88971 91091 gene locus_tag LOCUS_27010 88971 91091 CDS product glycogen debranching N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730677.1 protein_id gnl|my_center|LOCUS_27010 91142 91163 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 91244 92002 gene locus_tag LOCUS_27020 91244 92002 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973205.1 protein_id gnl|my_center|LOCUS_27020 92055 94148 gene locus_tag LOCUS_27030 92055 94148 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485553.1 protein_id gnl|my_center|LOCUS_27030 94311 95198 gene locus_tag LOCUS_27040 gene whiH 94311 95198 CDS product sporulation transcriptional regulator WhiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030477.1 protein_id gnl|my_center|LOCUS_27040 95730 95509 gene locus_tag LOCUS_27050 95730 95509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27050 95672 97216 gene locus_tag LOCUS_27060 95672 97216 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973202.1 protein_id gnl|my_center|LOCUS_27060 97338 98195 gene locus_tag LOCUS_27070 97338 98195 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973201.1 protein_id gnl|my_center|LOCUS_27070 98550 98320 gene locus_tag LOCUS_27080 98550 98320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805039.1 protein_id gnl|my_center|LOCUS_27080 98991 101135 gene locus_tag LOCUS_27090 98991 101135 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973199.1 protein_id gnl|my_center|LOCUS_27090 100086 100106 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 101323 101847 gene locus_tag LOCUS_27100 101323 101847 CDS product DUF1453 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030478.1 protein_id gnl|my_center|LOCUS_27100 101844 102995 gene locus_tag LOCUS_27110 101844 102995 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030479.1 protein_id gnl|my_center|LOCUS_27110 102992 103675 gene locus_tag LOCUS_27120 102992 103675 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030480.1 protein_id gnl|my_center|LOCUS_27120 103796 104302 gene locus_tag LOCUS_27130 103796 104302 CDS product DUF485 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030481.1 protein_id gnl|my_center|LOCUS_27130 104299 105915 gene locus_tag LOCUS_27140 104299 105915 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030482.1 protein_id gnl|my_center|LOCUS_27140 105706 105729 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 106636 105944 gene locus_tag LOCUS_27150 106636 105944 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030483.1 protein_id gnl|my_center|LOCUS_27150 106798 107613 gene locus_tag LOCUS_27160 106798 107613 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222207.1 protein_id gnl|my_center|LOCUS_27160 107603 108466 gene locus_tag LOCUS_27170 107603 108466 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201276.1 protein_id gnl|my_center|LOCUS_27170 108579 109640 gene locus_tag LOCUS_27180 108579 109640 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532456.1 protein_id gnl|my_center|LOCUS_27180 110375 109695 gene locus_tag LOCUS_27190 110375 109695 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030483.1 protein_id gnl|my_center|LOCUS_27190 111979 110372 gene locus_tag LOCUS_27200 111979 110372 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191850856.1 protein_id gnl|my_center|LOCUS_27200 112000 112021 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 113095 112196 gene locus_tag LOCUS_27210 113095 112196 CDS product sucrase ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030485.1 protein_id gnl|my_center|LOCUS_27210 114526 113231 gene locus_tag LOCUS_27220 114526 113231 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973190.1 protein_id gnl|my_center|LOCUS_27220 114168 114200 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 114632 115798 gene locus_tag LOCUS_27230 114632 115798 CDS product citrate synthase/methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973189.1 protein_id gnl|my_center|LOCUS_27230 116105 115869 gene locus_tag LOCUS_27240 116105 115869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973188.1 protein_id gnl|my_center|LOCUS_27240 116909 116403 gene locus_tag LOCUS_27250 116909 116403 CDS product DUF6082 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485539.1 protein_id gnl|my_center|LOCUS_27250 117300 118412 gene locus_tag LOCUS_27260 117300 118412 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030486.1 protein_id gnl|my_center|LOCUS_27260 120992 118536 gene locus_tag LOCUS_27270 120992 118536 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030487.1 protein_id gnl|my_center|LOCUS_27270 121337 122710 gene locus_tag LOCUS_27280 121337 122710 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973184.1 protein_id gnl|my_center|LOCUS_27280 122707 124119 gene locus_tag LOCUS_27290 122707 124119 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030488.1 protein_id gnl|my_center|LOCUS_27290 123893 123916 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 124533 125291 gene locus_tag LOCUS_27300 124533 125291 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030489.1 protein_id gnl|my_center|LOCUS_27300 125488 126186 gene locus_tag LOCUS_27310 125488 126186 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030490.1 protein_id gnl|my_center|LOCUS_27310 126718 126437 gene locus_tag LOCUS_27320 126718 126437 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973180.1 protein_id gnl|my_center|LOCUS_27320 126924 129806 gene locus_tag LOCUS_27330 126924 129806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27330 129913 130500 gene locus_tag LOCUS_27340 129913 130500 CDS product DUF5998 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030492.1 protein_id gnl|my_center|LOCUS_27340 130500 131690 gene locus_tag LOCUS_27350 130500 131690 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030493.1 protein_id gnl|my_center|LOCUS_27350 131790 132440 gene locus_tag LOCUS_27360 131790 132440 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973175.1 protein_id gnl|my_center|LOCUS_27360 133257 132454 gene locus_tag LOCUS_27370 133257 132454 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973167.1 protein_id gnl|my_center|LOCUS_27370 133568 133416 gene locus_tag LOCUS_27380 133568 133416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27380 133555 134406 gene locus_tag LOCUS_27390 133555 134406 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030499.1 protein_id gnl|my_center|LOCUS_27390 135557 134532 gene locus_tag LOCUS_27400 gene sepH 135557 134532 CDS product septation protein SepH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973165.1 protein_id gnl|my_center|LOCUS_27400 136402 136208 gene locus_tag LOCUS_27410 136402 136208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27410 136825 136406 gene locus_tag LOCUS_27420 136825 136406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27420 138111 136906 gene locus_tag LOCUS_27430 138111 136906 CDS product D-arabinono-1,4-lactone oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030501.1 protein_id gnl|my_center|LOCUS_27430 139423 138185 gene locus_tag LOCUS_27440 139423 138185 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973162.1 protein_id gnl|my_center|LOCUS_27440 139550 140677 gene locus_tag LOCUS_27450 139550 140677 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973161.1 protein_id gnl|my_center|LOCUS_27450 140686 141501 gene locus_tag LOCUS_27460 140686 141501 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153505920.1 protein_id gnl|my_center|LOCUS_27460 141943 141770 gene locus_tag LOCUS_27470 141943 141770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27470 142375 143028 gene locus_tag LOCUS_27480 142375 143028 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003993508.1 protein_id gnl|my_center|LOCUS_27480 143035 143355 gene locus_tag LOCUS_27490 143035 143355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27490 143263 143288 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 143352 144293 gene locus_tag LOCUS_27500 143352 144293 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973157.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27500 144697 144993 gene locus_tag LOCUS_27510 144697 144993 CDS product DUF4193 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003993510.1 protein_id gnl|my_center|LOCUS_27510 145007 145972 gene locus_tag LOCUS_27520 145007 145972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030505.1 protein_id gnl|my_center|LOCUS_27520 146490 146014 gene locus_tag LOCUS_27530 146490 146014 CDS product DUF3093 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973155.1 protein_id gnl|my_center|LOCUS_27530 146590 147132 gene locus_tag LOCUS_27540 146590 147132 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030506.1 protein_id gnl|my_center|LOCUS_27540 147129 147716 gene locus_tag LOCUS_27550 gene dut 147129 147716 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973153.1 protein_id gnl|my_center|LOCUS_27550 147718 148479 gene locus_tag LOCUS_27560 147718 148479 CDS product DUF3710 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973152.1 protein_id gnl|my_center|LOCUS_27560 148638 149330 gene locus_tag LOCUS_27570 148638 149330 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973151.1 protein_id gnl|my_center|LOCUS_27570 149472 152042 gene locus_tag LOCUS_27580 149472 152042 CDS product sensor histidine kinase KdpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030507.1 protein_id gnl|my_center|LOCUS_27580 152039 152725 gene locus_tag LOCUS_27590 152039 152725 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973149.1 protein_id gnl|my_center|LOCUS_27590 152799 153167 gene locus_tag LOCUS_27600 152799 153167 CDS product OB-fold nucleic acid binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327459.1 protein_id gnl|my_center|LOCUS_27600 153171 153971 gene locus_tag LOCUS_27610 153171 153971 CDS product DUF3159 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973147.1 protein_id gnl|my_center|LOCUS_27610 153689 153718 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 154741 154064 gene locus_tag LOCUS_27620 154741 154064 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973146.1 protein_id gnl|my_center|LOCUS_27620 155412 154741 gene locus_tag LOCUS_27630 155412 154741 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973145.1 protein_id gnl|my_center|LOCUS_27630 155822 157879 gene locus_tag LOCUS_27640 155822 157879 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973119.1 protein_id gnl|my_center|LOCUS_27640 157995 159365 gene locus_tag LOCUS_27650 157995 159365 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030522.1 protein_id gnl|my_center|LOCUS_27650 160189 159569 gene locus_tag LOCUS_27660 160189 159569 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262042.1 protein_id gnl|my_center|LOCUS_27660 160425 161114 gene locus_tag LOCUS_27670 160425 161114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27670 162572 161127 gene locus_tag LOCUS_27680 162572 161127 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027086.1 protein_id gnl|my_center|LOCUS_27680 163039 162476 gene locus_tag LOCUS_27690 163039 162476 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027085.1 protein_id gnl|my_center|LOCUS_27690 164334 163036 gene locus_tag LOCUS_27700 164334 163036 CDS product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030862504.1 protein_id gnl|my_center|LOCUS_27700 165278 164331 gene locus_tag LOCUS_27710 165278 164331 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027083.1 protein_id gnl|my_center|LOCUS_27710 166600 165275 gene locus_tag LOCUS_27720 166600 165275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978468.1 protein_id gnl|my_center|LOCUS_27720 167880 166606 gene locus_tag LOCUS_27730 167880 166606 CDS product DUF4910 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027082.1 protein_id gnl|my_center|LOCUS_27730 168902 167877 gene locus_tag LOCUS_27740 168902 167877 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978470.1 protein_id gnl|my_center|LOCUS_27740 169553 168906 gene locus_tag LOCUS_27750 169553 168906 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978471.1 protein_id gnl|my_center|LOCUS_27750 170344 169550 gene locus_tag LOCUS_27760 170344 169550 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978472.1 protein_id gnl|my_center|LOCUS_27760 171576 170341 gene locus_tag LOCUS_27770 171576 170341 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027081.1 protein_id gnl|my_center|LOCUS_27770 172808 171573 gene locus_tag LOCUS_27780 172808 171573 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027080.1 protein_id gnl|my_center|LOCUS_27780 174082 172811 gene locus_tag LOCUS_27790 174082 172811 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027079.1 protein_id gnl|my_center|LOCUS_27790 175475 174084 gene locus_tag LOCUS_27800 175475 174084 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027078.1 protein_id gnl|my_center|LOCUS_27800 174343 174369 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 175360 175761 gene locus_tag LOCUS_27810 175360 175761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27810 175394 175420 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 177636 175687 gene locus_tag LOCUS_27820 177636 175687 CDS product alginate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484340.1 protein_id gnl|my_center|LOCUS_27820 179825 177633 gene locus_tag LOCUS_27830 179825 177633 CDS product bi-domain-containing oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030862490.1 protein_id gnl|my_center|LOCUS_27830 181819 179867 gene locus_tag LOCUS_27840 gene asnB 181819 179867 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027075.1 protein_id gnl|my_center|LOCUS_27840 180285 180308 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 182095 181823 gene locus_tag LOCUS_27850 182095 181823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27850 183366 182011 gene locus_tag LOCUS_27860 183366 182011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27860 182240 182262 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 184766 183369 gene locus_tag LOCUS_27870 184766 183369 CDS product Wzz/FepE/Etk N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484338.1 protein_id gnl|my_center|LOCUS_27870 186027 184756 gene locus_tag LOCUS_27880 186027 184756 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484336.1 protein_id gnl|my_center|LOCUS_27880 187354 186017 gene locus_tag LOCUS_27890 187354 186017 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027071.1 protein_id gnl|my_center|LOCUS_27890 187233 187253 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 188900 187425 gene locus_tag LOCUS_27900 188900 187425 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978484.1 protein_id gnl|my_center|LOCUS_27900 189780 189400 gene locus_tag LOCUS_27910 189780 189400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27910 190855 189932 gene locus_tag LOCUS_27920 190855 189932 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898125.1 protein_id gnl|my_center|LOCUS_27920 192090 190852 gene locus_tag LOCUS_27930 192090 190852 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246304.1 protein_id gnl|my_center|LOCUS_27930 194705 192339 gene locus_tag LOCUS_27940 194705 192339 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030729.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27940 194665 194931 gene locus_tag LOCUS_27950 194665 194931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27950 194782 194806 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 194968 195264 gene locus_tag LOCUS_27960 194968 195264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27960 197249 195399 gene locus_tag LOCUS_27970 197249 195399 CDS product putative Ig domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226374.1 protein_id gnl|my_center|LOCUS_27970 199909 197393 gene locus_tag LOCUS_27980 199909 197393 CDS product M4 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034286347.1 protein_id gnl|my_center|LOCUS_27980 200939 200127 gene locus_tag LOCUS_27990 200939 200127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27990 201108 201497 gene locus_tag LOCUS_28000 201108 201497 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030864086.1 protein_id gnl|my_center|LOCUS_28000 201604 202800 gene locus_tag LOCUS_28010 201604 202800 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973054.1 protein_id gnl|my_center|LOCUS_28010 202797 203294 gene locus_tag LOCUS_28020 202797 203294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28020 203122 203155 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 203355 203825 gene locus_tag LOCUS_28030 203355 203825 CDS product DUF6099 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030573.1 protein_id gnl|my_center|LOCUS_28030 204392 203802 gene locus_tag LOCUS_28040 204392 203802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28040 204320 204340 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 204613 206088 gene locus_tag LOCUS_28050 204613 206088 CDS product 3' terminal RNA ribose 2'-O-methyltransferase Hen1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485480.1 protein_id gnl|my_center|LOCUS_28050 206085 208643 gene locus_tag LOCUS_28060 206085 208643 CDS product polynucleotide kinase-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030575.1 protein_id gnl|my_center|LOCUS_28060 209669 208770 gene locus_tag LOCUS_28070 209669 208770 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226431.1 protein_id gnl|my_center|LOCUS_28070 210796 209666 gene locus_tag LOCUS_28080 210796 209666 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226432.1 protein_id gnl|my_center|LOCUS_28080 210946 212175 gene locus_tag LOCUS_28090 210946 212175 CDS product arginine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973047.1 protein_id gnl|my_center|LOCUS_28090 212316 213323 gene locus_tag LOCUS_28100 gene argF 212316 213323 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030578.1 protein_id gnl|my_center|LOCUS_28100 213439 214938 gene locus_tag LOCUS_28110 213439 214938 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973044.1 protein_id gnl|my_center|LOCUS_28110 215272 214898 gene locus_tag LOCUS_28120 215272 214898 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973043.1 protein_id gnl|my_center|LOCUS_28120 215244 215564 gene locus_tag LOCUS_28130 215244 215564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28130 215296 215320 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 215763 216590 gene locus_tag LOCUS_28140 215763 216590 CDS product enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973042.1 protein_id gnl|my_center|LOCUS_28140 216598 218895 gene locus_tag LOCUS_28150 216598 218895 CDS product bifunctional salicylyl-CoA 5-hydroxylase/oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030579.1 protein_id gnl|my_center|LOCUS_28150 216961 216990 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 219759 218938 gene locus_tag LOCUS_28160 219759 218938 CDS product PaaX family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030580.1 protein_id gnl|my_center|LOCUS_28160 221457 219775 gene locus_tag LOCUS_28170 gene ambL 221457 219775 CDS product aminobenozate:CoA ligase AmbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485583.1 protein_id gnl|my_center|LOCUS_28170 221597 222733 gene locus_tag LOCUS_28180 221597 222733 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973037.1 protein_id gnl|my_center|LOCUS_28180 222771 223169 gene locus_tag LOCUS_28190 222771 223169 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973036.1 protein_id gnl|my_center|LOCUS_28190 223215 223249 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 223793 223326 gene locus_tag LOCUS_28200 223793 223326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28200 223948 224994 gene locus_tag LOCUS_28210 223948 224994 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487139.1 protein_id gnl|my_center|LOCUS_28210 226498 225080 gene locus_tag LOCUS_28220 226498 225080 CDS product 3-deoxy-7-phosphoheptulonate synthase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976701.1 protein_id gnl|my_center|LOCUS_28220 226710 228308 gene locus_tag LOCUS_28230 226710 228308 CDS product aromatic amino acid ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005396014.1 protein_id gnl|my_center|LOCUS_28230 228407 229840 gene locus_tag LOCUS_28240 228407 229840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28240 229916 230902 gene locus_tag LOCUS_28250 229916 230902 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224557.1 protein_id gnl|my_center|LOCUS_28250 230929 232221 gene locus_tag LOCUS_28260 230929 232221 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000421211.1 protein_id gnl|my_center|LOCUS_28260 232222 232689 gene locus_tag LOCUS_28270 232222 232689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28270 232787 234613 gene locus_tag LOCUS_28280 gene asnB 232787 234613 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392813.1 protein_id gnl|my_center|LOCUS_28280 234803 235996 gene locus_tag LOCUS_28290 234803 235996 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027959.1 protein_id gnl|my_center|LOCUS_28290 236167 236502 gene locus_tag LOCUS_28300 236167 236502 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001259894.1 protein_id gnl|my_center|LOCUS_28300 237472 236552 gene locus_tag LOCUS_28310 237472 236552 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728421.1 protein_id gnl|my_center|LOCUS_28310 237777 238217 gene locus_tag LOCUS_28320 237777 238217 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223693.1 protein_id gnl|my_center|LOCUS_28320 238293 238829 gene locus_tag LOCUS_28330 238293 238829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222815.1 protein_id gnl|my_center|LOCUS_28330 239009 239043 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 239086 240063 gene locus_tag LOCUS_28340 239086 240063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28340 241744 240215 gene locus_tag LOCUS_28350 241744 240215 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972925.1 protein_id gnl|my_center|LOCUS_28350 242160 244883 gene locus_tag LOCUS_28360 gene acnA 242160 244883 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972923.1 protein_id gnl|my_center|LOCUS_28360 245399 245689 gene locus_tag LOCUS_28370 245399 245689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28370 246077 245625 gene locus_tag LOCUS_28380 246077 245625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972920.1 protein_id gnl|my_center|LOCUS_28380 247009 246122 gene locus_tag LOCUS_28390 247009 246122 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972919.1 protein_id gnl|my_center|LOCUS_28390 246924 246950 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 247847 251134 gene locus_tag LOCUS_28400 247847 251134 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222888.1 protein_id gnl|my_center|LOCUS_28400 255013 251210 gene locus_tag LOCUS_28410 255013 251210 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226484.1 protein_id gnl|my_center|LOCUS_28410 255480 256940 gene locus_tag LOCUS_28420 gene ngcE 255480 256940 CDS product N-acetylglucosamine/diacetylchitobiose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776381.1 protein_id gnl|my_center|LOCUS_28420 257135 258070 gene locus_tag LOCUS_28430 257135 258070 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776380.1 protein_id gnl|my_center|LOCUS_28430 258086 259021 gene locus_tag LOCUS_28440 258086 259021 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776379.1 protein_id gnl|my_center|LOCUS_28440 259243 260442 gene locus_tag LOCUS_28450 259243 260442 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972914.1 protein_id gnl|my_center|LOCUS_28450 260613 261680 gene locus_tag LOCUS_28460 260613 261680 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972913.1 protein_id gnl|my_center|LOCUS_28460 261967 261614 gene locus_tag LOCUS_28470 261967 261614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28470 261878 262660 gene locus_tag LOCUS_28480 261878 262660 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972912.1 protein_id gnl|my_center|LOCUS_28480 262657 263949 gene locus_tag LOCUS_28490 262657 263949 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972911.1 protein_id gnl|my_center|LOCUS_28490 264180 266108 gene locus_tag LOCUS_28500 gene dxs 264180 266108 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972908.1 protein_id gnl|my_center|LOCUS_28500 266289 267803 gene locus_tag LOCUS_28510 266289 267803 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972907.1 protein_id gnl|my_center|LOCUS_28510 267813 267834 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 268231 267857 gene locus_tag LOCUS_28520 268231 267857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030597.1 protein_id gnl|my_center|LOCUS_28520 269238 268273 gene locus_tag LOCUS_28530 269238 268273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228831.1 protein_id gnl|my_center|LOCUS_28530 269259 270476 gene locus_tag LOCUS_28540 269259 270476 CDS product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223416.1 protein_id gnl|my_center|LOCUS_28540 270796 270823 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 270850 273060 gene locus_tag LOCUS_28550 270850 273060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28550 273067 274779 gene locus_tag LOCUS_28560 273067 274779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28560 274776 275258 gene locus_tag LOCUS_28570 gene pgsC 274776 275258 CDS product poly-gamma-glutamate biosynthesis protein PgsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943109.1 protein_id gnl|my_center|LOCUS_28570 275293 276354 gene locus_tag LOCUS_28580 275293 276354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28580 276452 277468 gene locus_tag LOCUS_28590 276452 277468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030598.1 protein_id gnl|my_center|LOCUS_28590 278588 277488 gene locus_tag LOCUS_28600 278588 277488 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972903.1 protein_id gnl|my_center|LOCUS_28600 280940 278811 gene locus_tag LOCUS_28610 280940 278811 CDS product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030602.1 protein_id gnl|my_center|LOCUS_28610 282157 280937 gene locus_tag LOCUS_28620 282157 280937 CDS product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030603.1 protein_id gnl|my_center|LOCUS_28620 283889 282690 gene locus_tag LOCUS_28630 283889 282690 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972895.1 protein_id gnl|my_center|LOCUS_28630 284854 284192 gene locus_tag LOCUS_28640 284854 284192 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972894.1 protein_id gnl|my_center|LOCUS_28640 285852 285220 gene locus_tag LOCUS_28650 285852 285220 CDS product DUF3000 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030605.1 protein_id gnl|my_center|LOCUS_28650 286020 287090 gene locus_tag LOCUS_28660 gene hemE 286020 287090 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972892.1 protein_id gnl|my_center|LOCUS_28660 287954 287130 gene locus_tag LOCUS_28670 287954 287130 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270259.1 protein_id gnl|my_center|LOCUS_28670 288149 288448 gene locus_tag LOCUS_28680 288149 288448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28680 289916 288498 gene locus_tag LOCUS_28690 289916 288498 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030612.1 protein_id gnl|my_center|LOCUS_28690 290992 289949 gene locus_tag LOCUS_28700 290992 289949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28700 291184 292662 gene locus_tag LOCUS_28710 gene hemG 291184 292662 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224513.1 protein_id gnl|my_center|LOCUS_28710 292667 293398 gene locus_tag LOCUS_28720 292667 293398 CDS product chlorite dismutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972879.1 protein_id gnl|my_center|LOCUS_28720 295032 293434 gene locus_tag LOCUS_28730 295032 293434 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485448.1 protein_id gnl|my_center|LOCUS_28730 296085 295237 gene locus_tag LOCUS_28740 296085 295237 CDS product TIGR04222 domain-containing membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972877.1 protein_id gnl|my_center|LOCUS_28740 296931 296146 gene locus_tag LOCUS_28750 296931 296146 CDS product DUF4142 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027588.1 protein_id gnl|my_center|LOCUS_28750 298609 297227 gene locus_tag LOCUS_28760 298609 297227 CDS product DUF692 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030615.1 protein_id gnl|my_center|LOCUS_28760 299563 298808 gene locus_tag LOCUS_28770 299563 298808 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030616.1 protein_id gnl|my_center|LOCUS_28770 299756 299571 gene locus_tag LOCUS_28780 299756 299571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972872.1 protein_id gnl|my_center|LOCUS_28780 300648 299776 gene locus_tag LOCUS_28790 300648 299776 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030618.1 protein_id gnl|my_center|LOCUS_28790 301654 300728 gene locus_tag LOCUS_28800 301654 300728 CDS product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972868.1 protein_id gnl|my_center|LOCUS_28800 302320 301742 gene locus_tag LOCUS_28810 302320 301742 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972866.1 protein_id gnl|my_center|LOCUS_28810 302898 302392 gene locus_tag LOCUS_28820 302898 302392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28820 304128 303016 gene locus_tag LOCUS_28830 gene zapE 304128 303016 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485435.1 protein_id gnl|my_center|LOCUS_28830 304094 304993 gene locus_tag LOCUS_28840 304094 304993 CDS product pyrimidine reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030623.1 protein_id gnl|my_center|LOCUS_28840 305421 305894 gene locus_tag LOCUS_28850 305421 305894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972862.1 protein_id gnl|my_center|LOCUS_28850 305968 307359 gene locus_tag LOCUS_28860 gene murC 305968 307359 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030625.1 protein_id gnl|my_center|LOCUS_28860 307374 307781 gene locus_tag LOCUS_28870 gene msrB 307374 307781 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972860.1 protein_id gnl|my_center|LOCUS_28870 307888 307709 gene locus_tag LOCUS_28880 307888 307709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28880 307923 308291 gene locus_tag LOCUS_28890 307923 308291 CDS product DUF6479 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326645.1 protein_id gnl|my_center|LOCUS_28890 308480 309631 gene locus_tag LOCUS_28900 308480 309631 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972859.1 protein_id gnl|my_center|LOCUS_28900 309628 310350 gene locus_tag LOCUS_28910 309628 310350 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972858.1 protein_id gnl|my_center|LOCUS_28910 310347 311015 gene locus_tag LOCUS_28920 310347 311015 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030627.1 protein_id gnl|my_center|LOCUS_28920 311701 311099 gene locus_tag LOCUS_28930 311701 311099 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230634.1 protein_id gnl|my_center|LOCUS_28930 312104 311688 gene locus_tag LOCUS_28940 312104 311688 CDS product DUF742 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977673.1 protein_id gnl|my_center|LOCUS_28940 312618 312142 gene locus_tag LOCUS_28950 312618 312142 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003061341.1 protein_id gnl|my_center|LOCUS_28950 315566 312615 gene locus_tag LOCUS_28960 315566 312615 CDS product nitrate- and nitrite sensing domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230636.1 protein_id gnl|my_center|LOCUS_28960 315904 316869 gene locus_tag LOCUS_28970 315904 316869 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972856.1 protein_id gnl|my_center|LOCUS_28970 316880 318865 gene locus_tag LOCUS_28980 316880 318865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28980 319358 318903 gene locus_tag LOCUS_28990 319358 318903 CDS product tellurite resistance TerB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975175.1 protein_id gnl|my_center|LOCUS_28990 319541 322561 gene locus_tag LOCUS_29000 gene mgtA 319541 322561 CDS product magnesium-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704210.1 protein_id gnl|my_center|LOCUS_29000 319796 319824 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 322676 322936 gene locus_tag LOCUS_29010 322676 322936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29010 323522 323043 gene locus_tag LOCUS_29020 323522 323043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29020 324192 323527 gene locus_tag LOCUS_29030 324192 323527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29030 324745 325398 gene locus_tag LOCUS_29040 324745 325398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29040 326316 325417 gene locus_tag LOCUS_29050 326316 325417 CDS product lytic polysaccharide monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020942913.1 protein_id gnl|my_center|LOCUS_29050 327198 326422 gene locus_tag LOCUS_29060 327198 326422 CDS product ScbR family autoregulator-binding transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972660.1 protein_id gnl|my_center|LOCUS_29060 327455 328102 gene locus_tag LOCUS_29070 gene cprB 327455 328102 CDS product transcriptional regulator CprB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030630.1 protein_id gnl|my_center|LOCUS_29070 328125 329315 gene locus_tag LOCUS_29080 328125 329315 CDS product damage-control phosphatase ARMT1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485432.1 protein_id gnl|my_center|LOCUS_29080 329402 330745 gene locus_tag LOCUS_29090 329402 330745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29090 330595 330625 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 330648 331595 gene locus_tag LOCUS_29100 330648 331595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29100 331618 332256 gene locus_tag LOCUS_29110 331618 332256 CDS product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485430.1 protein_id gnl|my_center|LOCUS_29110 332768 333895 gene locus_tag LOCUS_29120 332768 333895 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030634.1 protein_id gnl|my_center|LOCUS_29120 333943 334941 gene locus_tag LOCUS_29130 333943 334941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29130 336757 335003 gene locus_tag LOCUS_29140 gene treZ 336757 335003 CDS product malto-oligosyltrehalose trehalohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030636.1 protein_id gnl|my_center|LOCUS_29140 336931 337482 gene locus_tag LOCUS_29150 336931 337482 CDS product DUF1707 and FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030637.1 protein_id gnl|my_center|LOCUS_29150 337679 338986 gene locus_tag LOCUS_29160 337679 338986 CDS product M14 family zinc carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327597.1 protein_id gnl|my_center|LOCUS_29160 339029 339454 gene locus_tag LOCUS_29170 339029 339454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29170 340743 339493 gene locus_tag LOCUS_29180 340743 339493 CDS product M14 family zinc carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486388.1 protein_id gnl|my_center|LOCUS_29180 343398 341038 gene locus_tag LOCUS_29190 gene treY 343398 341038 CDS product malto-oligosyltrehalose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030639.1 protein_id gnl|my_center|LOCUS_29190 345601 343493 gene locus_tag LOCUS_29200 gene glgX 345601 343493 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030640.1 protein_id gnl|my_center|LOCUS_29200 345945 347183 gene locus_tag LOCUS_29210 345945 347183 CDS product SAV2148 family HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030641.1 protein_id gnl|my_center|LOCUS_29210 347290 348012 gene locus_tag LOCUS_29220 347290 348012 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030642.1 protein_id gnl|my_center|LOCUS_29220 348901 348038 gene locus_tag LOCUS_29230 348901 348038 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030643.1 protein_id gnl|my_center|LOCUS_29230 351296 349053 gene locus_tag LOCUS_29240 351296 349053 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030648.1 protein_id gnl|my_center|LOCUS_29240 351719 352294 gene locus_tag LOCUS_29250 351719 352294 CDS product DUF1697 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030649.1 protein_id gnl|my_center|LOCUS_29250 352125 352148 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 353204 352350 gene locus_tag LOCUS_29260 353204 352350 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228409.1 protein_id gnl|my_center|LOCUS_29260 353243 354262 gene locus_tag LOCUS_29270 353243 354262 CDS product 2-dehydropantoate 2-reductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728687.1 protein_id gnl|my_center|LOCUS_29270 355228 354482 gene locus_tag LOCUS_29280 355228 354482 CDS product sirohydrochlorin chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030650.1 protein_id gnl|my_center|LOCUS_29280 356149 355235 gene locus_tag LOCUS_29290 356149 355235 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030651.1 protein_id gnl|my_center|LOCUS_29290 356921 356136 gene locus_tag LOCUS_29300 356921 356136 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972825.1 protein_id gnl|my_center|LOCUS_29300 358070 356958 gene locus_tag LOCUS_29310 358070 356958 CDS product aliphatic sulfonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030652.1 protein_id gnl|my_center|LOCUS_29310 359672 358383 gene locus_tag LOCUS_29320 359672 358383 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972823.1 protein_id gnl|my_center|LOCUS_29320 358401 358435 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 360619 359675 gene locus_tag LOCUS_29330 gene cysD 360619 359675 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972822.1 protein_id gnl|my_center|LOCUS_29330 361173 360616 gene locus_tag LOCUS_29340 gene cysC 361173 360616 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164276380.1 protein_id gnl|my_center|LOCUS_29340 360726 360746 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 361910 361200 gene locus_tag LOCUS_29350 361910 361200 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972820.1 protein_id gnl|my_center|LOCUS_29350 362092 361907 gene locus_tag LOCUS_29360 362092 361907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972819.1 protein_id gnl|my_center|LOCUS_29360 363783 362089 gene locus_tag LOCUS_29370 gene sirA 363783 362089 CDS product sulfite reductase SirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972818.1 protein_id gnl|my_center|LOCUS_29370 364690 364133 gene locus_tag LOCUS_29380 364690 364133 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030654.1 protein_id gnl|my_center|LOCUS_29380 366137 364779 gene locus_tag LOCUS_29390 366137 364779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972816.1 protein_id gnl|my_center|LOCUS_29390 367687 366398 gene locus_tag LOCUS_29400 367687 366398 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972815.1 protein_id gnl|my_center|LOCUS_29400 369700 368057 gene locus_tag LOCUS_29410 369700 368057 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030655.1 protein_id gnl|my_center|LOCUS_29410 369811 370971 gene locus_tag LOCUS_29420 369811 370971 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972813.1 protein_id gnl|my_center|LOCUS_29420 371051 371743 gene locus_tag LOCUS_29430 371051 371743 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030664.1 protein_id gnl|my_center|LOCUS_29430 372127 371723 gene locus_tag LOCUS_29440 372127 371723 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030668.1 protein_id gnl|my_center|LOCUS_29440 372860 372231 gene locus_tag LOCUS_29450 372860 372231 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223118.1 protein_id gnl|my_center|LOCUS_29450 373859 372915 gene locus_tag LOCUS_29460 373859 372915 CDS product hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227186.1 protein_id gnl|my_center|LOCUS_29460 373864 373897 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 374072 374800 gene locus_tag LOCUS_29470 374072 374800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29470 374718 374740 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 374890 375762 gene locus_tag LOCUS_29480 374890 375762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29480 376766 375792 gene locus_tag LOCUS_29490 gene mmuM 376766 375792 CDS product homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030679.1 protein_id gnl|my_center|LOCUS_29490 376823 377161 gene locus_tag LOCUS_29500 376823 377161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29500 377708 377124 gene locus_tag LOCUS_29510 377708 377124 CDS product TetR-like C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972778.1 protein_id gnl|my_center|LOCUS_29510 378996 377755 gene locus_tag LOCUS_29520 gene aldO 378996 377755 CDS product alditol oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030685.1 protein_id gnl|my_center|LOCUS_29520 379159 379896 gene locus_tag LOCUS_29530 379159 379896 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223636.1 protein_id gnl|my_center|LOCUS_29530 379931 381235 gene locus_tag LOCUS_29540 379931 381235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030686.1 protein_id gnl|my_center|LOCUS_29540 381439 382953 gene locus_tag LOCUS_29550 381439 382953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29550 383100 384659 gene locus_tag LOCUS_29560 383100 384659 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030990.1 protein_id gnl|my_center|LOCUS_29560 385099 385129 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 385157 386068 gene locus_tag LOCUS_29570 385157 386068 CDS product arginine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973047.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29570 386096 387115 gene locus_tag LOCUS_29580 gene argF 386096 387115 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030578.1 protein_id gnl|my_center|LOCUS_29580 387119 388042 gene locus_tag LOCUS_29590 gene arcC 387119 388042 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707754.1 protein_id gnl|my_center|LOCUS_29590 388182 389678 gene locus_tag LOCUS_29600 388182 389678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29600 389232 389265 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 389671 390492 gene locus_tag LOCUS_29610 389671 390492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29610 390498 391322 gene locus_tag LOCUS_29620 gene pflA 390498 391322 CDS product pyruvate formate-lyase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390067.1 protein_id gnl|my_center|LOCUS_29620 391485 393869 gene locus_tag LOCUS_29630 391485 393869 CDS product phosphoketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161269956.1 protein_id gnl|my_center|LOCUS_29630 394001 394639 gene locus_tag LOCUS_29640 394001 394639 CDS product DoxX family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173668689.1 protein_id gnl|my_center|LOCUS_29640 395057 394713 gene locus_tag LOCUS_29650 395057 394713 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975218.1 protein_id gnl|my_center|LOCUS_29650 396874 395051 gene locus_tag LOCUS_29660 396874 395051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29660 395492 395516 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 397092 397784 gene locus_tag LOCUS_29670 397092 397784 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026924.1 protein_id gnl|my_center|LOCUS_29670 >Feature sequence007 300 3821 gene locus_tag LOCUS_29680 300 3821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29680 3870 4154 gene locus_tag LOCUS_29690 3870 4154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29690 4290 4616 gene locus_tag LOCUS_29700 4290 4616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29700 4833 4636 gene locus_tag LOCUS_29710 4833 4636 CDS product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029810.1 protein_id gnl|my_center|LOCUS_29710 5363 4830 gene locus_tag LOCUS_29720 5363 4830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29720 5464 5865 gene locus_tag LOCUS_29730 5464 5865 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029808.1 protein_id gnl|my_center|LOCUS_29730 5913 6815 gene locus_tag LOCUS_29740 gene mshB 5913 6815 CDS product N-acetyl-1-D-myo-inositol-2-amino-2-deoxy-alpha-D-glucopyranoside deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030070.1 protein_id gnl|my_center|LOCUS_29740 6812 7234 gene locus_tag LOCUS_29750 6812 7234 CDS product DUF6113 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030071.1 protein_id gnl|my_center|LOCUS_29750 7394 9670 gene locus_tag LOCUS_29760 7394 9670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030072.1 protein_id gnl|my_center|LOCUS_29760 9843 10772 gene locus_tag LOCUS_29770 9843 10772 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973848.1 protein_id gnl|my_center|LOCUS_29770 10769 11509 gene locus_tag LOCUS_29780 10769 11509 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973847.1 protein_id gnl|my_center|LOCUS_29780 11530 12726 gene locus_tag LOCUS_29790 11530 12726 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030073.1 protein_id gnl|my_center|LOCUS_29790 12723 13337 gene locus_tag LOCUS_29800 12723 13337 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030074.1 protein_id gnl|my_center|LOCUS_29800 14224 13373 gene locus_tag LOCUS_29810 14224 13373 CDS product transglutaminase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030075.1 protein_id gnl|my_center|LOCUS_29810 15298 14255 gene locus_tag LOCUS_29820 15298 14255 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030076.1 protein_id gnl|my_center|LOCUS_29820 15439 15759 gene locus_tag LOCUS_29830 15439 15759 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973842.1 protein_id gnl|my_center|LOCUS_29830 15872 16963 gene locus_tag LOCUS_29840 15872 16963 CDS product bifunctional succinyldiaminopimelate transaminase/glutamate-prephenate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030077.1 protein_id gnl|my_center|LOCUS_29840 17503 17048 gene locus_tag LOCUS_29850 17503 17048 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973840.1 protein_id gnl|my_center|LOCUS_29850 18758 17820 gene locus_tag LOCUS_29860 18758 17820 CDS product heavy metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486364.1 protein_id gnl|my_center|LOCUS_29860 18916 19995 gene locus_tag LOCUS_29870 gene dapE 18916 19995 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030079.1 protein_id gnl|my_center|LOCUS_29870 20112 20870 gene locus_tag LOCUS_29880 20112 20870 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973837.1 protein_id gnl|my_center|LOCUS_29880 21792 20932 gene locus_tag LOCUS_29890 gene folP 21792 20932 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327205.1 protein_id gnl|my_center|LOCUS_29890 21918 22274 gene locus_tag LOCUS_29900 21918 22274 CDS product DivIVA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973835.1 protein_id gnl|my_center|LOCUS_29900 22271 22999 gene locus_tag LOCUS_29910 22271 22999 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973834.1 protein_id gnl|my_center|LOCUS_29910 23821 23018 gene locus_tag LOCUS_29920 23821 23018 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030081.1 protein_id gnl|my_center|LOCUS_29920 24211 24378 gene locus_tag LOCUS_29930 24211 24378 CDS product DUF3117 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003966491.1 protein_id gnl|my_center|LOCUS_29930 24648 24454 gene locus_tag LOCUS_29940 24648 24454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29940 24652 24674 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 25410 26111 gene locus_tag LOCUS_29950 gene sigE 25410 26111 CDS product RNA polymerase sigma factor SigE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973830.1 protein_id gnl|my_center|LOCUS_29950 26108 27103 gene locus_tag LOCUS_29960 26108 27103 CDS product zf-HC2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030084.1 protein_id gnl|my_center|LOCUS_29960 27177 29180 gene locus_tag LOCUS_29970 27177 29180 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093456948.1 protein_id gnl|my_center|LOCUS_29970 29421 29858 gene locus_tag LOCUS_29980 29421 29858 CDS product sec-independent translocase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030086.1 protein_id gnl|my_center|LOCUS_29980 30123 30797 gene locus_tag LOCUS_29990 30123 30797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327210.1 protein_id gnl|my_center|LOCUS_29990 30872 30905 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 32055 30940 gene locus_tag LOCUS_30000 32055 30940 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973825.1 protein_id gnl|my_center|LOCUS_30000 34099 32117 gene locus_tag LOCUS_30010 34099 32117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30010 32802 32830 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 34326 35072 gene locus_tag LOCUS_30020 34326 35072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973822.1 protein_id gnl|my_center|LOCUS_30020 35674 35135 gene locus_tag LOCUS_30030 35674 35135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973821.1 protein_id gnl|my_center|LOCUS_30030 35331 35357 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 36833 35718 gene locus_tag LOCUS_30040 36833 35718 CDS product magnesium and cobalt transport protein CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030090.1 protein_id gnl|my_center|LOCUS_30040 37400 37984 gene locus_tag LOCUS_30050 37400 37984 CDS product suppressor of fused domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030091.1 protein_id gnl|my_center|LOCUS_30050 39151 38015 gene locus_tag LOCUS_30060 39151 38015 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973818.1 protein_id gnl|my_center|LOCUS_30060 39066 39356 gene locus_tag LOCUS_30070 39066 39356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30070 39232 39259 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 39470 40111 gene locus_tag LOCUS_30080 39470 40111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973817.1 protein_id gnl|my_center|LOCUS_30080 40269 41168 gene locus_tag LOCUS_30090 40269 41168 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973816.1 protein_id gnl|my_center|LOCUS_30090 41225 41830 gene locus_tag LOCUS_30100 41225 41830 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973815.1 protein_id gnl|my_center|LOCUS_30100 42071 41919 gene locus_tag LOCUS_30110 42071 41919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007444413.1 protein_id gnl|my_center|LOCUS_30110 42313 43206 gene locus_tag LOCUS_30120 42313 43206 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167469674.1 protein_id gnl|my_center|LOCUS_30120 43983 43231 gene locus_tag LOCUS_30130 43983 43231 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030092.1 protein_id gnl|my_center|LOCUS_30130 43955 44116 gene locus_tag LOCUS_30140 43955 44116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30140 47198 44301 gene locus_tag LOCUS_30150 47198 44301 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030093.1 protein_id gnl|my_center|LOCUS_30150 47375 48130 gene locus_tag LOCUS_30160 47375 48130 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973811.1 protein_id gnl|my_center|LOCUS_30160 48926 48606 gene locus_tag LOCUS_30170 48926 48606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30170 49285 49058 gene locus_tag LOCUS_30180 49285 49058 CDS product DUF3107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_221492514.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_30180 50087 49443 gene locus_tag LOCUS_30190 50087 49443 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973808.1 protein_id gnl|my_center|LOCUS_30190 50512 50294 gene locus_tag LOCUS_30200 50512 50294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973806.1 protein_id gnl|my_center|LOCUS_30200 50720 51754 gene locus_tag LOCUS_30210 50720 51754 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030094.1 protein_id gnl|my_center|LOCUS_30210 51763 53388 gene locus_tag LOCUS_30220 51763 53388 CDS product DUF3152 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030095.1 protein_id gnl|my_center|LOCUS_30220 53597 53896 gene locus_tag LOCUS_30230 53597 53896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30230 54064 55794 gene locus_tag LOCUS_30240 54064 55794 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030096.1 protein_id gnl|my_center|LOCUS_30240 55791 56933 gene locus_tag LOCUS_30250 55791 56933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030867977.1 protein_id gnl|my_center|LOCUS_30250 57241 58203 gene locus_tag LOCUS_30260 57241 58203 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_134112038.1 protein_id gnl|my_center|LOCUS_30260 58191 58970 gene locus_tag LOCUS_30270 58191 58970 CDS product spherulation-specific family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973799.1 protein_id gnl|my_center|LOCUS_30270 58482 58511 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 59034 60212 gene locus_tag LOCUS_30280 gene moeZ 59034 60212 CDS product adenylyltransferase/sulfurtransferase MoeZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973798.1 protein_id gnl|my_center|LOCUS_30280 61837 60284 gene locus_tag LOCUS_30290 61837 60284 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030099.1 protein_id gnl|my_center|LOCUS_30290 63558 62005 gene locus_tag LOCUS_30300 63558 62005 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030100.1 protein_id gnl|my_center|LOCUS_30300 66550 63650 gene locus_tag LOCUS_30310 66550 63650 CDS product lysylphosphatidylglycerol synthase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030101.1 protein_id gnl|my_center|LOCUS_30310 64402 64425 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 64869 64889 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 66592 67122 gene locus_tag LOCUS_30320 66592 67122 CDS product MGMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030102.1 protein_id gnl|my_center|LOCUS_30320 67557 70895 gene locus_tag LOCUS_30330 67557 70895 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030103.1 protein_id gnl|my_center|LOCUS_30330 71020 72162 gene locus_tag LOCUS_30340 71020 72162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30340 72094 72116 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 72162 74633 gene locus_tag LOCUS_30350 72162 74633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30350 74644 76047 gene locus_tag LOCUS_30360 74644 76047 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973791.1 protein_id gnl|my_center|LOCUS_30360 76202 77146 gene locus_tag LOCUS_30370 gene nudC 76202 77146 CDS product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327228.1 protein_id gnl|my_center|LOCUS_30370 77490 77248 gene locus_tag LOCUS_30380 77490 77248 CDS product mycoredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973789.1 protein_id gnl|my_center|LOCUS_30380 77697 79901 gene locus_tag LOCUS_30390 77697 79901 CDS product ATP-dependent DNA helicase UvrD2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173668762.1 protein_id gnl|my_center|LOCUS_30390 80070 80390 gene locus_tag LOCUS_30400 80070 80390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973787.1 protein_id gnl|my_center|LOCUS_30400 80564 80932 gene locus_tag LOCUS_30410 80564 80932 CDS product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973786.1 protein_id gnl|my_center|LOCUS_30410 80929 81252 gene locus_tag LOCUS_30420 80929 81252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30420 81366 81611 gene locus_tag LOCUS_30430 81366 81611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30430 83028 81646 gene locus_tag LOCUS_30440 83028 81646 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030108.1 protein_id gnl|my_center|LOCUS_30440 84250 83021 gene locus_tag LOCUS_30450 84250 83021 CDS product TOMM precursor leader peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486346.1 protein_id gnl|my_center|LOCUS_30450 84506 85102 gene locus_tag LOCUS_30460 84506 85102 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030867997.1 protein_id gnl|my_center|LOCUS_30460 85244 86560 gene locus_tag LOCUS_30470 85244 86560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30470 86416 86444 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 86464 86991 gene locus_tag LOCUS_30480 86464 86991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30480 87004 87684 gene locus_tag LOCUS_30490 87004 87684 CDS product AIM24 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973780.1 protein_id gnl|my_center|LOCUS_30490 87702 88457 gene locus_tag LOCUS_30500 87702 88457 CDS product AIM24 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030111.1 protein_id gnl|my_center|LOCUS_30500 89045 88524 gene locus_tag LOCUS_30510 89045 88524 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973778.1 protein_id gnl|my_center|LOCUS_30510 90502 89042 gene locus_tag LOCUS_30520 90502 89042 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973777.1 protein_id gnl|my_center|LOCUS_30520 90751 91806 gene locus_tag LOCUS_30530 90751 91806 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973776.1 protein_id gnl|my_center|LOCUS_30530 91915 92376 gene locus_tag LOCUS_30540 91915 92376 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973775.1 protein_id gnl|my_center|LOCUS_30540 92443 92664 gene locus_tag LOCUS_30550 92443 92664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30550 92711 93808 gene locus_tag LOCUS_30560 92711 93808 CDS product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973773.1 protein_id gnl|my_center|LOCUS_30560 94485 93943 gene locus_tag LOCUS_30570 94485 93943 CDS product PPA1309 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167526720.1 protein_id gnl|my_center|LOCUS_30570 94740 97559 gene locus_tag LOCUS_30580 94740 97559 CDS product UPF0182 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973771.1 protein_id gnl|my_center|LOCUS_30580 97806 99656 gene locus_tag LOCUS_30590 97806 99656 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030113.1 protein_id gnl|my_center|LOCUS_30590 100033 100108 gene locus_tag LOCUS_t00270 100033 100108 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 100106 100149 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 100693 100274 gene locus_tag LOCUS_30600 100693 100274 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973766.1 protein_id gnl|my_center|LOCUS_30600 100837 102288 gene locus_tag LOCUS_30610 100837 102288 CDS product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972723.1 protein_id gnl|my_center|LOCUS_30610 102765 102364 gene locus_tag LOCUS_30620 102765 102364 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486342.1 protein_id gnl|my_center|LOCUS_30620 103843 102914 gene locus_tag LOCUS_30630 gene hisN 103843 102914 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973764.1 protein_id gnl|my_center|LOCUS_30630 103908 104567 gene locus_tag LOCUS_30640 103908 104567 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030115.1 protein_id gnl|my_center|LOCUS_30640 104966 104643 gene locus_tag LOCUS_30650 104966 104643 CDS product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973762.1 protein_id gnl|my_center|LOCUS_30650 106106 105096 gene locus_tag LOCUS_30660 gene rsgA 106106 105096 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973761.1 protein_id gnl|my_center|LOCUS_30660 107456 106125 gene locus_tag LOCUS_30670 gene aroA 107456 106125 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973760.1 protein_id gnl|my_center|LOCUS_30670 108234 107512 gene locus_tag LOCUS_30680 108234 107512 CDS product M50 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973759.1 protein_id gnl|my_center|LOCUS_30680 108285 109100 gene locus_tag LOCUS_30690 108285 109100 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030116.1 protein_id gnl|my_center|LOCUS_30690 109102 109779 gene locus_tag LOCUS_30700 109102 109779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973757.1 protein_id gnl|my_center|LOCUS_30700 109879 110739 gene locus_tag LOCUS_30710 gene sigR 109879 110739 CDS product RNA polymerase sigma factor SigR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973756.1 protein_id gnl|my_center|LOCUS_30710 110736 111047 gene locus_tag LOCUS_30720 gene rsrA 110736 111047 CDS product mycothiol system anti-sigma-R factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973755.1 protein_id gnl|my_center|LOCUS_30720 111163 112518 gene locus_tag LOCUS_30730 111163 112518 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030117.1 protein_id gnl|my_center|LOCUS_30730 112515 113783 gene locus_tag LOCUS_30740 112515 113783 CDS product metal-dependent phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162495247.1 protein_id gnl|my_center|LOCUS_30740 113889 114869 gene locus_tag LOCUS_30750 113889 114869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973752.1 protein_id gnl|my_center|LOCUS_30750 114929 115600 gene locus_tag LOCUS_30760 gene def 114929 115600 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973751.1 protein_id gnl|my_center|LOCUS_30760 115097 115117 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 116023 116946 gene locus_tag LOCUS_30770 116023 116946 CDS product terpene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030119.1 protein_id gnl|my_center|LOCUS_30770 116943 118343 gene locus_tag LOCUS_30780 116943 118343 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030120.1 protein_id gnl|my_center|LOCUS_30780 119344 118382 gene locus_tag LOCUS_30790 119344 118382 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030121.1 protein_id gnl|my_center|LOCUS_30790 119432 119656 gene locus_tag LOCUS_30800 119432 119656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30800 120585 119569 gene locus_tag LOCUS_30810 120585 119569 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030122.1 protein_id gnl|my_center|LOCUS_30810 122936 120582 gene locus_tag LOCUS_30820 122936 120582 CDS product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030123.1 protein_id gnl|my_center|LOCUS_30820 123789 123283 gene locus_tag LOCUS_30830 123789 123283 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030124.1 protein_id gnl|my_center|LOCUS_30830 125491 123863 gene locus_tag LOCUS_30840 125491 123863 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973742.1 protein_id gnl|my_center|LOCUS_30840 125724 125488 gene locus_tag LOCUS_30850 125724 125488 CDS product DUF3311 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973741.1 protein_id gnl|my_center|LOCUS_30850 126640 125876 gene locus_tag LOCUS_30860 126640 125876 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973740.1 protein_id gnl|my_center|LOCUS_30860 127108 128391 gene locus_tag LOCUS_30870 127108 128391 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226207.1 protein_id gnl|my_center|LOCUS_30870 128522 129511 gene locus_tag LOCUS_30880 128522 129511 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225177.1 protein_id gnl|my_center|LOCUS_30880 129508 130350 gene locus_tag LOCUS_30890 129508 130350 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225176.1 protein_id gnl|my_center|LOCUS_30890 130360 131880 gene locus_tag LOCUS_30900 130360 131880 CDS product glycoside hydrolase family 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031132272.1 protein_id gnl|my_center|LOCUS_30900 132741 131956 gene locus_tag LOCUS_30910 gene nagB 132741 131956 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030128.1 protein_id gnl|my_center|LOCUS_30910 132958 133608 gene locus_tag LOCUS_30920 132958 133608 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030130.1 protein_id gnl|my_center|LOCUS_30920 134046 135521 gene locus_tag LOCUS_30930 134046 135521 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973732.1 protein_id gnl|my_center|LOCUS_30930 135918 135661 gene locus_tag LOCUS_30940 135918 135661 CDS product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973730.1 protein_id gnl|my_center|LOCUS_30940 137205 136237 gene locus_tag LOCUS_30950 137205 136237 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030131.1 protein_id gnl|my_center|LOCUS_30950 137322 137813 gene locus_tag LOCUS_30960 137322 137813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030132.1 protein_id gnl|my_center|LOCUS_30960 139044 137842 gene locus_tag LOCUS_30970 139044 137842 CDS product RNA polymerase sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270193.1 protein_id gnl|my_center|LOCUS_30970 139478 139062 gene locus_tag LOCUS_30980 139478 139062 CDS product anti-sigma regulatory factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973726.1 protein_id gnl|my_center|LOCUS_30980 140155 139730 gene locus_tag LOCUS_30990 140155 139730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30990 140088 141683 gene locus_tag LOCUS_31000 140088 141683 CDS product Na+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973724.1 protein_id gnl|my_center|LOCUS_31000 142634 141684 gene locus_tag LOCUS_31010 142634 141684 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030134.1 protein_id gnl|my_center|LOCUS_31010 142690 142718 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 142839 144245 gene locus_tag LOCUS_31020 142839 144245 CDS product family 2B encapsulin nanocompartment shell protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973721.1 protein_id gnl|my_center|LOCUS_31020 144544 145644 gene locus_tag LOCUS_31030 144544 145644 CDS product family 2 encapsulin nanocompartment cargo protein polyprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973720.1 protein_id gnl|my_center|LOCUS_31030 144654 144689 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 145897 146556 gene locus_tag LOCUS_31040 145897 146556 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973719.1 protein_id gnl|my_center|LOCUS_31040 146566 146823 gene locus_tag LOCUS_31050 146566 146823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31050 147653 146880 gene locus_tag LOCUS_31060 147653 146880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31060 148119 147697 gene locus_tag LOCUS_31070 148119 147697 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972459.1 protein_id gnl|my_center|LOCUS_31070 148539 148123 gene locus_tag LOCUS_31080 148539 148123 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030981.1 protein_id gnl|my_center|LOCUS_31080 152954 148575 gene locus_tag LOCUS_31090 152954 148575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31090 153596 153171 gene locus_tag LOCUS_31100 153596 153171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31100 154190 153795 gene locus_tag LOCUS_31110 gene sodN 154190 153795 CDS product superoxide dismutase, Ni inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973716.1 protein_id gnl|my_center|LOCUS_31110 154336 154770 gene locus_tag LOCUS_31120 gene sodX 154336 154770 CDS product nickel-type superoxide dismutase maturation protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868025.1 protein_id gnl|my_center|LOCUS_31120 155303 154674 gene locus_tag LOCUS_31130 155303 154674 CDS product CGNR zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973714.1 protein_id gnl|my_center|LOCUS_31130 155418 156194 gene locus_tag LOCUS_31140 155418 156194 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030136.1 protein_id gnl|my_center|LOCUS_31140 157110 156301 gene locus_tag LOCUS_31150 157110 156301 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973712.1 protein_id gnl|my_center|LOCUS_31150 158042 157107 gene locus_tag LOCUS_31160 158042 157107 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973711.1 protein_id gnl|my_center|LOCUS_31160 159034 158075 gene locus_tag LOCUS_31170 159034 158075 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973710.1 protein_id gnl|my_center|LOCUS_31170 159582 160805 gene locus_tag LOCUS_31180 159582 160805 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973709.1 protein_id gnl|my_center|LOCUS_31180 160936 161958 gene locus_tag LOCUS_31190 160936 161958 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973708.1 protein_id gnl|my_center|LOCUS_31190 162019 162228 gene locus_tag LOCUS_31200 162019 162228 CDS product sigma factor-like helix-turn-helix DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004559389.1 protein_id gnl|my_center|LOCUS_31200 162228 162800 gene locus_tag LOCUS_31210 162228 162800 CDS product Clp protease N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030137.1 protein_id gnl|my_center|LOCUS_31210 163874 162819 gene locus_tag LOCUS_31220 163874 162819 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973705.1 protein_id gnl|my_center|LOCUS_31220 164784 163876 gene locus_tag LOCUS_31230 164784 163876 CDS product DUF4097 family beta strand repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486398.1 protein_id gnl|my_center|LOCUS_31230 165242 165063 gene locus_tag LOCUS_31240 165242 165063 CDS product DUF6104 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030139.1 protein_id gnl|my_center|LOCUS_31240 169116 165322 gene locus_tag LOCUS_31250 169116 165322 CDS product multifunctional oxoglutarate decarboxylase/oxoglutarate dehydrogenase thiamine pyrophosphate-binding subunit/dihydrolipoyllysine-residue succinyltransferase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030150.1 protein_id gnl|my_center|LOCUS_31250 170504 169398 gene locus_tag LOCUS_31260 170504 169398 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973687.1 protein_id gnl|my_center|LOCUS_31260 171238 170501 gene locus_tag LOCUS_31270 171238 170501 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973686.1 protein_id gnl|my_center|LOCUS_31270 172037 171360 gene locus_tag LOCUS_31280 172037 171360 CDS product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030151.1 protein_id gnl|my_center|LOCUS_31280 172242 173084 gene locus_tag LOCUS_31290 172242 173084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31290 173175 175598 gene locus_tag LOCUS_31300 gene lon 173175 175598 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030152.1 protein_id gnl|my_center|LOCUS_31300 176516 175677 gene locus_tag LOCUS_31310 176516 175677 CDS product lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030153.1 protein_id gnl|my_center|LOCUS_31310 176802 177293 gene locus_tag LOCUS_31320 176802 177293 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973682.1 protein_id gnl|my_center|LOCUS_31320 178513 177725 gene locus_tag LOCUS_31330 178513 177725 CDS product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030154.1 protein_id gnl|my_center|LOCUS_31330 178932 181976 gene locus_tag LOCUS_31340 178932 181976 CDS product nitrate- and nitrite sensing domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486303.1 protein_id gnl|my_center|LOCUS_31340 181973 182476 gene locus_tag LOCUS_31350 181973 182476 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327267.1 protein_id gnl|my_center|LOCUS_31350 182473 182910 gene locus_tag LOCUS_31360 182473 182910 CDS product DUF742 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973678.1 protein_id gnl|my_center|LOCUS_31360 182891 183529 gene locus_tag LOCUS_31370 182891 183529 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973677.1 protein_id gnl|my_center|LOCUS_31370 183591 184853 gene locus_tag LOCUS_31380 183591 184853 CDS product alanine-phosphoribitol ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973676.1 protein_id gnl|my_center|LOCUS_31380 185968 184817 gene locus_tag LOCUS_31390 185968 184817 CDS product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030158.1 protein_id gnl|my_center|LOCUS_31390 186424 186071 gene locus_tag LOCUS_31400 186424 186071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030159.1 protein_id gnl|my_center|LOCUS_31400 187190 186417 gene locus_tag LOCUS_31410 187190 186417 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030160.1 protein_id gnl|my_center|LOCUS_31410 188160 187222 gene locus_tag LOCUS_31420 188160 187222 CDS product diiron oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030161.1 protein_id gnl|my_center|LOCUS_31420 188312 189424 gene locus_tag LOCUS_31430 188312 189424 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195328.1 protein_id gnl|my_center|LOCUS_31430 190903 189434 gene locus_tag LOCUS_31440 190903 189434 CDS product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973670.1 protein_id gnl|my_center|LOCUS_31440 191916 190900 gene locus_tag LOCUS_31450 191916 190900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31450 192284 191814 gene locus_tag LOCUS_31460 192284 191814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31460 191935 191957 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 192813 192328 gene locus_tag LOCUS_31470 192813 192328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31470 192842 192866 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 194355 193018 gene locus_tag LOCUS_31480 194355 193018 CDS product histidine kinase dimerization/phospho-acceptor domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030163.1 protein_id gnl|my_center|LOCUS_31480 195227 194361 gene locus_tag LOCUS_31490 195227 194361 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030164.1 protein_id gnl|my_center|LOCUS_31490 195881 195375 gene locus_tag LOCUS_31500 195881 195375 CDS product dual specificity protein phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486294.1 protein_id gnl|my_center|LOCUS_31500 195984 196802 gene locus_tag LOCUS_31510 195984 196802 CDS product NERD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270195.1 protein_id gnl|my_center|LOCUS_31510 197773 196889 gene locus_tag LOCUS_31520 gene ligD 197773 196889 CDS product non-homologous end-joining DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973663.1 protein_id gnl|my_center|LOCUS_31520 197828 198898 gene locus_tag LOCUS_31530 197828 198898 CDS product Ku protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030872665.1 protein_id gnl|my_center|LOCUS_31530 199873 199013 gene locus_tag LOCUS_31540 199873 199013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31540 200826 199849 gene locus_tag LOCUS_31550 200826 199849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31550 199941 199966 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 202865 201165 gene locus_tag LOCUS_31560 202865 201165 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900872.1 protein_id gnl|my_center|LOCUS_31560 204386 202872 gene locus_tag LOCUS_31570 204386 202872 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229625.1 protein_id gnl|my_center|LOCUS_31570 204610 205110 gene locus_tag LOCUS_31580 204610 205110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31580 205145 205330 gene locus_tag LOCUS_31590 205145 205330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31590 205415 205654 gene locus_tag LOCUS_31600 205415 205654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31600 205680 206732 gene locus_tag LOCUS_31610 205680 206732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31610 207011 209533 gene locus_tag LOCUS_31620 207011 209533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31620 209533 209925 gene locus_tag LOCUS_31630 209533 209925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31630 210781 210272 gene locus_tag LOCUS_31640 210781 210272 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030759.1 protein_id gnl|my_center|LOCUS_31640 210956 211810 gene locus_tag LOCUS_31650 210956 211810 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031055.1 protein_id gnl|my_center|LOCUS_31650 211807 211995 gene locus_tag LOCUS_31660 211807 211995 CDS product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031056.1 protein_id gnl|my_center|LOCUS_31660 213179 212796 gene locus_tag LOCUS_31670 213179 212796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31670 213554 214735 gene locus_tag LOCUS_31680 213554 214735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31680 217271 215100 gene locus_tag LOCUS_31690 217271 215100 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031066.1 protein_id gnl|my_center|LOCUS_31690 218641 217310 gene locus_tag LOCUS_31700 gene brxD 218641 217310 CDS product BREX system ATP-binding protein BrxD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031065.1 protein_id gnl|my_center|LOCUS_31700 221391 218638 gene locus_tag LOCUS_31710 gene pglZ 221391 218638 CDS product BREX-2 system phosphatase PglZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031062.1 protein_id gnl|my_center|LOCUS_31710 222836 221388 gene locus_tag LOCUS_31720 222836 221388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31720 225343 222719 gene locus_tag LOCUS_31730 225343 222719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31730 222841 222866 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 225711 225743 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 226179 225814 gene locus_tag LOCUS_31740 226179 225814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31740 226210 226521 gene locus_tag LOCUS_31750 226210 226521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31750 229663 226523 gene locus_tag LOCUS_31760 229663 226523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31760 226723 226750 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 231245 229758 gene locus_tag LOCUS_31770 231245 229758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390741.1 protein_id gnl|my_center|LOCUS_31770 232657 231242 gene locus_tag LOCUS_31780 232657 231242 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390742.1 protein_id gnl|my_center|LOCUS_31780 237678 232654 gene locus_tag LOCUS_31790 237678 232654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31790 234192 234213 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 236765 236788 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 238122 238436 gene locus_tag LOCUS_31800 238122 238436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31800 238548 238943 gene locus_tag LOCUS_31810 238548 238943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31810 239206 239505 gene locus_tag LOCUS_31820 239206 239505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31820 240848 240870 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 242586 243368 gene locus_tag LOCUS_31830 242586 243368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31830 245110 243947 gene locus_tag LOCUS_31840 245110 243947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31840 245196 245438 gene locus_tag LOCUS_31850 245196 245438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31850 245799 245389 gene locus_tag LOCUS_31860 245799 245389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31860 246257 245793 gene locus_tag LOCUS_31870 246257 245793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31870 246458 246772 gene locus_tag LOCUS_31880 246458 246772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31880 246762 247991 gene locus_tag LOCUS_31890 246762 247991 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227700.1 protein_id gnl|my_center|LOCUS_31890 248311 248667 gene locus_tag LOCUS_31900 248311 248667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028865.1 protein_id gnl|my_center|LOCUS_31900 248667 250064 gene locus_tag LOCUS_31910 248667 250064 CDS product FtsK/SpoIIIE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028864.1 protein_id gnl|my_center|LOCUS_31910 249403 249423 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 250147 250761 gene locus_tag LOCUS_31920 250147 250761 CDS product DUF2637 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028863.1 protein_id gnl|my_center|LOCUS_31920 250781 250972 gene locus_tag LOCUS_31930 250781 250972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31930 250972 251163 gene locus_tag LOCUS_31940 250972 251163 CDS product mobile element transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226027129.1 protein_id gnl|my_center|LOCUS_31940 251173 251367 gene locus_tag LOCUS_31950 251173 251367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31950 251382 251627 gene locus_tag LOCUS_31960 251382 251627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31960 251759 252808 gene locus_tag LOCUS_31970 251759 252808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31970 252754 252776 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 252838 253104 gene locus_tag LOCUS_31980 252838 253104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31980 253077 253274 gene locus_tag LOCUS_31990 253077 253274 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031039432.1 protein_id gnl|my_center|LOCUS_31990 253271 254644 gene locus_tag LOCUS_32000 253271 254644 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030198.1 protein_id gnl|my_center|LOCUS_32000 255199 254810 gene locus_tag LOCUS_32010 255199 254810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32010 255869 256114 gene locus_tag LOCUS_32020 255869 256114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32020 256383 256310 gene locus_tag LOCUS_t00280 256383 256310 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 256709 256374 gene locus_tag LOCUS_32030 256709 256374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32030 256602 257042 gene locus_tag LOCUS_32040 256602 257042 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030200.1 protein_id gnl|my_center|LOCUS_32040 257529 257143 gene locus_tag LOCUS_32050 257529 257143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32050 257982 257551 gene locus_tag LOCUS_32060 257982 257551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32060 257920 258273 gene locus_tag LOCUS_32070 257920 258273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32070 258297 259688 gene locus_tag LOCUS_32080 gene lysA 258297 259688 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030202.1 protein_id gnl|my_center|LOCUS_32080 259851 261143 gene locus_tag LOCUS_32090 259851 261143 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189283905.1 protein_id gnl|my_center|LOCUS_32090 261150 262208 gene locus_tag LOCUS_32100 gene thrC 261150 262208 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973642.1 protein_id gnl|my_center|LOCUS_32100 262909 263826 gene locus_tag LOCUS_32110 gene thrB 262909 263826 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030204.1 protein_id gnl|my_center|LOCUS_32110 264241 266226 gene locus_tag LOCUS_32120 gene rho 264241 266226 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030205.1 protein_id gnl|my_center|LOCUS_32120 266412 267584 gene locus_tag LOCUS_32130 266412 267584 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973639.1 protein_id gnl|my_center|LOCUS_32130 266652 266675 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 267746 267970 gene locus_tag LOCUS_32140 gene rpmE 267746 267970 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973638.1 protein_id gnl|my_center|LOCUS_32140 268088 269155 gene locus_tag LOCUS_32150 gene prfA 268088 269155 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973637.1 protein_id gnl|my_center|LOCUS_32150 269235 270116 gene locus_tag LOCUS_32160 gene prmC 269235 270116 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973636.1 protein_id gnl|my_center|LOCUS_32160 270181 270828 gene locus_tag LOCUS_32170 270181 270828 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973635.1 protein_id gnl|my_center|LOCUS_32170 270825 271502 gene locus_tag LOCUS_32180 270825 271502 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068381.1 protein_id gnl|my_center|LOCUS_32180 271605 272843 gene locus_tag LOCUS_32190 271605 272843 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973633.1 protein_id gnl|my_center|LOCUS_32190 272994 274313 gene locus_tag LOCUS_32200 272994 274313 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030207.1 protein_id gnl|my_center|LOCUS_32200 274603 275040 gene locus_tag LOCUS_32210 274603 275040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973631.1 protein_id gnl|my_center|LOCUS_32210 275239 275261 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 275289 276110 gene locus_tag LOCUS_32220 gene atpB 275289 276110 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030208.1 protein_id gnl|my_center|LOCUS_32220 276185 276412 gene locus_tag LOCUS_32230 gene atpE 276185 276412 CDS product ATP synthase F0 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973629.1 protein_id gnl|my_center|LOCUS_32230 276453 276995 gene locus_tag LOCUS_32240 276453 276995 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030209.1 protein_id gnl|my_center|LOCUS_32240 276992 277813 gene locus_tag LOCUS_32250 276992 277813 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327277.1 protein_id gnl|my_center|LOCUS_32250 277943 278950 gene locus_tag LOCUS_32260 277943 278950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32260 278843 278874 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 278932 279567 gene locus_tag LOCUS_32270 278932 279567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32270 279589 280506 gene locus_tag LOCUS_32280 279589 280506 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973625.1 protein_id gnl|my_center|LOCUS_32280 280507 281943 gene locus_tag LOCUS_32290 gene atpD 280507 281943 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973624.1 protein_id gnl|my_center|LOCUS_32290 282054 282431 gene locus_tag LOCUS_32300 282054 282431 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973623.1 protein_id gnl|my_center|LOCUS_32300 282562 283008 gene locus_tag LOCUS_32310 282562 283008 CDS product DUF2550 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973622.1 protein_id gnl|my_center|LOCUS_32310 283330 283085 gene locus_tag LOCUS_32320 283330 283085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32320 285398 283569 gene locus_tag LOCUS_32330 285398 283569 CDS product glycoside hydrolase family 18 chitinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030211.1 protein_id gnl|my_center|LOCUS_32330 285430 285450 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 285687 286430 gene locus_tag LOCUS_32340 gene prrA 285687 286430 CDS product two-component system response regulator PrrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168189073.1 protein_id gnl|my_center|LOCUS_32340 286427 287782 gene locus_tag LOCUS_32350 286427 287782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32350 287688 287719 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 287779 287940 gene locus_tag LOCUS_32360 287779 287940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32360 288000 288419 gene locus_tag LOCUS_32370 288000 288419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32370 288419 288703 gene locus_tag LOCUS_32380 288419 288703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32380 289358 288786 gene locus_tag LOCUS_32390 289358 288786 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973616.1 protein_id gnl|my_center|LOCUS_32390 290121 289372 gene locus_tag LOCUS_32400 290121 289372 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973615.1 protein_id gnl|my_center|LOCUS_32400 290890 290108 gene locus_tag LOCUS_32410 290890 290108 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973614.1 protein_id gnl|my_center|LOCUS_32410 290971 291612 gene locus_tag LOCUS_32420 290971 291612 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973613.1 protein_id gnl|my_center|LOCUS_32420 291866 292714 gene locus_tag LOCUS_32430 291866 292714 CDS product 3-hydroxyacyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030215.1 protein_id gnl|my_center|LOCUS_32430 292861 293184 gene locus_tag LOCUS_32440 292861 293184 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973611.1 protein_id gnl|my_center|LOCUS_32440 293495 296248 gene locus_tag LOCUS_32450 293495 296248 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030216.1 protein_id gnl|my_center|LOCUS_32450 297011 296340 gene locus_tag LOCUS_32460 gene nucS 297011 296340 CDS product endonuclease NucS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007387684.1 protein_id gnl|my_center|LOCUS_32460 297314 297706 gene locus_tag LOCUS_32470 297314 297706 CDS product SCO5389 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973607.1 protein_id gnl|my_center|LOCUS_32470 298815 297787 gene locus_tag LOCUS_32480 298815 297787 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030217.1 protein_id gnl|my_center|LOCUS_32480 299050 299382 gene locus_tag LOCUS_32490 299050 299382 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973605.1 protein_id gnl|my_center|LOCUS_32490 300286 299414 gene locus_tag LOCUS_32500 300286 299414 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973604.1 protein_id gnl|my_center|LOCUS_32500 301623 300283 gene locus_tag LOCUS_32510 301623 300283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32510 302751 301816 gene locus_tag LOCUS_32520 302751 301816 CDS product cellulose-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973600.1 protein_id gnl|my_center|LOCUS_32520 306782 302934 gene locus_tag LOCUS_32530 gene scy 306782 302934 CDS product polarized growth protein Scy inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030220.1 protein_id gnl|my_center|LOCUS_32530 307457 307017 gene locus_tag LOCUS_32540 gene mce 307457 307017 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973598.1 protein_id gnl|my_center|LOCUS_32540 307607 308815 gene locus_tag LOCUS_32550 307607 308815 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030221.1 protein_id gnl|my_center|LOCUS_32550 308887 309843 gene locus_tag LOCUS_32560 gene meaB 308887 309843 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030222.1 protein_id gnl|my_center|LOCUS_32560 310394 309918 gene locus_tag LOCUS_32570 310394 309918 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973592.1 protein_id gnl|my_center|LOCUS_32570 311293 310490 gene locus_tag LOCUS_32580 311293 310490 CDS product AIM24 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973591.1 protein_id gnl|my_center|LOCUS_32580 311940 311290 gene locus_tag LOCUS_32590 311940 311290 CDS product AIM24 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109033475.1 protein_id gnl|my_center|LOCUS_32590 312548 311940 gene locus_tag LOCUS_32600 312548 311940 CDS product AIM24 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189739317.1 protein_id gnl|my_center|LOCUS_32600 312713 313057 gene locus_tag LOCUS_32610 312713 313057 CDS product DUF3817 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030226.1 protein_id gnl|my_center|LOCUS_32610 313054 313347 gene locus_tag LOCUS_32620 313054 313347 CDS product MTH1187 family thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409536.1 protein_id gnl|my_center|LOCUS_32620 314487 313534 gene locus_tag LOCUS_32630 314487 313534 CDS product DUF5937 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284397.1 protein_id gnl|my_center|LOCUS_32630 314595 315917 gene locus_tag LOCUS_32640 314595 315917 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228761.1 protein_id gnl|my_center|LOCUS_32640 315929 316438 gene locus_tag LOCUS_32650 315929 316438 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973586.1 protein_id gnl|my_center|LOCUS_32650 316527 316865 gene locus_tag LOCUS_32660 316527 316865 CDS product DUF3817 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037666291.1 protein_id gnl|my_center|LOCUS_32660 316939 318639 gene locus_tag LOCUS_32670 316939 318639 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030230.1 protein_id gnl|my_center|LOCUS_32670 319385 318765 gene locus_tag LOCUS_32680 319385 318765 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030233.1 protein_id gnl|my_center|LOCUS_32680 319617 320573 gene locus_tag LOCUS_32690 319617 320573 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973580.1 protein_id gnl|my_center|LOCUS_32690 321222 321857 gene locus_tag LOCUS_32700 321222 321857 CDS product DUF6230 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030235.1 protein_id gnl|my_center|LOCUS_32700 321991 322545 gene locus_tag LOCUS_32710 321991 322545 CDS product DUF6114 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030236.1 protein_id gnl|my_center|LOCUS_32710 322535 323932 gene locus_tag LOCUS_32720 322535 323932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189283916.1 protein_id gnl|my_center|LOCUS_32720 325489 324059 gene locus_tag LOCUS_32730 gene pyk 325489 324059 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973575.1 protein_id gnl|my_center|LOCUS_32730 326805 325588 gene locus_tag LOCUS_32740 326805 325588 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030238.1 protein_id gnl|my_center|LOCUS_32740 328915 326840 gene locus_tag LOCUS_32750 gene pta 328915 326840 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030239.1 protein_id gnl|my_center|LOCUS_32750 329152 330177 gene locus_tag LOCUS_32760 329152 330177 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973572.1 protein_id gnl|my_center|LOCUS_32760 330964 330254 gene locus_tag LOCUS_32770 330964 330254 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030245.1 protein_id gnl|my_center|LOCUS_32770 332616 330961 gene locus_tag LOCUS_32780 332616 330961 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030246.1 protein_id gnl|my_center|LOCUS_32780 332770 334179 gene locus_tag LOCUS_32790 332770 334179 CDS product C4-dicarboxylate transporter DctA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973562.1 protein_id gnl|my_center|LOCUS_32790 334934 334317 gene locus_tag LOCUS_32800 334934 334317 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030864062.1 protein_id gnl|my_center|LOCUS_32800 335050 336729 gene locus_tag LOCUS_32810 335050 336729 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030563.1 protein_id gnl|my_center|LOCUS_32810 336826 337590 gene locus_tag LOCUS_32820 336826 337590 CDS product DUF2127 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899807.1 protein_id gnl|my_center|LOCUS_32820 337638 338066 gene locus_tag LOCUS_32830 337638 338066 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973561.1 protein_id gnl|my_center|LOCUS_32830 338063 338395 gene locus_tag LOCUS_32840 338063 338395 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973560.1 protein_id gnl|my_center|LOCUS_32840 338532 340784 gene locus_tag LOCUS_32850 338532 340784 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973559.1 protein_id gnl|my_center|LOCUS_32850 343651 340904 gene locus_tag LOCUS_32860 343651 340904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32860 342357 342596 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 345122 343707 gene locus_tag LOCUS_32870 345122 343707 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973557.1 protein_id gnl|my_center|LOCUS_32870 345550 345209 gene locus_tag LOCUS_32880 345550 345209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32880 >Feature sequence008 1648 203 gene locus_tag LOCUS_32890 gene obgE 1648 203 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976206.1 protein_id gnl|my_center|LOCUS_32890 2008 1754 gene locus_tag LOCUS_32900 gene rpmA 2008 1754 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976205.1 protein_id gnl|my_center|LOCUS_32900 2400 2023 gene locus_tag LOCUS_32910 gene rplU 2400 2023 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976204.1 protein_id gnl|my_center|LOCUS_32910 5805 2581 gene locus_tag LOCUS_32920 5805 2581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_32920 6736 5837 gene locus_tag LOCUS_32930 6736 5837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32930 5943 5967 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6700 6727 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8023 7247 gene locus_tag LOCUS_32940 8023 7247 CDS product TIGR03936 family radical SAM-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976201.1 protein_id gnl|my_center|LOCUS_32940 10075 8126 gene locus_tag LOCUS_32950 10075 8126 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976193.1 protein_id gnl|my_center|LOCUS_32950 11621 10116 gene locus_tag LOCUS_32960 11621 10116 CDS product CYTH and CHAD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978319.1 protein_id gnl|my_center|LOCUS_32960 12910 11711 gene locus_tag LOCUS_32970 gene rodA 12910 11711 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976192.1 protein_id gnl|my_center|LOCUS_32970 15174 12907 gene locus_tag LOCUS_32980 gene mrdA 15174 12907 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028453.1 protein_id gnl|my_center|LOCUS_32980 16019 15339 gene locus_tag LOCUS_32990 gene mreD 16019 15339 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976190.1 protein_id gnl|my_center|LOCUS_32990 16976 16035 gene locus_tag LOCUS_33000 gene mreC 16976 16035 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976189.1 protein_id gnl|my_center|LOCUS_33000 17332 17141 gene locus_tag LOCUS_33010 17332 17141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33010 18189 17311 gene locus_tag LOCUS_33020 18189 17311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33020 17413 17441 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 18884 18471 gene locus_tag LOCUS_33030 gene ndk 18884 18471 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976187.1 protein_id gnl|my_center|LOCUS_33030 19318 18950 gene locus_tag LOCUS_33040 19318 18950 CDS product DUF4233 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976186.1 protein_id gnl|my_center|LOCUS_33040 20809 19325 gene locus_tag LOCUS_33050 20809 19325 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485025.1 protein_id gnl|my_center|LOCUS_33050 23568 20944 gene locus_tag LOCUS_33060 23568 20944 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028455.1 protein_id gnl|my_center|LOCUS_33060 23705 24688 gene locus_tag LOCUS_33070 23705 24688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33070 26063 24744 gene locus_tag LOCUS_33080 gene clpX 26063 24744 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028457.1 protein_id gnl|my_center|LOCUS_33080 25975 26007 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 26904 26224 gene locus_tag LOCUS_33090 26904 26224 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173668811.1 protein_id gnl|my_center|LOCUS_33090 27610 26993 gene locus_tag LOCUS_33100 27610 26993 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030186848.1 protein_id gnl|my_center|LOCUS_33100 29355 27964 gene locus_tag LOCUS_33110 gene tig 29355 27964 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976179.1 protein_id gnl|my_center|LOCUS_33110 29633 29557 gene locus_tag LOCUS_t00290 29633 29557 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 29847 29920 gene locus_tag LOCUS_t00300 29847 29920 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 30166 29972 gene locus_tag LOCUS_33120 30166 29972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976178.1 protein_id gnl|my_center|LOCUS_33120 30740 31870 gene locus_tag LOCUS_33130 30740 31870 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028459.1 protein_id gnl|my_center|LOCUS_33130 32460 31939 gene locus_tag LOCUS_33140 32460 31939 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028460.1 protein_id gnl|my_center|LOCUS_33140 33621 32503 gene locus_tag LOCUS_33150 33621 32503 CDS product PP2C family protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976175.1 protein_id gnl|my_center|LOCUS_33150 33841 34671 gene locus_tag LOCUS_33160 33841 34671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33160 34562 34584 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 34692 35105 gene locus_tag LOCUS_33170 34692 35105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33170 35952 35143 gene locus_tag LOCUS_33180 35952 35143 CDS product Fpg/Nei family DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228580.1 protein_id gnl|my_center|LOCUS_33180 36828 36343 gene locus_tag LOCUS_33190 36828 36343 CDS product ribose-5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037666673.1 protein_id gnl|my_center|LOCUS_33190 37056 38537 gene locus_tag LOCUS_33200 37056 38537 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030869905.1 protein_id gnl|my_center|LOCUS_33200 40248 38611 gene locus_tag LOCUS_33210 40248 38611 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486587.1 protein_id gnl|my_center|LOCUS_33210 40425 40739 gene locus_tag LOCUS_33220 40425 40739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33220 40662 40690 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 40751 41170 gene locus_tag LOCUS_33230 40751 41170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33230 41857 41261 gene locus_tag LOCUS_33240 41857 41261 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167469637.1 protein_id gnl|my_center|LOCUS_33240 42324 43532 gene locus_tag LOCUS_33250 42324 43532 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226155.1 protein_id gnl|my_center|LOCUS_33250 43772 44845 gene locus_tag LOCUS_33260 43772 44845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33260 44851 45711 gene locus_tag LOCUS_33270 44851 45711 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226851.1 protein_id gnl|my_center|LOCUS_33270 45687 46421 gene locus_tag LOCUS_33280 45687 46421 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730600.1 protein_id gnl|my_center|LOCUS_33280 46418 46564 gene locus_tag LOCUS_33290 46418 46564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33290 46885 46915 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 46946 47818 gene locus_tag LOCUS_33300 46946 47818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33300 47833 48675 gene locus_tag LOCUS_33310 47833 48675 CDS product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226150.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33310 48596 48623 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 48897 50285 gene locus_tag LOCUS_33320 48897 50285 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976169.1 protein_id gnl|my_center|LOCUS_33320 51099 50437 gene locus_tag LOCUS_33330 51099 50437 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326218.1 protein_id gnl|my_center|LOCUS_33330 51280 53883 gene locus_tag LOCUS_33340 gene pepN 51280 53883 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326219.1 protein_id gnl|my_center|LOCUS_33340 54051 55112 gene locus_tag LOCUS_33350 54051 55112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270042.1 protein_id gnl|my_center|LOCUS_33350 56345 55143 gene locus_tag LOCUS_33360 56345 55143 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000710628.1 protein_id gnl|my_center|LOCUS_33360 58213 56435 gene locus_tag LOCUS_33370 58213 56435 CDS product TIGR03767 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230137.1 protein_id gnl|my_center|LOCUS_33370 58908 58414 gene locus_tag LOCUS_33380 58908 58414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33380 58770 58790 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 59877 58936 gene locus_tag LOCUS_33390 59877 58936 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111553.1 protein_id gnl|my_center|LOCUS_33390 60344 59880 gene locus_tag LOCUS_33400 60344 59880 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093742.1 protein_id gnl|my_center|LOCUS_33400 60467 61006 gene locus_tag LOCUS_33410 60467 61006 CDS product CGNR zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081838.1 protein_id gnl|my_center|LOCUS_33410 61827 61045 gene locus_tag LOCUS_33420 61827 61045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028470.1 protein_id gnl|my_center|LOCUS_33420 62359 61829 gene locus_tag LOCUS_33430 62359 61829 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976162.1 protein_id gnl|my_center|LOCUS_33430 62746 63771 gene locus_tag LOCUS_33440 62746 63771 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028472.1 protein_id gnl|my_center|LOCUS_33440 63892 65238 gene locus_tag LOCUS_33450 63892 65238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33450 65178 65209 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 65382 66503 gene locus_tag LOCUS_33460 65382 66503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33460 67021 66752 gene locus_tag LOCUS_33470 67021 66752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028480.1 protein_id gnl|my_center|LOCUS_33470 69225 67084 gene locus_tag LOCUS_33480 gene malQ 69225 67084 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028481.1 protein_id gnl|my_center|LOCUS_33480 69528 69226 gene locus_tag LOCUS_33490 69528 69226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028482.1 protein_id gnl|my_center|LOCUS_33490 69758 72772 gene locus_tag LOCUS_33500 69758 72772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33500 73404 72868 gene locus_tag LOCUS_33510 73404 72868 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028487.1 protein_id gnl|my_center|LOCUS_33510 73807 74838 gene locus_tag LOCUS_33520 73807 74838 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189283001.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33520 74996 76207 gene locus_tag LOCUS_33530 74996 76207 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136208195.1 protein_id gnl|my_center|LOCUS_33530 76395 76429 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 77531 77289 gene locus_tag LOCUS_33540 77531 77289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33540 77645 77670 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 77693 78670 gene locus_tag LOCUS_33550 77693 78670 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976142.1 protein_id gnl|my_center|LOCUS_33550 78673 79566 gene locus_tag LOCUS_33560 78673 79566 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028491.1 protein_id gnl|my_center|LOCUS_33560 79577 79599 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 79604 80857 gene locus_tag LOCUS_33570 79604 80857 CDS product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028492.1 protein_id gnl|my_center|LOCUS_33570 80848 81816 gene locus_tag LOCUS_33580 80848 81816 CDS product BadF/BadG/BcrA/BcrD ATPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030866323.1 protein_id gnl|my_center|LOCUS_33580 81995 83440 gene locus_tag LOCUS_33590 81995 83440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976138.1 protein_id gnl|my_center|LOCUS_33590 83476 84516 gene locus_tag LOCUS_33600 83476 84516 CDS product glutamate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028495.1 protein_id gnl|my_center|LOCUS_33600 84622 85962 gene locus_tag LOCUS_33610 84622 85962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028496.1 protein_id gnl|my_center|LOCUS_33610 86539 86006 gene locus_tag LOCUS_33620 86539 86006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33620 86421 88511 gene locus_tag LOCUS_33630 86421 88511 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028497.1 protein_id gnl|my_center|LOCUS_33630 88515 89813 gene locus_tag LOCUS_33640 88515 89813 CDS product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028498.1 protein_id gnl|my_center|LOCUS_33640 89992 91338 gene locus_tag LOCUS_33650 89992 91338 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484988.1 protein_id gnl|my_center|LOCUS_33650 92323 92347 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 92506 92859 gene locus_tag LOCUS_33660 92506 92859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33660 93873 92887 gene locus_tag LOCUS_33670 93873 92887 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028500.1 protein_id gnl|my_center|LOCUS_33670 93977 94381 gene locus_tag LOCUS_33680 93977 94381 CDS product globin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028501.1 protein_id gnl|my_center|LOCUS_33680 94638 97931 gene locus_tag LOCUS_33690 94638 97931 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484982.1 protein_id gnl|my_center|LOCUS_33690 96129 96213 gene locus_tag LOCUS_t00310 96129 96213 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 97933 100716 gene locus_tag LOCUS_33700 97933 100716 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484980.1 protein_id gnl|my_center|LOCUS_33700 100781 101740 gene locus_tag LOCUS_33710 100781 101740 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028504.1 protein_id gnl|my_center|LOCUS_33710 102462 101779 gene locus_tag LOCUS_33720 102462 101779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030866307.1 protein_id gnl|my_center|LOCUS_33720 102887 102459 gene locus_tag LOCUS_33730 102887 102459 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028505.1 protein_id gnl|my_center|LOCUS_33730 103303 102896 gene locus_tag LOCUS_33740 103303 102896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33740 104597 103221 gene locus_tag LOCUS_33750 104597 103221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33750 103319 103355 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 106068 104761 gene locus_tag LOCUS_33760 106068 104761 CDS product TQXA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028511.1 protein_id gnl|my_center|LOCUS_33760 106001 106405 gene locus_tag LOCUS_33770 106001 106405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33770 106854 106378 gene locus_tag LOCUS_33780 106854 106378 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976116.1 protein_id gnl|my_center|LOCUS_33780 109475 107178 gene locus_tag LOCUS_33790 109475 107178 CDS product YfjP family GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484979.1 protein_id gnl|my_center|LOCUS_33790 111083 109479 gene locus_tag LOCUS_33800 111083 109479 CDS product dynamin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028513.1 protein_id gnl|my_center|LOCUS_33800 111414 111489 gene locus_tag LOCUS_t00320 111414 111489 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 112587 111724 gene locus_tag LOCUS_33810 112587 111724 CDS product tyrosinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976100.1 protein_id gnl|my_center|LOCUS_33810 113080 112574 gene locus_tag LOCUS_33820 113080 112574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33820 113598 113311 gene locus_tag LOCUS_33830 113598 113311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33830 114213 113935 gene locus_tag LOCUS_33840 114213 113935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33840 115259 114423 gene locus_tag LOCUS_33850 115259 114423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33850 115645 116805 gene locus_tag LOCUS_33860 115645 116805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33860 116854 118137 gene locus_tag LOCUS_33870 116854 118137 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028527.1 protein_id gnl|my_center|LOCUS_33870 118241 118266 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 118304 119590 gene locus_tag LOCUS_33880 118304 119590 CDS product exopolysaccharide biosynthesis polyprenyl glycosylphosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028528.1 protein_id gnl|my_center|LOCUS_33880 119594 121021 gene locus_tag LOCUS_33890 119594 121021 CDS product O-antigen ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028529.1 protein_id gnl|my_center|LOCUS_33890 121018 122685 gene locus_tag LOCUS_33900 121018 122685 CDS product lipid II flippase MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030866257.1 protein_id gnl|my_center|LOCUS_33900 122968 122621 gene locus_tag LOCUS_33910 122968 122621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33910 123072 123464 gene locus_tag LOCUS_33920 123072 123464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33920 123098 123128 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 123466 124617 gene locus_tag LOCUS_33930 123466 124617 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028531.1 protein_id gnl|my_center|LOCUS_33930 124614 125270 gene locus_tag LOCUS_33940 124614 125270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028532.1 protein_id gnl|my_center|LOCUS_33940 125350 126699 gene locus_tag LOCUS_33950 125350 126699 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028533.1 protein_id gnl|my_center|LOCUS_33950 127483 127920 gene locus_tag LOCUS_33960 127483 127920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33960 128358 127942 gene locus_tag LOCUS_33970 128358 127942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33970 128263 129291 gene locus_tag LOCUS_33980 128263 129291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33980 129291 130556 gene locus_tag LOCUS_33990 129291 130556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33990 131467 130613 gene locus_tag LOCUS_34000 gene chpA 131467 130613 CDS product LAXTG-anchored chaplin ChpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976084.1 protein_id gnl|my_center|LOCUS_34000 131928 131668 gene locus_tag LOCUS_34010 131928 131668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34010 132446 132183 gene locus_tag LOCUS_34020 132446 132183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34020 132887 132660 gene locus_tag LOCUS_34030 132887 132660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34030 133612 133247 gene locus_tag LOCUS_34040 133612 133247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34040 134015 133668 gene locus_tag LOCUS_34050 134015 133668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34050 135111 134239 gene locus_tag LOCUS_34060 135111 134239 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028540.1 protein_id gnl|my_center|LOCUS_34060 137792 135108 gene locus_tag LOCUS_34070 137792 135108 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484949.1 protein_id gnl|my_center|LOCUS_34070 139321 137903 gene locus_tag LOCUS_34080 139321 137903 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028542.1 protein_id gnl|my_center|LOCUS_34080 141209 139707 gene locus_tag LOCUS_34090 gene mmsA 141209 139707 CDS product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028544.1 protein_id gnl|my_center|LOCUS_34090 141592 141206 gene locus_tag LOCUS_34100 141592 141206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34100 141916 142116 gene locus_tag LOCUS_34110 141916 142116 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326277.1 protein_id gnl|my_center|LOCUS_34110 143178 142135 gene locus_tag LOCUS_34120 143178 142135 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531254.1 protein_id gnl|my_center|LOCUS_34120 145729 143297 gene locus_tag LOCUS_34130 145729 143297 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028362.1 protein_id gnl|my_center|LOCUS_34130 145916 146614 gene locus_tag LOCUS_34140 145916 146614 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140806.1 protein_id gnl|my_center|LOCUS_34140 146685 146924 gene locus_tag LOCUS_34150 146685 146924 CDS product heavy-metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027541.1 protein_id gnl|my_center|LOCUS_34150 147070 149373 gene locus_tag LOCUS_34160 147070 149373 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028547.1 protein_id gnl|my_center|LOCUS_34160 149547 149571 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 151382 150081 gene locus_tag LOCUS_34170 151382 150081 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976064.1 protein_id gnl|my_center|LOCUS_34170 151831 151646 gene locus_tag LOCUS_34180 151831 151646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34180 153870 151867 gene locus_tag LOCUS_34190 153870 151867 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028552.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34190 151918 151943 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 154118 155038 gene locus_tag LOCUS_34200 154118 155038 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028558.1 protein_id gnl|my_center|LOCUS_34200 155786 155205 gene locus_tag LOCUS_34210 155786 155205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975661.1 protein_id gnl|my_center|LOCUS_34210 156624 155791 gene locus_tag LOCUS_34220 156624 155791 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028560.1 protein_id gnl|my_center|LOCUS_34220 157802 156621 gene locus_tag LOCUS_34230 157802 156621 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028561.1 protein_id gnl|my_center|LOCUS_34230 158923 157799 gene locus_tag LOCUS_34240 158923 157799 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093456192.1 protein_id gnl|my_center|LOCUS_34240 159255 160316 gene locus_tag LOCUS_34250 159255 160316 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976047.1 protein_id gnl|my_center|LOCUS_34250 161039 162007 gene locus_tag LOCUS_34260 161039 162007 CDS product helix-turn-helix domain-containing GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085299.1 protein_id gnl|my_center|LOCUS_34260 162019 162819 gene locus_tag LOCUS_34270 162019 162819 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976046.1 protein_id gnl|my_center|LOCUS_34270 163050 163544 gene locus_tag LOCUS_34280 163050 163544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34280 163544 163849 gene locus_tag LOCUS_34290 163544 163849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34290 163849 165138 gene locus_tag LOCUS_34300 163849 165138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34300 165116 165382 gene locus_tag LOCUS_34310 165116 165382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34310 165324 165346 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 165379 165663 gene locus_tag LOCUS_34320 165379 165663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34320 165660 166244 gene locus_tag LOCUS_34330 165660 166244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34330 167118 166192 gene locus_tag LOCUS_34340 167118 166192 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976044.1 protein_id gnl|my_center|LOCUS_34340 167247 168164 gene locus_tag LOCUS_34350 167247 168164 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028565.1 protein_id gnl|my_center|LOCUS_34350 168542 170365 gene locus_tag LOCUS_34360 168542 170365 CDS product glycoside hydrolase family 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028566.1 protein_id gnl|my_center|LOCUS_34360 170503 171144 gene locus_tag LOCUS_34370 170503 171144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028567.1 protein_id gnl|my_center|LOCUS_34370 172669 171215 gene locus_tag LOCUS_34380 172669 171215 CDS product S28 family serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028568.1 protein_id gnl|my_center|LOCUS_34380 173167 172778 gene locus_tag LOCUS_34390 173167 172778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976038.1 protein_id gnl|my_center|LOCUS_34390 177027 173272 gene locus_tag LOCUS_34400 177027 173272 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028569.1 protein_id gnl|my_center|LOCUS_34400 176601 176624 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 178065 177145 gene locus_tag LOCUS_34410 178065 177145 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135794525.1 protein_id gnl|my_center|LOCUS_34410 179813 178128 gene locus_tag LOCUS_34420 179813 178128 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028574.1 protein_id gnl|my_center|LOCUS_34420 180880 179912 gene locus_tag LOCUS_34430 gene speB 180880 179912 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895813.1 protein_id gnl|my_center|LOCUS_34430 182397 180937 gene locus_tag LOCUS_34440 182397 180937 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224493.1 protein_id gnl|my_center|LOCUS_34440 182595 184178 gene locus_tag LOCUS_34450 182595 184178 CDS product PucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742168.1 protein_id gnl|my_center|LOCUS_34450 184362 185150 gene locus_tag LOCUS_34460 184362 185150 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976029.1 protein_id gnl|my_center|LOCUS_34460 186042 185089 gene locus_tag LOCUS_34470 186042 185089 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028575.1 protein_id gnl|my_center|LOCUS_34470 186983 186111 gene locus_tag LOCUS_34480 186983 186111 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028576.1 protein_id gnl|my_center|LOCUS_34480 188187 187030 gene locus_tag LOCUS_34490 188187 187030 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028577.1 protein_id gnl|my_center|LOCUS_34490 188579 188486 gene locus_tag LOCUS_t00330 188579 188486 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 189131 190747 gene locus_tag LOCUS_34500 189131 190747 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028579.1 protein_id gnl|my_center|LOCUS_34500 190767 192719 gene locus_tag LOCUS_34510 190767 192719 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028580.1 protein_id gnl|my_center|LOCUS_34510 192716 193690 gene locus_tag LOCUS_34520 192716 193690 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028581.1 protein_id gnl|my_center|LOCUS_34520 193000 193020 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 193690 194850 gene locus_tag LOCUS_34530 193690 194850 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976021.1 protein_id gnl|my_center|LOCUS_34530 194997 196046 gene locus_tag LOCUS_34540 gene desE 194997 196046 CDS product siderophore-binding protein DesE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976020.1 protein_id gnl|my_center|LOCUS_34540 196268 197710 gene locus_tag LOCUS_34550 gene desA 196268 197710 CDS product lysine decarboxylase DesA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028583.1 protein_id gnl|my_center|LOCUS_34550 197694 198986 gene locus_tag LOCUS_34560 197694 198986 CDS product lysine N(6)-hydroxylase/L-ornithine N(5)-oxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326291.1 protein_id gnl|my_center|LOCUS_34560 198983 199543 gene locus_tag LOCUS_34570 198983 199543 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976016.1 protein_id gnl|my_center|LOCUS_34570 199540 201426 gene locus_tag LOCUS_34580 gene desD 199540 201426 CDS product desferrioxamine E synthetase DesD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028585.1 protein_id gnl|my_center|LOCUS_34580 203054 201390 gene locus_tag LOCUS_34590 203054 201390 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028586.1 protein_id gnl|my_center|LOCUS_34590 203140 204042 gene locus_tag LOCUS_34600 203140 204042 CDS product DUF4429 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976013.1 protein_id gnl|my_center|LOCUS_34600 204850 204077 gene locus_tag LOCUS_34610 204850 204077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34610 204818 204845 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 205020 205712 gene locus_tag LOCUS_34620 205020 205712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34620 205878 206111 gene locus_tag LOCUS_34630 205878 206111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976012.1 protein_id gnl|my_center|LOCUS_34630 206144 207961 gene locus_tag LOCUS_34640 gene glmS 206144 207961 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976011.1 protein_id gnl|my_center|LOCUS_34640 208621 208058 gene locus_tag LOCUS_34650 208621 208058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34650 209285 208758 gene locus_tag LOCUS_34660 209285 208758 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976010.1 protein_id gnl|my_center|LOCUS_34660 209626 209973 gene locus_tag LOCUS_34670 209626 209973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34670 210353 211609 gene locus_tag LOCUS_34680 210353 211609 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028588.1 protein_id gnl|my_center|LOCUS_34680 211758 212366 gene locus_tag LOCUS_34690 gene orn 211758 212366 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976007.1 protein_id gnl|my_center|LOCUS_34690 212479 212552 gene locus_tag LOCUS_t00340 212479 212552 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 213744 212689 gene locus_tag LOCUS_34700 213744 212689 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976006.1 protein_id gnl|my_center|LOCUS_34700 214146 215474 gene locus_tag LOCUS_34710 214146 215474 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028589.1 protein_id gnl|my_center|LOCUS_34710 215480 216493 gene locus_tag LOCUS_34720 215480 216493 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028590.1 protein_id gnl|my_center|LOCUS_34720 216505 217431 gene locus_tag LOCUS_34730 216505 217431 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028591.1 protein_id gnl|my_center|LOCUS_34730 217578 217625 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 217712 219148 gene locus_tag LOCUS_34740 217712 219148 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976002.1 protein_id gnl|my_center|LOCUS_34740 220724 219264 gene locus_tag LOCUS_34750 220724 219264 CDS product cellulose binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028592.1 protein_id gnl|my_center|LOCUS_34750 222315 220942 gene locus_tag LOCUS_34760 222315 220942 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976000.1 protein_id gnl|my_center|LOCUS_34760 223016 222312 gene locus_tag LOCUS_34770 223016 222312 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326297.1 protein_id gnl|my_center|LOCUS_34770 223015 223683 gene locus_tag LOCUS_34780 223015 223683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270050.1 protein_id gnl|my_center|LOCUS_34780 224575 223706 gene locus_tag LOCUS_34790 224575 223706 CDS product fused MFS/spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028594.1 protein_id gnl|my_center|LOCUS_34790 225057 224662 gene locus_tag LOCUS_34800 225057 224662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975996.1 protein_id gnl|my_center|LOCUS_34800 225342 226820 gene locus_tag LOCUS_34810 225342 226820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028595.1 protein_id gnl|my_center|LOCUS_34810 227457 226861 gene locus_tag LOCUS_34820 227457 226861 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028596.1 protein_id gnl|my_center|LOCUS_34820 227714 228673 gene locus_tag LOCUS_34830 227714 228673 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028597.1 protein_id gnl|my_center|LOCUS_34830 228570 229775 gene locus_tag LOCUS_34840 228570 229775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485125.1 protein_id gnl|my_center|LOCUS_34840 229766 231364 gene locus_tag LOCUS_34850 229766 231364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484926.1 protein_id gnl|my_center|LOCUS_34850 231361 232755 gene locus_tag LOCUS_34860 231361 232755 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975990.1 protein_id gnl|my_center|LOCUS_34860 233111 233485 gene locus_tag LOCUS_34870 233111 233485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975980.1 protein_id gnl|my_center|LOCUS_34870 233618 234220 gene locus_tag LOCUS_34880 233618 234220 CDS product bifunctional DNA primase/polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028603.1 protein_id gnl|my_center|LOCUS_34880 234274 234308 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 235747 234362 gene locus_tag LOCUS_34890 235747 234362 CDS product M6 family metalloprotease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028602.1 protein_id gnl|my_center|LOCUS_34890 235770 235800 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 236277 238268 gene locus_tag LOCUS_34900 236277 238268 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975983.1 protein_id gnl|my_center|LOCUS_34900 239409 238285 gene locus_tag LOCUS_34910 239409 238285 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028601.1 protein_id gnl|my_center|LOCUS_34910 240709 239555 gene locus_tag LOCUS_34920 240709 239555 CDS product glutathione-independent formaldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974908.1 protein_id gnl|my_center|LOCUS_34920 241650 240919 gene locus_tag LOCUS_34930 241650 240919 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975978.1 protein_id gnl|my_center|LOCUS_34930 241803 242723 gene locus_tag LOCUS_34940 gene ehuB 241803 242723 CDS product ectoine/hydroxyectoine ABC transporter substrate-binding protein EhuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975972.1 protein_id gnl|my_center|LOCUS_34940 242720 243448 gene locus_tag LOCUS_34950 gene ehuC 242720 243448 CDS product ectoine/hydroxyectoine ABC transporter permease subunit EhuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975971.1 protein_id gnl|my_center|LOCUS_34950 243445 244095 gene locus_tag LOCUS_34960 gene ehuD 243445 244095 CDS product ectoine/hydroxyectoine ABC transporter permease subunit EhuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975970.1 protein_id gnl|my_center|LOCUS_34960 244085 244894 gene locus_tag LOCUS_34970 gene ehuA 244085 244894 CDS product ectoine/hydroxyectoine ABC transporter ATP-binding protein EhuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975969.1 protein_id gnl|my_center|LOCUS_34970 245032 245817 gene locus_tag LOCUS_34980 245032 245817 CDS product IclR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030866451.1 protein_id gnl|my_center|LOCUS_34980 245617 245643 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 245912 245986 gene locus_tag LOCUS_t00350 245912 245986 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 246664 246059 gene locus_tag LOCUS_34990 246664 246059 CDS product lytic polysaccharide monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975967.1 protein_id gnl|my_center|LOCUS_34990 246724 246746 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 247855 246791 gene locus_tag LOCUS_35000 247855 246791 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975966.1 protein_id gnl|my_center|LOCUS_35000 248971 247940 gene locus_tag LOCUS_35010 248971 247940 CDS product peptidoglycan-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028607.1 protein_id gnl|my_center|LOCUS_35010 249100 249026 gene locus_tag LOCUS_t00360 249100 249026 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 249288 251225 gene locus_tag LOCUS_35020 249288 251225 CDS product cellulose synthase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028608.1 protein_id gnl|my_center|LOCUS_35020 251222 253159 gene locus_tag LOCUS_35030 251222 253159 CDS product kelch motif-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028609.1 protein_id gnl|my_center|LOCUS_35030 253735 253187 gene locus_tag LOCUS_35040 253735 253187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35040 254268 253621 gene locus_tag LOCUS_35050 254268 253621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35050 253884 253909 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 255217 254552 gene locus_tag LOCUS_35060 255217 254552 CDS product class F sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028613.1 protein_id gnl|my_center|LOCUS_35060 255303 255330 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 256514 255735 gene locus_tag LOCUS_35070 256514 255735 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975956.1 protein_id gnl|my_center|LOCUS_35070 257475 256627 gene locus_tag LOCUS_35080 257475 256627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35080 258786 257578 gene locus_tag LOCUS_35090 258786 257578 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975954.1 protein_id gnl|my_center|LOCUS_35090 258870 259949 gene locus_tag LOCUS_35100 258870 259949 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975953.1 protein_id gnl|my_center|LOCUS_35100 259946 260554 gene locus_tag LOCUS_35110 259946 260554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35110 260653 261531 gene locus_tag LOCUS_35120 260653 261531 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975951.1 protein_id gnl|my_center|LOCUS_35120 262452 261595 gene locus_tag LOCUS_35130 262452 261595 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028618.1 protein_id gnl|my_center|LOCUS_35130 263340 262612 gene locus_tag LOCUS_35140 263340 262612 CDS product YidC/Oxa1 family membrane protein insertase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028619.1 protein_id gnl|my_center|LOCUS_35140 263768 263442 gene locus_tag LOCUS_35150 263768 263442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35150 264371 263832 gene locus_tag LOCUS_35160 264371 263832 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326320.1 protein_id gnl|my_center|LOCUS_35160 264478 265908 gene locus_tag LOCUS_35170 264478 265908 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028622.1 protein_id gnl|my_center|LOCUS_35170 266704 265886 gene locus_tag LOCUS_35180 266704 265886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35180 266849 267880 gene locus_tag LOCUS_35190 266849 267880 CDS product SEC-C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028623.1 protein_id gnl|my_center|LOCUS_35190 268947 268255 gene locus_tag LOCUS_35200 268947 268255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030998.1 protein_id gnl|my_center|LOCUS_35200 269139 272306 gene locus_tag LOCUS_35210 269139 272306 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189742338.1 protein_id gnl|my_center|LOCUS_35210 272867 272328 gene locus_tag LOCUS_35220 272867 272328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35220 273039 273887 gene locus_tag LOCUS_35230 273039 273887 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028631.1 protein_id gnl|my_center|LOCUS_35230 273884 274081 gene locus_tag LOCUS_35240 273884 274081 CDS product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974539.1 protein_id gnl|my_center|LOCUS_35240 274142 274564 gene locus_tag LOCUS_35250 274142 274564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35250 274447 274740 gene locus_tag LOCUS_35260 274447 274740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35260 275769 275296 gene locus_tag LOCUS_35270 275769 275296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35270 276308 275889 gene locus_tag LOCUS_35280 276308 275889 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224922.1 protein_id gnl|my_center|LOCUS_35280 276473 276775 gene locus_tag LOCUS_35290 276473 276775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028647.1 protein_id gnl|my_center|LOCUS_35290 277322 276849 gene locus_tag LOCUS_35300 277322 276849 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028645.1 protein_id gnl|my_center|LOCUS_35300 278526 277498 gene locus_tag LOCUS_35310 278526 277498 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027239.1 protein_id gnl|my_center|LOCUS_35310 278572 279216 gene locus_tag LOCUS_35320 278572 279216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35320 280732 279188 gene locus_tag LOCUS_35330 280732 279188 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028648.1 protein_id gnl|my_center|LOCUS_35330 280731 281057 gene locus_tag LOCUS_35340 280731 281057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35340 282497 281163 gene locus_tag LOCUS_35350 282497 281163 CDS product DUF445 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222356.1 protein_id gnl|my_center|LOCUS_35350 282803 284137 gene locus_tag LOCUS_35360 282803 284137 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028649.1 protein_id gnl|my_center|LOCUS_35360 284968 284213 gene locus_tag LOCUS_35370 284968 284213 CDS product DUF1707 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028650.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_35370 285994 284978 gene locus_tag LOCUS_35380 285994 284978 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030865419.1 protein_id gnl|my_center|LOCUS_35380 286934 286116 gene locus_tag LOCUS_35390 286934 286116 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028652.1 protein_id gnl|my_center|LOCUS_35390 287643 286927 gene locus_tag LOCUS_35400 287643 286927 CDS product ABC-2 family transporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975914.1 protein_id gnl|my_center|LOCUS_35400 287931 291056 gene locus_tag LOCUS_35410 287931 291056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35410 291533 291177 gene locus_tag LOCUS_35420 291533 291177 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975911.1 protein_id gnl|my_center|LOCUS_35420 291918 291589 gene locus_tag LOCUS_35430 291918 291589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35430 292055 292522 gene locus_tag LOCUS_35440 gene bcp 292055 292522 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730061.1 protein_id gnl|my_center|LOCUS_35440 292597 293031 gene locus_tag LOCUS_35450 292597 293031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35450 293043 293115 gene locus_tag LOCUS_t00370 293043 293115 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 293771 293169 gene locus_tag LOCUS_35460 gene rdgB 293771 293169 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028655.1 protein_id gnl|my_center|LOCUS_35460 294196 293783 gene locus_tag LOCUS_35470 294196 293783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975907.1 protein_id gnl|my_center|LOCUS_35470 295056 294322 gene locus_tag LOCUS_35480 gene rph 295056 294322 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975906.1 protein_id gnl|my_center|LOCUS_35480 295409 295176 gene locus_tag LOCUS_35490 295409 295176 CDS product PTS glucose/sucrose transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975905.1 protein_id gnl|my_center|LOCUS_35490 295584 295607 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 295632 296936 gene locus_tag LOCUS_35500 295632 296936 CDS product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028656.1 protein_id gnl|my_center|LOCUS_35500 297061 298314 gene locus_tag LOCUS_35510 297061 298314 CDS product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028657.1 protein_id gnl|my_center|LOCUS_35510 299135 298383 gene locus_tag LOCUS_35520 299135 298383 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975902.1 protein_id gnl|my_center|LOCUS_35520 299352 299807 gene locus_tag LOCUS_35530 299352 299807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35530 300380 299820 gene locus_tag LOCUS_35540 300380 299820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35540 302609 300540 gene locus_tag LOCUS_35550 302609 300540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35550 303867 302917 gene locus_tag LOCUS_35560 303867 302917 CDS product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975900.1 protein_id gnl|my_center|LOCUS_35560 304218 303874 gene locus_tag LOCUS_35570 304218 303874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35570 305028 304546 gene locus_tag LOCUS_35580 305028 304546 CDS product M67 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028660.1 protein_id gnl|my_center|LOCUS_35580 306574 305135 gene locus_tag LOCUS_35590 306574 305135 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028661.1 protein_id gnl|my_center|LOCUS_35590 307521 306904 gene locus_tag LOCUS_35600 307521 306904 CDS product DUF2017 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975896.1 protein_id gnl|my_center|LOCUS_35600 307908 307591 gene locus_tag LOCUS_35610 gene clpS 307908 307591 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030180153.1 protein_id gnl|my_center|LOCUS_35610 308057 309376 gene locus_tag LOCUS_35620 308057 309376 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028662.1 protein_id gnl|my_center|LOCUS_35620 309526 310113 gene locus_tag LOCUS_35630 309526 310113 CDS product nicotinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975893.1 protein_id gnl|my_center|LOCUS_35630 310143 310170 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 313013 310722 gene locus_tag LOCUS_35640 313013 310722 CDS product immune inhibitor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028663.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35640 311107 311131 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 313408 313749 gene locus_tag LOCUS_35650 313408 313749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35650 314448 313777 gene locus_tag LOCUS_35660 314448 313777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35660 316047 314521 gene locus_tag LOCUS_35670 316047 314521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35670 316317 316730 gene locus_tag LOCUS_35680 316317 316730 CDS product SsgA family sporulation/cell division regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975886.1 protein_id gnl|my_center|LOCUS_35680 317394 316759 gene locus_tag LOCUS_35690 317394 316759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35690 318185 317355 gene locus_tag LOCUS_35700 318185 317355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35700 317438 317463 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 318309 320258 gene locus_tag LOCUS_35710 318309 320258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35710 319420 319444 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 320758 320153 gene locus_tag LOCUS_35720 gene nthA 320758 320153 CDS product nitrile hydratase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174055.1 protein_id gnl|my_center|LOCUS_35720 320555 320578 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 321032 320748 gene locus_tag LOCUS_35730 321032 320748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35730 321306 321025 gene locus_tag LOCUS_35740 321306 321025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35740 322489 321341 gene locus_tag LOCUS_35750 gene hppD 322489 321341 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975883.1 protein_id gnl|my_center|LOCUS_35750 322615 323082 gene locus_tag LOCUS_35760 322615 323082 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028667.1 protein_id gnl|my_center|LOCUS_35760 323906 323115 gene locus_tag LOCUS_35770 323906 323115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028670.1 protein_id gnl|my_center|LOCUS_35770 324695 324111 gene locus_tag LOCUS_35780 324695 324111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35780 324824 324845 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 326006 325239 gene locus_tag LOCUS_35790 326006 325239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225316.1 protein_id gnl|my_center|LOCUS_35790 326113 327666 gene locus_tag LOCUS_35800 326113 327666 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224529.1 protein_id gnl|my_center|LOCUS_35800 328824 327685 gene locus_tag LOCUS_35810 gene dapE 328824 327685 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030079.1 protein_id gnl|my_center|LOCUS_35810 330329 328821 gene locus_tag LOCUS_35820 330329 328821 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228708.1 protein_id gnl|my_center|LOCUS_35820 >Feature sequence009 115 684 gene locus_tag LOCUS_35830 115 684 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974845.1 protein_id gnl|my_center|LOCUS_35830 2296 713 gene locus_tag LOCUS_35840 2296 713 CDS product type IV secretory system conjugative DNA transfer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029453.1 protein_id gnl|my_center|LOCUS_35840 3738 2326 gene locus_tag LOCUS_35850 3738 2326 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974843.1 protein_id gnl|my_center|LOCUS_35850 5312 3753 gene locus_tag LOCUS_35860 5312 3753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326782.1 protein_id gnl|my_center|LOCUS_35860 6655 5309 gene locus_tag LOCUS_35870 6655 5309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173668748.1 protein_id gnl|my_center|LOCUS_35870 7493 6645 gene locus_tag LOCUS_35880 7493 6645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029454.1 protein_id gnl|my_center|LOCUS_35880 7981 8011 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8814 9611 gene locus_tag LOCUS_35890 8814 9611 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223253.1 protein_id gnl|my_center|LOCUS_35890 9694 9805 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9894 10895 gene locus_tag LOCUS_35900 gene tgdA 9894 10895 CDS product transglycosylase TgdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029455.1 protein_id gnl|my_center|LOCUS_35900 11167 11877 gene locus_tag LOCUS_35910 11167 11877 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974837.1 protein_id gnl|my_center|LOCUS_35910 13629 12049 gene locus_tag LOCUS_35920 13629 12049 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222690.1 protein_id gnl|my_center|LOCUS_35920 13952 15082 gene locus_tag LOCUS_35930 gene pstS 13952 15082 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974827.1 protein_id gnl|my_center|LOCUS_35930 15194 16201 gene locus_tag LOCUS_35940 gene pstC 15194 16201 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029460.1 protein_id gnl|my_center|LOCUS_35940 16198 17262 gene locus_tag LOCUS_35950 gene pstA 16198 17262 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974829.1 protein_id gnl|my_center|LOCUS_35950 17309 18085 gene locus_tag LOCUS_35960 gene pstB 17309 18085 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974830.1 protein_id gnl|my_center|LOCUS_35960 18419 18219 gene locus_tag LOCUS_35970 18419 18219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35970 19449 18451 gene locus_tag LOCUS_35980 gene pitH 19449 18451 CDS product low-affinity phosphate transporter PitH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029459.1 protein_id gnl|my_center|LOCUS_35980 20077 19457 gene locus_tag LOCUS_35990 20077 19457 CDS product DUF47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974832.1 protein_id gnl|my_center|LOCUS_35990 20387 20169 gene locus_tag LOCUS_36000 20387 20169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36000 20296 20667 gene locus_tag LOCUS_36010 20296 20667 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029458.1 protein_id gnl|my_center|LOCUS_36010 20910 20731 gene locus_tag LOCUS_36020 20910 20731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36020 21803 21021 gene locus_tag LOCUS_36030 21803 21021 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029457.1 protein_id gnl|my_center|LOCUS_36030 22184 22014 gene locus_tag LOCUS_36040 22184 22014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36040 22625 22203 gene locus_tag LOCUS_36050 22625 22203 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029461.1 protein_id gnl|my_center|LOCUS_36050 23821 22643 gene locus_tag LOCUS_36060 23821 22643 CDS product CHAD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487611.1 protein_id gnl|my_center|LOCUS_36060 26198 23802 gene locus_tag LOCUS_36070 26198 23802 CDS product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270140.1 protein_id gnl|my_center|LOCUS_36070 27368 26295 gene locus_tag LOCUS_36080 27368 26295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36080 28270 27365 gene locus_tag LOCUS_36090 28270 27365 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978035.1 protein_id gnl|my_center|LOCUS_36090 28704 28267 gene locus_tag LOCUS_36100 28704 28267 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978036.1 protein_id gnl|my_center|LOCUS_36100 28804 29343 gene locus_tag LOCUS_36110 28804 29343 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029464.1 protein_id gnl|my_center|LOCUS_36110 29340 30446 gene locus_tag LOCUS_36120 29340 30446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36120 30443 31318 gene locus_tag LOCUS_36130 30443 31318 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029465.1 protein_id gnl|my_center|LOCUS_36130 31992 31366 gene locus_tag LOCUS_36140 31992 31366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36140 32313 31996 gene locus_tag LOCUS_36150 32313 31996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36150 32426 32929 gene locus_tag LOCUS_36160 32426 32929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36160 32947 33624 gene locus_tag LOCUS_36170 32947 33624 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168715281.1 protein_id gnl|my_center|LOCUS_36170 34501 33581 gene locus_tag LOCUS_36180 gene mshD 34501 33581 CDS product mycothiol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974818.1 protein_id gnl|my_center|LOCUS_36180 36068 34602 gene locus_tag LOCUS_36190 36068 34602 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029471.1 protein_id gnl|my_center|LOCUS_36190 36805 36065 gene locus_tag LOCUS_36200 36805 36065 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029472.1 protein_id gnl|my_center|LOCUS_36200 37171 36932 gene locus_tag LOCUS_36210 37171 36932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36210 38302 37226 gene locus_tag LOCUS_36220 38302 37226 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186009689.1 protein_id gnl|my_center|LOCUS_36220 39463 38441 gene locus_tag LOCUS_36230 39463 38441 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974813.1 protein_id gnl|my_center|LOCUS_36230 39854 39624 gene locus_tag LOCUS_36240 39854 39624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36240 39970 40455 gene locus_tag LOCUS_36250 39970 40455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36250 39973 40006 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 40683 41552 gene locus_tag LOCUS_36260 40683 41552 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974811.1 protein_id gnl|my_center|LOCUS_36260 41602 41856 gene locus_tag LOCUS_36270 41602 41856 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974810.1 protein_id gnl|my_center|LOCUS_36270 41860 43077 gene locus_tag LOCUS_36280 41860 43077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029476.1 protein_id gnl|my_center|LOCUS_36280 43220 43915 gene locus_tag LOCUS_36290 43220 43915 CDS product DUF2993 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974808.1 protein_id gnl|my_center|LOCUS_36290 44339 45205 gene locus_tag LOCUS_36300 44339 45205 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974806.1 protein_id gnl|my_center|LOCUS_36300 45023 45043 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 45243 45530 gene locus_tag LOCUS_36310 45243 45530 CDS product DUF1416 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974805.1 protein_id gnl|my_center|LOCUS_36310 45630 45887 gene locus_tag LOCUS_36320 45630 45887 CDS product DUF3099 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326801.1 protein_id gnl|my_center|LOCUS_36320 46343 45981 gene locus_tag LOCUS_36330 46343 45981 CDS product DsrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974797.1 protein_id gnl|my_center|LOCUS_36330 46524 47234 gene locus_tag LOCUS_36340 46524 47234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487454.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36340 47231 48085 gene locus_tag LOCUS_36350 47231 48085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029482.1 protein_id gnl|my_center|LOCUS_36350 48082 48933 gene locus_tag LOCUS_36360 48082 48933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029483.1 protein_id gnl|my_center|LOCUS_36360 49173 49748 gene locus_tag LOCUS_36370 49173 49748 CDS product FABP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974791.1 protein_id gnl|my_center|LOCUS_36370 49777 50214 gene locus_tag LOCUS_36380 49777 50214 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974790.1 protein_id gnl|my_center|LOCUS_36380 50225 51190 gene locus_tag LOCUS_36390 50225 51190 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974789.1 protein_id gnl|my_center|LOCUS_36390 51721 51230 gene locus_tag LOCUS_36400 gene dtd 51721 51230 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029487.1 protein_id gnl|my_center|LOCUS_36400 51876 52463 gene locus_tag LOCUS_36410 51876 52463 CDS product aerial mycelium formation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029488.1 protein_id gnl|my_center|LOCUS_36410 52553 53533 gene locus_tag LOCUS_36420 52553 53533 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974786.1 protein_id gnl|my_center|LOCUS_36420 53660 54928 gene locus_tag LOCUS_36430 53660 54928 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974785.1 protein_id gnl|my_center|LOCUS_36430 55169 54984 gene locus_tag LOCUS_36440 55169 54984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36440 55313 56212 gene locus_tag LOCUS_36450 55313 56212 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029489.1 protein_id gnl|my_center|LOCUS_36450 56499 56311 gene locus_tag LOCUS_36460 56499 56311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029490.1 protein_id gnl|my_center|LOCUS_36460 56699 57556 gene locus_tag LOCUS_36470 56699 57556 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974781.1 protein_id gnl|my_center|LOCUS_36470 57586 58305 gene locus_tag LOCUS_36480 57586 58305 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974780.1 protein_id gnl|my_center|LOCUS_36480 58478 58296 gene locus_tag LOCUS_36490 58478 58296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36490 58655 59527 gene locus_tag LOCUS_36500 58655 59527 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974781.1 protein_id gnl|my_center|LOCUS_36500 60298 59498 gene locus_tag LOCUS_36510 60298 59498 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974780.1 protein_id gnl|my_center|LOCUS_36510 60762 60793 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 60808 61632 gene locus_tag LOCUS_36520 60808 61632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36520 62736 61633 gene locus_tag LOCUS_36530 62736 61633 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971615.1 protein_id gnl|my_center|LOCUS_36530 62899 63441 gene locus_tag LOCUS_36540 62899 63441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36540 63634 64350 gene locus_tag LOCUS_36550 63634 64350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974772.1 protein_id gnl|my_center|LOCUS_36550 64444 64797 gene locus_tag LOCUS_36560 64444 64797 CDS product DUF2516 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868443.1 protein_id gnl|my_center|LOCUS_36560 66461 65124 gene locus_tag LOCUS_36570 66461 65124 CDS product fused response regulator/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487464.1 protein_id gnl|my_center|LOCUS_36570 67881 66766 gene locus_tag LOCUS_36580 67881 66766 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029498.1 protein_id gnl|my_center|LOCUS_36580 68922 68092 gene locus_tag LOCUS_36590 68922 68092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974768.1 protein_id gnl|my_center|LOCUS_36590 69166 70602 gene locus_tag LOCUS_36600 gene mshA 69166 70602 CDS product D-inositol-3-phosphate glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326818.1 protein_id gnl|my_center|LOCUS_36600 70607 71116 gene locus_tag LOCUS_36610 70607 71116 CDS product YbjN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974766.1 protein_id gnl|my_center|LOCUS_36610 71232 72917 gene locus_tag LOCUS_36620 71232 72917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36620 73183 72896 gene locus_tag LOCUS_36630 73183 72896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36630 73763 73212 gene locus_tag LOCUS_36640 73763 73212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36640 73265 73286 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 73813 74271 gene locus_tag LOCUS_36650 73813 74271 CDS product DUF2000 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974764.1 protein_id gnl|my_center|LOCUS_36650 75579 74302 gene locus_tag LOCUS_36660 75579 74302 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029501.1 protein_id gnl|my_center|LOCUS_36660 75774 76535 gene locus_tag LOCUS_36670 75774 76535 CDS product phosphoglyceromutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974762.1 protein_id gnl|my_center|LOCUS_36670 76872 77468 gene locus_tag LOCUS_36680 76872 77468 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973718.1 protein_id gnl|my_center|LOCUS_36680 77709 78074 gene locus_tag LOCUS_36690 77709 78074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36690 78190 78789 gene locus_tag LOCUS_36700 78190 78789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36700 78821 79333 gene locus_tag LOCUS_36710 78821 79333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36710 80919 79309 gene locus_tag LOCUS_36720 80919 79309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36720 82707 81052 gene locus_tag LOCUS_36730 82707 81052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36730 82601 82942 gene locus_tag LOCUS_36740 82601 82942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36740 83728 83195 gene locus_tag LOCUS_36750 83728 83195 CDS product lamin tail domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167469843.1 protein_id gnl|my_center|LOCUS_36750 84277 84089 gene locus_tag LOCUS_36760 84277 84089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36760 85057 84368 gene locus_tag LOCUS_36770 gene phoU 85057 84368 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974747.1 protein_id gnl|my_center|LOCUS_36770 85246 86559 gene locus_tag LOCUS_36780 85246 86559 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974746.1 protein_id gnl|my_center|LOCUS_36780 86556 87236 gene locus_tag LOCUS_36790 86556 87236 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974745.1 protein_id gnl|my_center|LOCUS_36790 88017 87325 gene locus_tag LOCUS_36800 88017 87325 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029520.1 protein_id gnl|my_center|LOCUS_36800 88261 88073 gene locus_tag LOCUS_36810 88261 88073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36810 88699 89181 gene locus_tag LOCUS_36820 88699 89181 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003953493.1 protein_id gnl|my_center|LOCUS_36820 89494 90330 gene locus_tag LOCUS_36830 gene ispD 89494 90330 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029521.1 protein_id gnl|my_center|LOCUS_36830 90320 90817 gene locus_tag LOCUS_36840 gene ispF 90320 90817 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029522.1 protein_id gnl|my_center|LOCUS_36840 90875 91279 gene locus_tag LOCUS_36850 90875 91279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36850 91341 92828 gene locus_tag LOCUS_36860 gene cysS 91341 92828 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868385.1 protein_id gnl|my_center|LOCUS_36860 91368 91397 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 92971 93912 gene locus_tag LOCUS_36870 gene rlmB 92971 93912 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029524.1 protein_id gnl|my_center|LOCUS_36870 93980 94011 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 94098 95840 gene locus_tag LOCUS_36880 94098 95840 CDS product DoxX family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063739108.1 protein_id gnl|my_center|LOCUS_36880 96089 98716 gene locus_tag LOCUS_36890 gene lanKC 96089 98716 CDS product class III lanthionine synthetase LanKC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162495285.1 protein_id gnl|my_center|LOCUS_36890 98750 98878 gene locus_tag LOCUS_36900 98750 98878 CDS product SapB/AmfS family lanthipeptide inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972313.1 protein_id gnl|my_center|LOCUS_36900 99003 100874 gene locus_tag LOCUS_36910 99003 100874 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031101.1 protein_id gnl|my_center|LOCUS_36910 100871 102040 gene locus_tag LOCUS_36920 100871 102040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36920 101866 101894 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 102037 102732 gene locus_tag LOCUS_36930 102037 102732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36930 103340 102738 gene locus_tag LOCUS_36940 103340 102738 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226387.1 protein_id gnl|my_center|LOCUS_36940 104442 103708 gene locus_tag LOCUS_36950 104442 103708 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974737.1 protein_id gnl|my_center|LOCUS_36950 104996 104535 gene locus_tag LOCUS_36960 104996 104535 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029526.1 protein_id gnl|my_center|LOCUS_36960 106371 105235 gene locus_tag LOCUS_36970 gene msiK 106371 105235 CDS product diacetylchitobiose ABC transporter ATP-binding protein MsiK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029527.1 protein_id gnl|my_center|LOCUS_36970 106616 106691 gene locus_tag LOCUS_t00380 106616 106691 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 108673 106766 gene locus_tag LOCUS_36980 108673 106766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36980 108920 110053 gene locus_tag LOCUS_36990 108920 110053 CDS product SchA/CurD-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971691.1 protein_id gnl|my_center|LOCUS_36990 110097 110543 gene locus_tag LOCUS_37000 110097 110543 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973653.1 protein_id gnl|my_center|LOCUS_37000 110540 111793 gene locus_tag LOCUS_37010 110540 111793 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973654.1 protein_id gnl|my_center|LOCUS_37010 111814 113061 gene locus_tag LOCUS_37020 111814 113061 CDS product ketosynthase chain-length factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030171.1 protein_id gnl|my_center|LOCUS_37020 113136 113393 gene locus_tag LOCUS_37030 113136 113393 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030170.1 protein_id gnl|my_center|LOCUS_37030 113397 113882 gene locus_tag LOCUS_37040 113397 113882 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973657.1 protein_id gnl|my_center|LOCUS_37040 113929 114261 gene locus_tag LOCUS_37050 113929 114261 CDS product TcmI family type II polyketide cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030169.1 protein_id gnl|my_center|LOCUS_37050 115377 114349 gene locus_tag LOCUS_37060 115377 114349 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971690.1 protein_id gnl|my_center|LOCUS_37060 116502 115444 gene locus_tag LOCUS_37070 116502 115444 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971689.1 protein_id gnl|my_center|LOCUS_37070 116713 116531 gene locus_tag LOCUS_37080 116713 116531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37080 116676 117290 gene locus_tag LOCUS_37090 116676 117290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235191121.1 protein_id gnl|my_center|LOCUS_37090 117300 118706 gene locus_tag LOCUS_37100 117300 118706 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878659.1 protein_id gnl|my_center|LOCUS_37100 118883 121528 gene locus_tag LOCUS_37110 118883 121528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37110 123226 121634 gene locus_tag LOCUS_37120 123226 121634 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029543.1 protein_id gnl|my_center|LOCUS_37120 123725 123756 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 123801 124040 gene locus_tag LOCUS_37130 123801 124040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37130 124547 124047 gene locus_tag LOCUS_37140 124547 124047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974706.1 protein_id gnl|my_center|LOCUS_37140 124636 126003 gene locus_tag LOCUS_37150 124636 126003 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029546.1 protein_id gnl|my_center|LOCUS_37150 126520 126008 gene locus_tag LOCUS_37160 126520 126008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_37160 127258 126683 gene locus_tag LOCUS_37170 127258 126683 CDS product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974698.1 protein_id gnl|my_center|LOCUS_37170 127447 127884 gene locus_tag LOCUS_37180 gene arfB 127447 127884 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974697.1 protein_id gnl|my_center|LOCUS_37180 128549 127959 gene locus_tag LOCUS_37190 128549 127959 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109035270.1 protein_id gnl|my_center|LOCUS_37190 128896 130542 gene locus_tag LOCUS_37200 gene cdgB 128896 130542 CDS product diguanylate cyclase CdgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029551.1 protein_id gnl|my_center|LOCUS_37200 130661 131605 gene locus_tag LOCUS_37210 130661 131605 CDS product CBM35 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029552.1 protein_id gnl|my_center|LOCUS_37210 132541 131612 gene locus_tag LOCUS_37220 132541 131612 CDS product 1-phosphofructokinase family hexose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029553.1 protein_id gnl|my_center|LOCUS_37220 133869 132727 gene locus_tag LOCUS_37230 gene nagA 133869 132727 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029554.1 protein_id gnl|my_center|LOCUS_37230 134839 133877 gene locus_tag LOCUS_37240 134839 133877 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029555.1 protein_id gnl|my_center|LOCUS_37240 135071 134847 gene locus_tag LOCUS_37250 135071 134847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37250 135016 136245 gene locus_tag LOCUS_37260 135016 136245 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136207383.1 protein_id gnl|my_center|LOCUS_37260 136252 136587 gene locus_tag LOCUS_37270 136252 136587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37270 136732 137601 gene locus_tag LOCUS_37280 gene otsB 136732 137601 CDS product trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029558.1 protein_id gnl|my_center|LOCUS_37280 139156 137714 gene locus_tag LOCUS_37290 139156 137714 CDS product trehalose-6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029560.1 protein_id gnl|my_center|LOCUS_37290 140194 139250 gene locus_tag LOCUS_37300 140194 139250 CDS product glucosyl-3-phosphoglycerate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974682.1 protein_id gnl|my_center|LOCUS_37300 140507 141796 gene locus_tag LOCUS_37310 gene thrC 140507 141796 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270150.1 protein_id gnl|my_center|LOCUS_37310 141846 142121 gene locus_tag LOCUS_37320 141846 142121 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974680.1 protein_id gnl|my_center|LOCUS_37320 142596 142799 gene locus_tag LOCUS_37330 142596 142799 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004929928.1 protein_id gnl|my_center|LOCUS_37330 143180 144802 gene locus_tag LOCUS_37340 gene groL 143180 144802 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974678.1 protein_id gnl|my_center|LOCUS_37340 145243 145524 gene locus_tag LOCUS_37350 145243 145524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37350 145723 145511 gene locus_tag LOCUS_37360 145723 145511 CDS product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029565.1 protein_id gnl|my_center|LOCUS_37360 146546 145704 gene locus_tag LOCUS_37370 146546 145704 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029566.1 protein_id gnl|my_center|LOCUS_37370 146659 146892 gene locus_tag LOCUS_37380 146659 146892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37380 146889 147107 gene locus_tag LOCUS_37390 146889 147107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37390 147237 148370 gene locus_tag LOCUS_37400 147237 148370 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974677.1 protein_id gnl|my_center|LOCUS_37400 148656 148411 gene locus_tag LOCUS_37410 148656 148411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37410 148727 148757 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 151888 149141 gene locus_tag LOCUS_37420 151888 149141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37420 152034 153086 gene locus_tag LOCUS_37430 152034 153086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37430 154080 153145 gene locus_tag LOCUS_37440 gene murQ 154080 153145 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029570.1 protein_id gnl|my_center|LOCUS_37440 154969 154142 gene locus_tag LOCUS_37450 154969 154142 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974666.1 protein_id gnl|my_center|LOCUS_37450 154980 155159 gene locus_tag LOCUS_37460 154980 155159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37460 155209 155592 gene locus_tag LOCUS_37470 155209 155592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974665.1 protein_id gnl|my_center|LOCUS_37470 155589 155891 gene locus_tag LOCUS_37480 155589 155891 CDS product DUF4031 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974664.1 protein_id gnl|my_center|LOCUS_37480 156955 155849 gene locus_tag LOCUS_37490 156955 155849 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029571.1 protein_id gnl|my_center|LOCUS_37490 157661 157008 gene locus_tag LOCUS_37500 157661 157008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974662.1 protein_id gnl|my_center|LOCUS_37500 157743 158402 gene locus_tag LOCUS_37510 157743 158402 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029573.1 protein_id gnl|my_center|LOCUS_37510 158502 159227 gene locus_tag LOCUS_37520 158502 159227 CDS product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029574.1 protein_id gnl|my_center|LOCUS_37520 161445 159376 gene locus_tag LOCUS_37530 161445 159376 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029575.1 protein_id gnl|my_center|LOCUS_37530 161791 161979 gene locus_tag LOCUS_37540 161791 161979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974657.1 protein_id gnl|my_center|LOCUS_37540 162127 161984 gene locus_tag LOCUS_37550 162127 161984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37550 162078 163244 gene locus_tag LOCUS_37560 162078 163244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37560 164872 163199 gene locus_tag LOCUS_37570 164872 163199 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005063651.1 protein_id gnl|my_center|LOCUS_37570 167605 164942 gene locus_tag LOCUS_37580 167605 164942 CDS product helicase-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029578.1 protein_id gnl|my_center|LOCUS_37580 167851 168849 gene locus_tag LOCUS_37590 167851 168849 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029579.1 protein_id gnl|my_center|LOCUS_37590 168931 169563 gene locus_tag LOCUS_37600 168931 169563 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029580.1 protein_id gnl|my_center|LOCUS_37600 169805 169560 gene locus_tag LOCUS_37610 169805 169560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974651.1 protein_id gnl|my_center|LOCUS_37610 169970 170353 gene locus_tag LOCUS_37620 169970 170353 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974650.1 protein_id gnl|my_center|LOCUS_37620 171311 170454 gene locus_tag LOCUS_37630 171311 170454 CDS product 1,4-dihydroxy-6-naphthoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974649.1 protein_id gnl|my_center|LOCUS_37630 172092 171301 gene locus_tag LOCUS_37640 172092 171301 CDS product futalosine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326870.1 protein_id gnl|my_center|LOCUS_37640 172583 172110 gene locus_tag LOCUS_37650 172583 172110 CDS product DUF2771 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173668749.1 protein_id gnl|my_center|LOCUS_37650 172909 172691 gene locus_tag LOCUS_37660 172909 172691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37660 174138 172921 gene locus_tag LOCUS_37670 174138 172921 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029582.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37670 172933 172961 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 174306 174662 gene locus_tag LOCUS_37680 174306 174662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37680 174874 175797 gene locus_tag LOCUS_37690 174874 175797 CDS product DUF3027 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974645.1 protein_id gnl|my_center|LOCUS_37690 179076 175921 gene locus_tag LOCUS_37700 179076 175921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029583.1 protein_id gnl|my_center|LOCUS_37700 179161 179478 gene locus_tag LOCUS_37710 179161 179478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37710 181895 179499 gene locus_tag LOCUS_37720 181895 179499 CDS product HAD-IC family P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029584.1 protein_id gnl|my_center|LOCUS_37720 182389 182108 gene locus_tag LOCUS_37730 182389 182108 CDS product DUF2530 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029585.1 protein_id gnl|my_center|LOCUS_37730 182653 184104 gene locus_tag LOCUS_37740 182653 184104 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029586.1 protein_id gnl|my_center|LOCUS_37740 184309 184118 gene locus_tag LOCUS_37750 184309 184118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974640.1 protein_id gnl|my_center|LOCUS_37750 184475 184912 gene locus_tag LOCUS_37760 184475 184912 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974639.1 protein_id gnl|my_center|LOCUS_37760 185018 186292 gene locus_tag LOCUS_37770 185018 186292 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974638.1 protein_id gnl|my_center|LOCUS_37770 186928 186341 gene locus_tag LOCUS_37780 186928 186341 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030867169.1 protein_id gnl|my_center|LOCUS_37780 187050 187604 gene locus_tag LOCUS_37790 gene thpR 187050 187604 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029587.1 protein_id gnl|my_center|LOCUS_37790 188154 187756 gene locus_tag LOCUS_37800 188154 187756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37800 188224 188257 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 189445 188852 gene locus_tag LOCUS_37810 189445 188852 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030867169.1 protein_id gnl|my_center|LOCUS_37810 190222 189533 gene locus_tag LOCUS_37820 190222 189533 CDS product GDSL-type esterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974625.1 protein_id gnl|my_center|LOCUS_37820 190311 191366 gene locus_tag LOCUS_37830 190311 191366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37830 192803 191685 gene locus_tag LOCUS_37840 gene serC 192803 191685 CDS product phosphoserine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029607.1 protein_id gnl|my_center|LOCUS_37840 192949 195942 gene locus_tag LOCUS_37850 192949 195942 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029608.1 protein_id gnl|my_center|LOCUS_37850 196187 197164 gene locus_tag LOCUS_37860 196187 197164 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974609.1 protein_id gnl|my_center|LOCUS_37860 197269 198084 gene locus_tag LOCUS_37870 197269 198084 CDS product TIGR03084 family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270155.1 protein_id gnl|my_center|LOCUS_37870 198081 199787 gene locus_tag LOCUS_37880 198081 199787 CDS product DUF1446 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029617.1 protein_id gnl|my_center|LOCUS_37880 199784 201382 gene locus_tag LOCUS_37890 199784 201382 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974603.1 protein_id gnl|my_center|LOCUS_37890 201424 203265 gene locus_tag LOCUS_37900 201424 203265 CDS product biotin carboxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029618.1 protein_id gnl|my_center|LOCUS_37900 203321 204481 gene locus_tag LOCUS_37910 203321 204481 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029619.1 protein_id gnl|my_center|LOCUS_37910 204523 206124 gene locus_tag LOCUS_37920 204523 206124 CDS product 4-coumarate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029620.1 protein_id gnl|my_center|LOCUS_37920 206121 206855 gene locus_tag LOCUS_37930 206121 206855 CDS product enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974599.1 protein_id gnl|my_center|LOCUS_37930 206843 207499 gene locus_tag LOCUS_37940 206843 207499 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030867225.1 protein_id gnl|my_center|LOCUS_37940 208619 207519 gene locus_tag LOCUS_37950 208619 207519 CDS product citrate synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029624.1 protein_id gnl|my_center|LOCUS_37950 208926 209603 gene locus_tag LOCUS_37960 gene pdxH 208926 209603 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029623.1 protein_id gnl|my_center|LOCUS_37960 209777 210532 gene locus_tag LOCUS_37970 209777 210532 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974589.1 protein_id gnl|my_center|LOCUS_37970 210923 212371 gene locus_tag LOCUS_37980 210923 212371 CDS product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051815090.1 protein_id gnl|my_center|LOCUS_37980 213350 212376 gene locus_tag LOCUS_37990 213350 212376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37990 213851 214543 gene locus_tag LOCUS_38000 213851 214543 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974588.1 protein_id gnl|my_center|LOCUS_38000 215167 216255 gene locus_tag LOCUS_38010 215167 216255 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326902.1 protein_id gnl|my_center|LOCUS_38010 217956 216331 gene locus_tag LOCUS_38020 217956 216331 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029630.1 protein_id gnl|my_center|LOCUS_38020 218666 217953 gene locus_tag LOCUS_38030 218666 217953 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029631.1 protein_id gnl|my_center|LOCUS_38030 219636 218971 gene locus_tag LOCUS_38040 219636 218971 CDS product bifunctional DNA primase/polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974584.1 protein_id gnl|my_center|LOCUS_38040 219967 221352 gene locus_tag LOCUS_38050 219967 221352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029632.1 protein_id gnl|my_center|LOCUS_38050 221531 223375 gene locus_tag LOCUS_38060 221531 223375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38060 224518 223379 gene locus_tag LOCUS_38070 224518 223379 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974581.1 protein_id gnl|my_center|LOCUS_38070 224421 224729 gene locus_tag LOCUS_38080 224421 224729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38080 224861 225307 gene locus_tag LOCUS_38090 224861 225307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974580.1 protein_id gnl|my_center|LOCUS_38090 225378 226259 gene locus_tag LOCUS_38100 gene purU 225378 226259 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974579.1 protein_id gnl|my_center|LOCUS_38100 227569 226298 gene locus_tag LOCUS_38110 227569 226298 CDS product zf-HC2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029636.1 protein_id gnl|my_center|LOCUS_38110 228156 227566 gene locus_tag LOCUS_38120 228156 227566 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974573.1 protein_id gnl|my_center|LOCUS_38120 228494 228862 gene locus_tag LOCUS_38130 228494 228862 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974572.1 protein_id gnl|my_center|LOCUS_38130 229019 229531 gene locus_tag LOCUS_38140 gene calD 229019 229531 CDS product calcium binding protein CalD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974571.1 protein_id gnl|my_center|LOCUS_38140 231018 229510 gene locus_tag LOCUS_38150 231018 229510 CDS product cyclohexanecarboxylate-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730669.1 protein_id gnl|my_center|LOCUS_38150 231225 232427 gene locus_tag LOCUS_38160 231225 232427 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228941.1 protein_id gnl|my_center|LOCUS_38160 232427 234514 gene locus_tag LOCUS_38170 232427 234514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38170 233295 233331 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 234483 234506 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 235009 235512 gene locus_tag LOCUS_38180 235009 235512 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326908.1 protein_id gnl|my_center|LOCUS_38180 236829 235879 gene locus_tag LOCUS_38190 236829 235879 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228899.1 protein_id gnl|my_center|LOCUS_38190 236168 236191 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 236916 237830 gene locus_tag LOCUS_38200 236916 237830 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085741.1 protein_id gnl|my_center|LOCUS_38200 237923 239086 gene locus_tag LOCUS_38210 237923 239086 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113162.1 protein_id gnl|my_center|LOCUS_38210 239102 240151 gene locus_tag LOCUS_38220 239102 240151 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041170159.1 protein_id gnl|my_center|LOCUS_38220 240169 240693 gene locus_tag LOCUS_38230 240169 240693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38230 241365 240682 gene locus_tag LOCUS_38240 241365 240682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38240 241312 241629 gene locus_tag LOCUS_38250 241312 241629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38250 241482 241507 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 241944 243239 gene locus_tag LOCUS_38260 241944 243239 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029637.1 protein_id gnl|my_center|LOCUS_38260 243828 243220 gene locus_tag LOCUS_38270 243828 243220 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224396.1 protein_id gnl|my_center|LOCUS_38270 244759 243911 gene locus_tag LOCUS_38280 gene paaG 244759 243911 CDS product 2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase PaaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003528003.1 protein_id gnl|my_center|LOCUS_38280 247059 244756 gene locus_tag LOCUS_38290 247059 244756 CDS product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112541.1 protein_id gnl|my_center|LOCUS_38290 247119 247143 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 248461 247244 gene locus_tag LOCUS_38300 248461 247244 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029639.1 protein_id gnl|my_center|LOCUS_38300 248837 248858 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 248891 249115 gene locus_tag LOCUS_38310 248891 249115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38310 249112 249576 gene locus_tag LOCUS_38320 249112 249576 CDS product OB-fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965765.1 protein_id gnl|my_center|LOCUS_38320 249581 250192 gene locus_tag LOCUS_38330 249581 250192 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029640.1 protein_id gnl|my_center|LOCUS_38330 250273 251136 gene locus_tag LOCUS_38340 250273 251136 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028329.1 protein_id gnl|my_center|LOCUS_38340 251733 251152 gene locus_tag LOCUS_38350 251733 251152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38350 251994 251737 gene locus_tag LOCUS_38360 251994 251737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38360 252338 251991 gene locus_tag LOCUS_38370 252338 251991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38370 253173 252406 gene locus_tag LOCUS_38380 253173 252406 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029807.1 protein_id gnl|my_center|LOCUS_38380 252936 252962 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 253326 254141 gene locus_tag LOCUS_38390 253326 254141 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029809.1 protein_id gnl|my_center|LOCUS_38390 254138 254350 gene locus_tag LOCUS_38400 254138 254350 CDS product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029810.1 protein_id gnl|my_center|LOCUS_38400 255030 254365 gene locus_tag LOCUS_38410 255030 254365 CDS product pyridoxal 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974564.1 protein_id gnl|my_center|LOCUS_38410 256231 255059 gene locus_tag LOCUS_38420 256231 255059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064066.1 protein_id gnl|my_center|LOCUS_38420 256349 257551 gene locus_tag LOCUS_38430 256349 257551 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225715.1 protein_id gnl|my_center|LOCUS_38430 257548 258030 gene locus_tag LOCUS_38440 257548 258030 CDS product nitroreductase family deazaflavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467644.1 protein_id gnl|my_center|LOCUS_38440 258786 258061 gene locus_tag LOCUS_38450 258786 258061 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028934.1 protein_id gnl|my_center|LOCUS_38450 258776 259228 gene locus_tag LOCUS_38460 258776 259228 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975474.1 protein_id gnl|my_center|LOCUS_38460 259391 260800 gene locus_tag LOCUS_38470 259391 260800 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225752.1 protein_id gnl|my_center|LOCUS_38470 261586 260939 gene locus_tag LOCUS_38480 261586 260939 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974562.1 protein_id gnl|my_center|LOCUS_38480 261757 262437 gene locus_tag LOCUS_38490 261757 262437 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029642.1 protein_id gnl|my_center|LOCUS_38490 262637 264976 gene locus_tag LOCUS_38500 262637 264976 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029643.1 protein_id gnl|my_center|LOCUS_38500 265160 265720 gene locus_tag LOCUS_38510 265160 265720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029644.1 protein_id gnl|my_center|LOCUS_38510 266530 265757 gene locus_tag LOCUS_38520 266530 265757 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228963.1 protein_id gnl|my_center|LOCUS_38520 266943 266527 gene locus_tag LOCUS_38530 266943 266527 CDS product OB-fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467030.1 protein_id gnl|my_center|LOCUS_38530 268108 266954 gene locus_tag LOCUS_38540 268108 266954 CDS product lipid-transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730955.1 protein_id gnl|my_center|LOCUS_38540 268219 269847 gene locus_tag LOCUS_38550 268219 269847 CDS product FadD3 family acyl-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071020870.1 protein_id gnl|my_center|LOCUS_38550 268827 268853 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 270143 269952 gene locus_tag LOCUS_38560 270143 269952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38560 270809 270435 gene locus_tag LOCUS_38570 270809 270435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38570 271843 270734 gene locus_tag LOCUS_38580 271843 270734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38580 271075 271103 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 272898 271840 gene locus_tag LOCUS_38590 272898 271840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38590 271844 271878 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 273515 272853 gene locus_tag LOCUS_38600 273515 272853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38600 272944 272966 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 273724 274983 gene locus_tag LOCUS_38610 273724 274983 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228941.1 protein_id gnl|my_center|LOCUS_38610 274980 275930 gene locus_tag LOCUS_38620 274980 275930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38620 275939 276709 gene locus_tag LOCUS_38630 275939 276709 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224298.1 protein_id gnl|my_center|LOCUS_38630 276831 277949 gene locus_tag LOCUS_38640 276831 277949 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730143.1 protein_id gnl|my_center|LOCUS_38640 278784 278808 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 278840 279745 gene locus_tag LOCUS_38650 278840 279745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38650 279742 281193 gene locus_tag LOCUS_38660 279742 281193 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225133.1 protein_id gnl|my_center|LOCUS_38660 281592 281197 gene locus_tag LOCUS_38670 281592 281197 CDS product nitroreductase family deazaflavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029646.1 protein_id gnl|my_center|LOCUS_38670 281754 284294 gene locus_tag LOCUS_38680 281754 284294 CDS product bifunctional FO biosynthesis protein CofGH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029648.1 protein_id gnl|my_center|LOCUS_38680 284379 284945 gene locus_tag LOCUS_38690 284379 284945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189284288.1 protein_id gnl|my_center|LOCUS_38690 285042 286160 gene locus_tag LOCUS_38700 285042 286160 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974547.1 protein_id gnl|my_center|LOCUS_38700 287731 286142 gene locus_tag LOCUS_38710 287731 286142 CDS product Na+:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029652.1 protein_id gnl|my_center|LOCUS_38710 288644 287859 gene locus_tag LOCUS_38720 288644 287859 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083761.1 protein_id gnl|my_center|LOCUS_38720 288736 289671 gene locus_tag LOCUS_38730 288736 289671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38730 289927 289736 gene locus_tag LOCUS_38740 289927 289736 CDS product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974539.1 protein_id gnl|my_center|LOCUS_38740 290963 290097 gene locus_tag LOCUS_38750 290963 290097 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029655.1 protein_id gnl|my_center|LOCUS_38750 292021 291266 gene locus_tag LOCUS_38760 292021 291266 CDS product GPP34 family phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974541.1 protein_id gnl|my_center|LOCUS_38760 292295 294400 gene locus_tag LOCUS_38770 292295 294400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38770 294224 294245 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 294414 294662 gene locus_tag LOCUS_38780 294414 294662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38780 294848 296695 gene locus_tag LOCUS_38790 294848 296695 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029653.1 protein_id gnl|my_center|LOCUS_38790 297263 296712 gene locus_tag LOCUS_38800 297263 296712 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224296754.1 protein_id gnl|my_center|LOCUS_38800 298276 297260 gene locus_tag LOCUS_38810 298276 297260 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029658.1 protein_id gnl|my_center|LOCUS_38810 298368 299810 gene locus_tag LOCUS_38820 298368 299810 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029659.1 protein_id gnl|my_center|LOCUS_38820 300502 299717 gene locus_tag LOCUS_38830 300502 299717 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226025318.1 protein_id gnl|my_center|LOCUS_38830 300624 301043 gene locus_tag LOCUS_38840 300624 301043 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093457988.1 protein_id gnl|my_center|LOCUS_38840 301785 301069 gene locus_tag LOCUS_38850 301785 301069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38850 303237 301900 gene locus_tag LOCUS_38860 303237 301900 CDS product FG-GAP repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168538635.1 protein_id gnl|my_center|LOCUS_38860 302017 302048 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 305690 303360 gene locus_tag LOCUS_38870 305690 303360 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026895.1 protein_id gnl|my_center|LOCUS_38870 305911 306813 gene locus_tag LOCUS_38880 305911 306813 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064726614.1 protein_id gnl|my_center|LOCUS_38880 306542 306565 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 307368 307054 gene locus_tag LOCUS_38890 307368 307054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38890 307323 307346 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 307744 307352 gene locus_tag LOCUS_38900 307744 307352 CDS product PTS fructose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164277346.1 protein_id gnl|my_center|LOCUS_38900 307806 308585 gene locus_tag LOCUS_38910 307806 308585 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226255.1 protein_id gnl|my_center|LOCUS_38910 309224 309252 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 309276 309713 gene locus_tag LOCUS_38920 309276 309713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38920 309710 310705 gene locus_tag LOCUS_38930 gene dhaK 309710 310705 CDS product dihydroxyacetone kinase subunit DhaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728174.1 protein_id gnl|my_center|LOCUS_38930 310860 311507 gene locus_tag LOCUS_38940 gene dhaL 310860 311507 CDS product dihydroxyacetone kinase subunit DhaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031416.1 protein_id gnl|my_center|LOCUS_38940 311504 313261 gene locus_tag LOCUS_38950 311504 313261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38950 313984 314262 gene locus_tag LOCUS_38960 313984 314262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38960 314295 314873 gene locus_tag LOCUS_38970 314295 314873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38970 315073 316335 gene locus_tag LOCUS_38980 315073 316335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38980 316790 316389 gene locus_tag LOCUS_38990 316790 316389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38990 316888 317226 gene locus_tag LOCUS_39000 316888 317226 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191850181.1 protein_id gnl|my_center|LOCUS_39000 318017 317220 gene locus_tag LOCUS_39010 318017 317220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39010 318627 318169 gene locus_tag LOCUS_39020 318627 318169 CDS product DUF1801 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258443.1 protein_id gnl|my_center|LOCUS_39020 318735 319328 gene locus_tag LOCUS_39030 318735 319328 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228475.1 protein_id gnl|my_center|LOCUS_39030 319381 320007 gene locus_tag LOCUS_39040 319381 320007 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228774.1 protein_id gnl|my_center|LOCUS_39040 321156 320626 gene locus_tag LOCUS_39050 321156 320626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39050 321405 322973 gene locus_tag LOCUS_39060 321405 322973 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191850204.1 protein_id gnl|my_center|LOCUS_39060 323668 323841 gene locus_tag LOCUS_39070 323668 323841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39070 324296 324325 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 324902 325618 gene locus_tag LOCUS_39080 324902 325618 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920549.1 protein_id gnl|my_center|LOCUS_39080 325615 326118 gene locus_tag LOCUS_39090 325615 326118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39090 327057 326155 gene locus_tag LOCUS_39100 327057 326155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39100 >Feature sequence010 <1 900 gene locus_tag LOCUS_39110 <1 900 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003973461.1:acyl-CoA carboxylase subunit beta 618 665 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 973 1959 gene locus_tag LOCUS_39120 gene speB 973 1959 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224492.1 protein_id gnl|my_center|LOCUS_39120 2035 3882 gene locus_tag LOCUS_39130 2035 3882 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327729.1 protein_id gnl|my_center|LOCUS_39130 4009 4854 gene locus_tag LOCUS_39140 4009 4854 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972533.1 protein_id gnl|my_center|LOCUS_39140 5048 6457 gene locus_tag LOCUS_39150 5048 6457 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972529.1 protein_id gnl|my_center|LOCUS_39150 6454 6975 gene locus_tag LOCUS_39160 6454 6975 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030929.1 protein_id gnl|my_center|LOCUS_39160 7099 8601 gene locus_tag LOCUS_39170 7099 8601 CDS product AlkA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972517.1 protein_id gnl|my_center|LOCUS_39170 8615 9151 gene locus_tag LOCUS_39180 8615 9151 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030939.1 protein_id gnl|my_center|LOCUS_39180 9377 9586 gene locus_tag LOCUS_39190 9377 9586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39190 9673 9873 gene locus_tag LOCUS_39200 9673 9873 CDS product type II toxin-antitoxin system VapB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973256.1 protein_id gnl|my_center|LOCUS_39200 10407 9916 gene locus_tag LOCUS_39210 10407 9916 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230489.1 protein_id gnl|my_center|LOCUS_39210 11477 10404 gene locus_tag LOCUS_39220 11477 10404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_39220 11639 12790 gene locus_tag LOCUS_39230 11639 12790 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093457344.1 protein_id gnl|my_center|LOCUS_39230 13784 12930 gene locus_tag LOCUS_39240 gene pssA 13784 12930 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972511.1 protein_id gnl|my_center|LOCUS_39240 14427 13771 gene locus_tag LOCUS_39250 14427 13771 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972510.1 protein_id gnl|my_center|LOCUS_39250 15803 14598 gene locus_tag LOCUS_39260 15803 14598 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030944.1 protein_id gnl|my_center|LOCUS_39260 16319 15807 gene locus_tag LOCUS_39270 16319 15807 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030945.1 protein_id gnl|my_center|LOCUS_39270 17299 16325 gene locus_tag LOCUS_39280 17299 16325 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030946.1 protein_id gnl|my_center|LOCUS_39280 19344 17296 gene locus_tag LOCUS_39290 19344 17296 CDS product protein meaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030947.1 protein_id gnl|my_center|LOCUS_39290 20705 19362 gene locus_tag LOCUS_39300 gene ccrA 20705 19362 CDS product crotonyl-CoA carboxylase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189283587.1 protein_id gnl|my_center|LOCUS_39300 20987 21010 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 22166 21132 gene locus_tag LOCUS_39310 22166 21132 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972504.1 protein_id gnl|my_center|LOCUS_39310 23958 22153 gene locus_tag LOCUS_39320 23958 22153 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030948.1 protein_id gnl|my_center|LOCUS_39320 24341 24916 gene locus_tag LOCUS_39330 24341 24916 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030949.1 protein_id gnl|my_center|LOCUS_39330 25445 24924 gene locus_tag LOCUS_39340 25445 24924 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030950.1 protein_id gnl|my_center|LOCUS_39340 25843 25442 gene locus_tag LOCUS_39350 25843 25442 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030951.1 protein_id gnl|my_center|LOCUS_39350 27498 25894 gene locus_tag LOCUS_39360 27498 25894 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030952.1 protein_id gnl|my_center|LOCUS_39360 28692 27634 gene locus_tag LOCUS_39370 28692 27634 CDS product Rv2578c family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972497.1 protein_id gnl|my_center|LOCUS_39370 28861 29304 gene locus_tag LOCUS_39380 28861 29304 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972496.1 protein_id gnl|my_center|LOCUS_39380 29389 31782 gene locus_tag LOCUS_39390 29389 31782 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173668834.1 protein_id gnl|my_center|LOCUS_39390 31955 34405 gene locus_tag LOCUS_39400 31955 34405 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485626.1 protein_id gnl|my_center|LOCUS_39400 34509 35234 gene locus_tag LOCUS_39410 34509 35234 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030956.1 protein_id gnl|my_center|LOCUS_39410 35392 38268 gene locus_tag LOCUS_39420 35392 38268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39420 38265 39398 gene locus_tag LOCUS_39430 38265 39398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39430 39527 40360 gene locus_tag LOCUS_39440 39527 40360 CDS product M55 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030957.1 protein_id gnl|my_center|LOCUS_39440 40353 41657 gene locus_tag LOCUS_39450 40353 41657 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030958.1 protein_id gnl|my_center|LOCUS_39450 41661 43688 gene locus_tag LOCUS_39460 41661 43688 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972490.1 protein_id gnl|my_center|LOCUS_39460 43685 44608 gene locus_tag LOCUS_39470 43685 44608 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030863161.1 protein_id gnl|my_center|LOCUS_39470 44998 44651 gene locus_tag LOCUS_39480 44998 44651 CDS product DUF6204 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972487.1 protein_id gnl|my_center|LOCUS_39480 45168 47162 gene locus_tag LOCUS_39490 45168 47162 CDS product DUF5107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_160859024.1 protein_id gnl|my_center|LOCUS_39490 47263 47721 gene locus_tag LOCUS_39500 47263 47721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39500 48741 47791 gene locus_tag LOCUS_39510 48741 47791 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030964.1 protein_id gnl|my_center|LOCUS_39510 48960 50582 gene locus_tag LOCUS_39520 48960 50582 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030965.1 protein_id gnl|my_center|LOCUS_39520 50610 52457 gene locus_tag LOCUS_39530 50610 52457 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030966.1 protein_id gnl|my_center|LOCUS_39530 52454 53392 gene locus_tag LOCUS_39540 gene ligD 52454 53392 CDS product non-homologous end-joining DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030863172.1 protein_id gnl|my_center|LOCUS_39540 53609 53869 gene locus_tag LOCUS_39550 53609 53869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39550 53964 54395 gene locus_tag LOCUS_39560 53964 54395 CDS product gas vesicle structural protein GvpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030969.1 protein_id gnl|my_center|LOCUS_39560 54392 55162 gene locus_tag LOCUS_39570 54392 55162 CDS product GvpL/GvpF family gas vesicle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972477.1 protein_id gnl|my_center|LOCUS_39570 55167 55430 gene locus_tag LOCUS_39580 55167 55430 CDS product gas vesicle protein GvpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972476.1 protein_id gnl|my_center|LOCUS_39580 55427 56146 gene locus_tag LOCUS_39590 55427 56146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39590 56143 57357 gene locus_tag LOCUS_39600 56143 57357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39600 56390 56416 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 57269 57289 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 57354 57713 gene locus_tag LOCUS_39610 57354 57713 CDS product gas vesicle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972473.1 protein_id gnl|my_center|LOCUS_39610 57710 58555 gene locus_tag LOCUS_39620 57710 58555 CDS product GvpL/GvpF family gas vesicle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030972.1 protein_id gnl|my_center|LOCUS_39620 58552 58746 gene locus_tag LOCUS_39630 58552 58746 CDS product gas vesicle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972471.1 protein_id gnl|my_center|LOCUS_39630 58753 59034 gene locus_tag LOCUS_39640 58753 59034 CDS product gas vesicle protein K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972470.1 protein_id gnl|my_center|LOCUS_39640 59900 59079 gene locus_tag LOCUS_39650 59900 59079 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030973.1 protein_id gnl|my_center|LOCUS_39650 61604 60051 gene locus_tag LOCUS_39660 61604 60051 CDS product bifunctional phosphatase PAP2/diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030974.1 protein_id gnl|my_center|LOCUS_39660 61656 62309 gene locus_tag LOCUS_39670 61656 62309 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971514.1 protein_id gnl|my_center|LOCUS_39670 62392 64011 gene locus_tag LOCUS_39680 62392 64011 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030975.1 protein_id gnl|my_center|LOCUS_39680 65282 64113 gene locus_tag LOCUS_39690 65282 64113 CDS product Vms1/Ankzf1 family peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030976.1 protein_id gnl|my_center|LOCUS_39690 65281 65619 gene locus_tag LOCUS_39700 65281 65619 CDS product DUF6158 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030977.1 protein_id gnl|my_center|LOCUS_39700 66289 65747 gene locus_tag LOCUS_39710 66289 65747 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030978.1 protein_id gnl|my_center|LOCUS_39710 67110 66307 gene locus_tag LOCUS_39720 67110 66307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39720 67568 67116 gene locus_tag LOCUS_39730 67568 67116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39730 67816 68610 gene locus_tag LOCUS_39740 67816 68610 CDS product RNA polymerase sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030982.1 protein_id gnl|my_center|LOCUS_39740 68777 69409 gene locus_tag LOCUS_39750 68777 69409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39750 69556 70860 gene locus_tag LOCUS_39760 69556 70860 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485736.1 protein_id gnl|my_center|LOCUS_39760 70857 71957 gene locus_tag LOCUS_39770 70857 71957 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030985.1 protein_id gnl|my_center|LOCUS_39770 72609 71965 gene locus_tag LOCUS_39780 72609 71965 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030986.1 protein_id gnl|my_center|LOCUS_39780 73379 72606 gene locus_tag LOCUS_39790 73379 72606 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972454.1 protein_id gnl|my_center|LOCUS_39790 73465 73905 gene locus_tag LOCUS_39800 73465 73905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030988.1 protein_id gnl|my_center|LOCUS_39800 74004 76172 gene locus_tag LOCUS_39810 74004 76172 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030989.1 protein_id gnl|my_center|LOCUS_39810 78994 76181 gene locus_tag LOCUS_39820 78994 76181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39820 79763 78984 gene locus_tag LOCUS_39830 79763 78984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39830 79914 80378 gene locus_tag LOCUS_39840 79914 80378 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972448.1 protein_id gnl|my_center|LOCUS_39840 80194 80220 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 80568 82460 gene locus_tag LOCUS_39850 gene dnaK 80568 82460 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975268.1 protein_id gnl|my_center|LOCUS_39850 83451 82636 gene locus_tag LOCUS_39860 83451 82636 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972443.1 protein_id gnl|my_center|LOCUS_39860 84403 83540 gene locus_tag LOCUS_39870 84403 83540 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972442.1 protein_id gnl|my_center|LOCUS_39870 85311 84469 gene locus_tag LOCUS_39880 85311 84469 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030996.1 protein_id gnl|my_center|LOCUS_39880 85486 85791 gene locus_tag LOCUS_39890 85486 85791 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972439.1 protein_id gnl|my_center|LOCUS_39890 85825 86574 gene locus_tag LOCUS_39900 85825 86574 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972438.1 protein_id gnl|my_center|LOCUS_39900 87858 86656 gene locus_tag LOCUS_39910 87858 86656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39910 88684 87803 gene locus_tag LOCUS_39920 88684 87803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39920 87908 87929 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 89622 88681 gene locus_tag LOCUS_39930 89622 88681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39930 88727 88752 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 89909 91384 gene locus_tag LOCUS_39940 89909 91384 CDS product cellulase family glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229871.1 protein_id gnl|my_center|LOCUS_39940 91429 93162 gene locus_tag LOCUS_39950 91429 93162 CDS product cellulose 1,4-beta-cellobiosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031002.1 protein_id gnl|my_center|LOCUS_39950 93961 93188 gene locus_tag LOCUS_39960 93961 93188 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892805.1 protein_id gnl|my_center|LOCUS_39960 94086 95036 gene locus_tag LOCUS_39970 94086 95036 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972431.1 protein_id gnl|my_center|LOCUS_39970 95092 95835 gene locus_tag LOCUS_39980 95092 95835 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972430.1 protein_id gnl|my_center|LOCUS_39980 96608 95913 gene locus_tag LOCUS_39990 96608 95913 CDS product glycoside hydrolase family 75 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222477.1 protein_id gnl|my_center|LOCUS_39990 97621 96785 gene locus_tag LOCUS_40000 97621 96785 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031003.1 protein_id gnl|my_center|LOCUS_40000 99531 97705 gene locus_tag LOCUS_40010 99531 97705 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972428.1 protein_id gnl|my_center|LOCUS_40010 101292 99793 gene locus_tag LOCUS_40020 101292 99793 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972427.1 protein_id gnl|my_center|LOCUS_40020 101404 102438 gene locus_tag LOCUS_40030 101404 102438 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031004.1 protein_id gnl|my_center|LOCUS_40030 103295 102387 gene locus_tag LOCUS_40040 103295 102387 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972425.1 protein_id gnl|my_center|LOCUS_40040 103404 104354 gene locus_tag LOCUS_40050 103404 104354 CDS product bile acid:sodium symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972424.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40050 104246 104271 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 104303 104500 gene locus_tag LOCUS_40060 104303 104500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40060 104682 105209 gene locus_tag LOCUS_40070 104682 105209 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978113.1 protein_id gnl|my_center|LOCUS_40070 106581 105217 gene locus_tag LOCUS_40080 106581 105217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40080 106682 107629 gene locus_tag LOCUS_40090 106682 107629 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031009.1 protein_id gnl|my_center|LOCUS_40090 107795 108472 gene locus_tag LOCUS_40100 107795 108472 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972414.1 protein_id gnl|my_center|LOCUS_40100 108741 109379 gene locus_tag LOCUS_40110 108741 109379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40110 109340 109368 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 109463 110329 gene locus_tag LOCUS_40120 109463 110329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40120 110567 110599 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 111789 111025 gene locus_tag LOCUS_40130 111789 111025 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486023.1 protein_id gnl|my_center|LOCUS_40130 111862 113076 gene locus_tag LOCUS_40140 111862 113076 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031604.1 protein_id gnl|my_center|LOCUS_40140 113134 113367 gene locus_tag LOCUS_40150 113134 113367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40150 114634 113429 gene locus_tag LOCUS_40160 114634 113429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40160 116013 114631 gene locus_tag LOCUS_40170 116013 114631 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223027.1 protein_id gnl|my_center|LOCUS_40170 118106 116010 gene locus_tag LOCUS_40180 118106 116010 CDS product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223026.1 protein_id gnl|my_center|LOCUS_40180 118446 118099 gene locus_tag LOCUS_40190 118446 118099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40190 119010 118477 gene locus_tag LOCUS_40200 gene ssuE 119010 118477 CDS product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808029.1 protein_id gnl|my_center|LOCUS_40200 119939 119106 gene locus_tag LOCUS_40210 119939 119106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40210 120807 120043 gene locus_tag LOCUS_40220 120807 120043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40220 121034 120804 gene locus_tag LOCUS_40230 121034 120804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40230 121647 121078 gene locus_tag LOCUS_40240 121647 121078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40240 122970 121756 gene locus_tag LOCUS_40250 122970 121756 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089023.1 protein_id gnl|my_center|LOCUS_40250 124673 122967 gene locus_tag LOCUS_40260 124673 122967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40260 124061 124081 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 125743 124712 gene locus_tag LOCUS_40270 gene phzM 125743 124712 CDS product phenazine-1-carboxylate N-methyltransferase PhzM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093617.1 protein_id gnl|my_center|LOCUS_40270 127247 126495 gene locus_tag LOCUS_40280 127247 126495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40280 128521 128994 gene locus_tag LOCUS_40290 128521 128994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40290 129053 130348 gene locus_tag LOCUS_40300 gene ectB 129053 130348 CDS product diaminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976955.1 protein_id gnl|my_center|LOCUS_40300 131837 130638 gene locus_tag LOCUS_40310 131837 130638 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978774.1 protein_id gnl|my_center|LOCUS_40310 132290 131847 gene locus_tag LOCUS_40320 132290 131847 CDS product globin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928811.1 protein_id gnl|my_center|LOCUS_40320 132627 134324 gene locus_tag LOCUS_40330 132627 134324 CDS product PP2C family protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191850187.1 protein_id gnl|my_center|LOCUS_40330 134321 135418 gene locus_tag LOCUS_40340 134321 135418 CDS product cobalamin-dependent protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897959.1 protein_id gnl|my_center|LOCUS_40340 136533 135685 gene locus_tag LOCUS_40350 136533 135685 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028543.1 protein_id gnl|my_center|LOCUS_40350 137902 136682 gene locus_tag LOCUS_40360 137902 136682 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029959.1 protein_id gnl|my_center|LOCUS_40360 142733 138180 gene locus_tag LOCUS_40370 142733 138180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40370 142226 142258 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 143556 142726 gene locus_tag LOCUS_40380 143556 142726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40380 145336 143756 gene locus_tag LOCUS_40390 145336 143756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40390 143934 143970 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 147106 145460 gene locus_tag LOCUS_40400 147106 145460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40400 147350 147955 gene locus_tag LOCUS_40410 147350 147955 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729062.1 protein_id gnl|my_center|LOCUS_40410 148026 148766 gene locus_tag LOCUS_40420 148026 148766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109030875.1 protein_id gnl|my_center|LOCUS_40420 148686 148708 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 149144 148836 gene locus_tag LOCUS_40430 149144 148836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40430 150487 149495 gene locus_tag LOCUS_40440 150487 149495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40440 152718 150907 gene locus_tag LOCUS_40450 152718 150907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031030.1 protein_id gnl|my_center|LOCUS_40450 153203 154519 gene locus_tag LOCUS_40460 153203 154519 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972377.1 protein_id gnl|my_center|LOCUS_40460 154516 155547 gene locus_tag LOCUS_40470 154516 155547 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031035.1 protein_id gnl|my_center|LOCUS_40470 155540 156421 gene locus_tag LOCUS_40480 155540 156421 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972375.1 protein_id gnl|my_center|LOCUS_40480 156418 157818 gene locus_tag LOCUS_40490 156418 157818 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093457391.1 protein_id gnl|my_center|LOCUS_40490 158464 157871 gene locus_tag LOCUS_40500 158464 157871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40500 160231 158468 gene locus_tag LOCUS_40510 gene ctaD 160231 158468 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976660.1 protein_id gnl|my_center|LOCUS_40510 161521 160484 gene locus_tag LOCUS_40520 161521 160484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40520 161155 161187 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 161956 161549 gene locus_tag LOCUS_40530 161956 161549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40530 162421 162191 gene locus_tag LOCUS_40540 162421 162191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40540 162317 163468 gene locus_tag LOCUS_40550 162317 163468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40550 164089 163580 gene locus_tag LOCUS_40560 164089 163580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40560 165543 164086 gene locus_tag LOCUS_40570 165543 164086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40570 166007 165591 gene locus_tag LOCUS_40580 166007 165591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40580 166311 167186 gene locus_tag LOCUS_40590 166311 167186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031057.1 protein_id gnl|my_center|LOCUS_40590 167621 167648 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 167713 168207 gene locus_tag LOCUS_40600 167713 168207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40600 168328 168786 gene locus_tag LOCUS_40610 168328 168786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40610 169026 168823 gene locus_tag LOCUS_40620 169026 168823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40620 169150 169656 gene locus_tag LOCUS_40630 169150 169656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40630 170195 171184 gene locus_tag LOCUS_40640 170195 171184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40640 171222 171377 gene locus_tag LOCUS_40650 171222 171377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40650 171529 172281 gene locus_tag LOCUS_40660 171529 172281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027495.1 protein_id gnl|my_center|LOCUS_40660 172206 172982 gene locus_tag LOCUS_40670 172206 172982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40670 173867 173070 gene locus_tag LOCUS_40680 173867 173070 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031073.1 protein_id gnl|my_center|LOCUS_40680 173977 174963 gene locus_tag LOCUS_40690 173977 174963 CDS product zinc-binding alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485699.1 protein_id gnl|my_center|LOCUS_40690 175144 175542 gene locus_tag LOCUS_40700 175144 175542 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031076.1 protein_id gnl|my_center|LOCUS_40700 175539 176738 gene locus_tag LOCUS_40710 175539 176738 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230077.1 protein_id gnl|my_center|LOCUS_40710 176879 177877 gene locus_tag LOCUS_40720 176879 177877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40720 177874 179175 gene locus_tag LOCUS_40730 177874 179175 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031079.1 protein_id gnl|my_center|LOCUS_40730 179199 179720 gene locus_tag LOCUS_40740 179199 179720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40740 179846 180505 gene locus_tag LOCUS_40750 gene ribA 179846 180505 CDS product GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031080.1 protein_id gnl|my_center|LOCUS_40750 181860 180595 gene locus_tag LOCUS_40760 181860 180595 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031081.1 protein_id gnl|my_center|LOCUS_40760 183310 181952 gene locus_tag LOCUS_40770 183310 181952 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223898.1 protein_id gnl|my_center|LOCUS_40770 183419 183895 gene locus_tag LOCUS_40780 183419 183895 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730357.1 protein_id gnl|my_center|LOCUS_40780 184776 183892 gene locus_tag LOCUS_40790 184776 183892 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523300.1 protein_id gnl|my_center|LOCUS_40790 184940 185554 gene locus_tag LOCUS_40800 184940 185554 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093953615.1 protein_id gnl|my_center|LOCUS_40800 186216 185551 gene locus_tag LOCUS_40810 186216 185551 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226204.1 protein_id gnl|my_center|LOCUS_40810 186728 186336 gene locus_tag LOCUS_40820 186728 186336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40820 186736 186920 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 188933 187293 gene locus_tag LOCUS_40830 gene pgi 188933 187293 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031083.1 protein_id gnl|my_center|LOCUS_40830 189861 188935 gene locus_tag LOCUS_40840 gene opcA 189861 188935 CDS product glucose-6-phosphate dehydrogenase assembly protein OpcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972335.1 protein_id gnl|my_center|LOCUS_40840 191624 189858 gene locus_tag LOCUS_40850 gene zwf 191624 189858 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031084.1 protein_id gnl|my_center|LOCUS_40850 190797 190826 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 192781 191621 gene locus_tag LOCUS_40860 gene tal 192781 191621 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031085.1 protein_id gnl|my_center|LOCUS_40860 194861 192810 gene locus_tag LOCUS_40870 gene tkt 194861 192810 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031086.1 protein_id gnl|my_center|LOCUS_40870 195041 195934 gene locus_tag LOCUS_40880 195041 195934 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031087.1 protein_id gnl|my_center|LOCUS_40880 197432 195999 gene locus_tag LOCUS_40890 197432 195999 CDS product glycoside hydrolase family 16 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031088.1 protein_id gnl|my_center|LOCUS_40890 198111 199454 gene locus_tag LOCUS_40900 198111 199454 CDS product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031093.1 protein_id gnl|my_center|LOCUS_40900 200817 199741 gene locus_tag LOCUS_40910 200817 199741 CDS product cellulose binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222228.1 protein_id gnl|my_center|LOCUS_40910 200916 200940 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 202803 201652 gene locus_tag LOCUS_40920 202803 201652 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031094.1 protein_id gnl|my_center|LOCUS_40920 203057 203773 gene locus_tag LOCUS_40930 203057 203773 CDS product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031096.1 protein_id gnl|my_center|LOCUS_40930 203391 203429 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 204034 203807 gene locus_tag LOCUS_40940 204034 203807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972321.1 protein_id gnl|my_center|LOCUS_40940 204777 204199 gene locus_tag LOCUS_40950 204777 204199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028350.1 protein_id gnl|my_center|LOCUS_40950 205448 204792 gene locus_tag LOCUS_40960 205448 204792 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972320.1 protein_id gnl|my_center|LOCUS_40960 205683 206354 gene locus_tag LOCUS_40970 205683 206354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327825.1 protein_id gnl|my_center|LOCUS_40970 207280 206372 gene locus_tag LOCUS_40980 207280 206372 CDS product cache domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223103.1 protein_id gnl|my_center|LOCUS_40980 208093 207317 gene locus_tag LOCUS_40990 208093 207317 CDS product FCD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223104.1 protein_id gnl|my_center|LOCUS_40990 208205 209242 gene locus_tag LOCUS_41000 208205 209242 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034286312.1 protein_id gnl|my_center|LOCUS_41000 209277 210476 gene locus_tag LOCUS_41010 209277 210476 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223107.1 protein_id gnl|my_center|LOCUS_41010 210484 211383 gene locus_tag LOCUS_41020 210484 211383 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223108.1 protein_id gnl|my_center|LOCUS_41020 211414 212229 gene locus_tag LOCUS_41030 211414 212229 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223109.1 protein_id gnl|my_center|LOCUS_41030 212302 213282 gene locus_tag LOCUS_41040 212302 213282 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031380.1 protein_id gnl|my_center|LOCUS_41040 213426 214775 gene locus_tag LOCUS_41050 213426 214775 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228682.1 protein_id gnl|my_center|LOCUS_41050 214779 215744 gene locus_tag LOCUS_41060 214779 215744 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228683.1 protein_id gnl|my_center|LOCUS_41060 215741 216619 gene locus_tag LOCUS_41070 215741 216619 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228684.1 protein_id gnl|my_center|LOCUS_41070 216682 218298 gene locus_tag LOCUS_41080 216682 218298 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972134.1 protein_id gnl|my_center|LOCUS_41080 218366 220570 gene locus_tag LOCUS_41090 218366 220570 CDS product discoidin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228677.1 protein_id gnl|my_center|LOCUS_41090 220803 222857 gene locus_tag LOCUS_41100 220803 222857 CDS product phospholipase C, phosphocholine-specific inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225090.1 protein_id gnl|my_center|LOCUS_41100 222910 223743 gene locus_tag LOCUS_41110 222910 223743 CDS product phospholipid scramblase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223563.1 protein_id gnl|my_center|LOCUS_41110 224730 223783 gene locus_tag LOCUS_41120 224730 223783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031110.1 protein_id gnl|my_center|LOCUS_41120 225524 224727 gene locus_tag LOCUS_41130 225524 224727 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972302.1 protein_id gnl|my_center|LOCUS_41130 225719 226333 gene locus_tag LOCUS_41140 225719 226333 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975649.1 protein_id gnl|my_center|LOCUS_41140 227670 226480 gene locus_tag LOCUS_41150 227670 226480 CDS product DUF2510 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031111.1 protein_id gnl|my_center|LOCUS_41150 227829 230600 gene locus_tag LOCUS_41160 227829 230600 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031112.1 protein_id gnl|my_center|LOCUS_41160 228759 228788 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 229747 229893 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 231078 230875 gene locus_tag LOCUS_41170 231078 230875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41170 232336 231203 gene locus_tag LOCUS_41180 232336 231203 CDS product DUF3048 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031120.1 protein_id gnl|my_center|LOCUS_41180 232436 233626 gene locus_tag LOCUS_41190 232436 233626 CDS product zinc-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031121.1 protein_id gnl|my_center|LOCUS_41190 234762 233692 gene locus_tag LOCUS_41200 234762 233692 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031122.1 protein_id gnl|my_center|LOCUS_41200 234849 235862 gene locus_tag LOCUS_41210 gene ligD 234849 235862 CDS product non-homologous end-joining DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972287.1 protein_id gnl|my_center|LOCUS_41210 236160 236185 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 236201 237103 gene locus_tag LOCUS_41220 236201 237103 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031126.1 protein_id gnl|my_center|LOCUS_41220 237900 237109 gene locus_tag LOCUS_41230 237900 237109 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031127.1 protein_id gnl|my_center|LOCUS_41230 238105 238350 gene locus_tag LOCUS_41240 238105 238350 CDS product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031128.1 protein_id gnl|my_center|LOCUS_41240 239383 238409 gene locus_tag LOCUS_41250 239383 238409 CDS product acyl-ACP desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031130.1 protein_id gnl|my_center|LOCUS_41250 240386 239610 gene locus_tag LOCUS_41260 gene ddaH 240386 239610 CDS product N(G),N(G)-dimethylarginine dimethylaminohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972278.1 protein_id gnl|my_center|LOCUS_41260 242141 240516 gene locus_tag LOCUS_41270 242141 240516 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031132.1 protein_id gnl|my_center|LOCUS_41270 242479 243150 gene locus_tag LOCUS_41280 242479 243150 CDS product GPP34 family phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327844.1 protein_id gnl|my_center|LOCUS_41280 243707 243291 gene locus_tag LOCUS_41290 243707 243291 CDS product SsgA family sporulation/cell division regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972274.1 protein_id gnl|my_center|LOCUS_41290 243979 245166 gene locus_tag LOCUS_41300 243979 245166 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031134.1 protein_id gnl|my_center|LOCUS_41300 245237 245563 gene locus_tag LOCUS_41310 245237 245563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972272.1 protein_id gnl|my_center|LOCUS_41310 245654 246373 gene locus_tag LOCUS_41320 245654 246373 CDS product endonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031135.1 protein_id gnl|my_center|LOCUS_41320 246442 246591 gene locus_tag LOCUS_41330 246442 246591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031137.1 protein_id gnl|my_center|LOCUS_41330 248266 247088 gene locus_tag LOCUS_41340 248266 247088 CDS product saccharopine dehydrogenase NADP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031138.1 protein_id gnl|my_center|LOCUS_41340 248451 249596 gene locus_tag LOCUS_41350 248451 249596 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031139.1 protein_id gnl|my_center|LOCUS_41350 249608 250822 gene locus_tag LOCUS_41360 249608 250822 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031140.1 protein_id gnl|my_center|LOCUS_41360 250863 253052 gene locus_tag LOCUS_41370 250863 253052 CDS product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031141.1 protein_id gnl|my_center|LOCUS_41370 253838 253104 gene locus_tag LOCUS_41380 253838 253104 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031142.1 protein_id gnl|my_center|LOCUS_41380 253880 254092 gene locus_tag LOCUS_41390 253880 254092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41390 254089 255549 gene locus_tag LOCUS_41400 254089 255549 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031143.1 protein_id gnl|my_center|LOCUS_41400 257208 255715 gene locus_tag LOCUS_41410 257208 255715 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174854953.1 protein_id gnl|my_center|LOCUS_41410 257500 257315 gene locus_tag LOCUS_41420 257500 257315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41420 257463 259412 gene locus_tag LOCUS_41430 257463 259412 CDS product Xaa-Pro dipeptidyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189868312.1 protein_id gnl|my_center|LOCUS_41430 259555 261216 gene locus_tag LOCUS_41440 259555 261216 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972254.1 protein_id gnl|my_center|LOCUS_41440 259824 259844 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 261228 261512 gene locus_tag LOCUS_41450 261228 261512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41450 264008 261618 gene locus_tag LOCUS_41460 264008 261618 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031148.1 protein_id gnl|my_center|LOCUS_41460 264863 264108 gene locus_tag LOCUS_41470 264863 264108 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972249.1 protein_id gnl|my_center|LOCUS_41470 265110 265613 gene locus_tag LOCUS_41480 265110 265613 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327856.1 protein_id gnl|my_center|LOCUS_41480 266227 265637 gene locus_tag LOCUS_41490 gene idi 266227 265637 CDS product isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972247.1 protein_id gnl|my_center|LOCUS_41490 267376 266438 gene locus_tag LOCUS_41500 267376 266438 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972246.1 protein_id gnl|my_center|LOCUS_41500 268510 267536 gene locus_tag LOCUS_41510 gene galE 268510 267536 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975823.1 protein_id gnl|my_center|LOCUS_41510 268815 270611 gene locus_tag LOCUS_41520 268815 270611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41520 270608 271360 gene locus_tag LOCUS_41530 270608 271360 CDS product phosphocholine cytidylyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031156.1 protein_id gnl|my_center|LOCUS_41530 271348 272409 gene locus_tag LOCUS_41540 271348 272409 CDS product iron-containing alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972242.1 protein_id gnl|my_center|LOCUS_41540 272387 273196 gene locus_tag LOCUS_41550 272387 273196 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270333.1 protein_id gnl|my_center|LOCUS_41550 272524 272553 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 273193 274077 gene locus_tag LOCUS_41560 273193 274077 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031159.1 protein_id gnl|my_center|LOCUS_41560 274180 275109 gene locus_tag LOCUS_41570 274180 275109 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972239.1 protein_id gnl|my_center|LOCUS_41570 275102 275911 gene locus_tag LOCUS_41580 275102 275911 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972238.1 protein_id gnl|my_center|LOCUS_41580 276273 277169 gene locus_tag LOCUS_41590 gene hpnC 276273 277169 CDS product squalene synthase HpnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031161.1 protein_id gnl|my_center|LOCUS_41590 277166 278116 gene locus_tag LOCUS_41600 gene hpnD 277166 278116 CDS product presqualene diphosphate synthase HpnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162483877.1 protein_id gnl|my_center|LOCUS_41600 278253 279698 gene locus_tag LOCUS_41610 gene hpnE 278253 279698 CDS product hydroxysqualene dehydroxylase HpnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031164.1 protein_id gnl|my_center|LOCUS_41610 279806 280834 gene locus_tag LOCUS_41620 279806 280834 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107420324.1 protein_id gnl|my_center|LOCUS_41620 280951 282975 gene locus_tag LOCUS_41630 gene shc 280951 282975 CDS product squalene--hopene cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031166.1 protein_id gnl|my_center|LOCUS_41630 282976 283617 gene locus_tag LOCUS_41640 282976 283617 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972232.1 protein_id gnl|my_center|LOCUS_41640 283623 284645 gene locus_tag LOCUS_41650 gene hpnH 283623 284645 CDS product adenosyl-hopene transferase HpnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972231.1 protein_id gnl|my_center|LOCUS_41650 >Feature sequence011 1336 74 gene locus_tag LOCUS_41660 1336 74 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029086.1 protein_id gnl|my_center|LOCUS_41660 1602 3956 gene locus_tag LOCUS_41670 1602 3956 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029087.1 protein_id gnl|my_center|LOCUS_41670 4200 6164 gene locus_tag LOCUS_41680 gene acs 4200 6164 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975373.1 protein_id gnl|my_center|LOCUS_41680 6439 7878 gene locus_tag LOCUS_41690 gene nhaA 6439 7878 CDS product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029088.1 protein_id gnl|my_center|LOCUS_41690 7972 8466 gene locus_tag LOCUS_41700 7972 8466 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975371.1 protein_id gnl|my_center|LOCUS_41700 8463 9422 gene locus_tag LOCUS_41710 8463 9422 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029089.1 protein_id gnl|my_center|LOCUS_41710 9542 9718 gene locus_tag LOCUS_41720 9542 9718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41720 10927 9728 gene locus_tag LOCUS_41730 10927 9728 CDS product MarP family serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136209493.1 protein_id gnl|my_center|LOCUS_41730 11830 11048 gene locus_tag LOCUS_41740 11830 11048 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029090.1 protein_id gnl|my_center|LOCUS_41740 12971 11916 gene locus_tag LOCUS_41750 12971 11916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41750 13247 13921 gene locus_tag LOCUS_41760 13247 13921 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975365.1 protein_id gnl|my_center|LOCUS_41760 13999 14754 gene locus_tag LOCUS_41770 13999 14754 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112421.1 protein_id gnl|my_center|LOCUS_41770 15593 14763 gene locus_tag LOCUS_41780 15593 14763 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975364.1 protein_id gnl|my_center|LOCUS_41780 16496 15627 gene locus_tag LOCUS_41790 16496 15627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975363.1 protein_id gnl|my_center|LOCUS_41790 17203 16739 gene locus_tag LOCUS_41800 17203 16739 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975361.1 protein_id gnl|my_center|LOCUS_41800 17358 17200 gene locus_tag LOCUS_41810 17358 17200 CDS product DUF4177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975360.1 protein_id gnl|my_center|LOCUS_41810 17465 18463 gene locus_tag LOCUS_41820 17465 18463 CDS product ArsA-related P-loop ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029095.1 protein_id gnl|my_center|LOCUS_41820 17506 17526 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 18460 19818 gene locus_tag LOCUS_41830 18460 19818 CDS product ArsA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029096.1 protein_id gnl|my_center|LOCUS_41830 20334 19945 gene locus_tag LOCUS_41840 gene wblA 20334 19945 CDS product transcriptional regulator WblA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029097.1 protein_id gnl|my_center|LOCUS_41840 21658 21682 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 21822 23114 gene locus_tag LOCUS_41850 21822 23114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41850 23642 23178 gene locus_tag LOCUS_41860 23642 23178 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975355.1 protein_id gnl|my_center|LOCUS_41860 23850 24803 gene locus_tag LOCUS_41870 23850 24803 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975354.1 protein_id gnl|my_center|LOCUS_41870 23861 23887 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 24924 25724 gene locus_tag LOCUS_41880 24924 25724 CDS product Pr6Pr family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029099.1 protein_id gnl|my_center|LOCUS_41880 25758 25832 gene locus_tag LOCUS_t00390 25758 25832 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 26099 25929 gene locus_tag LOCUS_41890 26099 25929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41890 26795 27199 gene locus_tag LOCUS_41900 26795 27199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41900 27222 28364 gene locus_tag LOCUS_41910 27222 28364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029802.1 protein_id gnl|my_center|LOCUS_41910 29112 28402 gene locus_tag LOCUS_41920 29112 28402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41920 29228 29905 gene locus_tag LOCUS_41930 29228 29905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41930 29788 30114 gene locus_tag LOCUS_41940 29788 30114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41940 29813 29835 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 30662 30126 gene locus_tag LOCUS_41950 30662 30126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41950 31137 30646 gene locus_tag LOCUS_41960 31137 30646 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975205.1 protein_id gnl|my_center|LOCUS_41960 31839 31189 gene locus_tag LOCUS_41970 31839 31189 CDS product class F sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029197.1 protein_id gnl|my_center|LOCUS_41970 32447 31836 gene locus_tag LOCUS_41980 32447 31836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41980 32831 34750 gene locus_tag LOCUS_41990 32831 34750 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258732.1 protein_id gnl|my_center|LOCUS_41990 34747 35739 gene locus_tag LOCUS_42000 34747 35739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42000 36504 35749 gene locus_tag LOCUS_42010 36504 35749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42010 37093 36494 gene locus_tag LOCUS_42020 37093 36494 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892873.1 protein_id gnl|my_center|LOCUS_42020 38075 37230 gene locus_tag LOCUS_42030 38075 37230 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030940.1 protein_id gnl|my_center|LOCUS_42030 39008 38289 gene locus_tag LOCUS_42040 39008 38289 CDS product TIGR03943 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225346.1 protein_id gnl|my_center|LOCUS_42040 40051 39005 gene locus_tag LOCUS_42050 40051 39005 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225345.1 protein_id gnl|my_center|LOCUS_42050 40250 42289 gene locus_tag LOCUS_42060 40250 42289 CDS product NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029118.1 protein_id gnl|my_center|LOCUS_42060 44170 42344 gene locus_tag LOCUS_42070 44170 42344 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975329.1 protein_id gnl|my_center|LOCUS_42070 44281 45063 gene locus_tag LOCUS_42080 44281 45063 CDS product SURF1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173943910.1 protein_id gnl|my_center|LOCUS_42080 46288 45113 gene locus_tag LOCUS_42090 46288 45113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029120.1 protein_id gnl|my_center|LOCUS_42090 46989 46285 gene locus_tag LOCUS_42100 46989 46285 CDS product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975326.1 protein_id gnl|my_center|LOCUS_42100 48490 47438 gene locus_tag LOCUS_42110 48490 47438 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975325.1 protein_id gnl|my_center|LOCUS_42110 49844 48567 gene locus_tag LOCUS_42120 49844 48567 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975324.1 protein_id gnl|my_center|LOCUS_42120 50208 50023 gene locus_tag LOCUS_42130 50208 50023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42130 51010 50201 gene locus_tag LOCUS_42140 51010 50201 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226025318.1 protein_id gnl|my_center|LOCUS_42140 51153 51752 gene locus_tag LOCUS_42150 51153 51752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42150 51754 52797 gene locus_tag LOCUS_42160 51754 52797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42160 52797 53456 gene locus_tag LOCUS_42170 52797 53456 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083699.1 protein_id gnl|my_center|LOCUS_42170 54108 53449 gene locus_tag LOCUS_42180 54108 53449 CDS product DUF5063 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975322.1 protein_id gnl|my_center|LOCUS_42180 54700 54101 gene locus_tag LOCUS_42190 gene recR 54700 54101 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975321.1 protein_id gnl|my_center|LOCUS_42190 55106 54762 gene locus_tag LOCUS_42200 55106 54762 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975320.1 protein_id gnl|my_center|LOCUS_42200 55387 56136 gene locus_tag LOCUS_42210 55387 56136 CDS product SLATT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029121.1 protein_id gnl|my_center|LOCUS_42210 58141 56174 gene locus_tag LOCUS_42220 58141 56174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42220 58181 59764 gene locus_tag LOCUS_42230 58181 59764 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029123.1 protein_id gnl|my_center|LOCUS_42230 59891 60595 gene locus_tag LOCUS_42240 59891 60595 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327688.1 protein_id gnl|my_center|LOCUS_42240 60592 63051 gene locus_tag LOCUS_42250 60592 63051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42250 63124 63774 gene locus_tag LOCUS_42260 63124 63774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975315.1 protein_id gnl|my_center|LOCUS_42260 65614 63812 gene locus_tag LOCUS_42270 65614 63812 CDS product 5'-nucleotidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028097.1 protein_id gnl|my_center|LOCUS_42270 67045 65762 gene locus_tag LOCUS_42280 67045 65762 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975310.1 protein_id gnl|my_center|LOCUS_42280 67241 68134 gene locus_tag LOCUS_42290 67241 68134 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029127.1 protein_id gnl|my_center|LOCUS_42290 68847 68323 gene locus_tag LOCUS_42300 68847 68323 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030867895.1 protein_id gnl|my_center|LOCUS_42300 68965 69885 gene locus_tag LOCUS_42310 68965 69885 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029129.1 protein_id gnl|my_center|LOCUS_42310 69882 71495 gene locus_tag LOCUS_42320 69882 71495 CDS product ABC transporter membrane-spanning protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029130.1 protein_id gnl|my_center|LOCUS_42320 72759 71539 gene locus_tag LOCUS_42330 72759 71539 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029132.1 protein_id gnl|my_center|LOCUS_42330 73433 72801 gene locus_tag LOCUS_42340 73433 72801 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975300.1 protein_id gnl|my_center|LOCUS_42340 73446 73471 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 74865 73498 gene locus_tag LOCUS_42350 74865 73498 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029134.1 protein_id gnl|my_center|LOCUS_42350 75667 74993 gene locus_tag LOCUS_42360 75667 74993 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975298.1 protein_id gnl|my_center|LOCUS_42360 77172 75664 gene locus_tag LOCUS_42370 77172 75664 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029135.1 protein_id gnl|my_center|LOCUS_42370 78523 77165 gene locus_tag LOCUS_42380 78523 77165 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029136.1 protein_id gnl|my_center|LOCUS_42380 79439 78516 gene locus_tag LOCUS_42390 79439 78516 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029137.1 protein_id gnl|my_center|LOCUS_42390 79497 79530 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 80817 79900 gene locus_tag LOCUS_42400 80817 79900 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975294.1 protein_id gnl|my_center|LOCUS_42400 82283 81021 gene locus_tag LOCUS_42410 gene kynU 82283 81021 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029138.1 protein_id gnl|my_center|LOCUS_42410 83160 82276 gene locus_tag LOCUS_42420 83160 82276 CDS product tryptophan 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029139.1 protein_id gnl|my_center|LOCUS_42420 83756 83310 gene locus_tag LOCUS_42430 83756 83310 CDS product DUF3151 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975291.1 protein_id gnl|my_center|LOCUS_42430 85509 83728 gene locus_tag LOCUS_42440 85509 83728 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029141.1 protein_id gnl|my_center|LOCUS_42440 86715 85684 gene locus_tag LOCUS_42450 gene fbaA 86715 85684 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029142.1 protein_id gnl|my_center|LOCUS_42450 87473 86925 gene locus_tag LOCUS_42460 gene pyrE 87473 86925 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029143.1 protein_id gnl|my_center|LOCUS_42460 88272 87484 gene locus_tag LOCUS_42470 88272 87484 CDS product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029144.1 protein_id gnl|my_center|LOCUS_42470 89481 88396 gene locus_tag LOCUS_42480 89481 88396 CDS product SRPBCC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109029331.1 protein_id gnl|my_center|LOCUS_42480 90248 89583 gene locus_tag LOCUS_42490 90248 89583 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029146.1 protein_id gnl|my_center|LOCUS_42490 91501 90254 gene locus_tag LOCUS_42500 91501 90254 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975284.1 protein_id gnl|my_center|LOCUS_42500 93426 91855 gene locus_tag LOCUS_42510 93426 91855 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029148.1 protein_id gnl|my_center|LOCUS_42510 93430 93463 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 94159 93632 gene locus_tag LOCUS_42520 94159 93632 CDS product DUF2617 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975282.1 protein_id gnl|my_center|LOCUS_42520 94908 94564 gene locus_tag LOCUS_42530 94908 94564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42530 95610 95272 gene locus_tag LOCUS_42540 95610 95272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42540 95887 97068 gene locus_tag LOCUS_42550 95887 97068 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029150.1 protein_id gnl|my_center|LOCUS_42550 97494 97518 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 97582 98334 gene locus_tag LOCUS_42560 97582 98334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42560 98956 98426 gene locus_tag LOCUS_42570 98956 98426 CDS product YbjN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975279.1 protein_id gnl|my_center|LOCUS_42570 99065 99616 gene locus_tag LOCUS_42580 99065 99616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42580 102276 99679 gene locus_tag LOCUS_42590 gene clpB 102276 99679 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975278.1 protein_id gnl|my_center|LOCUS_42590 102431 102850 gene locus_tag LOCUS_42600 102431 102850 CDS product TIGR03618 family F420-dependent PPOX class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284874.1 protein_id gnl|my_center|LOCUS_42600 103354 103019 gene locus_tag LOCUS_42610 103354 103019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975277.1 protein_id gnl|my_center|LOCUS_42610 103541 103356 gene locus_tag LOCUS_42620 103541 103356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42620 103712 104656 gene locus_tag LOCUS_42630 103712 104656 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166680919.1 protein_id gnl|my_center|LOCUS_42630 104677 105678 gene locus_tag LOCUS_42640 104677 105678 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029154.1 protein_id gnl|my_center|LOCUS_42640 106684 105632 gene locus_tag LOCUS_42650 106684 105632 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164279310.1 protein_id gnl|my_center|LOCUS_42650 107981 106875 gene locus_tag LOCUS_42660 107981 106875 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975272.1 protein_id gnl|my_center|LOCUS_42660 108271 108635 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 110076 108898 gene locus_tag LOCUS_42670 gene dnaJ 110076 108898 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975270.1 protein_id gnl|my_center|LOCUS_42670 110805 110116 gene locus_tag LOCUS_42680 gene grpE 110805 110116 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975269.1 protein_id gnl|my_center|LOCUS_42680 112649 110802 gene locus_tag LOCUS_42690 gene dnaK 112649 110802 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975268.1 protein_id gnl|my_center|LOCUS_42690 114050 112839 gene locus_tag LOCUS_42700 114050 112839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42700 114274 116556 gene locus_tag LOCUS_42710 114274 116556 CDS product heterodisulfide reductase-related iron-sulfur binding cluster inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029156.1 protein_id gnl|my_center|LOCUS_42710 117018 116632 gene locus_tag LOCUS_42720 gene mhuD 117018 116632 CDS product mycobilin-forming heme oxygenase MhuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419501.1 protein_id gnl|my_center|LOCUS_42720 117132 118661 gene locus_tag LOCUS_42730 117132 118661 CDS product FG-GAP repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168538635.1 protein_id gnl|my_center|LOCUS_42730 117189 117213 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 118857 119816 gene locus_tag LOCUS_42740 118857 119816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42740 120002 121441 gene locus_tag LOCUS_42750 120002 121441 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029324.1 protein_id gnl|my_center|LOCUS_42750 121600 121445 gene locus_tag LOCUS_42760 121600 121445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42760 122972 121584 gene locus_tag LOCUS_42770 gene repSA 122972 121584 CDS product replication initiator protein RepSA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030196.1 protein_id gnl|my_center|LOCUS_42770 123139 122969 gene locus_tag LOCUS_42780 123139 122969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42780 123327 123145 gene locus_tag LOCUS_42790 123327 123145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42790 123657 123421 gene locus_tag LOCUS_42800 123657 123421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42800 123991 123659 gene locus_tag LOCUS_42810 123991 123659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42810 123792 123818 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 124192 124007 gene locus_tag LOCUS_42820 124192 124007 CDS product mobile element transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226027129.1 protein_id gnl|my_center|LOCUS_42820 124612 124211 gene locus_tag LOCUS_42830 124612 124211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42830 126399 125890 gene locus_tag LOCUS_42840 126399 125890 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975262.1 protein_id gnl|my_center|LOCUS_42840 126988 126413 gene locus_tag LOCUS_42850 gene dcd 126988 126413 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975261.1 protein_id gnl|my_center|LOCUS_42850 127560 127633 gene locus_tag LOCUS_t00400 127560 127633 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 128607 129071 gene locus_tag LOCUS_42860 128607 129071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42860 129334 129690 gene locus_tag LOCUS_42870 129334 129690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42870 130646 129738 gene locus_tag LOCUS_42880 130646 129738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42880 130753 131298 gene locus_tag LOCUS_42890 130753 131298 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284042.1 protein_id gnl|my_center|LOCUS_42890 131355 132101 gene locus_tag LOCUS_42900 131355 132101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42900 132238 132933 gene locus_tag LOCUS_42910 132238 132933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42910 132970 133176 gene locus_tag LOCUS_42920 132970 133176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42920 134056 133358 gene locus_tag LOCUS_42930 134056 133358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42930 134216 135277 gene locus_tag LOCUS_42940 134216 135277 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225345.1 protein_id gnl|my_center|LOCUS_42940 135480 135175 gene locus_tag LOCUS_42950 135480 135175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42950 135385 136008 gene locus_tag LOCUS_42960 135385 136008 CDS product TIGR03943 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228386.1 protein_id gnl|my_center|LOCUS_42960 136476 136051 gene locus_tag LOCUS_42970 136476 136051 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971698.1 protein_id gnl|my_center|LOCUS_42970 137792 136737 gene locus_tag LOCUS_42980 137792 136737 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084065.1 protein_id gnl|my_center|LOCUS_42980 138013 139032 gene locus_tag LOCUS_42990 138013 139032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42990 144236 139029 gene locus_tag LOCUS_43000 144236 139029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43000 139812 139832 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 144176 144208 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 146369 144291 gene locus_tag LOCUS_43010 146369 144291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975548.1 protein_id gnl|my_center|LOCUS_43010 146767 148935 gene locus_tag LOCUS_43020 146767 148935 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031735.1 protein_id gnl|my_center|LOCUS_43020 149323 148955 gene locus_tag LOCUS_43030 149323 148955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43030 149741 149400 gene locus_tag LOCUS_43040 149741 149400 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973842.1 protein_id gnl|my_center|LOCUS_43040 149851 150486 gene locus_tag LOCUS_43050 149851 150486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43050 150479 150904 gene locus_tag LOCUS_43060 150479 150904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031656.1 protein_id gnl|my_center|LOCUS_43060 151590 150949 gene locus_tag LOCUS_43070 151590 150949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972757.1 protein_id gnl|my_center|LOCUS_43070 152497 151661 gene locus_tag LOCUS_43080 152497 151661 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972758.1 protein_id gnl|my_center|LOCUS_43080 152862 152494 gene locus_tag LOCUS_43090 152862 152494 CDS product TraR/DksA C4-type zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972760.1 protein_id gnl|my_center|LOCUS_43090 153468 153142 gene locus_tag LOCUS_43100 153468 153142 CDS product TraR/DksA C4-type zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972760.1 protein_id gnl|my_center|LOCUS_43100 153811 154764 gene locus_tag LOCUS_43110 153811 154764 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327630.1 protein_id gnl|my_center|LOCUS_43110 154767 155483 gene locus_tag LOCUS_43120 154767 155483 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030700.1 protein_id gnl|my_center|LOCUS_43120 155592 156119 gene locus_tag LOCUS_43130 155592 156119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43130 156164 158446 gene locus_tag LOCUS_43140 gene secD 156164 158446 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030698.1 protein_id gnl|my_center|LOCUS_43140 158650 158994 gene locus_tag LOCUS_43150 158650 158994 CDS product TraR/DksA C4-type zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972760.1 protein_id gnl|my_center|LOCUS_43150 159250 162900 gene locus_tag LOCUS_43160 159250 162900 CDS product nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487114.1 protein_id gnl|my_center|LOCUS_43160 162902 164572 gene locus_tag LOCUS_43170 gene narH 162902 164572 CDS product nitrate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487116.1 protein_id gnl|my_center|LOCUS_43170 164569 165171 gene locus_tag LOCUS_43180 gene narJ 164569 165171 CDS product nitrate reductase molybdenum cofactor assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029970.1 protein_id gnl|my_center|LOCUS_43180 165171 165920 gene locus_tag LOCUS_43190 gene narI 165171 165920 CDS product respiratory nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029971.1 protein_id gnl|my_center|LOCUS_43190 165781 165816 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 166007 166993 gene locus_tag LOCUS_43200 166007 166993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43200 166023 166062 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 166997 167362 gene locus_tag LOCUS_43210 166997 167362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43210 168573 167332 gene locus_tag LOCUS_43220 168573 167332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43220 168787 169692 gene locus_tag LOCUS_43230 168787 169692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43230 170594 169659 gene locus_tag LOCUS_43240 170594 169659 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027435.1 protein_id gnl|my_center|LOCUS_43240 170717 171250 gene locus_tag LOCUS_43250 170717 171250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43250 171971 171288 gene locus_tag LOCUS_43260 171971 171288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43260 172187 172975 gene locus_tag LOCUS_43270 172187 172975 CDS product DUF4142 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027588.1 protein_id gnl|my_center|LOCUS_43270 174728 173028 gene locus_tag LOCUS_43280 174728 173028 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975161.1 protein_id gnl|my_center|LOCUS_43280 175215 174856 gene locus_tag LOCUS_43290 175215 174856 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224845.1 protein_id gnl|my_center|LOCUS_43290 175461 175484 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 175522 176499 gene locus_tag LOCUS_43300 175522 176499 CDS product HoxN/HupN/NixA family nickel/cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467826.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_43300 176474 176496 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 177677 176706 gene locus_tag LOCUS_43310 177677 176706 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975162.1 protein_id gnl|my_center|LOCUS_43310 179015 177756 gene locus_tag LOCUS_43320 gene thrS 179015 177756 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485230.1 protein_id gnl|my_center|LOCUS_43320 179357 180139 gene locus_tag LOCUS_43330 179357 180139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029230.1 protein_id gnl|my_center|LOCUS_43330 181513 180158 gene locus_tag LOCUS_43340 181513 180158 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975159.1 protein_id gnl|my_center|LOCUS_43340 181688 181855 gene locus_tag LOCUS_43350 181688 181855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43350 183064 181871 gene locus_tag LOCUS_43360 183064 181871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029232.1 protein_id gnl|my_center|LOCUS_43360 182486 182506 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 183514 183582 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 184989 183700 gene locus_tag LOCUS_43370 184989 183700 CDS product PP2C family protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975156.1 protein_id gnl|my_center|LOCUS_43370 185054 185506 gene locus_tag LOCUS_43380 185054 185506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43380 185575 186567 gene locus_tag LOCUS_43390 185575 186567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029234.1 protein_id gnl|my_center|LOCUS_43390 187513 186686 gene locus_tag LOCUS_43400 187513 186686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43400 187209 187244 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 187537 188313 gene locus_tag LOCUS_43410 187537 188313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43410 187632 187656 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 188409 190025 gene locus_tag LOCUS_43420 gene metG 188409 190025 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975149.1 protein_id gnl|my_center|LOCUS_43420 192417 190654 gene locus_tag LOCUS_43430 gene aspS 192417 190654 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029239.1 protein_id gnl|my_center|LOCUS_43430 192657 194798 gene locus_tag LOCUS_43440 192657 194798 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975145.1 protein_id gnl|my_center|LOCUS_43440 196222 194831 gene locus_tag LOCUS_43450 196222 194831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43450 196924 196298 gene locus_tag LOCUS_43460 196924 196298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43460 197668 197120 gene locus_tag LOCUS_43470 197668 197120 CDS product SseB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975142.1 protein_id gnl|my_center|LOCUS_43470 197790 199616 gene locus_tag LOCUS_43480 197790 199616 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230903.1 protein_id gnl|my_center|LOCUS_43480 199713 201017 gene locus_tag LOCUS_43490 199713 201017 CDS product M18 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975140.1 protein_id gnl|my_center|LOCUS_43490 201170 201424 gene locus_tag LOCUS_43500 201170 201424 CDS product DUF6458 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975139.1 protein_id gnl|my_center|LOCUS_43500 203269 201440 gene locus_tag LOCUS_43510 203269 201440 CDS product redoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026880.1 protein_id gnl|my_center|LOCUS_43510 203390 203887 gene locus_tag LOCUS_43520 203390 203887 CDS product LURP-one-related/scramblase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975131.1 protein_id gnl|my_center|LOCUS_43520 204727 203933 gene locus_tag LOCUS_43530 204727 203933 CDS product carbon-nitrogen family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975129.1 protein_id gnl|my_center|LOCUS_43530 204949 205773 gene locus_tag LOCUS_43540 204949 205773 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029242.1 protein_id gnl|my_center|LOCUS_43540 206600 205656 gene locus_tag LOCUS_43550 206600 205656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43550 206589 206753 gene locus_tag LOCUS_43560 206589 206753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43560 208098 206782 gene locus_tag LOCUS_43570 208098 206782 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975127.1 protein_id gnl|my_center|LOCUS_43570 208763 208095 gene locus_tag LOCUS_43580 208763 208095 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975126.1 protein_id gnl|my_center|LOCUS_43580 208966 209871 gene locus_tag LOCUS_43590 208966 209871 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029243.1 protein_id gnl|my_center|LOCUS_43590 210006 210440 gene locus_tag LOCUS_43600 210006 210440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43600 210477 210791 gene locus_tag LOCUS_43610 210477 210791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43610 210776 212773 gene locus_tag LOCUS_43620 210776 212773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43620 211719 211751 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 212775 213506 gene locus_tag LOCUS_43630 212775 213506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43630 213555 213854 gene locus_tag LOCUS_43640 213555 213854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43640 213892 214572 gene locus_tag LOCUS_43650 213892 214572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43650 214621 215208 gene locus_tag LOCUS_43660 214621 215208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43660 215587 215315 gene locus_tag LOCUS_43670 215587 215315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43670 216801 215695 gene locus_tag LOCUS_43680 216801 215695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43680 215708 215736 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 217793 216813 gene locus_tag LOCUS_43690 217793 216813 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326663.1 protein_id gnl|my_center|LOCUS_43690 219049 217796 gene locus_tag LOCUS_43700 gene pdhA 219049 217796 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230923.1 protein_id gnl|my_center|LOCUS_43700 219529 220626 gene locus_tag LOCUS_43710 219529 220626 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109282207.1 protein_id gnl|my_center|LOCUS_43710 222311 220650 gene locus_tag LOCUS_43720 222311 220650 CDS product protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326665.1 protein_id gnl|my_center|LOCUS_43720 222630 224297 gene locus_tag LOCUS_43730 222630 224297 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029251.1 protein_id gnl|my_center|LOCUS_43730 224976 224419 gene locus_tag LOCUS_43740 224976 224419 CDS product bacterial proteasome activator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975113.1 protein_id gnl|my_center|LOCUS_43740 225597 224986 gene locus_tag LOCUS_43750 225597 224986 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804263.1 protein_id gnl|my_center|LOCUS_43750 226236 226051 gene locus_tag LOCUS_43760 226236 226051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43760 226429 226467 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 226680 226738 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 227771 226791 gene locus_tag LOCUS_43770 227771 226791 CDS product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975111.1 protein_id gnl|my_center|LOCUS_43770 228919 227822 gene locus_tag LOCUS_43780 228919 227822 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975108.1 protein_id gnl|my_center|LOCUS_43780 230343 228916 gene locus_tag LOCUS_43790 230343 228916 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029253.1 protein_id gnl|my_center|LOCUS_43790 231320 230340 gene locus_tag LOCUS_43800 231320 230340 CDS product NTP transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173943903.1 protein_id gnl|my_center|LOCUS_43800 232875 231376 gene locus_tag LOCUS_43810 232875 231376 CDS product 2-oxo acid dehydrogenase subunit E2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029255.1 protein_id gnl|my_center|LOCUS_43810 233861 232857 gene locus_tag LOCUS_43820 233861 232857 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029256.1 protein_id gnl|my_center|LOCUS_43820 235003 233858 gene locus_tag LOCUS_43830 gene pdhA 235003 233858 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467649.1 protein_id gnl|my_center|LOCUS_43830 235179 235676 gene locus_tag LOCUS_43840 235179 235676 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109029198.1 protein_id gnl|my_center|LOCUS_43840 236278 235688 gene locus_tag LOCUS_43850 236278 235688 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975101.1 protein_id gnl|my_center|LOCUS_43850 237789 236275 gene locus_tag LOCUS_43860 237789 236275 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029259.1 protein_id gnl|my_center|LOCUS_43860 237961 239652 gene locus_tag LOCUS_43870 gene paaN 237961 239652 CDS product phenylacetic acid degradation protein PaaN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029260.1 protein_id gnl|my_center|LOCUS_43870 240484 239732 gene locus_tag LOCUS_43880 240484 239732 CDS product TrmH family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029261.1 protein_id gnl|my_center|LOCUS_43880 241692 240481 gene locus_tag LOCUS_43890 241692 240481 CDS product HTTM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029262.1 protein_id gnl|my_center|LOCUS_43890 242678 241689 gene locus_tag LOCUS_43900 242678 241689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43900 243070 243549 gene locus_tag LOCUS_43910 243070 243549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_43910 243137 243163 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 243582 244172 gene locus_tag LOCUS_43920 243582 244172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_43920 244169 244456 gene locus_tag LOCUS_43930 gene paaB 244169 244456 CDS product 1,2-phenylacetyl-CoA epoxidase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167454960.1 protein_id gnl|my_center|LOCUS_43930 244466 244494 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 244542 245207 gene locus_tag LOCUS_43940 gene paaC 244542 245207 CDS product phenylacetate-CoA oxygenase subunit PaaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965788.1 protein_id gnl|my_center|LOCUS_43940 245201 245776 gene locus_tag LOCUS_43950 gene paaJ 245201 245776 CDS product phenylacetate-CoA oxygenase subunit PaaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223466.1 protein_id gnl|my_center|LOCUS_43950 245776 246840 gene locus_tag LOCUS_43960 gene paaK 245776 246840 CDS product phenylacetate-CoA oxygenase/reductase subunit PaaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086838237.1 protein_id gnl|my_center|LOCUS_43960 246997 248187 gene locus_tag LOCUS_43970 246997 248187 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112221.1 protein_id gnl|my_center|LOCUS_43970 248576 248229 gene locus_tag LOCUS_43980 248576 248229 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975095.1 protein_id gnl|my_center|LOCUS_43980 249690 248734 gene locus_tag LOCUS_43990 249690 248734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975094.1 protein_id gnl|my_center|LOCUS_43990 250961 249687 gene locus_tag LOCUS_44000 250961 249687 CDS product DUF2252 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029264.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_44000 250042 250071 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 251074 251095 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 251486 251400 gene locus_tag LOCUS_t00410 251486 251400 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 251500 251991 gene locus_tag LOCUS_44010 251500 251991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44010 251979 252845 gene locus_tag LOCUS_44020 gene fhaA 251979 252845 CDS product antibiotic biosynthesis regulator FhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975091.1 protein_id gnl|my_center|LOCUS_44020 252856 253377 gene locus_tag LOCUS_44030 gene fhaB 252856 253377 CDS product antibiotic biosynthesis regulator FhaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975090.1 protein_id gnl|my_center|LOCUS_44030 253470 255083 gene locus_tag LOCUS_44040 253470 255083 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029266.1 protein_id gnl|my_center|LOCUS_44040 255111 256547 gene locus_tag LOCUS_44050 255111 256547 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029267.1 protein_id gnl|my_center|LOCUS_44050 256544 258028 gene locus_tag LOCUS_44060 256544 258028 CDS product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029268.1 protein_id gnl|my_center|LOCUS_44060 258286 258035 gene locus_tag LOCUS_44070 258286 258035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44070 258200 260203 gene locus_tag LOCUS_44080 gene pknB 258200 260203 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029269.1 protein_id gnl|my_center|LOCUS_44080 261039 260281 gene locus_tag LOCUS_44090 261039 260281 CDS product class E sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975085.1 protein_id gnl|my_center|LOCUS_44090 262187 261045 gene locus_tag LOCUS_44100 262187 261045 CDS product class E sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029270.1 protein_id gnl|my_center|LOCUS_44100 262822 262184 gene locus_tag LOCUS_44110 262822 262184 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029271.1 protein_id gnl|my_center|LOCUS_44110 262980 262819 gene locus_tag LOCUS_44120 262980 262819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174256084.1 protein_id gnl|my_center|LOCUS_44120 263725 263033 gene locus_tag LOCUS_44130 263725 263033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44130 264530 263751 gene locus_tag LOCUS_44140 264530 263751 CDS product DUF881 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485254.1 protein_id gnl|my_center|LOCUS_44140 264673 264927 gene locus_tag LOCUS_44150 gene crgA 264673 264927 CDS product cell division protein CrgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975080.1 protein_id gnl|my_center|LOCUS_44150 266138 265197 gene locus_tag LOCUS_44160 266138 265197 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975079.1 protein_id gnl|my_center|LOCUS_44160 265890 265916 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 266787 266254 gene locus_tag LOCUS_44170 266787 266254 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975078.1 protein_id gnl|my_center|LOCUS_44170 267062 267808 gene locus_tag LOCUS_44180 267062 267808 CDS product DUF5324 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029273.1 protein_id gnl|my_center|LOCUS_44180 267955 267881 gene locus_tag LOCUS_t00420 267955 267881 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 268139 268687 gene locus_tag LOCUS_44190 268139 268687 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029275.1 protein_id gnl|my_center|LOCUS_44190 268746 270419 gene locus_tag LOCUS_44200 268746 270419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44200 271726 270383 gene locus_tag LOCUS_44210 271726 270383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029277.1 protein_id gnl|my_center|LOCUS_44210 272100 271972 gene locus_tag LOCUS_44220 272100 271972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_44220 272313 272669 gene locus_tag LOCUS_44230 272313 272669 CDS product DUF6344 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975071.1 protein_id gnl|my_center|LOCUS_44230 274248 272818 gene locus_tag LOCUS_44240 274248 272818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44240 275132 274335 gene locus_tag LOCUS_44250 275132 274335 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031856.1 protein_id gnl|my_center|LOCUS_44250 276386 275442 gene locus_tag LOCUS_44260 276386 275442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44260 276718 276858 gene locus_tag LOCUS_44270 276718 276858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44270 277313 277095 gene locus_tag LOCUS_44280 277313 277095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44280 >Feature sequence012 <1 929 gene locus_tag LOCUS_44290 <1 929 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011027904.1:methionine synthase 1137 1838 gene locus_tag LOCUS_44300 1137 1838 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977169.1 protein_id gnl|my_center|LOCUS_44300 2273 3877 gene locus_tag LOCUS_44310 2273 3877 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977170.1 protein_id gnl|my_center|LOCUS_44310 4629 3958 gene locus_tag LOCUS_44320 4629 3958 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977171.1 protein_id gnl|my_center|LOCUS_44320 6005 4674 gene locus_tag LOCUS_44330 6005 4674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44330 6122 7741 gene locus_tag LOCUS_44340 6122 7741 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167469715.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_44340 7853 8755 gene locus_tag LOCUS_44350 7853 8755 CDS product tRNA (adenine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027901.1 protein_id gnl|my_center|LOCUS_44350 8941 9567 gene locus_tag LOCUS_44360 8941 9567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977175.1 protein_id gnl|my_center|LOCUS_44360 9980 9681 gene locus_tag LOCUS_44370 9980 9681 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977176.1 protein_id gnl|my_center|LOCUS_44370 10230 11996 gene locus_tag LOCUS_44380 gene arc 10230 11996 CDS product proteasome ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027900.1 protein_id gnl|my_center|LOCUS_44380 12230 13741 gene locus_tag LOCUS_44390 gene dop 12230 13741 CDS product depupylase/deamidase Dop inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977179.1 protein_id gnl|my_center|LOCUS_44390 13778 13799 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 13952 14170 gene locus_tag LOCUS_44400 13952 14170 CDS product ubiquitin-like protein Pup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027899.1 protein_id gnl|my_center|LOCUS_44400 14321 15166 gene locus_tag LOCUS_44410 gene prcB 14321 15166 CDS product proteasome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977182.1 protein_id gnl|my_center|LOCUS_44410 15227 15982 gene locus_tag LOCUS_44420 gene prcA 15227 15982 CDS product proteasome subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027897.1 protein_id gnl|my_center|LOCUS_44420 17066 16050 gene locus_tag LOCUS_44430 17066 16050 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977184.1 protein_id gnl|my_center|LOCUS_44430 17248 18516 gene locus_tag LOCUS_44440 17248 18516 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870809.1 protein_id gnl|my_center|LOCUS_44440 18526 19887 gene locus_tag LOCUS_44450 gene pafA 18526 19887 CDS product Pup--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977186.1 protein_id gnl|my_center|LOCUS_44450 20018 21028 gene locus_tag LOCUS_44460 20018 21028 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977187.1 protein_id gnl|my_center|LOCUS_44460 21141 21512 gene locus_tag LOCUS_44470 21141 21512 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977188.1 protein_id gnl|my_center|LOCUS_44470 22315 23268 gene locus_tag LOCUS_44480 22315 23268 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027895.1 protein_id gnl|my_center|LOCUS_44480 23287 24372 gene locus_tag LOCUS_44490 23287 24372 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027894.1 protein_id gnl|my_center|LOCUS_44490 24369 24662 gene locus_tag LOCUS_44500 24369 24662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977191.1 protein_id gnl|my_center|LOCUS_44500 24673 24867 gene locus_tag LOCUS_44510 24673 24867 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977192.1 protein_id gnl|my_center|LOCUS_44510 25124 25405 gene locus_tag LOCUS_44520 gene tatA 25124 25405 CDS product Sec-independent protein translocase subunit TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977193.1 protein_id gnl|my_center|LOCUS_44520 25454 26404 gene locus_tag LOCUS_44530 gene tatC 25454 26404 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977194.1 protein_id gnl|my_center|LOCUS_44530 26459 27541 gene locus_tag LOCUS_44540 26459 27541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_44540 27424 27446 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 27688 29388 gene locus_tag LOCUS_44550 27688 29388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_44550 29814 31427 gene locus_tag LOCUS_44560 29814 31427 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977196.1 protein_id gnl|my_center|LOCUS_44560 31424 31831 gene locus_tag LOCUS_44570 31424 31831 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977197.1 protein_id gnl|my_center|LOCUS_44570 31828 32235 gene locus_tag LOCUS_44580 31828 32235 CDS product DUF742 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977198.1 protein_id gnl|my_center|LOCUS_44580 32216 32836 gene locus_tag LOCUS_44590 32216 32836 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977199.1 protein_id gnl|my_center|LOCUS_44590 32743 34371 gene locus_tag LOCUS_44600 32743 34371 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027891.1 protein_id gnl|my_center|LOCUS_44600 35255 34365 gene locus_tag LOCUS_44610 35255 34365 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977201.1 protein_id gnl|my_center|LOCUS_44610 35444 36100 gene locus_tag LOCUS_44620 35444 36100 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466502.1 protein_id gnl|my_center|LOCUS_44620 36281 37354 gene locus_tag LOCUS_44630 36281 37354 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223936.1 protein_id gnl|my_center|LOCUS_44630 37351 38127 gene locus_tag LOCUS_44640 37351 38127 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582486.1 protein_id gnl|my_center|LOCUS_44640 39069 38203 gene locus_tag LOCUS_44650 39069 38203 CDS product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977203.1 protein_id gnl|my_center|LOCUS_44650 40097 39153 gene locus_tag LOCUS_44660 40097 39153 CDS product 5'-3' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027889.1 protein_id gnl|my_center|LOCUS_44660 40313 41401 gene locus_tag LOCUS_44670 40313 41401 CDS product betaine/proline/choline family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977205.1 protein_id gnl|my_center|LOCUS_44670 42157 41801 gene locus_tag LOCUS_44680 42157 41801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44680 42793 42536 gene locus_tag LOCUS_44690 42793 42536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44690 42846 42870 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 42886 44043 gene locus_tag LOCUS_44700 42886 44043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_44700 44521 45123 gene locus_tag LOCUS_44710 44521 45123 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977207.1 protein_id gnl|my_center|LOCUS_44710 45123 45941 gene locus_tag LOCUS_44720 45123 45941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44720 45673 45694 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 47258 46032 gene locus_tag LOCUS_44730 47258 46032 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531626.1 protein_id gnl|my_center|LOCUS_44730 47490 47738 gene locus_tag LOCUS_44740 47490 47738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44740 47735 48037 gene locus_tag LOCUS_44750 47735 48037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44750 48063 48200 gene locus_tag LOCUS_44760 48063 48200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44760 48197 48664 gene locus_tag LOCUS_44770 48197 48664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44770 48735 48911 gene locus_tag LOCUS_44780 48735 48911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44780 49125 50150 gene locus_tag LOCUS_44790 49125 50150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44790 50147 51745 gene locus_tag LOCUS_44800 50147 51745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44800 51993 52544 gene locus_tag LOCUS_44810 51993 52544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44810 53632 52913 gene locus_tag LOCUS_44820 53632 52913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44820 53856 54554 gene locus_tag LOCUS_44830 53856 54554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44830 54601 55221 gene locus_tag LOCUS_44840 54601 55221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44840 55596 55399 gene locus_tag LOCUS_44850 55596 55399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44850 56141 56389 gene locus_tag LOCUS_44860 56141 56389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44860 56386 56733 gene locus_tag LOCUS_44870 56386 56733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44870 56630 56651 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 56745 57158 gene locus_tag LOCUS_44880 56745 57158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44880 57155 57685 gene locus_tag LOCUS_44890 57155 57685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44890 57682 58023 gene locus_tag LOCUS_44900 57682 58023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44900 58016 58423 gene locus_tag LOCUS_44910 58016 58423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44910 58488 60512 gene locus_tag LOCUS_44920 58488 60512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44920 60520 60780 gene locus_tag LOCUS_44930 60520 60780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44930 60956 61885 gene locus_tag LOCUS_44940 60956 61885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44940 62664 61918 gene locus_tag LOCUS_44950 62664 61918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44950 63429 62722 gene locus_tag LOCUS_44960 63429 62722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44960 62886 62914 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 63600 63884 gene locus_tag LOCUS_44970 63600 63884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44970 63881 64111 gene locus_tag LOCUS_44980 63881 64111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44980 64154 64612 gene locus_tag LOCUS_44990 64154 64612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44990 64619 65122 gene locus_tag LOCUS_45000 64619 65122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45000 65119 65307 gene locus_tag LOCUS_45010 65119 65307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45010 65267 66001 gene locus_tag LOCUS_45020 65267 66001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45020 66131 66574 gene locus_tag LOCUS_45030 66131 66574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45030 66574 68907 gene locus_tag LOCUS_45040 66574 68907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45040 68803 68823 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 70345 69077 gene locus_tag LOCUS_45050 70345 69077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45050 70925 71203 gene locus_tag LOCUS_45060 70925 71203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45060 71728 72363 gene locus_tag LOCUS_45070 71728 72363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45070 72475 73026 gene locus_tag LOCUS_45080 72475 73026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45080 73615 73115 gene locus_tag LOCUS_45090 73615 73115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45090 73905 73612 gene locus_tag LOCUS_45100 73905 73612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45100 74287 73889 gene locus_tag LOCUS_45110 74287 73889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45110 74524 74784 gene locus_tag LOCUS_45120 74524 74784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153524579.1 protein_id gnl|my_center|LOCUS_45120 74756 75283 gene locus_tag LOCUS_45130 74756 75283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143647548.1 protein_id gnl|my_center|LOCUS_45130 75310 76164 gene locus_tag LOCUS_45140 75310 76164 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_199889868.1 protein_id gnl|my_center|LOCUS_45140 77024 76638 gene locus_tag LOCUS_45150 77024 76638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45150 77391 78314 gene locus_tag LOCUS_45160 77391 78314 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977210.1 protein_id gnl|my_center|LOCUS_45160 79005 78301 gene locus_tag LOCUS_45170 79005 78301 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027885.1 protein_id gnl|my_center|LOCUS_45170 79827 79090 gene locus_tag LOCUS_45180 79827 79090 CDS product FCD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027884.1 protein_id gnl|my_center|LOCUS_45180 79948 81318 gene locus_tag LOCUS_45190 gene glnA4 79948 81318 CDS product gamma-glutamylethanolamide synthetase GlnA4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027883.1 protein_id gnl|my_center|LOCUS_45190 81327 82727 gene locus_tag LOCUS_45200 81327 82727 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162495124.1 protein_id gnl|my_center|LOCUS_45200 83021 83046 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 83143 83532 gene locus_tag LOCUS_45210 83143 83532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_45210 84749 83547 gene locus_tag LOCUS_45220 84749 83547 CDS product amino acid deaminase/aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027880.1 protein_id gnl|my_center|LOCUS_45220 85269 84772 gene locus_tag LOCUS_45230 85269 84772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45230 86587 86491 gene locus_tag LOCUS_t00430 86587 86491 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 86619 87845 gene locus_tag LOCUS_45240 gene mycP 86619 87845 CDS product type VII secretion-associated serine protease mycosin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977220.1 protein_id gnl|my_center|LOCUS_45240 88867 87911 gene locus_tag LOCUS_45250 88867 87911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45250 88818 89588 gene locus_tag LOCUS_45260 88818 89588 CDS product SseB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027875.1 protein_id gnl|my_center|LOCUS_45260 89995 89633 gene locus_tag LOCUS_45270 89995 89633 CDS product DUF1844 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977223.1 protein_id gnl|my_center|LOCUS_45270 90438 91004 gene locus_tag LOCUS_45280 gene infC 90438 91004 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027874.1 protein_id gnl|my_center|LOCUS_45280 91107 91301 gene locus_tag LOCUS_45290 gene rpmI 91107 91301 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977225.1 protein_id gnl|my_center|LOCUS_45290 91415 91798 gene locus_tag LOCUS_45300 gene rplT 91415 91798 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977226.1 protein_id gnl|my_center|LOCUS_45300 91893 92756 gene locus_tag LOCUS_45310 91893 92756 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027873.1 protein_id gnl|my_center|LOCUS_45310 92808 93944 gene locus_tag LOCUS_45320 92808 93944 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027872.1 protein_id gnl|my_center|LOCUS_45320 94133 95251 gene locus_tag LOCUS_45330 gene pheS 94133 95251 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977229.1 protein_id gnl|my_center|LOCUS_45330 95251 97755 gene locus_tag LOCUS_45340 gene pheT 95251 97755 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027870.1 protein_id gnl|my_center|LOCUS_45340 98187 99080 gene locus_tag LOCUS_45350 98187 99080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45350 99366 100535 gene locus_tag LOCUS_45360 99366 100535 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027869.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_45360 100373 100401 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 100454 100735 gene locus_tag LOCUS_45370 100454 100735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_45370 100829 101359 gene locus_tag LOCUS_45380 100829 101359 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977232.1 protein_id gnl|my_center|LOCUS_45380 102274 101414 gene locus_tag LOCUS_45390 102274 101414 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977233.1 protein_id gnl|my_center|LOCUS_45390 102447 103691 gene locus_tag LOCUS_45400 102447 103691 CDS product family 10 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027868.1 protein_id gnl|my_center|LOCUS_45400 103922 103710 gene locus_tag LOCUS_45410 103922 103710 CDS product DUF1918 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977235.1 protein_id gnl|my_center|LOCUS_45410 104272 104018 gene locus_tag LOCUS_45420 104272 104018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_45420 104286 104311 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 104623 105003 gene locus_tag LOCUS_45430 104623 105003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45430 105008 106435 gene locus_tag LOCUS_45440 105008 106435 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038535091.1 protein_id gnl|my_center|LOCUS_45440 106618 107211 gene locus_tag LOCUS_45450 106618 107211 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027864.1 protein_id gnl|my_center|LOCUS_45450 107678 107193 gene locus_tag LOCUS_45460 107678 107193 CDS product DUF6314 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174855167.1 protein_id gnl|my_center|LOCUS_45460 108304 108398 gene locus_tag LOCUS_t00440 108304 108398 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 108636 108663 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 108739 110721 gene locus_tag LOCUS_45470 108739 110721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_45470 110742 111692 gene locus_tag LOCUS_45480 110742 111692 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029921.1 protein_id gnl|my_center|LOCUS_45480 111692 112090 gene locus_tag LOCUS_45490 111692 112090 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974096.1 protein_id gnl|my_center|LOCUS_45490 112145 113173 gene locus_tag LOCUS_45500 gene argC 112145 113173 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977244.1 protein_id gnl|my_center|LOCUS_45500 113170 114321 gene locus_tag LOCUS_45510 gene argJ 113170 114321 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027859.1 protein_id gnl|my_center|LOCUS_45510 114634 114665 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 114680 115261 gene locus_tag LOCUS_45520 114680 115261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_45520 115258 116463 gene locus_tag LOCUS_45530 115258 116463 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977247.1 protein_id gnl|my_center|LOCUS_45530 116471 117013 gene locus_tag LOCUS_45540 116471 117013 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977248.1 protein_id gnl|my_center|LOCUS_45540 117873 117073 gene locus_tag LOCUS_45550 117873 117073 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027858.1 protein_id gnl|my_center|LOCUS_45550 118735 117866 gene locus_tag LOCUS_45560 118735 117866 CDS product FMN-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030871157.1 protein_id gnl|my_center|LOCUS_45560 118039 118069 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 118414 118450 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 120146 118764 gene locus_tag LOCUS_45570 120146 118764 CDS product ferredoxin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027856.1 protein_id gnl|my_center|LOCUS_45570 120457 120206 gene locus_tag LOCUS_45580 120457 120206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45580 120390 120833 gene locus_tag LOCUS_45590 120390 120833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45590 122086 120731 gene locus_tag LOCUS_45600 122086 120731 CDS product ferredoxin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027856.1 protein_id gnl|my_center|LOCUS_45600 122347 123078 gene locus_tag LOCUS_45610 122347 123078 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030863629.1 protein_id gnl|my_center|LOCUS_45610 123075 124619 gene locus_tag LOCUS_45620 123075 124619 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228517.1 protein_id gnl|my_center|LOCUS_45620 125243 124635 gene locus_tag LOCUS_45630 125243 124635 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977253.1 protein_id gnl|my_center|LOCUS_45630 125836 125387 gene locus_tag LOCUS_45640 125836 125387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_45640 126090 127313 gene locus_tag LOCUS_45650 126090 127313 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776176.1 protein_id gnl|my_center|LOCUS_45650 126454 126483 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 127429 128874 gene locus_tag LOCUS_45660 gene argH 127429 128874 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027854.1 protein_id gnl|my_center|LOCUS_45660 128829 128854 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 129101 130072 gene locus_tag LOCUS_45670 129101 130072 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325827.1 protein_id gnl|my_center|LOCUS_45670 130187 130738 gene locus_tag LOCUS_45680 130187 130738 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325826.1 protein_id gnl|my_center|LOCUS_45680 130735 132258 gene locus_tag LOCUS_45690 130735 132258 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977257.1 protein_id gnl|my_center|LOCUS_45690 133057 132386 gene locus_tag LOCUS_45700 133057 132386 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007447704.1 protein_id gnl|my_center|LOCUS_45700 133427 134671 gene locus_tag LOCUS_45710 133427 134671 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027852.1 protein_id gnl|my_center|LOCUS_45710 134763 135269 gene locus_tag LOCUS_45720 134763 135269 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027851.1 protein_id gnl|my_center|LOCUS_45720 135315 135812 gene locus_tag LOCUS_45730 135315 135812 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977261.1 protein_id gnl|my_center|LOCUS_45730 136224 135802 gene locus_tag LOCUS_45740 136224 135802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977262.1 protein_id gnl|my_center|LOCUS_45740 136585 136226 gene locus_tag LOCUS_45750 136585 136226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977263.1 protein_id gnl|my_center|LOCUS_45750 136821 136570 gene locus_tag LOCUS_45760 136821 136570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45760 137083 138138 gene locus_tag LOCUS_45770 137083 138138 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325822.1 protein_id gnl|my_center|LOCUS_45770 137791 137811 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 138135 138872 gene locus_tag LOCUS_45780 138135 138872 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027847.1 protein_id gnl|my_center|LOCUS_45780 138990 139829 gene locus_tag LOCUS_45790 138990 139829 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977267.1 protein_id gnl|my_center|LOCUS_45790 139976 140623 gene locus_tag LOCUS_45800 139976 140623 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161269997.1 protein_id gnl|my_center|LOCUS_45800 140758 141969 gene locus_tag LOCUS_45810 gene cbiE 140758 141969 CDS product precorrin-6y C5,15-methyltransferase (decarboxylating) subunit CbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977269.1 protein_id gnl|my_center|LOCUS_45810 142317 144146 gene locus_tag LOCUS_45820 142317 144146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_45820 143887 143937 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 144136 146643 gene locus_tag LOCUS_45830 144136 146643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_45830 146913 148151 gene locus_tag LOCUS_45840 gene cobA 146913 148151 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977272.1 protein_id gnl|my_center|LOCUS_45840 148318 148349 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 148410 149066 gene locus_tag LOCUS_45850 148410 149066 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977273.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_45850 150730 149363 gene locus_tag LOCUS_45860 150730 149363 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168715246.1 protein_id gnl|my_center|LOCUS_45860 151407 151601 gene locus_tag LOCUS_45870 151407 151601 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977275.1 protein_id gnl|my_center|LOCUS_45870 151791 152876 gene locus_tag LOCUS_45880 151791 152876 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027843.1 protein_id gnl|my_center|LOCUS_45880 152957 153247 gene locus_tag LOCUS_45890 152957 153247 CDS product zf-TFIIB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109033875.1 protein_id gnl|my_center|LOCUS_45890 153373 153301 gene locus_tag LOCUS_t00450 153373 153301 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 153488 153416 gene locus_tag LOCUS_t00460 153488 153416 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 153583 153511 gene locus_tag LOCUS_t00470 153583 153511 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 153658 153585 gene locus_tag LOCUS_t00480 153658 153585 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 153767 153694 gene locus_tag LOCUS_t00490 153767 153694 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 153945 154994 gene locus_tag LOCUS_45900 153945 154994 CDS product chorismate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027841.1 protein_id gnl|my_center|LOCUS_45900 154997 155818 gene locus_tag LOCUS_45910 154997 155818 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977279.1 protein_id gnl|my_center|LOCUS_45910 155912 156736 gene locus_tag LOCUS_45920 155912 156736 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485797.1 protein_id gnl|my_center|LOCUS_45920 157343 156825 gene locus_tag LOCUS_45930 157343 156825 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325815.1 protein_id gnl|my_center|LOCUS_45930 157563 158018 gene locus_tag LOCUS_45940 157563 158018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977282.1 protein_id gnl|my_center|LOCUS_45940 158220 158372 gene locus_tag LOCUS_45950 158220 158372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45950 158999 158439 gene locus_tag LOCUS_45960 158999 158439 CDS product CGNR zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977284.1 protein_id gnl|my_center|LOCUS_45960 159719 159306 gene locus_tag LOCUS_45970 159719 159306 CDS product SsgA family sporulation/cell division regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004002642.1 protein_id gnl|my_center|LOCUS_45970 159946 160428 gene locus_tag LOCUS_45980 159946 160428 CDS product TIGR02611 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027839.1 protein_id gnl|my_center|LOCUS_45980 160510 160583 gene locus_tag LOCUS_t00500 160510 160583 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 160966 161421 gene locus_tag LOCUS_45990 160966 161421 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027835.1 protein_id gnl|my_center|LOCUS_45990 161461 161534 gene locus_tag LOCUS_t00510 161461 161534 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 162319 161588 gene locus_tag LOCUS_46000 162319 161588 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977293.1 protein_id gnl|my_center|LOCUS_46000 162526 162750 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 162767 163114 gene locus_tag LOCUS_46010 162767 163114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46010 163111 164391 gene locus_tag LOCUS_46020 163111 164391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027834.1 protein_id gnl|my_center|LOCUS_46020 164549 166525 gene locus_tag LOCUS_46030 gene thrS 164549 166525 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977296.1 protein_id gnl|my_center|LOCUS_46030 166605 167165 gene locus_tag LOCUS_46040 166605 167165 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027833.1 protein_id gnl|my_center|LOCUS_46040 168939 167284 gene locus_tag LOCUS_46050 168939 167284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027832.1 protein_id gnl|my_center|LOCUS_46050 171364 169166 gene locus_tag LOCUS_46060 171364 169166 CDS product elongation factor G-like protein EF-G2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027831.1 protein_id gnl|my_center|LOCUS_46060 172058 172732 gene locus_tag LOCUS_46070 172058 172732 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027830.1 protein_id gnl|my_center|LOCUS_46070 172729 173646 gene locus_tag LOCUS_46080 172729 173646 CDS product phosphatidylinositol mannoside acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027829.1 protein_id gnl|my_center|LOCUS_46080 173643 174806 gene locus_tag LOCUS_46090 173643 174806 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027828.1 protein_id gnl|my_center|LOCUS_46090 174852 175421 gene locus_tag LOCUS_46100 174852 175421 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027827.1 protein_id gnl|my_center|LOCUS_46100 175551 176465 gene locus_tag LOCUS_46110 gene pdxS 175551 176465 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977304.1 protein_id gnl|my_center|LOCUS_46110 176474 177085 gene locus_tag LOCUS_46120 gene pdxT 176474 177085 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977305.1 protein_id gnl|my_center|LOCUS_46120 177134 177886 gene locus_tag LOCUS_46130 177134 177886 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977306.1 protein_id gnl|my_center|LOCUS_46130 178256 177948 gene locus_tag LOCUS_46140 178256 177948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46140 178554 179093 gene locus_tag LOCUS_46150 gene ruvC 178554 179093 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977307.1 protein_id gnl|my_center|LOCUS_46150 179090 179695 gene locus_tag LOCUS_46160 gene ruvA 179090 179695 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027825.1 protein_id gnl|my_center|LOCUS_46160 179721 180791 gene locus_tag LOCUS_46170 gene ruvB 179721 180791 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977309.1 protein_id gnl|my_center|LOCUS_46170 180955 181467 gene locus_tag LOCUS_46180 gene yajC 180955 181467 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027824.1 protein_id gnl|my_center|LOCUS_46180 181554 183398 gene locus_tag LOCUS_46190 gene secD 181554 183398 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027823.1 protein_id gnl|my_center|LOCUS_46190 183402 184517 gene locus_tag LOCUS_46200 gene secF 183402 184517 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977312.1 protein_id gnl|my_center|LOCUS_46200 184514 185062 gene locus_tag LOCUS_46210 184514 185062 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325803.1 protein_id gnl|my_center|LOCUS_46210 185275 187788 gene locus_tag LOCUS_46220 gene relA 185275 187788 CDS product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977314.1 protein_id gnl|my_center|LOCUS_46220 189130 187901 gene locus_tag LOCUS_46230 189130 187901 CDS product DUF349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325802.1 protein_id gnl|my_center|LOCUS_46230 190092 189268 gene locus_tag LOCUS_46240 190092 189268 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977316.1 protein_id gnl|my_center|LOCUS_46240 190446 190105 gene locus_tag LOCUS_46250 190446 190105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46250 190339 190974 gene locus_tag LOCUS_46260 190339 190974 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977317.1 protein_id gnl|my_center|LOCUS_46260 190971 192248 gene locus_tag LOCUS_46270 gene hisS 190971 192248 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325801.1 protein_id gnl|my_center|LOCUS_46270 192497 193153 gene locus_tag LOCUS_46280 192497 193153 CDS product vitamin K epoxide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030871078.1 protein_id gnl|my_center|LOCUS_46280 193211 194617 gene locus_tag LOCUS_46290 193211 194617 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977320.1 protein_id gnl|my_center|LOCUS_46290 194939 195553 gene locus_tag LOCUS_46300 gene rpsD 194939 195553 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977321.1 protein_id gnl|my_center|LOCUS_46300 195741 196208 gene locus_tag LOCUS_46310 195741 196208 CDS product DUF948 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977323.1 protein_id gnl|my_center|LOCUS_46310 196218 196577 gene locus_tag LOCUS_46320 196218 196577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977324.1 protein_id gnl|my_center|LOCUS_46320 196577 199249 gene locus_tag LOCUS_46330 gene alaS 196577 199249 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977325.1 protein_id gnl|my_center|LOCUS_46330 199258 199722 gene locus_tag LOCUS_46340 gene ruvX 199258 199722 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042825781.1 protein_id gnl|my_center|LOCUS_46340 199898 201637 gene locus_tag LOCUS_46350 gene mltG 199898 201637 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977327.1 protein_id gnl|my_center|LOCUS_46350 201618 202466 gene locus_tag LOCUS_46360 201618 202466 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027816.1 protein_id gnl|my_center|LOCUS_46360 202645 203844 gene locus_tag LOCUS_46370 gene aroC 202645 203844 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977330.1 protein_id gnl|my_center|LOCUS_46370 203610 203633 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 203841 204359 gene locus_tag LOCUS_46380 203841 204359 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027814.1 protein_id gnl|my_center|LOCUS_46380 204356 205447 gene locus_tag LOCUS_46390 gene aroB 204356 205447 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027813.1 protein_id gnl|my_center|LOCUS_46390 206051 206707 gene locus_tag LOCUS_46400 206051 206707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_46400 206813 207919 gene locus_tag LOCUS_46410 206813 207919 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977334.1 protein_id gnl|my_center|LOCUS_46410 207968 208534 gene locus_tag LOCUS_46420 gene efp 207968 208534 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977335.1 protein_id gnl|my_center|LOCUS_46420 208537 208980 gene locus_tag LOCUS_46430 gene nusB 208537 208980 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977336.1 protein_id gnl|my_center|LOCUS_46430 209759 209202 gene locus_tag LOCUS_46440 gene bldD 209759 209202 CDS product transcriptional regulator BldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977337.1 protein_id gnl|my_center|LOCUS_46440 209948 210532 gene locus_tag LOCUS_46450 gene pyrR 209948 210532 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977338.1 protein_id gnl|my_center|LOCUS_46450 210632 211612 gene locus_tag LOCUS_46460 210632 211612 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027811.1 protein_id gnl|my_center|LOCUS_46460 211618 212904 gene locus_tag LOCUS_46470 211618 212904 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977340.1 protein_id gnl|my_center|LOCUS_46470 212901 213506 gene locus_tag LOCUS_46480 212901 213506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977341.1 protein_id gnl|my_center|LOCUS_46480 213503 214648 gene locus_tag LOCUS_46490 gene carA 213503 214648 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027810.1 protein_id gnl|my_center|LOCUS_46490 214641 217949 gene locus_tag LOCUS_46500 gene carB 214641 217949 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977343.1 protein_id gnl|my_center|LOCUS_46500 218035 219141 gene locus_tag LOCUS_46510 218035 219141 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977344.1 protein_id gnl|my_center|LOCUS_46510 219138 219983 gene locus_tag LOCUS_46520 gene pyrF 219138 219983 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485777.1 protein_id gnl|my_center|LOCUS_46520 220272 220595 gene locus_tag LOCUS_46530 220272 220595 CDS product integration host factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977346.1 protein_id gnl|my_center|LOCUS_46530 220656 221249 gene locus_tag LOCUS_46540 gene gmk 220656 221249 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977347.1 protein_id gnl|my_center|LOCUS_46540 221315 221587 gene locus_tag LOCUS_46550 gene rpoZ 221315 221587 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977348.1 protein_id gnl|my_center|LOCUS_46550 221713 222915 gene locus_tag LOCUS_46560 gene coaBC 221713 222915 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485775.1 protein_id gnl|my_center|LOCUS_46560 >Feature sequence013 1010 693 gene locus_tag LOCUS_46570 1010 693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46570 1509 1877 gene locus_tag LOCUS_46580 1509 1877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46580 1874 3586 gene locus_tag LOCUS_46590 1874 3586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_46590 3462 3490 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3652 4056 gene locus_tag LOCUS_46600 3652 4056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_46600 5385 4582 gene locus_tag LOCUS_46610 5385 4582 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868693.1 protein_id gnl|my_center|LOCUS_46610 5940 5674 gene locus_tag LOCUS_46620 5940 5674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_46620 6490 5822 gene locus_tag LOCUS_46630 6490 5822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_46630 5955 5979 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6884 7366 gene locus_tag LOCUS_46640 6884 7366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46640 7363 8247 gene locus_tag LOCUS_46650 7363 8247 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897923.1 protein_id gnl|my_center|LOCUS_46650 8207 9067 gene locus_tag LOCUS_46660 8207 9067 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224893.1 protein_id gnl|my_center|LOCUS_46660 9289 9840 gene locus_tag LOCUS_46670 9289 9840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971799.1 protein_id gnl|my_center|LOCUS_46670 10520 10026 gene locus_tag LOCUS_46680 10520 10026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_46680 10995 10402 gene locus_tag LOCUS_46690 10995 10402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_46690 10544 10568 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12066 11068 gene locus_tag LOCUS_46700 12066 11068 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971796.1 protein_id gnl|my_center|LOCUS_46700 12269 12096 gene locus_tag LOCUS_46710 12269 12096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46710 12204 12584 gene locus_tag LOCUS_46720 12204 12584 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971791.1 protein_id gnl|my_center|LOCUS_46720 12581 13057 gene locus_tag LOCUS_46730 12581 13057 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971790.1 protein_id gnl|my_center|LOCUS_46730 13690 13073 gene locus_tag LOCUS_46740 13690 13073 CDS product DNA polymerase ligase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031607.1 protein_id gnl|my_center|LOCUS_46740 14580 13750 gene locus_tag LOCUS_46750 14580 13750 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971787.1 protein_id gnl|my_center|LOCUS_46750 14601 15668 gene locus_tag LOCUS_46760 14601 15668 CDS product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031608.1 protein_id gnl|my_center|LOCUS_46760 17246 15735 gene locus_tag LOCUS_46770 17246 15735 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971785.1 protein_id gnl|my_center|LOCUS_46770 18164 17331 gene locus_tag LOCUS_46780 18164 17331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_46780 18217 18597 gene locus_tag LOCUS_46790 18217 18597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46790 18307 18328 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 19412 18657 gene locus_tag LOCUS_46800 19412 18657 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971784.1 protein_id gnl|my_center|LOCUS_46800 20871 20251 gene locus_tag LOCUS_46810 20871 20251 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016328048.1 protein_id gnl|my_center|LOCUS_46810 21347 21024 gene locus_tag LOCUS_46820 21347 21024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46820 21297 21318 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 21337 22734 gene locus_tag LOCUS_46830 21337 22734 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031609.1 protein_id gnl|my_center|LOCUS_46830 23870 23205 gene locus_tag LOCUS_46840 23870 23205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46840 24022 24052 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 24161 24736 gene locus_tag LOCUS_46850 24161 24736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_46850 25231 24770 gene locus_tag LOCUS_46860 25231 24770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030378.1 protein_id gnl|my_center|LOCUS_46860 25503 26852 gene locus_tag LOCUS_46870 25503 26852 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205737.1 protein_id gnl|my_center|LOCUS_46870 26924 27364 gene locus_tag LOCUS_46880 26924 27364 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230688.1 protein_id gnl|my_center|LOCUS_46880 28541 27417 gene locus_tag LOCUS_46890 28541 27417 CDS product PP2C family protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027313.1 protein_id gnl|my_center|LOCUS_46890 29848 28625 gene locus_tag LOCUS_46900 29848 28625 CDS product glycoside hydrolase family 64 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027312.1 protein_id gnl|my_center|LOCUS_46900 28858 28884 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 30194 30472 gene locus_tag LOCUS_46910 30194 30472 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225295.1 protein_id gnl|my_center|LOCUS_46910 31554 30667 gene locus_tag LOCUS_46920 31554 30667 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027311.1 protein_id gnl|my_center|LOCUS_46920 31950 31675 gene locus_tag LOCUS_46930 31950 31675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46930 32167 32985 gene locus_tag LOCUS_46940 32167 32985 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978157.1 protein_id gnl|my_center|LOCUS_46940 33966 33046 gene locus_tag LOCUS_46950 33966 33046 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230746.1 protein_id gnl|my_center|LOCUS_46950 34311 34081 gene locus_tag LOCUS_46960 34311 34081 CDS product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978159.1 protein_id gnl|my_center|LOCUS_46960 34523 35101 gene locus_tag LOCUS_46970 34523 35101 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978160.1 protein_id gnl|my_center|LOCUS_46970 35247 35690 gene locus_tag LOCUS_46980 35247 35690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325223.1 protein_id gnl|my_center|LOCUS_46980 36045 36308 gene locus_tag LOCUS_46990 36045 36308 CDS product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973730.1 protein_id gnl|my_center|LOCUS_46990 36383 36694 gene locus_tag LOCUS_47000 36383 36694 CDS product DUF5133 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189282707.1 protein_id gnl|my_center|LOCUS_47000 37763 36780 gene locus_tag LOCUS_47010 gene tgmB 37763 36780 CDS product ATP-grasp ribosomal peptide maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027302.1 protein_id gnl|my_center|LOCUS_47010 37970 37779 gene locus_tag LOCUS_47020 gene tgmA 37970 37779 CDS product putative ATP-grasp-modified RiPP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978169.1 protein_id gnl|my_center|LOCUS_47020 38432 38091 gene locus_tag LOCUS_47030 38432 38091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47030 38686 39768 gene locus_tag LOCUS_47040 38686 39768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47040 41899 39782 gene locus_tag LOCUS_47050 41899 39782 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727118.1 protein_id gnl|my_center|LOCUS_47050 42954 41962 gene locus_tag LOCUS_47060 42954 41962 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027298.1 protein_id gnl|my_center|LOCUS_47060 43595 42951 gene locus_tag LOCUS_47070 43595 42951 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978174.1 protein_id gnl|my_center|LOCUS_47070 43155 43178 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 45126 43936 gene locus_tag LOCUS_47080 45126 43936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027296.1 protein_id gnl|my_center|LOCUS_47080 45780 45385 gene locus_tag LOCUS_47090 45780 45385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47090 46927 45797 gene locus_tag LOCUS_47100 46927 45797 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189282703.1 protein_id gnl|my_center|LOCUS_47100 47190 46924 gene locus_tag LOCUS_47110 47190 46924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47110 48426 47251 gene locus_tag LOCUS_47120 48426 47251 CDS product zinc-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140737.1 protein_id gnl|my_center|LOCUS_47120 49418 48423 gene locus_tag LOCUS_47130 49418 48423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47130 49033 49053 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 50976 49606 gene locus_tag LOCUS_47140 50976 49606 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978182.1 protein_id gnl|my_center|LOCUS_47140 52055 51210 gene locus_tag LOCUS_47150 52055 51210 CDS product RNA polymerase sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978261.1 protein_id gnl|my_center|LOCUS_47150 53670 52219 gene locus_tag LOCUS_47160 53670 52219 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027423.1 protein_id gnl|my_center|LOCUS_47160 54965 53670 gene locus_tag LOCUS_47170 54965 53670 CDS product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027422.1 protein_id gnl|my_center|LOCUS_47170 55938 55096 gene locus_tag LOCUS_47180 55938 55096 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731143.1 protein_id gnl|my_center|LOCUS_47180 56521 56057 gene locus_tag LOCUS_47190 56521 56057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47190 56851 58353 gene locus_tag LOCUS_47200 56851 58353 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224038.1 protein_id gnl|my_center|LOCUS_47200 60030 58417 gene locus_tag LOCUS_47210 60030 58417 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_213089166.1 protein_id gnl|my_center|LOCUS_47210 60189 60362 gene locus_tag LOCUS_47220 60189 60362 CDS product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027290.1 protein_id gnl|my_center|LOCUS_47220 61031 60498 gene locus_tag LOCUS_47230 61031 60498 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031617.1 protein_id gnl|my_center|LOCUS_47230 61030 61290 gene locus_tag LOCUS_47240 61030 61290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47240 61257 61766 gene locus_tag LOCUS_47250 61257 61766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47250 61956 63590 gene locus_tag LOCUS_47260 61956 63590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47260 63730 64293 gene locus_tag LOCUS_47270 63730 64293 CDS product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971771.1 protein_id gnl|my_center|LOCUS_47270 64410 64619 gene locus_tag LOCUS_47280 64410 64619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47280 64616 66214 gene locus_tag LOCUS_47290 64616 66214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47290 66587 66222 gene locus_tag LOCUS_47300 66587 66222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_47300 67634 66732 gene locus_tag LOCUS_47310 67634 66732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029935.1 protein_id gnl|my_center|LOCUS_47310 67848 68867 gene locus_tag LOCUS_47320 67848 68867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47320 69374 68892 gene locus_tag LOCUS_47330 69374 68892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47330 69553 69281 gene locus_tag LOCUS_47340 69553 69281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47340 70923 69685 gene locus_tag LOCUS_47350 70923 69685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47350 71220 72032 gene locus_tag LOCUS_47360 71220 72032 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229628.1 protein_id gnl|my_center|LOCUS_47360 73873 72092 gene locus_tag LOCUS_47370 73873 72092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47370 75578 74196 gene locus_tag LOCUS_47380 75578 74196 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038534689.1 protein_id gnl|my_center|LOCUS_47380 75693 76931 gene locus_tag LOCUS_47390 75693 76931 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191849057.1 protein_id gnl|my_center|LOCUS_47390 76928 77404 gene locus_tag LOCUS_47400 76928 77404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_159394617.1 protein_id gnl|my_center|LOCUS_47400 78665 78048 gene locus_tag LOCUS_47410 78665 78048 CDS product DUF2064 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870668.1 protein_id gnl|my_center|LOCUS_47410 79429 78662 gene locus_tag LOCUS_47420 79429 78662 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029202.1 protein_id gnl|my_center|LOCUS_47420 79553 80332 gene locus_tag LOCUS_47430 79553 80332 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485328.1 protein_id gnl|my_center|LOCUS_47430 80335 81447 gene locus_tag LOCUS_47440 80335 81447 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029200.1 protein_id gnl|my_center|LOCUS_47440 82465 81455 gene locus_tag LOCUS_47450 82465 81455 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029199.1 protein_id gnl|my_center|LOCUS_47450 82565 83323 gene locus_tag LOCUS_47460 82565 83323 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030116.1 protein_id gnl|my_center|LOCUS_47460 83778 83329 gene locus_tag LOCUS_47470 83778 83329 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028286.1 protein_id gnl|my_center|LOCUS_47470 83832 84725 gene locus_tag LOCUS_47480 83832 84725 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028287.1 protein_id gnl|my_center|LOCUS_47480 83992 84021 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 84807 85220 gene locus_tag LOCUS_47490 84807 85220 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971761.1 protein_id gnl|my_center|LOCUS_47490 85881 85255 gene locus_tag LOCUS_47500 85881 85255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47500 86341 85970 gene locus_tag LOCUS_47510 86341 85970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47510 86704 87261 gene locus_tag LOCUS_47520 86704 87261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47520 87323 87913 gene locus_tag LOCUS_47530 87323 87913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47530 88070 89401 gene locus_tag LOCUS_47540 gene selA 88070 89401 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226943.1 protein_id gnl|my_center|LOCUS_47540 89411 91291 gene locus_tag LOCUS_47550 gene selB 89411 91291 CDS product selenocysteine-specific translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226942.1 protein_id gnl|my_center|LOCUS_47550 89533 89565 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 91326 91234 gene locus_tag LOCUS_t00520 91326 91234 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 91422 92447 gene locus_tag LOCUS_47560 gene selD 91422 92447 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727954.1 protein_id gnl|my_center|LOCUS_47560 95756 92496 gene locus_tag LOCUS_47570 gene fdh 95756 92496 CDS product formate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227547.1 transl_except (pos:complement(95190..95192),aa:Sec) note codon on position 189 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_47570 96795 95812 gene locus_tag LOCUS_47580 96795 95812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47580 97044 97712 gene locus_tag LOCUS_47590 97044 97712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47590 97486 97506 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 97709 99388 gene locus_tag LOCUS_47600 gene ctaD 97709 99388 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229476.1 protein_id gnl|my_center|LOCUS_47600 99385 99759 gene locus_tag LOCUS_47610 99385 99759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47610 99765 100307 gene locus_tag LOCUS_47620 99765 100307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47620 100297 100974 gene locus_tag LOCUS_47630 100297 100974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47630 100687 100709 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 102051 101032 gene locus_tag LOCUS_47640 gene nrfD 102051 101032 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227549.1 protein_id gnl|my_center|LOCUS_47640 103100 102048 gene locus_tag LOCUS_47650 103100 102048 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225066.1 protein_id gnl|my_center|LOCUS_47650 104712 103126 gene locus_tag LOCUS_47660 104712 103126 CDS product ubiquinol-cytochrome c reductase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031531.1 protein_id gnl|my_center|LOCUS_47660 106222 104909 gene locus_tag LOCUS_47670 106222 104909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227554.1 protein_id gnl|my_center|LOCUS_47670 107073 106219 gene locus_tag LOCUS_47680 107073 106219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47680 108227 107070 gene locus_tag LOCUS_47690 108227 107070 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187247289.1 protein_id gnl|my_center|LOCUS_47690 108480 108887 gene locus_tag LOCUS_47700 108480 108887 CDS product four-helix bundle copper-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975554.1 protein_id gnl|my_center|LOCUS_47700 109413 108961 gene locus_tag LOCUS_47710 109413 108961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031649.1 protein_id gnl|my_center|LOCUS_47710 112537 109490 gene locus_tag LOCUS_47720 112537 109490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47720 115710 112510 gene locus_tag LOCUS_47730 115710 112510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47730 114618 114640 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 116852 115941 gene locus_tag LOCUS_47740 gene slbR 116852 115941 CDS product gamma-butyrolactone-binding regulator SlbR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027242.1 protein_id gnl|my_center|LOCUS_47740 116933 117922 gene locus_tag LOCUS_47750 116933 117922 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027205.1 protein_id gnl|my_center|LOCUS_47750 118050 118736 gene locus_tag LOCUS_47760 118050 118736 CDS product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978037.1 protein_id gnl|my_center|LOCUS_47760 118733 119701 gene locus_tag LOCUS_47770 118733 119701 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027374.1 protein_id gnl|my_center|LOCUS_47770 120199 119726 gene locus_tag LOCUS_47780 120199 119726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978246.1 protein_id gnl|my_center|LOCUS_47780 120519 120295 gene locus_tag LOCUS_47790 120519 120295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47790 121978 120740 gene locus_tag LOCUS_47800 121978 120740 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104331.1 protein_id gnl|my_center|LOCUS_47800 123423 122029 gene locus_tag LOCUS_47810 123423 122029 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165781113.1 protein_id gnl|my_center|LOCUS_47810 123649 123413 gene locus_tag LOCUS_47820 123649 123413 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898093.1 protein_id gnl|my_center|LOCUS_47820 124514 123834 gene locus_tag LOCUS_47830 124514 123834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47830 126230 124539 gene locus_tag LOCUS_47840 gene mmcO 126230 124539 CDS product multicopper oxidase MmcO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404392.1 protein_id gnl|my_center|LOCUS_47840 126510 128657 gene locus_tag LOCUS_47850 126510 128657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47850 128963 128754 gene locus_tag LOCUS_47860 128963 128754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47860 129909 129088 gene locus_tag LOCUS_47870 129909 129088 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031676.1 protein_id gnl|my_center|LOCUS_47870 130460 130050 gene locus_tag LOCUS_47880 130460 130050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47880 130680 131120 gene locus_tag LOCUS_47890 130680 131120 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971698.1 protein_id gnl|my_center|LOCUS_47890 131909 131175 gene locus_tag LOCUS_47900 131909 131175 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027608.1 protein_id gnl|my_center|LOCUS_47900 132065 132286 gene locus_tag LOCUS_47910 132065 132286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029392867.1 protein_id gnl|my_center|LOCUS_47910 132676 132521 gene locus_tag LOCUS_47920 132676 132521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47920 132758 133093 gene locus_tag LOCUS_47930 132758 133093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47930 133299 134591 gene locus_tag LOCUS_47940 133299 134591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47940 134741 134763 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 135922 134765 gene locus_tag LOCUS_47950 135922 134765 CDS product S1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031628.1 protein_id gnl|my_center|LOCUS_47950 136883 136158 gene locus_tag LOCUS_47960 gene pyrF 136883 136158 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705735.1 protein_id gnl|my_center|LOCUS_47960 137013 139784 gene locus_tag LOCUS_47970 137013 139784 CDS product SpoIIE family protein phosphatase/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186009676.1 protein_id gnl|my_center|LOCUS_47970 138229 138258 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 140016 139798 gene locus_tag LOCUS_47980 140016 139798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47980 140793 140023 gene locus_tag LOCUS_47990 140793 140023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229704.1 protein_id gnl|my_center|LOCUS_47990 141180 140896 gene locus_tag LOCUS_48000 141180 140896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_48000 141826 143424 gene locus_tag LOCUS_48010 gene ctaD 141826 143424 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976660.1 protein_id gnl|my_center|LOCUS_48010 143421 143795 gene locus_tag LOCUS_48020 143421 143795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48020 143983 144219 gene locus_tag LOCUS_48030 143983 144219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48030 144687 144220 gene locus_tag LOCUS_48040 144687 144220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48040 144904 144740 gene locus_tag LOCUS_48050 144904 144740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48050 144852 145490 gene locus_tag LOCUS_48060 144852 145490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48060 145720 145526 gene locus_tag LOCUS_48070 145720 145526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48070 146385 145810 gene locus_tag LOCUS_48080 146385 145810 CDS product TetR-like C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284050.1 protein_id gnl|my_center|LOCUS_48080 149399 146481 gene locus_tag LOCUS_48090 149399 146481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48090 149609 150283 gene locus_tag LOCUS_48100 149609 150283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48100 150840 150301 gene locus_tag LOCUS_48110 150840 150301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48110 151036 154335 gene locus_tag LOCUS_48120 151036 154335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48120 154463 155875 gene locus_tag LOCUS_48130 154463 155875 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060563245.1 protein_id gnl|my_center|LOCUS_48130 155939 156388 gene locus_tag LOCUS_48140 155939 156388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485933.1 protein_id gnl|my_center|LOCUS_48140 156608 157858 gene locus_tag LOCUS_48150 156608 157858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48150 158686 157892 gene locus_tag LOCUS_48160 158686 157892 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191849049.1 protein_id gnl|my_center|LOCUS_48160 158950 162324 gene locus_tag LOCUS_48170 158950 162324 CDS product pyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027194.1 protein_id gnl|my_center|LOCUS_48170 162356 162652 gene locus_tag LOCUS_48180 162356 162652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48180 162813 163256 gene locus_tag LOCUS_48190 162813 163256 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978301.1 protein_id gnl|my_center|LOCUS_48190 163281 165512 gene locus_tag LOCUS_48200 gene katG 163281 165512 CDS product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027206.1 protein_id gnl|my_center|LOCUS_48200 165656 166999 gene locus_tag LOCUS_48210 165656 166999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48210 167701 167018 gene locus_tag LOCUS_48220 167701 167018 CDS product potassium-transporting ATPase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029186.1 protein_id gnl|my_center|LOCUS_48220 169810 167711 gene locus_tag LOCUS_48230 gene kdpB 169810 167711 CDS product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029187.1 protein_id gnl|my_center|LOCUS_48230 171504 169840 gene locus_tag LOCUS_48240 gene kdpA 171504 169840 CDS product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029188.1 protein_id gnl|my_center|LOCUS_48240 172705 171782 gene locus_tag LOCUS_48250 172705 171782 CDS product oxygenase MpaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522101.1 protein_id gnl|my_center|LOCUS_48250 173468 172815 gene locus_tag LOCUS_48260 gene satP 173468 172815 CDS product acetate uptake transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815537.1 protein_id gnl|my_center|LOCUS_48260 173782 173627 gene locus_tag LOCUS_48270 173782 173627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010059700.1 protein_id gnl|my_center|LOCUS_48270 173988 174764 gene locus_tag LOCUS_48280 173988 174764 CDS product polysaccharide lyase family 7 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225953.1 protein_id gnl|my_center|LOCUS_48280 175680 174784 gene locus_tag LOCUS_48290 175680 174784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48290 175765 176616 gene locus_tag LOCUS_48300 175765 176616 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027243.1 protein_id gnl|my_center|LOCUS_48300 176646 177032 gene locus_tag LOCUS_48310 176646 177032 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036200.1 protein_id gnl|my_center|LOCUS_48310 178450 177062 gene locus_tag LOCUS_48320 gene mrx(A) 178450 177062 CDS product macrolide resistance MFS transporter Mrx(A) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004159.1 protein_id gnl|my_center|LOCUS_48320 179085 178447 gene locus_tag LOCUS_48330 179085 178447 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226757.1 protein_id gnl|my_center|LOCUS_48330 181517 179199 gene locus_tag LOCUS_48340 181517 179199 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027470.1 protein_id gnl|my_center|LOCUS_48340 181754 183196 gene locus_tag LOCUS_48350 181754 183196 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030570.1 protein_id gnl|my_center|LOCUS_48350 183459 184268 gene locus_tag LOCUS_48360 183459 184268 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141114.1 protein_id gnl|my_center|LOCUS_48360 184312 185796 gene locus_tag LOCUS_48370 184312 185796 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730651.1 protein_id gnl|my_center|LOCUS_48370 185793 186854 gene locus_tag LOCUS_48380 185793 186854 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897013.1 protein_id gnl|my_center|LOCUS_48380 186260 186280 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 186906 188669 gene locus_tag LOCUS_48390 186906 188669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48390 190504 188666 gene locus_tag LOCUS_48400 190504 188666 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225751.1 protein_id gnl|my_center|LOCUS_48400 191135 190611 gene locus_tag LOCUS_48410 191135 190611 CDS product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005125205.1 protein_id gnl|my_center|LOCUS_48410 192151 191147 gene locus_tag LOCUS_48420 192151 191147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48420 194780 192234 gene locus_tag LOCUS_48430 194780 192234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48430 192364 192272 gene locus_tag LOCUS_t00530 192364 192272 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 195508 194894 gene locus_tag LOCUS_48440 195508 194894 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004561734.1 protein_id gnl|my_center|LOCUS_48440 195863 195489 gene locus_tag LOCUS_48450 195863 195489 CDS product DUF742 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004561733.1 protein_id gnl|my_center|LOCUS_48450 196287 195856 gene locus_tag LOCUS_48460 196287 195856 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977425.1 protein_id gnl|my_center|LOCUS_48460 199123 196301 gene locus_tag LOCUS_48470 199123 196301 CDS product nitrate- and nitrite sensing domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030628.1 protein_id gnl|my_center|LOCUS_48470 200555 199371 gene locus_tag LOCUS_48480 200555 199371 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227131.1 protein_id gnl|my_center|LOCUS_48480 202193 200658 gene locus_tag LOCUS_48490 202193 200658 CDS product D-alanine--poly(phosphoribitol) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225537.1 protein_id gnl|my_center|LOCUS_48490 204169 202190 gene locus_tag LOCUS_48500 204169 202190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48500 204902 205924 gene locus_tag LOCUS_48510 204902 205924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48510 206244 205825 gene locus_tag LOCUS_48520 206244 205825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48520 207094 206552 gene locus_tag LOCUS_48530 207094 206552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48530 207235 207268 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 207351 208226 gene locus_tag LOCUS_48540 207351 208226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48540 208294 208755 gene locus_tag LOCUS_48550 208294 208755 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978225.1 protein_id gnl|my_center|LOCUS_48550 208959 209642 gene locus_tag LOCUS_48560 208959 209642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48560 209661 210044 gene locus_tag LOCUS_48570 209661 210044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48570 >Feature sequence014 739 143 gene locus_tag LOCUS_48580 739 143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48580 976 782 gene locus_tag LOCUS_48590 976 782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_48590 1332 949 gene locus_tag LOCUS_48600 1332 949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_48600 1494 2006 gene locus_tag LOCUS_48610 gene msrA 1494 2006 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974020.1 protein_id gnl|my_center|LOCUS_48610 2115 2960 gene locus_tag LOCUS_48620 2115 2960 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527936.1 protein_id gnl|my_center|LOCUS_48620 3131 3589 gene locus_tag LOCUS_48630 gene mscL 3131 3589 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928676.1 protein_id gnl|my_center|LOCUS_48630 3647 4453 gene locus_tag LOCUS_48640 3647 4453 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167469478.1 protein_id gnl|my_center|LOCUS_48640 4764 4492 gene locus_tag LOCUS_48650 4764 4492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48650 4769 5086 gene locus_tag LOCUS_48660 4769 5086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48660 5091 6125 gene locus_tag LOCUS_48670 5091 6125 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104392.1 protein_id gnl|my_center|LOCUS_48670 6122 7165 gene locus_tag LOCUS_48680 6122 7165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48680 7530 7703 gene locus_tag LOCUS_48690 7530 7703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48690 8876 7731 gene locus_tag LOCUS_48700 8876 7731 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225393.1 protein_id gnl|my_center|LOCUS_48700 9097 10692 gene locus_tag LOCUS_48710 9097 10692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48710 10809 11549 gene locus_tag LOCUS_48720 10809 11549 CDS product TRIC cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929937.1 protein_id gnl|my_center|LOCUS_48720 11546 12802 gene locus_tag LOCUS_48730 11546 12802 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029435.1 protein_id gnl|my_center|LOCUS_48730 12881 13864 gene locus_tag LOCUS_48740 12881 13864 CDS product Dyp-type peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730829.1 protein_id gnl|my_center|LOCUS_48740 13869 14684 gene locus_tag LOCUS_48750 13869 14684 CDS product family 1 encapsulin nanocompartment shell protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897233.1 protein_id gnl|my_center|LOCUS_48750 15239 14712 gene locus_tag LOCUS_48760 15239 14712 CDS product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031813.1 protein_id gnl|my_center|LOCUS_48760 16171 15296 gene locus_tag LOCUS_48770 16171 15296 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978710.1 protein_id gnl|my_center|LOCUS_48770 16336 17022 gene locus_tag LOCUS_48780 16336 17022 CDS product maleylpyruvate isomerase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728251.1 protein_id gnl|my_center|LOCUS_48780 17093 17968 gene locus_tag LOCUS_48790 17093 17968 CDS product PhzF family phenazine biosynthesis isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173668695.1 protein_id gnl|my_center|LOCUS_48790 18303 19106 gene locus_tag LOCUS_48800 18303 19106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48800 19578 19108 gene locus_tag LOCUS_48810 19578 19108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48810 20663 19476 gene locus_tag LOCUS_48820 20663 19476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_48820 19811 19836 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 20738 21400 gene locus_tag LOCUS_48830 20738 21400 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974777.1 protein_id gnl|my_center|LOCUS_48830 21495 21857 gene locus_tag LOCUS_48840 21495 21857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48840 25637 21912 gene locus_tag LOCUS_48850 25637 21912 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226391.1 protein_id gnl|my_center|LOCUS_48850 25928 26707 gene locus_tag LOCUS_48860 25928 26707 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225866.1 protein_id gnl|my_center|LOCUS_48860 26723 27673 gene locus_tag LOCUS_48870 26723 27673 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530136.1 protein_id gnl|my_center|LOCUS_48870 27836 28735 gene locus_tag LOCUS_48880 27836 28735 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027243.1 protein_id gnl|my_center|LOCUS_48880 29877 28756 gene locus_tag LOCUS_48890 29877 28756 CDS product DUF3103 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149560302.1 protein_id gnl|my_center|LOCUS_48890 29932 29957 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 30237 30881 gene locus_tag LOCUS_48900 30237 30881 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029175.1 protein_id gnl|my_center|LOCUS_48900 30933 31418 gene locus_tag LOCUS_48910 30933 31418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48910 31420 31785 gene locus_tag LOCUS_48920 31420 31785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978731.1 protein_id gnl|my_center|LOCUS_48920 32761 31820 gene locus_tag LOCUS_48930 32761 31820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027166.1 protein_id gnl|my_center|LOCUS_48930 32899 33489 gene locus_tag LOCUS_48940 32899 33489 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229197.1 protein_id gnl|my_center|LOCUS_48940 33717 34853 gene locus_tag LOCUS_48950 33717 34853 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028175.1 protein_id gnl|my_center|LOCUS_48950 35580 34861 gene locus_tag LOCUS_48960 35580 34861 CDS product DUF5701 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930138.1 protein_id gnl|my_center|LOCUS_48960 36025 35675 gene locus_tag LOCUS_48970 36025 35675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48970 36779 37210 gene locus_tag LOCUS_48980 36779 37210 CDS product SPW repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401141.1 protein_id gnl|my_center|LOCUS_48980 38689 37232 gene locus_tag LOCUS_48990 38689 37232 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227524.1 protein_id gnl|my_center|LOCUS_48990 41186 39153 gene locus_tag LOCUS_49000 41186 39153 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031409.1 protein_id gnl|my_center|LOCUS_49000 42373 41399 gene locus_tag LOCUS_49010 42373 41399 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030530.1 protein_id gnl|my_center|LOCUS_49010 42578 43111 gene locus_tag LOCUS_49020 42578 43111 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973107.1 protein_id gnl|my_center|LOCUS_49020 43578 43609 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 43748 44614 gene locus_tag LOCUS_49030 43748 44614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_49030 44718 46172 gene locus_tag LOCUS_49040 44718 46172 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930178.1 protein_id gnl|my_center|LOCUS_49040 46243 46950 gene locus_tag LOCUS_49050 46243 46950 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327688.1 protein_id gnl|my_center|LOCUS_49050 47488 50091 gene locus_tag LOCUS_49060 47488 50091 CDS product collagenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030528.1 protein_id gnl|my_center|LOCUS_49060 50225 51160 gene locus_tag LOCUS_49070 50225 51160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49070 51103 51126 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 51956 51129 gene locus_tag LOCUS_49080 51956 51129 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027090.1 protein_id gnl|my_center|LOCUS_49080 53510 51999 gene locus_tag LOCUS_49090 53510 51999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49090 53740 56463 gene locus_tag LOCUS_49100 53740 56463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49100 56671 57399 gene locus_tag LOCUS_49110 56671 57399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49110 58180 57407 gene locus_tag LOCUS_49120 58180 57407 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229505.1 protein_id gnl|my_center|LOCUS_49120 58267 59424 gene locus_tag LOCUS_49130 58267 59424 CDS product ArsO family NAD(P)H-dependent flavin-containing monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043376805.1 protein_id gnl|my_center|LOCUS_49130 59569 60366 gene locus_tag LOCUS_49140 59569 60366 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226742.1 protein_id gnl|my_center|LOCUS_49140 61427 60546 gene locus_tag LOCUS_49150 61427 60546 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228801.1 protein_id gnl|my_center|LOCUS_49150 61516 62094 gene locus_tag LOCUS_49160 61516 62094 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228802.1 protein_id gnl|my_center|LOCUS_49160 62147 62866 gene locus_tag LOCUS_49170 62147 62866 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970812.1 protein_id gnl|my_center|LOCUS_49170 66739 62885 gene locus_tag LOCUS_49180 66739 62885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49180 68030 66723 gene locus_tag LOCUS_49190 68030 66723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49190 68856 68164 gene locus_tag LOCUS_49200 68856 68164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49200 69083 70531 gene locus_tag LOCUS_49210 69083 70531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49210 70681 71394 gene locus_tag LOCUS_49220 70681 71394 CDS product FAD binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027228.1 protein_id gnl|my_center|LOCUS_49220 71556 71948 gene locus_tag LOCUS_49230 71556 71948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49230 72376 71993 gene locus_tag LOCUS_49240 72376 71993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49240 73198 73410 gene locus_tag LOCUS_49250 73198 73410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49250 73516 73776 gene locus_tag LOCUS_49260 73516 73776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49260 73773 74432 gene locus_tag LOCUS_49270 73773 74432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_49270 74482 74724 gene locus_tag LOCUS_49280 74482 74724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49280 75108 74737 gene locus_tag LOCUS_49290 75108 74737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49290 76439 75528 gene locus_tag LOCUS_49300 76439 75528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49300 77059 76436 gene locus_tag LOCUS_49310 77059 76436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_49310 77395 77099 gene locus_tag LOCUS_49320 77395 77099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49320 77625 78101 gene locus_tag LOCUS_49330 77625 78101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49330 78406 78645 gene locus_tag LOCUS_49340 78406 78645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49340 79068 78664 gene locus_tag LOCUS_49350 79068 78664 CDS product glutaredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975822.1 protein_id gnl|my_center|LOCUS_49350 79076 79110 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 79520 79732 gene locus_tag LOCUS_49360 79520 79732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49360 79854 81728 gene locus_tag LOCUS_49370 79854 81728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49370 81779 82465 gene locus_tag LOCUS_49380 81779 82465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49380 82685 83425 gene locus_tag LOCUS_49390 82685 83425 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224207.1 protein_id gnl|my_center|LOCUS_49390 83464 83649 gene locus_tag LOCUS_49400 83464 83649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49400 84490 83600 gene locus_tag LOCUS_49410 84490 83600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49410 85053 84490 gene locus_tag LOCUS_49420 85053 84490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49420 85302 85174 gene locus_tag LOCUS_49430 85302 85174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49430 86566 85547 gene locus_tag LOCUS_49440 86566 85547 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897013.1 protein_id gnl|my_center|LOCUS_49440 87934 86609 gene locus_tag LOCUS_49450 87934 86609 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730651.1 protein_id gnl|my_center|LOCUS_49450 88248 88805 gene locus_tag LOCUS_49460 88248 88805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_49460 89153 88923 gene locus_tag LOCUS_49470 89153 88923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49470 90087 89176 gene locus_tag LOCUS_49480 90087 89176 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105573.1 protein_id gnl|my_center|LOCUS_49480 90455 90243 gene locus_tag LOCUS_49490 90455 90243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49490 91258 90521 gene locus_tag LOCUS_49500 91258 90521 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974575.1 protein_id gnl|my_center|LOCUS_49500 91505 92170 gene locus_tag LOCUS_49510 91505 92170 CDS product DUF4097 family beta strand repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029635.1 protein_id gnl|my_center|LOCUS_49510 92228 92815 gene locus_tag LOCUS_49520 92228 92815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49520 92739 92760 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 93223 95076 gene locus_tag LOCUS_49530 93223 95076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49530 95423 95139 gene locus_tag LOCUS_49540 95423 95139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49540 95586 98171 gene locus_tag LOCUS_49550 95586 98171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49550 98252 99289 gene locus_tag LOCUS_49560 98252 99289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49560 99143 99163 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 103577 99489 gene locus_tag LOCUS_49570 103577 99489 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226231.1 protein_id gnl|my_center|LOCUS_49570 104248 105723 gene locus_tag LOCUS_49580 104248 105723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49580 106052 105813 gene locus_tag LOCUS_49590 106052 105813 CDS product DUF2249 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963400.1 protein_id gnl|my_center|LOCUS_49590 106193 106543 gene locus_tag LOCUS_49600 106193 106543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49600 106540 107694 gene locus_tag LOCUS_49610 106540 107694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257446.1 protein_id gnl|my_center|LOCUS_49610 107712 108185 gene locus_tag LOCUS_49620 107712 108185 CDS product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777100.1 protein_id gnl|my_center|LOCUS_49620 108698 108222 gene locus_tag LOCUS_49630 108698 108222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49630 108860 111529 gene locus_tag LOCUS_49640 108860 111529 CDS product multicopper oxidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_218916596.1 protein_id gnl|my_center|LOCUS_49640 111644 112006 gene locus_tag LOCUS_49650 111644 112006 CDS product DUF488 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971524.1 protein_id gnl|my_center|LOCUS_49650 114371 112026 gene locus_tag LOCUS_49660 114371 112026 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189742800.1 protein_id gnl|my_center|LOCUS_49660 115835 114489 gene locus_tag LOCUS_49670 115835 114489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49670 117541 115892 gene locus_tag LOCUS_49680 117541 115892 CDS product aldehyde dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038347.1 protein_id gnl|my_center|LOCUS_49680 117647 118813 gene locus_tag LOCUS_49690 117647 118813 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030796.1 protein_id gnl|my_center|LOCUS_49690 118810 119136 gene locus_tag LOCUS_49700 118810 119136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49700 119129 120574 gene locus_tag LOCUS_49710 119129 120574 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030798.1 protein_id gnl|my_center|LOCUS_49710 120604 121500 gene locus_tag LOCUS_49720 120604 121500 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030799.1 protein_id gnl|my_center|LOCUS_49720 121503 122504 gene locus_tag LOCUS_49730 121503 122504 CDS product proline racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030800.1 protein_id gnl|my_center|LOCUS_49730 122796 123950 gene locus_tag LOCUS_49740 122796 123950 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013893969.1 protein_id gnl|my_center|LOCUS_49740 124019 124918 gene locus_tag LOCUS_49750 124019 124918 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525177.1 protein_id gnl|my_center|LOCUS_49750 124918 126021 gene locus_tag LOCUS_49760 124918 126021 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525178.1 protein_id gnl|my_center|LOCUS_49760 126018 126857 gene locus_tag LOCUS_49770 126018 126857 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525179.1 protein_id gnl|my_center|LOCUS_49770 126854 127567 gene locus_tag LOCUS_49780 126854 127567 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815204.1 protein_id gnl|my_center|LOCUS_49780 127767 127792 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 127793 128641 gene locus_tag LOCUS_49790 127793 128641 CDS product proline racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258816.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_49790 128638 129570 gene locus_tag LOCUS_49800 128638 129570 CDS product ornithine cyclodeaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258703.1 protein_id gnl|my_center|LOCUS_49800 130800 129787 gene locus_tag LOCUS_49810 130800 129787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49810 131855 130797 gene locus_tag LOCUS_49820 131855 130797 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973862.1 protein_id gnl|my_center|LOCUS_49820 132844 131858 gene locus_tag LOCUS_49830 132844 131858 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973520.1 protein_id gnl|my_center|LOCUS_49830 133827 132841 gene locus_tag LOCUS_49840 133827 132841 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973522.1 protein_id gnl|my_center|LOCUS_49840 135599 133857 gene locus_tag LOCUS_49850 135599 133857 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994617.1 protein_id gnl|my_center|LOCUS_49850 135953 136207 gene locus_tag LOCUS_49860 135953 136207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49860 136235 136690 gene locus_tag LOCUS_49870 136235 136690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49870 136966 137871 gene locus_tag LOCUS_49880 136966 137871 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978666.1 protein_id gnl|my_center|LOCUS_49880 140035 137915 gene locus_tag LOCUS_49890 140035 137915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49890 140241 140447 gene locus_tag LOCUS_49900 140241 140447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49900 141021 140497 gene locus_tag LOCUS_49910 141021 140497 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_078653187.1 protein_id gnl|my_center|LOCUS_49910 141045 141070 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 141159 142571 gene locus_tag LOCUS_49920 141159 142571 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257773.1 protein_id gnl|my_center|LOCUS_49920 142766 142566 gene locus_tag LOCUS_49930 142766 142566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49930 142935 143606 gene locus_tag LOCUS_49940 142935 143606 CDS product TetR/AcrR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031841.1 protein_id gnl|my_center|LOCUS_49940 144519 143620 gene locus_tag LOCUS_49950 144519 143620 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226008.1 protein_id gnl|my_center|LOCUS_49950 144757 146244 gene locus_tag LOCUS_49960 144757 146244 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029141.1 protein_id gnl|my_center|LOCUS_49960 146593 146282 gene locus_tag LOCUS_49970 146593 146282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49970 146799 147440 gene locus_tag LOCUS_49980 146799 147440 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973087.1 protein_id gnl|my_center|LOCUS_49980 147437 148498 gene locus_tag LOCUS_49990 147437 148498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49990 148550 149248 gene locus_tag LOCUS_50000 148550 149248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50000 150263 149397 gene locus_tag LOCUS_50010 150263 149397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50010 150529 150260 gene locus_tag LOCUS_50020 150529 150260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50020 150647 151654 gene locus_tag LOCUS_50030 150647 151654 CDS product D-cysteine desulfhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815232.1 protein_id gnl|my_center|LOCUS_50030 151678 152373 gene locus_tag LOCUS_50040 151678 152373 CDS product amino acid racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226631.1 protein_id gnl|my_center|LOCUS_50040 152417 153082 gene locus_tag LOCUS_50050 152417 153082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50050 155139 153142 gene locus_tag LOCUS_50060 155139 153142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50060 156503 155478 gene locus_tag LOCUS_50070 156503 155478 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194310.1 protein_id gnl|my_center|LOCUS_50070 156562 157680 gene locus_tag LOCUS_50080 156562 157680 CDS product YeiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356366.1 protein_id gnl|my_center|LOCUS_50080 157974 158153 gene locus_tag LOCUS_50090 157974 158153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50090 158180 159187 gene locus_tag LOCUS_50100 158180 159187 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029094.1 protein_id gnl|my_center|LOCUS_50100 159577 159335 gene locus_tag LOCUS_50110 159577 159335 CDS product 4-oxalocrotonate tautomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974281.1 protein_id gnl|my_center|LOCUS_50110 160527 159622 gene locus_tag LOCUS_50120 160527 159622 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027024.1 protein_id gnl|my_center|LOCUS_50120 161285 160524 gene locus_tag LOCUS_50130 161285 160524 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974282.1 protein_id gnl|my_center|LOCUS_50130 161372 162226 gene locus_tag LOCUS_50140 161372 162226 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029811.1 protein_id gnl|my_center|LOCUS_50140 162473 165454 gene locus_tag LOCUS_50150 162473 165454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_50150 164697 164727 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 165405 166034 gene locus_tag LOCUS_50160 165405 166034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50160 166844 166062 gene locus_tag LOCUS_50170 166844 166062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50170 166792 166819 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 166825 167088 gene locus_tag LOCUS_50180 166825 167088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50180 167190 167753 gene locus_tag LOCUS_50190 167190 167753 CDS product cysteine dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926066.1 protein_id gnl|my_center|LOCUS_50190 168012 167809 gene locus_tag LOCUS_50200 168012 167809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50200 167963 168163 gene locus_tag LOCUS_50210 167963 168163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50210 169056 168397 gene locus_tag LOCUS_50220 169056 168397 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029222.1 protein_id gnl|my_center|LOCUS_50220 169198 170037 gene locus_tag LOCUS_50230 169198 170037 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030872677.1 protein_id gnl|my_center|LOCUS_50230 170495 170052 gene locus_tag LOCUS_50240 170495 170052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50240 170811 170482 gene locus_tag LOCUS_50250 170811 170482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50250 170518 170545 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 171247 172257 gene locus_tag LOCUS_50260 171247 172257 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031646.1 protein_id gnl|my_center|LOCUS_50260 172379 173434 gene locus_tag LOCUS_50270 172379 173434 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_183337994.1 protein_id gnl|my_center|LOCUS_50270 173463 173810 gene locus_tag LOCUS_50280 173463 173810 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975921.1 protein_id gnl|my_center|LOCUS_50280 175182 173824 gene locus_tag LOCUS_50290 175182 173824 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029546.1 protein_id gnl|my_center|LOCUS_50290 175459 176289 gene locus_tag LOCUS_50300 175459 176289 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031934.1 protein_id gnl|my_center|LOCUS_50300 177258 176365 gene locus_tag LOCUS_50310 177258 176365 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284765.1 protein_id gnl|my_center|LOCUS_50310 177360 178448 gene locus_tag LOCUS_50320 177360 178448 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467622.1 protein_id gnl|my_center|LOCUS_50320 178548 179054 gene locus_tag LOCUS_50330 178548 179054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50330 179029 179733 gene locus_tag LOCUS_50340 179029 179733 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228565.1 protein_id gnl|my_center|LOCUS_50340 180735 179785 gene locus_tag LOCUS_50350 180735 179785 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228449.1 protein_id gnl|my_center|LOCUS_50350 182310 181036 gene locus_tag LOCUS_50360 182310 181036 CDS product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972063.1 protein_id gnl|my_center|LOCUS_50360 182903 182337 gene locus_tag LOCUS_50370 182903 182337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50370 183204 183851 gene locus_tag LOCUS_50380 183204 183851 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031734.1 protein_id gnl|my_center|LOCUS_50380 183955 184485 gene locus_tag LOCUS_50390 183955 184485 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005078812.1 protein_id gnl|my_center|LOCUS_50390 184603 186777 gene locus_tag LOCUS_50400 184603 186777 CDS product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_137396889.1 protein_id gnl|my_center|LOCUS_50400 186967 187572 gene locus_tag LOCUS_50410 186967 187572 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162495312.1 protein_id gnl|my_center|LOCUS_50410 >Feature sequence015 1692 1216 gene locus_tag LOCUS_50420 1692 1216 CDS product organic hydroperoxide resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005063604.1 protein_id gnl|my_center|LOCUS_50420 1466 1495 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2287 1820 gene locus_tag LOCUS_50430 2287 1820 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028699.1 protein_id gnl|my_center|LOCUS_50430 3042 2284 gene locus_tag LOCUS_50440 3042 2284 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028802.1 protein_id gnl|my_center|LOCUS_50440 3800 3039 gene locus_tag LOCUS_50450 gene cbiQ 3800 3039 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975656.1 protein_id gnl|my_center|LOCUS_50450 4848 3802 gene locus_tag LOCUS_50460 4848 3802 CDS product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028801.1 protein_id gnl|my_center|LOCUS_50460 5023 5385 gene locus_tag LOCUS_50470 5023 5385 CDS product SsgA family sporulation/cell division regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975658.1 protein_id gnl|my_center|LOCUS_50470 7080 5407 gene locus_tag LOCUS_50480 7080 5407 CDS product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_134111963.1 protein_id gnl|my_center|LOCUS_50480 8875 7253 gene locus_tag LOCUS_50490 8875 7253 CDS product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010985034.1 protein_id gnl|my_center|LOCUS_50490 10729 8981 gene locus_tag LOCUS_50500 10729 8981 CDS product phospholipid carrier-dependent glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486701.1 protein_id gnl|my_center|LOCUS_50500 10878 11705 gene locus_tag LOCUS_50510 gene rsmI 10878 11705 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975663.1 protein_id gnl|my_center|LOCUS_50510 12002 12433 gene locus_tag LOCUS_50520 12002 12433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028797.1 protein_id gnl|my_center|LOCUS_50520 12481 13353 gene locus_tag LOCUS_50530 12481 13353 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028796.1 protein_id gnl|my_center|LOCUS_50530 13565 14905 gene locus_tag LOCUS_50540 13565 14905 CDS product resuscitation-promoting factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229978.1 protein_id gnl|my_center|LOCUS_50540 14936 15844 gene locus_tag LOCUS_50550 gene rsmA 14936 15844 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975667.1 protein_id gnl|my_center|LOCUS_50550 15841 16770 gene locus_tag LOCUS_50560 15841 16770 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028794.1 protein_id gnl|my_center|LOCUS_50560 16846 18666 gene locus_tag LOCUS_50570 16846 18666 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975669.1 protein_id gnl|my_center|LOCUS_50570 18905 20800 gene locus_tag LOCUS_50580 18905 20800 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093456319.1 protein_id gnl|my_center|LOCUS_50580 20898 22802 gene locus_tag LOCUS_50590 20898 22802 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486695.1 protein_id gnl|my_center|LOCUS_50590 23080 23805 gene locus_tag LOCUS_50600 23080 23805 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028791.1 protein_id gnl|my_center|LOCUS_50600 24063 23860 gene locus_tag LOCUS_50610 24063 23860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50610 25934 23955 gene locus_tag LOCUS_50620 25934 23955 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975674.1 protein_id gnl|my_center|LOCUS_50620 24241 24288 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 26126 27187 gene locus_tag LOCUS_50630 gene galT 26126 27187 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028787.1 protein_id gnl|my_center|LOCUS_50630 27184 28152 gene locus_tag LOCUS_50640 gene galE 27184 28152 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975676.1 protein_id gnl|my_center|LOCUS_50640 28253 29281 gene locus_tag LOCUS_50650 gene galK 28253 29281 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028786.1 protein_id gnl|my_center|LOCUS_50650 29771 29328 gene locus_tag LOCUS_50660 29771 29328 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975678.1 protein_id gnl|my_center|LOCUS_50660 30042 30809 gene locus_tag LOCUS_50670 30042 30809 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326434.1 protein_id gnl|my_center|LOCUS_50670 31265 30768 gene locus_tag LOCUS_50680 gene tamR 31265 30768 CDS product MarR family transcriptional regulator TamR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975680.1 protein_id gnl|my_center|LOCUS_50680 31349 32203 gene locus_tag LOCUS_50690 31349 32203 CDS product trans-aconitate 2-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028784.1 protein_id gnl|my_center|LOCUS_50690 32286 32366 gene locus_tag LOCUS_t00540 32286 32366 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 33356 32679 gene locus_tag LOCUS_50700 33356 32679 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975684.1 protein_id gnl|my_center|LOCUS_50700 34360 33353 gene locus_tag LOCUS_50710 34360 33353 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975685.1 protein_id gnl|my_center|LOCUS_50710 34652 37381 gene locus_tag LOCUS_50720 gene ppc 34652 37381 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975687.1 protein_id gnl|my_center|LOCUS_50720 37997 37482 gene locus_tag LOCUS_50730 37997 37482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028783.1 protein_id gnl|my_center|LOCUS_50730 38659 38063 gene locus_tag LOCUS_50740 gene pth 38659 38063 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975689.1 protein_id gnl|my_center|LOCUS_50740 39041 38760 gene locus_tag LOCUS_50750 39041 38760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_50750 39094 39115 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 40553 39579 gene locus_tag LOCUS_50760 40553 39579 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975691.1 protein_id gnl|my_center|LOCUS_50760 42094 40703 gene locus_tag LOCUS_50770 gene glmU 42094 40703 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975692.1 protein_id gnl|my_center|LOCUS_50770 42334 42261 gene locus_tag LOCUS_t00550 42334 42261 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 43230 42343 gene locus_tag LOCUS_50780 43230 42343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50780 43368 44759 gene locus_tag LOCUS_50790 43368 44759 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975694.1 protein_id gnl|my_center|LOCUS_50790 45305 44811 gene locus_tag LOCUS_50800 45305 44811 CDS product SUKH-3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975695.1 protein_id gnl|my_center|LOCUS_50800 46232 45381 gene locus_tag LOCUS_50810 46232 45381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50810 46231 47259 gene locus_tag LOCUS_50820 46231 47259 CDS product SMI1/KNR4 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028779.1 protein_id gnl|my_center|LOCUS_50820 47270 50230 gene locus_tag LOCUS_50830 47270 50230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_50830 49703 49723 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 50441 51328 gene locus_tag LOCUS_50840 50441 51328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028777.1 protein_id gnl|my_center|LOCUS_50840 52975 51362 gene locus_tag LOCUS_50850 52975 51362 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030482.1 protein_id gnl|my_center|LOCUS_50850 53478 52972 gene locus_tag LOCUS_50860 53478 52972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50860 54065 54775 gene locus_tag LOCUS_50870 54065 54775 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028774.1 protein_id gnl|my_center|LOCUS_50870 54772 56955 gene locus_tag LOCUS_50880 54772 56955 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028773.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_50880 56924 56949 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 56982 57368 gene locus_tag LOCUS_50890 56982 57368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_50890 57841 57869 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 57891 61190 gene locus_tag LOCUS_50900 gene mfd 57891 61190 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028772.1 protein_id gnl|my_center|LOCUS_50900 61358 62086 gene locus_tag LOCUS_50910 61358 62086 CDS product HNH endonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028771.1 protein_id gnl|my_center|LOCUS_50910 62532 62089 gene locus_tag LOCUS_50920 62532 62089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50920 63023 62631 gene locus_tag LOCUS_50930 63023 62631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50930 63826 63113 gene locus_tag LOCUS_50940 63826 63113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50940 64047 64874 gene locus_tag LOCUS_50950 64047 64874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50950 65071 65718 gene locus_tag LOCUS_50960 65071 65718 CDS product SurA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975710.1 protein_id gnl|my_center|LOCUS_50960 65737 66771 gene locus_tag LOCUS_50970 65737 66771 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975711.1 protein_id gnl|my_center|LOCUS_50970 66814 68103 gene locus_tag LOCUS_50980 66814 68103 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975712.1 protein_id gnl|my_center|LOCUS_50980 68300 69391 gene locus_tag LOCUS_50990 gene rpfC 68300 69391 CDS product resuscitation-promoting factor protein RpfC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028765.1 protein_id gnl|my_center|LOCUS_50990 69745 70431 gene locus_tag LOCUS_51000 gene rpfA 69745 70431 CDS product resuscitation-promoting factor protein RpfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028764.1 protein_id gnl|my_center|LOCUS_51000 70662 71948 gene locus_tag LOCUS_51010 gene eno 70662 71948 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975715.1 protein_id gnl|my_center|LOCUS_51010 72077 72553 gene locus_tag LOCUS_51020 gene divIC 72077 72553 CDS product cell division protein DivIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975716.1 protein_id gnl|my_center|LOCUS_51020 72580 73146 gene locus_tag LOCUS_51030 72580 73146 CDS product DUF501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028762.1 protein_id gnl|my_center|LOCUS_51030 73143 74096 gene locus_tag LOCUS_51040 73143 74096 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975718.1 protein_id gnl|my_center|LOCUS_51040 74950 76332 gene locus_tag LOCUS_51050 74950 76332 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486678.1 protein_id gnl|my_center|LOCUS_51050 76594 77907 gene locus_tag LOCUS_51060 76594 77907 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028761.1 protein_id gnl|my_center|LOCUS_51060 79855 77972 gene locus_tag LOCUS_51070 79855 77972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_51070 79877 79898 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 81451 80681 gene locus_tag LOCUS_51080 81451 80681 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975722.1 protein_id gnl|my_center|LOCUS_51080 81905 81990 gene locus_tag LOCUS_t00560 81905 81990 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 82538 82278 gene locus_tag LOCUS_51090 82538 82278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51090 83166 82765 gene locus_tag LOCUS_51100 83166 82765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51100 83408 83623 gene locus_tag LOCUS_51110 83408 83623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51110 83818 83842 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 84113 86035 gene locus_tag LOCUS_51120 84113 86035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51120 86134 86808 gene locus_tag LOCUS_51130 86134 86808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51130 87102 87233 gene locus_tag LOCUS_51140 87102 87233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51140 87448 88359 gene locus_tag LOCUS_51150 87448 88359 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975728.1 protein_id gnl|my_center|LOCUS_51150 88688 88461 gene locus_tag LOCUS_51160 88688 88461 CDS product DUF4287 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975729.1 protein_id gnl|my_center|LOCUS_51160 88820 89101 gene locus_tag LOCUS_51170 88820 89101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975730.1 protein_id gnl|my_center|LOCUS_51170 89981 89160 gene locus_tag LOCUS_51180 89981 89160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028756.1 protein_id gnl|my_center|LOCUS_51180 91539 90319 gene locus_tag LOCUS_51190 91539 90319 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975732.1 protein_id gnl|my_center|LOCUS_51190 92776 91706 gene locus_tag LOCUS_51200 92776 91706 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975733.1 protein_id gnl|my_center|LOCUS_51200 92905 94296 gene locus_tag LOCUS_51210 92905 94296 CDS product cystathionine beta-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028755.1 protein_id gnl|my_center|LOCUS_51210 94306 94464 gene locus_tag LOCUS_51220 94306 94464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51220 95025 94585 gene locus_tag LOCUS_51230 95025 94585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167469765.1 protein_id gnl|my_center|LOCUS_51230 95533 95561 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 95600 96274 gene locus_tag LOCUS_51240 95600 96274 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028753.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_51240 96405 96989 gene locus_tag LOCUS_51250 96405 96989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028752.1 protein_id gnl|my_center|LOCUS_51250 97372 96998 gene locus_tag LOCUS_51260 97372 96998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978181.1 protein_id gnl|my_center|LOCUS_51260 97895 97392 gene locus_tag LOCUS_51270 97895 97392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51270 98742 97909 gene locus_tag LOCUS_51280 98742 97909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978179.1 protein_id gnl|my_center|LOCUS_51280 99131 98739 gene locus_tag LOCUS_51290 99131 98739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027293.1 protein_id gnl|my_center|LOCUS_51290 100723 99302 gene locus_tag LOCUS_51300 100723 99302 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027010.1 protein_id gnl|my_center|LOCUS_51300 101051 102634 gene locus_tag LOCUS_51310 101051 102634 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028751.1 protein_id gnl|my_center|LOCUS_51310 102631 103860 gene locus_tag LOCUS_51320 102631 103860 CDS product allantoate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028750.1 protein_id gnl|my_center|LOCUS_51320 103857 105206 gene locus_tag LOCUS_51330 103857 105206 CDS product formimidoylglutamate deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028749.1 protein_id gnl|my_center|LOCUS_51330 105245 106441 gene locus_tag LOCUS_51340 gene hutI 105245 106441 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028748.1 protein_id gnl|my_center|LOCUS_51340 108170 106500 gene locus_tag LOCUS_51350 108170 106500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51350 109241 108516 gene locus_tag LOCUS_51360 109241 108516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_51360 108625 108650 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 109443 109871 gene locus_tag LOCUS_51370 109443 109871 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975744.1 protein_id gnl|my_center|LOCUS_51370 110174 110722 gene locus_tag LOCUS_51380 110174 110722 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028746.1 protein_id gnl|my_center|LOCUS_51380 110893 111228 gene locus_tag LOCUS_51390 110893 111228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51390 111189 111214 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 111285 111668 gene locus_tag LOCUS_51400 111285 111668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51400 111702 112232 gene locus_tag LOCUS_51410 111702 112232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51410 112040 112067 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 112165 112767 gene locus_tag LOCUS_51420 112165 112767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51420 112764 114029 gene locus_tag LOCUS_51430 112764 114029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51430 114026 115354 gene locus_tag LOCUS_51440 114026 115354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51440 117063 115567 gene locus_tag LOCUS_51450 117063 115567 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975747.1 protein_id gnl|my_center|LOCUS_51450 117616 118293 gene locus_tag LOCUS_51460 117616 118293 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975748.1 protein_id gnl|my_center|LOCUS_51460 118338 119609 gene locus_tag LOCUS_51470 gene draK 118338 119609 CDS product two-component system sensor histidine kinase DraK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028744.1 protein_id gnl|my_center|LOCUS_51470 120214 119669 gene locus_tag LOCUS_51480 120214 119669 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028743.1 protein_id gnl|my_center|LOCUS_51480 120455 121573 gene locus_tag LOCUS_51490 120455 121573 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975751.1 protein_id gnl|my_center|LOCUS_51490 121594 122097 gene locus_tag LOCUS_51500 gene purE 121594 122097 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975752.1 protein_id gnl|my_center|LOCUS_51500 122103 123281 gene locus_tag LOCUS_51510 122103 123281 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028742.1 protein_id gnl|my_center|LOCUS_51510 123434 124570 gene locus_tag LOCUS_51520 123434 124570 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028741.1 protein_id gnl|my_center|LOCUS_51520 124986 124588 gene locus_tag LOCUS_51530 124986 124588 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028740.1 protein_id gnl|my_center|LOCUS_51530 125120 125626 gene locus_tag LOCUS_51540 125120 125626 CDS product CGNR zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028739.1 protein_id gnl|my_center|LOCUS_51540 127051 125768 gene locus_tag LOCUS_51550 127051 125768 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975759.1 protein_id gnl|my_center|LOCUS_51550 127066 127091 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 127320 128477 gene locus_tag LOCUS_51560 127320 128477 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975760.1 protein_id gnl|my_center|LOCUS_51560 129852 128677 gene locus_tag LOCUS_51570 129852 128677 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272155.1 protein_id gnl|my_center|LOCUS_51570 129998 130549 gene locus_tag LOCUS_51580 129998 130549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51580 131442 131014 gene locus_tag LOCUS_51590 131442 131014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51590 131957 131520 gene locus_tag LOCUS_51600 131957 131520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229068.1 protein_id gnl|my_center|LOCUS_51600 132284 132090 gene locus_tag LOCUS_51610 132284 132090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51610 132523 132284 gene locus_tag LOCUS_51620 132523 132284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51620 132885 132520 gene locus_tag LOCUS_51630 132885 132520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51630 133065 133487 gene locus_tag LOCUS_51640 133065 133487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51640 133444 133968 gene locus_tag LOCUS_51650 133444 133968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51650 133976 134830 gene locus_tag LOCUS_51660 133976 134830 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_199889868.1 protein_id gnl|my_center|LOCUS_51660 134843 135028 gene locus_tag LOCUS_51670 134843 135028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51670 135302 135328 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 135404 136753 gene locus_tag LOCUS_51680 135404 136753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51680 136914 137273 gene locus_tag LOCUS_51690 136914 137273 CDS product four-helix bundle copper-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969066.1 protein_id gnl|my_center|LOCUS_51690 138470 137355 gene locus_tag LOCUS_51700 138470 137355 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189284299.1 protein_id gnl|my_center|LOCUS_51700 138776 139333 gene locus_tag LOCUS_51710 138776 139333 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030873063.1 protein_id gnl|my_center|LOCUS_51710 140884 139349 gene locus_tag LOCUS_51720 140884 139349 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326400.1 protein_id gnl|my_center|LOCUS_51720 141013 142068 gene locus_tag LOCUS_51730 141013 142068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51730 141228 141254 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 143639 142149 gene locus_tag LOCUS_51740 143639 142149 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486658.1 protein_id gnl|my_center|LOCUS_51740 144071 143892 gene locus_tag LOCUS_51750 144071 143892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_51750 145701 144184 gene locus_tag LOCUS_51760 145701 144184 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486660.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_51760 144242 144269 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 147281 145929 gene locus_tag LOCUS_51770 147281 145929 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028731.1 protein_id gnl|my_center|LOCUS_51770 148223 147468 gene locus_tag LOCUS_51780 148223 147468 CDS product TIGR03089 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975771.1 protein_id gnl|my_center|LOCUS_51780 148578 148282 gene locus_tag LOCUS_51790 148578 148282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51790 148553 149821 gene locus_tag LOCUS_51800 148553 149821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51800 149934 151016 gene locus_tag LOCUS_51810 149934 151016 CDS product NDP-sugar synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028729.1 protein_id gnl|my_center|LOCUS_51810 152115 151093 gene locus_tag LOCUS_51820 152115 151093 CDS product 3-methyladenine DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028728.1 protein_id gnl|my_center|LOCUS_51820 153695 152268 gene locus_tag LOCUS_51830 153695 152268 CDS product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028727.1 protein_id gnl|my_center|LOCUS_51830 154651 153692 gene locus_tag LOCUS_51840 gene cofD 154651 153692 CDS product 2-phospho-L-lactate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975775.1 protein_id gnl|my_center|LOCUS_51840 155328 154804 gene locus_tag LOCUS_51850 155328 154804 CDS product cysteine dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028726.1 protein_id gnl|my_center|LOCUS_51850 155424 155873 gene locus_tag LOCUS_51860 155424 155873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51860 156000 156263 gene locus_tag LOCUS_51870 156000 156263 CDS product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975777.1 protein_id gnl|my_center|LOCUS_51870 156273 156293 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 156472 157242 gene locus_tag LOCUS_51880 156472 157242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_51880 157184 157212 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 157236 160256 gene locus_tag LOCUS_51890 157236 160256 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028725.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_51890 160253 161788 gene locus_tag LOCUS_51900 160253 161788 CDS product DUF5719 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028724.1 protein_id gnl|my_center|LOCUS_51900 162038 161844 gene locus_tag LOCUS_51910 162038 161844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_51910 162082 162107 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 162615 163040 gene locus_tag LOCUS_51920 162615 163040 CDS product DUF3499 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975781.1 protein_id gnl|my_center|LOCUS_51920 163200 164564 gene locus_tag LOCUS_51930 163200 164564 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028721.1 protein_id gnl|my_center|LOCUS_51930 164771 164941 gene locus_tag LOCUS_51940 164771 164941 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975784.1 protein_id gnl|my_center|LOCUS_51940 165078 166205 gene locus_tag LOCUS_51950 165078 166205 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975785.1 protein_id gnl|my_center|LOCUS_51950 166262 167413 gene locus_tag LOCUS_51960 gene manA 166262 167413 CDS product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975786.1 protein_id gnl|my_center|LOCUS_51960 167525 168505 gene locus_tag LOCUS_51970 167525 168505 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028720.1 protein_id gnl|my_center|LOCUS_51970 >Feature sequence016 58 1879 gene locus_tag LOCUS_r00010 58 1879 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 note aligned only 56 percent of the 23S ribosomal RNA 492 517 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1889 1898 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3347 3370 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3454 3564 gene locus_tag LOCUS_r00020 3454 3564 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 3665 5473 gene locus_tag LOCUS_51980 3665 5473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51980 6829 5567 gene locus_tag LOCUS_51990 6829 5567 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027979.1 protein_id gnl|my_center|LOCUS_51990 6933 7967 gene locus_tag LOCUS_52000 6933 7967 CDS product HAD hydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027978.1 protein_id gnl|my_center|LOCUS_52000 8024 9067 gene locus_tag LOCUS_52010 8024 9067 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027977.1 protein_id gnl|my_center|LOCUS_52010 9064 10221 gene locus_tag LOCUS_52020 9064 10221 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868181.1 protein_id gnl|my_center|LOCUS_52020 10275 11165 gene locus_tag LOCUS_52030 10275 11165 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027975.1 protein_id gnl|my_center|LOCUS_52030 11496 11149 gene locus_tag LOCUS_52040 11496 11149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977038.1 protein_id gnl|my_center|LOCUS_52040 11539 11829 gene locus_tag LOCUS_52050 11539 11829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977039.1 protein_id gnl|my_center|LOCUS_52050 11837 12652 gene locus_tag LOCUS_52060 11837 12652 CDS product hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027974.1 protein_id gnl|my_center|LOCUS_52060 12649 13554 gene locus_tag LOCUS_52070 12649 13554 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027973.1 protein_id gnl|my_center|LOCUS_52070 13623 14594 gene locus_tag LOCUS_52080 13623 14594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_52080 14212 14237 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 14507 15379 gene locus_tag LOCUS_52090 14507 15379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52090 15429 16178 gene locus_tag LOCUS_52100 15429 16178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804978.1 protein_id gnl|my_center|LOCUS_52100 16474 17610 gene locus_tag LOCUS_52110 16474 17610 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037666770.1 protein_id gnl|my_center|LOCUS_52110 19275 17644 gene locus_tag LOCUS_52120 19275 17644 CDS product PucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027970.1 protein_id gnl|my_center|LOCUS_52120 19883 19979 gene locus_tag LOCUS_t00570 19883 19979 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 21762 19960 gene locus_tag LOCUS_52130 21762 19960 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027969.1 protein_id gnl|my_center|LOCUS_52130 22265 21900 gene locus_tag LOCUS_52140 22265 21900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52140 22278 23951 gene locus_tag LOCUS_52150 22278 23951 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027968.1 protein_id gnl|my_center|LOCUS_52150 24082 24708 gene locus_tag LOCUS_52160 24082 24708 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977050.1 protein_id gnl|my_center|LOCUS_52160 24870 26966 gene locus_tag LOCUS_52170 24870 26966 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868162.1 protein_id gnl|my_center|LOCUS_52170 27111 28226 gene locus_tag LOCUS_52180 gene ald 27111 28226 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868159.1 protein_id gnl|my_center|LOCUS_52180 28749 29750 gene locus_tag LOCUS_52190 28749 29750 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977053.1 protein_id gnl|my_center|LOCUS_52190 29747 30337 gene locus_tag LOCUS_52200 29747 30337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162495132.1 protein_id gnl|my_center|LOCUS_52200 30356 31462 gene locus_tag LOCUS_52210 30356 31462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_52210 31459 32145 gene locus_tag LOCUS_52220 gene scpB 31459 32145 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027964.1 protein_id gnl|my_center|LOCUS_52220 32145 33227 gene locus_tag LOCUS_52230 32145 33227 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027963.1 protein_id gnl|my_center|LOCUS_52230 33946 33224 gene locus_tag LOCUS_52240 33946 33224 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027961.1 protein_id gnl|my_center|LOCUS_52240 34430 33969 gene locus_tag LOCUS_52250 34430 33969 CDS product Rieske (2Fe-2S) protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027960.1 protein_id gnl|my_center|LOCUS_52250 34680 35042 gene locus_tag LOCUS_52260 gene aroH 34680 35042 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977062.1 protein_id gnl|my_center|LOCUS_52260 35039 36124 gene locus_tag LOCUS_52270 35039 36124 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027959.1 protein_id gnl|my_center|LOCUS_52270 36262 36957 gene locus_tag LOCUS_52280 gene cmk 36262 36957 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027958.1 protein_id gnl|my_center|LOCUS_52280 36954 37634 gene locus_tag LOCUS_52290 36954 37634 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977065.1 protein_id gnl|my_center|LOCUS_52290 37711 39195 gene locus_tag LOCUS_52300 gene der 37711 39195 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977066.1 protein_id gnl|my_center|LOCUS_52300 39732 39319 gene locus_tag LOCUS_52310 39732 39319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52310 40603 39770 gene locus_tag LOCUS_52320 40603 39770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977068.1 protein_id gnl|my_center|LOCUS_52320 41142 41885 gene locus_tag LOCUS_52330 gene rpfA 41142 41885 CDS product resuscitation-promoting factor protein RpfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028764.1 protein_id gnl|my_center|LOCUS_52330 41246 41272 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 42677 42892 gene locus_tag LOCUS_52340 42677 42892 CDS product I78 family peptidase inhibitor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977071.1 protein_id gnl|my_center|LOCUS_52340 43983 42934 gene locus_tag LOCUS_52350 43983 42934 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027956.1 protein_id gnl|my_center|LOCUS_52350 45602 44268 gene locus_tag LOCUS_52360 45602 44268 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977073.1 protein_id gnl|my_center|LOCUS_52360 45781 47385 gene locus_tag LOCUS_52370 45781 47385 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027955.1 protein_id gnl|my_center|LOCUS_52370 47571 48761 gene locus_tag LOCUS_52380 47571 48761 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977076.1 protein_id gnl|my_center|LOCUS_52380 49251 48814 gene locus_tag LOCUS_52390 49251 48814 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977077.1 protein_id gnl|my_center|LOCUS_52390 49602 50789 gene locus_tag LOCUS_52400 49602 50789 CDS product DUF5685 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227909.1 protein_id gnl|my_center|LOCUS_52400 50832 51005 gene locus_tag LOCUS_52410 50832 51005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52410 51049 51351 gene locus_tag LOCUS_52420 51049 51351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52420 51545 52333 gene locus_tag LOCUS_52430 51545 52333 CDS product DUF1684 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027953.1 protein_id gnl|my_center|LOCUS_52430 52747 52361 gene locus_tag LOCUS_52440 52747 52361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52440 52635 53480 gene locus_tag LOCUS_52450 52635 53480 CDS product S1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977080.1 protein_id gnl|my_center|LOCUS_52450 53832 54911 gene locus_tag LOCUS_52460 53832 54911 CDS product S1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027949.1 protein_id gnl|my_center|LOCUS_52460 56138 55029 gene locus_tag LOCUS_52470 56138 55029 CDS product DUF3533 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977086.1 protein_id gnl|my_center|LOCUS_52470 56295 59936 gene locus_tag LOCUS_52480 gene dnaE 56295 59936 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027948.1 protein_id gnl|my_center|LOCUS_52480 59933 60907 gene locus_tag LOCUS_52490 59933 60907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027947.1 protein_id gnl|my_center|LOCUS_52490 61283 60909 gene locus_tag LOCUS_52500 61283 60909 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977089.1 protein_id gnl|my_center|LOCUS_52500 61384 61830 gene locus_tag LOCUS_52510 61384 61830 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977090.1 protein_id gnl|my_center|LOCUS_52510 62006 62866 gene locus_tag LOCUS_52520 62006 62866 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027946.1 protein_id gnl|my_center|LOCUS_52520 63980 62931 gene locus_tag LOCUS_52530 gene cbcC 63980 62931 CDS product carbohydrate-binding protein CbpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027945.1 protein_id gnl|my_center|LOCUS_52530 64066 64089 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 64379 64245 gene locus_tag LOCUS_52540 64379 64245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977094.1 protein_id gnl|my_center|LOCUS_52540 64530 65147 gene locus_tag LOCUS_52550 64530 65147 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977095.1 protein_id gnl|my_center|LOCUS_52550 65747 65235 gene locus_tag LOCUS_52560 65747 65235 CDS product DUF402 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027944.1 protein_id gnl|my_center|LOCUS_52560 66657 65728 gene locus_tag LOCUS_52570 66657 65728 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977097.1 protein_id gnl|my_center|LOCUS_52570 66541 67107 gene locus_tag LOCUS_52580 66541 67107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52580 67915 67142 gene locus_tag LOCUS_52590 67915 67142 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027942.1 protein_id gnl|my_center|LOCUS_52590 69049 67955 gene locus_tag LOCUS_52600 69049 67955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52600 69291 70640 gene locus_tag LOCUS_52610 69291 70640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52610 74400 70672 gene locus_tag LOCUS_52620 74400 70672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52620 75196 74393 gene locus_tag LOCUS_52630 75196 74393 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976090.1 protein_id gnl|my_center|LOCUS_52630 76212 75193 gene locus_tag LOCUS_52640 76212 75193 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878124.1 protein_id gnl|my_center|LOCUS_52640 76913 76209 gene locus_tag LOCUS_52650 76913 76209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52650 78522 77428 gene locus_tag LOCUS_52660 78522 77428 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878505.1 protein_id gnl|my_center|LOCUS_52660 78949 78524 gene locus_tag LOCUS_52670 78949 78524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52670 79159 79965 gene locus_tag LOCUS_52680 79159 79965 CDS product SGNH family lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977101.1 protein_id gnl|my_center|LOCUS_52680 81588 79969 gene locus_tag LOCUS_52690 81588 79969 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027941.1 protein_id gnl|my_center|LOCUS_52690 83284 81665 gene locus_tag LOCUS_52700 83284 81665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52700 84930 83281 gene locus_tag LOCUS_52710 84930 83281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52710 86586 85039 gene locus_tag LOCUS_52720 86586 85039 CDS product DUF4331 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929156.1 protein_id gnl|my_center|LOCUS_52720 86798 87340 gene locus_tag LOCUS_52730 86798 87340 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977103.1 protein_id gnl|my_center|LOCUS_52730 87337 88149 gene locus_tag LOCUS_52740 87337 88149 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977104.1 protein_id gnl|my_center|LOCUS_52740 88253 88531 gene locus_tag LOCUS_52750 88253 88531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977105.1 protein_id gnl|my_center|LOCUS_52750 89783 88575 gene locus_tag LOCUS_52760 89783 88575 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975683.1 protein_id gnl|my_center|LOCUS_52760 90676 89894 gene locus_tag LOCUS_52770 90676 89894 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027939.1 protein_id gnl|my_center|LOCUS_52770 91629 90673 gene locus_tag LOCUS_52780 91629 90673 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027938.1 protein_id gnl|my_center|LOCUS_52780 91693 92406 gene locus_tag LOCUS_52790 91693 92406 CDS product TetR/AcrR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977108.1 protein_id gnl|my_center|LOCUS_52790 93601 92432 gene locus_tag LOCUS_52800 93601 92432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325881.1 protein_id gnl|my_center|LOCUS_52800 94375 93626 gene locus_tag LOCUS_52810 94375 93626 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977110.1 protein_id gnl|my_center|LOCUS_52810 95718 94402 gene locus_tag LOCUS_52820 gene hmgA 95718 94402 CDS product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977111.1 protein_id gnl|my_center|LOCUS_52820 95871 96431 gene locus_tag LOCUS_52830 95871 96431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52830 96618 97226 gene locus_tag LOCUS_52840 96618 97226 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222036.1 protein_id gnl|my_center|LOCUS_52840 97342 99612 gene locus_tag LOCUS_52850 97342 99612 CDS product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027934.1 protein_id gnl|my_center|LOCUS_52850 99747 100454 gene locus_tag LOCUS_52860 99747 100454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52860 100510 101190 gene locus_tag LOCUS_52870 100510 101190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52870 101389 102897 gene locus_tag LOCUS_52880 101389 102897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52880 102397 102425 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 102971 104359 gene locus_tag LOCUS_52890 102971 104359 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027930.1 protein_id gnl|my_center|LOCUS_52890 104446 105531 gene locus_tag LOCUS_52900 104446 105531 CDS product Zn-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027929.1 protein_id gnl|my_center|LOCUS_52900 106492 105569 gene locus_tag LOCUS_52910 106492 105569 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027928.1 protein_id gnl|my_center|LOCUS_52910 107282 106572 gene locus_tag LOCUS_52920 107282 106572 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027927.1 protein_id gnl|my_center|LOCUS_52920 107979 107329 gene locus_tag LOCUS_52930 107979 107329 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977123.1 protein_id gnl|my_center|LOCUS_52930 108048 109199 gene locus_tag LOCUS_52940 108048 109199 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027926.1 protein_id gnl|my_center|LOCUS_52940 109224 109547 gene locus_tag LOCUS_52950 109224 109547 CDS product YiaA/YiaB family inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977125.1 protein_id gnl|my_center|LOCUS_52950 109659 110306 gene locus_tag LOCUS_52960 109659 110306 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977126.1 protein_id gnl|my_center|LOCUS_52960 110776 110297 gene locus_tag LOCUS_52970 110776 110297 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977127.1 protein_id gnl|my_center|LOCUS_52970 111378 110890 gene locus_tag LOCUS_52980 111378 110890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_52980 112274 111672 gene locus_tag LOCUS_52990 112274 111672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977130.1 protein_id gnl|my_center|LOCUS_52990 112442 112290 gene locus_tag LOCUS_53000 112442 112290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53000 112534 115359 gene locus_tag LOCUS_53010 112534 115359 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485851.1 protein_id gnl|my_center|LOCUS_53010 115024 115047 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 116786 115395 gene locus_tag LOCUS_53020 116786 115395 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729636.1 protein_id gnl|my_center|LOCUS_53020 118041 116797 gene locus_tag LOCUS_53030 118041 116797 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230529.1 protein_id gnl|my_center|LOCUS_53030 118240 119004 gene locus_tag LOCUS_53040 118240 119004 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977133.1 protein_id gnl|my_center|LOCUS_53040 119001 120710 gene locus_tag LOCUS_53050 119001 120710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53050 120754 121347 gene locus_tag LOCUS_53060 120754 121347 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868049.1 protein_id gnl|my_center|LOCUS_53060 122646 121432 gene locus_tag LOCUS_53070 122646 121432 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027921.1 protein_id gnl|my_center|LOCUS_53070 123687 122653 gene locus_tag LOCUS_53080 123687 122653 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027920.1 protein_id gnl|my_center|LOCUS_53080 124150 123791 gene locus_tag LOCUS_53090 124150 123791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53090 124614 124147 gene locus_tag LOCUS_53100 124614 124147 CDS product DUF202 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977138.1 protein_id gnl|my_center|LOCUS_53100 125208 124693 gene locus_tag LOCUS_53110 125208 124693 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485846.1 protein_id gnl|my_center|LOCUS_53110 126176 125265 gene locus_tag LOCUS_53120 126176 125265 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977140.1 protein_id gnl|my_center|LOCUS_53120 126664 127614 gene locus_tag LOCUS_53130 126664 127614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977141.1 protein_id gnl|my_center|LOCUS_53130 127637 129214 gene locus_tag LOCUS_53140 127637 129214 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027916.1 protein_id gnl|my_center|LOCUS_53140 129352 130164 gene locus_tag LOCUS_53150 129352 130164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53150 130148 130777 gene locus_tag LOCUS_53160 130148 130777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53160 131853 130828 gene locus_tag LOCUS_53170 131853 130828 CDS product L-idonate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027915.1 protein_id gnl|my_center|LOCUS_53170 132632 131868 gene locus_tag LOCUS_53180 132632 131868 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027914.1 protein_id gnl|my_center|LOCUS_53180 134040 132643 gene locus_tag LOCUS_53190 134040 132643 CDS product gluconate:H+ symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223067.1 protein_id gnl|my_center|LOCUS_53190 134788 134240 gene locus_tag LOCUS_53200 134788 134240 CDS product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977146.1 protein_id gnl|my_center|LOCUS_53200 134928 135629 gene locus_tag LOCUS_53210 134928 135629 CDS product FCD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027913.1 protein_id gnl|my_center|LOCUS_53210 136097 135705 gene locus_tag LOCUS_53220 136097 135705 CDS product YchJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027912.1 protein_id gnl|my_center|LOCUS_53220 136183 136494 gene locus_tag LOCUS_53230 136183 136494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53230 136505 137878 gene locus_tag LOCUS_53240 136505 137878 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403001.1 protein_id gnl|my_center|LOCUS_53240 138034 138065 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 138283 139608 gene locus_tag LOCUS_53250 138283 139608 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977149.1 protein_id gnl|my_center|LOCUS_53250 139765 139998 gene locus_tag LOCUS_53260 gene chpH 139765 139998 CDS product chaplin ChpH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977150.1 protein_id gnl|my_center|LOCUS_53260 140145 140597 gene locus_tag LOCUS_53270 140145 140597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_53270 140431 140453 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 140525 141055 gene locus_tag LOCUS_53280 140525 141055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_53280 141314 141126 gene locus_tag LOCUS_53290 141314 141126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53290 141362 142090 gene locus_tag LOCUS_53300 141362 142090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53300 144474 142144 gene locus_tag LOCUS_53310 144474 142144 CDS product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027909.1 protein_id gnl|my_center|LOCUS_53310 145454 144471 gene locus_tag LOCUS_53320 145454 144471 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977155.1 protein_id gnl|my_center|LOCUS_53320 145631 146686 gene locus_tag LOCUS_53330 145631 146686 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027908.1 protein_id gnl|my_center|LOCUS_53330 146965 147753 gene locus_tag LOCUS_53340 146965 147753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027907.1 protein_id gnl|my_center|LOCUS_53340 148783 147782 gene locus_tag LOCUS_53350 gene corA 148783 147782 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027906.1 protein_id gnl|my_center|LOCUS_53350 148846 149532 gene locus_tag LOCUS_53360 148846 149532 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977159.1 protein_id gnl|my_center|LOCUS_53360 149664 150254 gene locus_tag LOCUS_53370 149664 150254 CDS product DUF3090 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977160.1 protein_id gnl|my_center|LOCUS_53370 150251 151231 gene locus_tag LOCUS_53380 150251 151231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53380 150998 151031 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 151233 152462 gene locus_tag LOCUS_53390 gene mshC 151233 152462 CDS product cysteine--1-D-myo-inosityl 2-amino-2-deoxy-alpha-D-glucopyranoside ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977162.1 protein_id gnl|my_center|LOCUS_53390 153567 152551 gene locus_tag LOCUS_53400 gene parJ 153567 152551 CDS product filament polymerization regulator ParJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977163.1 protein_id gnl|my_center|LOCUS_53400 155401 153785 gene locus_tag LOCUS_53410 155401 153785 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977164.1 protein_id gnl|my_center|LOCUS_53410 156949 155411 gene locus_tag LOCUS_53420 gene glpK 156949 155411 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977165.1 protein_id gnl|my_center|LOCUS_53420 157851 157057 gene locus_tag LOCUS_53430 157851 157057 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977166.1 protein_id gnl|my_center|LOCUS_53430 159464 158700 gene locus_tag LOCUS_53440 159464 158700 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977167.1 protein_id gnl|my_center|LOCUS_53440 159892 159587 gene locus_tag LOCUS_53450 159892 159587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53450 160024 160046 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence017 985 335 gene locus_tag LOCUS_53460 985 335 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977030.1 protein_id gnl|my_center|LOCUS_53460 1124 1906 gene locus_tag LOCUS_53470 1124 1906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53470 1974 2513 gene locus_tag LOCUS_53480 1974 2513 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977028.1 protein_id gnl|my_center|LOCUS_53480 2690 3196 gene locus_tag LOCUS_53490 2690 3196 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977027.1 protein_id gnl|my_center|LOCUS_53490 4302 3343 gene locus_tag LOCUS_53500 4302 3343 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027982.1 protein_id gnl|my_center|LOCUS_53500 4895 4464 gene locus_tag LOCUS_53510 4895 4464 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977025.1 protein_id gnl|my_center|LOCUS_53510 5746 4949 gene locus_tag LOCUS_53520 5746 4949 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977024.1 protein_id gnl|my_center|LOCUS_53520 5899 6693 gene locus_tag LOCUS_53530 5899 6693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027983.1 protein_id gnl|my_center|LOCUS_53530 7093 6848 gene locus_tag LOCUS_53540 gene chpE 7093 6848 CDS product chaplin ChpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977022.1 protein_id gnl|my_center|LOCUS_53540 7704 7228 gene locus_tag LOCUS_53550 7704 7228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53550 9007 7862 gene locus_tag LOCUS_53560 9007 7862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53560 9051 9263 gene locus_tag LOCUS_53570 9051 9263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53570 9280 10002 gene locus_tag LOCUS_53580 9280 10002 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027986.1 protein_id gnl|my_center|LOCUS_53580 9484 9510 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9999 11090 gene locus_tag LOCUS_53590 9999 11090 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027987.1 protein_id gnl|my_center|LOCUS_53590 11389 12132 gene locus_tag LOCUS_53600 11389 12132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53600 13951 12233 gene locus_tag LOCUS_53610 13951 12233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_53610 14789 13953 gene locus_tag LOCUS_53620 14789 13953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_53620 14073 14094 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 14989 17418 gene locus_tag LOCUS_53630 14989 17418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_53630 17492 18700 gene locus_tag LOCUS_53640 gene serB 17492 18700 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977014.1 protein_id gnl|my_center|LOCUS_53640 19337 18819 gene locus_tag LOCUS_53650 19337 18819 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977013.1 protein_id gnl|my_center|LOCUS_53650 19603 19397 gene locus_tag LOCUS_53660 19603 19397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53660 19932 19813 gene locus_tag LOCUS_53670 19932 19813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53670 21350 19980 gene locus_tag LOCUS_53680 21350 19980 CDS product CynX/NimT family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486041.1 protein_id gnl|my_center|LOCUS_53680 21433 22170 gene locus_tag LOCUS_53690 21433 22170 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977010.1 protein_id gnl|my_center|LOCUS_53690 22533 22186 gene locus_tag LOCUS_53700 22533 22186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53700 23509 22742 gene locus_tag LOCUS_53710 gene fabI 23509 22742 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977009.1 protein_id gnl|my_center|LOCUS_53710 24219 23515 gene locus_tag LOCUS_53720 gene fabG 24219 23515 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977008.1 protein_id gnl|my_center|LOCUS_53720 24469 25992 gene locus_tag LOCUS_53730 24469 25992 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729853.1 protein_id gnl|my_center|LOCUS_53730 25989 27383 gene locus_tag LOCUS_53740 25989 27383 CDS product metallopeptidase TldD-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027992.1 protein_id gnl|my_center|LOCUS_53740 27440 28708 gene locus_tag LOCUS_53750 gene tyrS 27440 28708 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027993.1 protein_id gnl|my_center|LOCUS_53750 29092 28805 gene locus_tag LOCUS_53760 29092 28805 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977004.1 protein_id gnl|my_center|LOCUS_53760 29374 29793 gene locus_tag LOCUS_53770 29374 29793 CDS product DUF3099 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486044.1 protein_id gnl|my_center|LOCUS_53770 30014 30232 gene locus_tag LOCUS_53780 30014 30232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53780 30774 30271 gene locus_tag LOCUS_53790 30774 30271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_53790 31339 30854 gene locus_tag LOCUS_53800 31339 30854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_53800 31016 31043 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 33109 31490 gene locus_tag LOCUS_53810 33109 31490 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977000.1 protein_id gnl|my_center|LOCUS_53810 33462 33106 gene locus_tag LOCUS_53820 33462 33106 CDS product DUF485 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976999.1 protein_id gnl|my_center|LOCUS_53820 33723 35258 gene locus_tag LOCUS_53830 33723 35258 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027994.1 protein_id gnl|my_center|LOCUS_53830 35309 36853 gene locus_tag LOCUS_53840 35309 36853 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027994.1 protein_id gnl|my_center|LOCUS_53840 36887 38299 gene locus_tag LOCUS_53850 36887 38299 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110423.1 protein_id gnl|my_center|LOCUS_53850 38404 39405 gene locus_tag LOCUS_53860 38404 39405 CDS product CopD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027996.1 protein_id gnl|my_center|LOCUS_53860 40186 39410 gene locus_tag LOCUS_53870 40186 39410 CDS product VIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893323.1 protein_id gnl|my_center|LOCUS_53870 41421 40189 gene locus_tag LOCUS_53880 41421 40189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53880 42701 41418 gene locus_tag LOCUS_53890 42701 41418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53890 43595 42711 gene locus_tag LOCUS_53900 43595 42711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53900 44418 43621 gene locus_tag LOCUS_53910 44418 43621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53910 44635 45630 gene locus_tag LOCUS_53920 44635 45630 CDS product DEDDh family exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027997.1 protein_id gnl|my_center|LOCUS_53920 45650 45678 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 45714 46010 gene locus_tag LOCUS_53930 45714 46010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976994.1 protein_id gnl|my_center|LOCUS_53930 46110 46955 gene locus_tag LOCUS_53940 46110 46955 CDS product SURF1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030872966.1 protein_id gnl|my_center|LOCUS_53940 47106 48893 gene locus_tag LOCUS_53950 47106 48893 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027999.1 protein_id gnl|my_center|LOCUS_53950 48899 49654 gene locus_tag LOCUS_53960 48899 49654 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976991.1 protein_id gnl|my_center|LOCUS_53960 50194 50287 gene locus_tag LOCUS_t00580 50194 50287 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 51215 50388 gene locus_tag LOCUS_53970 51215 50388 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028003.1 protein_id gnl|my_center|LOCUS_53970 51570 51349 gene locus_tag LOCUS_53980 51570 51349 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976983.1 protein_id gnl|my_center|LOCUS_53980 53227 51917 gene locus_tag LOCUS_53990 53227 51917 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976982.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_53990 53273 53304 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 53775 54185 gene locus_tag LOCUS_54000 53775 54185 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030872956.1 protein_id gnl|my_center|LOCUS_54000 55748 54204 gene locus_tag LOCUS_54010 55748 54204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976980.1 protein_id gnl|my_center|LOCUS_54010 57141 55993 gene locus_tag LOCUS_54020 57141 55993 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976978.1 protein_id gnl|my_center|LOCUS_54020 57930 57241 gene locus_tag LOCUS_54030 57930 57241 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028005.1 protein_id gnl|my_center|LOCUS_54030 58131 59489 gene locus_tag LOCUS_54040 gene pitH 58131 59489 CDS product low-affinity phosphate transporter PitH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976976.1 protein_id gnl|my_center|LOCUS_54040 59527 59757 gene locus_tag LOCUS_54050 59527 59757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976975.1 protein_id gnl|my_center|LOCUS_54050 60173 61183 gene locus_tag LOCUS_54060 60173 61183 CDS product cobalamin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028006.1 protein_id gnl|my_center|LOCUS_54060 61180 62688 gene locus_tag LOCUS_54070 61180 62688 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028007.1 protein_id gnl|my_center|LOCUS_54070 62703 66341 gene locus_tag LOCUS_54080 gene cobN 62703 66341 CDS product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028008.1 protein_id gnl|my_center|LOCUS_54080 66338 68344 gene locus_tag LOCUS_54090 66338 68344 CDS product putative cobaltochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976970.1 protein_id gnl|my_center|LOCUS_54090 68344 68943 gene locus_tag LOCUS_54100 gene cobO 68344 68943 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976969.1 protein_id gnl|my_center|LOCUS_54100 68937 70463 gene locus_tag LOCUS_54110 68937 70463 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028009.1 protein_id gnl|my_center|LOCUS_54110 70162 70199 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 70474 71154 gene locus_tag LOCUS_54120 gene cobI 70474 71154 CDS product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028010.1 protein_id gnl|my_center|LOCUS_54120 71807 71187 gene locus_tag LOCUS_54130 71807 71187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54130 71843 71871 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 72043 72870 gene locus_tag LOCUS_54140 gene cobM 72043 72870 CDS product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976965.1 protein_id gnl|my_center|LOCUS_54140 72867 74117 gene locus_tag LOCUS_54150 72867 74117 CDS product bifunctional cobalt-precorrin-7 (C(5))-methyltransferase/cobalt-precorrin-6B (C(15))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868658.1 protein_id gnl|my_center|LOCUS_54150 74114 75838 gene locus_tag LOCUS_54160 gene cobJ 74114 75838 CDS product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162483898.1 protein_id gnl|my_center|LOCUS_54160 75835 76431 gene locus_tag LOCUS_54170 75835 76431 CDS product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028884.1 protein_id gnl|my_center|LOCUS_54170 76620 77378 gene locus_tag LOCUS_54180 76620 77378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54180 77302 78444 gene locus_tag LOCUS_54190 gene cobC 77302 78444 CDS product Rv2231c family pyridoxal phosphate-dependent protein CobC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037897661.1 protein_id gnl|my_center|LOCUS_54190 79399 78485 gene locus_tag LOCUS_54200 79399 78485 CDS product SCO1860 family LAETG-anchored protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486091.1 protein_id gnl|my_center|LOCUS_54200 80683 79520 gene locus_tag LOCUS_54210 80683 79520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54210 79870 79897 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 81523 80729 gene locus_tag LOCUS_54220 81523 80729 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878183.1 protein_id gnl|my_center|LOCUS_54220 82353 81520 gene locus_tag LOCUS_54230 82353 81520 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230771.1 protein_id gnl|my_center|LOCUS_54230 83216 82350 gene locus_tag LOCUS_54240 83216 82350 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533636.1 protein_id gnl|my_center|LOCUS_54240 83430 84521 gene locus_tag LOCUS_54250 83430 84521 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972854.1 protein_id gnl|my_center|LOCUS_54250 84606 85133 gene locus_tag LOCUS_54260 84606 85133 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027877.1 protein_id gnl|my_center|LOCUS_54260 85478 85975 gene locus_tag LOCUS_54270 gene ectA 85478 85975 CDS product diaminobutyrate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976956.1 protein_id gnl|my_center|LOCUS_54270 86101 87321 gene locus_tag LOCUS_54280 gene ectB 86101 87321 CDS product diaminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976955.1 protein_id gnl|my_center|LOCUS_54280 87356 87760 gene locus_tag LOCUS_54290 87356 87760 CDS product ectoine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976954.1 protein_id gnl|my_center|LOCUS_54290 87766 88677 gene locus_tag LOCUS_54300 gene thpD 87766 88677 CDS product ectoine hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976953.1 protein_id gnl|my_center|LOCUS_54300 88061 88081 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 89914 88829 gene locus_tag LOCUS_54310 89914 88829 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107093947.1 protein_id gnl|my_center|LOCUS_54310 88838 88934 gene locus_tag LOCUS_t00590 88838 88934 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 90708 89986 gene locus_tag LOCUS_54320 90708 89986 CDS product DsbA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976951.1 protein_id gnl|my_center|LOCUS_54320 90730 90757 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 91413 90814 gene locus_tag LOCUS_54330 91413 90814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54330 92057 91449 gene locus_tag LOCUS_54340 92057 91449 CDS product DUF1349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028021.1 protein_id gnl|my_center|LOCUS_54340 93570 92104 gene locus_tag LOCUS_54350 93570 92104 CDS product aldehyde dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028022.1 protein_id gnl|my_center|LOCUS_54350 93775 94548 gene locus_tag LOCUS_54360 93775 94548 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976948.1 protein_id gnl|my_center|LOCUS_54360 94552 95022 gene locus_tag LOCUS_54370 94552 95022 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976947.1 protein_id gnl|my_center|LOCUS_54370 95137 96588 gene locus_tag LOCUS_54380 95137 96588 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976945.1 protein_id gnl|my_center|LOCUS_54380 98083 96632 gene locus_tag LOCUS_54390 98083 96632 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029586.1 protein_id gnl|my_center|LOCUS_54390 99079 98285 gene locus_tag LOCUS_54400 99079 98285 CDS product HAD family acid phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028026.1 protein_id gnl|my_center|LOCUS_54400 99608 99198 gene locus_tag LOCUS_54410 99608 99198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54410 101445 99706 gene locus_tag LOCUS_54420 gene araD 101445 99706 CDS product L-arabinonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028032.1 protein_id gnl|my_center|LOCUS_54420 102353 101442 gene locus_tag LOCUS_54430 102353 101442 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976931.1 protein_id gnl|my_center|LOCUS_54430 103015 102350 gene locus_tag LOCUS_54440 103015 102350 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028033.1 protein_id gnl|my_center|LOCUS_54440 103913 103164 gene locus_tag LOCUS_54450 103913 103164 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224130.1 protein_id gnl|my_center|LOCUS_54450 104570 103983 gene locus_tag LOCUS_54460 104570 103983 CDS product TIGR03086 family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028034.1 protein_id gnl|my_center|LOCUS_54460 104805 104563 gene locus_tag LOCUS_54470 104805 104563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54470 105012 106217 gene locus_tag LOCUS_54480 105012 106217 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028035.1 protein_id gnl|my_center|LOCUS_54480 107516 106350 gene locus_tag LOCUS_54490 107516 106350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028037.1 protein_id gnl|my_center|LOCUS_54490 108463 107513 gene locus_tag LOCUS_54500 108463 107513 CDS product 5-dehydro-4-deoxyglucarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976924.1 protein_id gnl|my_center|LOCUS_54500 108746 109555 gene locus_tag LOCUS_54510 108746 109555 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976923.1 protein_id gnl|my_center|LOCUS_54510 109862 110632 gene locus_tag LOCUS_54520 109862 110632 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976922.1 protein_id gnl|my_center|LOCUS_54520 110772 112139 gene locus_tag LOCUS_54530 110772 112139 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976921.1 protein_id gnl|my_center|LOCUS_54530 112139 113083 gene locus_tag LOCUS_54540 112139 113083 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976920.1 protein_id gnl|my_center|LOCUS_54540 113080 113940 gene locus_tag LOCUS_54550 113080 113940 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028038.1 protein_id gnl|my_center|LOCUS_54550 113937 114926 gene locus_tag LOCUS_54560 113937 114926 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976918.1 protein_id gnl|my_center|LOCUS_54560 115022 116260 gene locus_tag LOCUS_54570 115022 116260 CDS product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028040.1 protein_id gnl|my_center|LOCUS_54570 117009 116386 gene locus_tag LOCUS_54580 117009 116386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_54580 117029 117880 gene locus_tag LOCUS_54590 117029 117880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54590 117072 117096 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 118819 118028 gene locus_tag LOCUS_54600 118819 118028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_54600 118821 118852 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 119189 119521 gene locus_tag LOCUS_54610 119189 119521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54610 119727 121640 gene locus_tag LOCUS_54620 119727 121640 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976911.1 protein_id gnl|my_center|LOCUS_54620 122297 121773 gene locus_tag LOCUS_54630 122297 121773 CDS product DUF3618 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028044.1 protein_id gnl|my_center|LOCUS_54630 122761 122294 gene locus_tag LOCUS_54640 122761 122294 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976908.1 protein_id gnl|my_center|LOCUS_54640 123540 122815 gene locus_tag LOCUS_54650 123540 122815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54650 123716 123537 gene locus_tag LOCUS_54660 123716 123537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54660 123870 124841 gene locus_tag LOCUS_54670 gene dapA 123870 124841 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173943917.1 protein_id gnl|my_center|LOCUS_54670 124838 125338 gene locus_tag LOCUS_54680 124838 125338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484326.1 protein_id gnl|my_center|LOCUS_54680 126313 125360 gene locus_tag LOCUS_54690 gene dapD 126313 125360 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976903.1 protein_id gnl|my_center|LOCUS_54690 126339 126363 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 126784 126464 gene locus_tag LOCUS_54700 126784 126464 CDS product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976901.1 protein_id gnl|my_center|LOCUS_54700 127235 126915 gene locus_tag LOCUS_54710 127235 126915 CDS product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894514.1 protein_id gnl|my_center|LOCUS_54710 127711 127244 gene locus_tag LOCUS_54720 127711 127244 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976899.1 protein_id gnl|my_center|LOCUS_54720 128979 127723 gene locus_tag LOCUS_54730 128979 127723 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976898.1 protein_id gnl|my_center|LOCUS_54730 129740 128976 gene locus_tag LOCUS_54740 gene sufC 129740 128976 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976897.1 protein_id gnl|my_center|LOCUS_54740 130008 129748 gene locus_tag LOCUS_54750 130008 129748 CDS product non-heme iron oxygenase ferredoxin subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976896.1 protein_id gnl|my_center|LOCUS_54750 131246 130065 gene locus_tag LOCUS_54760 gene sufD 131246 130065 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976895.1 protein_id gnl|my_center|LOCUS_54760 132758 131337 gene locus_tag LOCUS_54770 gene sufB 132758 131337 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976894.1 protein_id gnl|my_center|LOCUS_54770 133498 132755 gene locus_tag LOCUS_54780 133498 132755 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976893.1 protein_id gnl|my_center|LOCUS_54780 133636 134472 gene locus_tag LOCUS_54790 133636 134472 CDS product AAC(3) family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976892.1 protein_id gnl|my_center|LOCUS_54790 134519 135427 gene locus_tag LOCUS_54800 134519 135427 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976891.1 protein_id gnl|my_center|LOCUS_54800 135424 136209 gene locus_tag LOCUS_54810 135424 136209 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976890.1 protein_id gnl|my_center|LOCUS_54810 136265 137272 gene locus_tag LOCUS_54820 136265 137272 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037897656.1 protein_id gnl|my_center|LOCUS_54820 138416 137310 gene locus_tag LOCUS_54830 138416 137310 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028051.1 protein_id gnl|my_center|LOCUS_54830 138807 138475 gene locus_tag LOCUS_54840 138807 138475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038534985.1 protein_id gnl|my_center|LOCUS_54840 139821 138904 gene locus_tag LOCUS_54850 139821 138904 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976885.1 protein_id gnl|my_center|LOCUS_54850 140235 142361 gene locus_tag LOCUS_54860 gene tkt 140235 142361 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976883.1 protein_id gnl|my_center|LOCUS_54860 141133 141162 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 142396 143514 gene locus_tag LOCUS_54870 gene tal 142396 143514 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976882.1 protein_id gnl|my_center|LOCUS_54870 143519 144463 gene locus_tag LOCUS_54880 143519 144463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_54880 144187 144223 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 144357 145085 gene locus_tag LOCUS_54890 144357 145085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_54890 145082 146143 gene locus_tag LOCUS_54900 gene opcA 145082 146143 CDS product glucose-6-phosphate dehydrogenase assembly protein OpcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976880.1 protein_id gnl|my_center|LOCUS_54900 146140 146922 gene locus_tag LOCUS_54910 gene pgl 146140 146922 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976879.1 protein_id gnl|my_center|LOCUS_54910 147820 146981 gene locus_tag LOCUS_54920 147820 146981 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975831.1 protein_id gnl|my_center|LOCUS_54920 149184 147817 gene locus_tag LOCUS_54930 149184 147817 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030865510.1 protein_id gnl|my_center|LOCUS_54930 150521 149190 gene locus_tag LOCUS_54940 150521 149190 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975833.1 protein_id gnl|my_center|LOCUS_54940 152176 150569 gene locus_tag LOCUS_54950 152176 150569 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225052.1 protein_id gnl|my_center|LOCUS_54950 153711 152416 gene locus_tag LOCUS_54960 153711 152416 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013850.1 protein_id gnl|my_center|LOCUS_54960 152556 152579 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 153868 154383 gene locus_tag LOCUS_54970 153868 154383 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225030.1 protein_id gnl|my_center|LOCUS_54970 154380 155138 gene locus_tag LOCUS_54980 154380 155138 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941338.1 protein_id gnl|my_center|LOCUS_54980 155259 157556 gene locus_tag LOCUS_54990 155259 157556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54990 >Feature sequence018 628 110 gene locus_tag LOCUS_55000 628 110 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230489.1 protein_id gnl|my_center|LOCUS_55000 1841 618 gene locus_tag LOCUS_55010 1841 618 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227700.1 protein_id gnl|my_center|LOCUS_55010 2438 2067 gene locus_tag LOCUS_55020 2438 2067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55020 2590 2946 gene locus_tag LOCUS_55030 2590 2946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028865.1 protein_id gnl|my_center|LOCUS_55030 2949 4304 gene locus_tag LOCUS_55040 2949 4304 CDS product FtsK/SpoIIIE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030188.1 protein_id gnl|my_center|LOCUS_55040 4387 4593 gene locus_tag LOCUS_55050 4387 4593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55050 4596 4781 gene locus_tag LOCUS_55060 4596 4781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55060 4858 5520 gene locus_tag LOCUS_55070 4858 5520 CDS product DUF2637 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030190.1 protein_id gnl|my_center|LOCUS_55070 5539 5730 gene locus_tag LOCUS_55080 5539 5730 CDS product mobile element transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030191.1 protein_id gnl|my_center|LOCUS_55080 5741 5896 gene locus_tag LOCUS_55090 5741 5896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003950175.1 protein_id gnl|my_center|LOCUS_55090 5920 6237 gene locus_tag LOCUS_55100 5920 6237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028861.1 protein_id gnl|my_center|LOCUS_55100 6328 6510 gene locus_tag LOCUS_55110 6328 6510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030195.1 protein_id gnl|my_center|LOCUS_55110 6515 6685 gene locus_tag LOCUS_55120 6515 6685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55120 6682 8163 gene locus_tag LOCUS_55130 gene repSA 6682 8163 CDS product replication initiator protein RepSA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030196.1 protein_id gnl|my_center|LOCUS_55130 8160 8348 gene locus_tag LOCUS_55140 8160 8348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55140 8348 9505 gene locus_tag LOCUS_55150 8348 9505 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028858.1 protein_id gnl|my_center|LOCUS_55150 9637 9561 gene locus_tag LOCUS_t00600 9637 9561 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 10555 9773 gene locus_tag LOCUS_55160 10555 9773 CDS product DUF3566 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326689.1 protein_id gnl|my_center|LOCUS_55160 13168 10574 gene locus_tag LOCUS_55170 gene gyrA 13168 10574 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326690.1 protein_id gnl|my_center|LOCUS_55170 15292 13211 gene locus_tag LOCUS_55180 gene gyrB 15292 13211 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029285.1 protein_id gnl|my_center|LOCUS_55180 16319 15738 gene locus_tag LOCUS_55190 16319 15738 CDS product DUF721 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975057.1 protein_id gnl|my_center|LOCUS_55190 16492 16316 gene locus_tag LOCUS_55200 16492 16316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_55200 17469 16486 gene locus_tag LOCUS_55210 gene recF 17469 16486 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975056.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_55210 16590 16621 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 18438 17536 gene locus_tag LOCUS_55220 gene gnd 18438 17536 CDS product decarboxylating 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029286.1 protein_id gnl|my_center|LOCUS_55220 17930 17961 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 19744 18614 gene locus_tag LOCUS_55230 gene dnaN 19744 18614 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975054.1 protein_id gnl|my_center|LOCUS_55230 22883 20259 gene locus_tag LOCUS_55240 gene dnaA 22883 20259 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029287.1 protein_id gnl|my_center|LOCUS_55240 20693 20718 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 23282 23419 gene locus_tag LOCUS_55250 gene rpmH 23282 23419 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975051.1 protein_id gnl|my_center|LOCUS_55250 23749 23426 gene locus_tag LOCUS_55260 23749 23426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55260 23809 24162 gene locus_tag LOCUS_55270 gene yidD 23809 24162 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975049.1 protein_id gnl|my_center|LOCUS_55270 24166 25467 gene locus_tag LOCUS_55280 gene yidC 24166 25467 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029289.1 protein_id gnl|my_center|LOCUS_55280 25483 25896 gene locus_tag LOCUS_55290 25483 25896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_55290 25751 25773 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 25797 26018 gene locus_tag LOCUS_55300 25797 26018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_55300 26134 26850 gene locus_tag LOCUS_55310 gene rsmG 26134 26850 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029291.1 protein_id gnl|my_center|LOCUS_55310 27163 28188 gene locus_tag LOCUS_55320 27163 28188 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029292.1 protein_id gnl|my_center|LOCUS_55320 28401 29297 gene locus_tag LOCUS_55330 28401 29297 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030863476.1 protein_id gnl|my_center|LOCUS_55330 29630 30247 gene locus_tag LOCUS_55340 29630 30247 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975043.1 protein_id gnl|my_center|LOCUS_55340 30668 30336 gene locus_tag LOCUS_55350 gene trxA 30668 30336 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975042.1 protein_id gnl|my_center|LOCUS_55350 31683 30712 gene locus_tag LOCUS_55360 gene trxB 31683 30712 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975041.1 protein_id gnl|my_center|LOCUS_55360 32765 31854 gene locus_tag LOCUS_55370 32765 31854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029294.1 protein_id gnl|my_center|LOCUS_55370 33493 32762 gene locus_tag LOCUS_55380 gene sigM 33493 32762 CDS product RNA polymerase sigma factor SigM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029295.1 protein_id gnl|my_center|LOCUS_55380 35241 33520 gene locus_tag LOCUS_55390 35241 33520 CDS product protein kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029296.1 protein_id gnl|my_center|LOCUS_55390 37714 35360 gene locus_tag LOCUS_55400 gene murJ 37714 35360 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029297.1 protein_id gnl|my_center|LOCUS_55400 38069 37758 gene locus_tag LOCUS_55410 38069 37758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_55410 40263 37954 gene locus_tag LOCUS_55420 40263 37954 CDS product DUF6049 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029298.1 protein_id gnl|my_center|LOCUS_55420 38156 38189 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 40435 42132 gene locus_tag LOCUS_55430 40435 42132 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975035.1 protein_id gnl|my_center|LOCUS_55430 42000 42023 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 42607 42116 gene locus_tag LOCUS_55440 42607 42116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029299.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_55440 43995 42733 gene locus_tag LOCUS_55450 43995 42733 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029300.1 protein_id gnl|my_center|LOCUS_55450 45189 44077 gene locus_tag LOCUS_55460 45189 44077 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975032.1 protein_id gnl|my_center|LOCUS_55460 44125 44154 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 45918 45235 gene locus_tag LOCUS_55470 45918 45235 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975031.1 protein_id gnl|my_center|LOCUS_55470 46315 49020 gene locus_tag LOCUS_55480 46315 49020 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975030.1 protein_id gnl|my_center|LOCUS_55480 49158 50636 gene locus_tag LOCUS_55490 49158 50636 CDS product glycosyltransferase 87 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029301.1 protein_id gnl|my_center|LOCUS_55490 51297 50758 gene locus_tag LOCUS_55500 51297 50758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_55500 51390 51415 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 53034 51913 gene locus_tag LOCUS_55510 gene femX 53034 51913 CDS product peptidoglycan bridge formation glycyltransferase FemX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029302.1 protein_id gnl|my_center|LOCUS_55510 53537 53208 gene locus_tag LOCUS_55520 53537 53208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975026.1 protein_id gnl|my_center|LOCUS_55520 53816 54106 gene locus_tag LOCUS_55530 gene rpsF 53816 54106 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975025.1 protein_id gnl|my_center|LOCUS_55530 54181 54759 gene locus_tag LOCUS_55540 54181 54759 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029303.1 protein_id gnl|my_center|LOCUS_55540 54800 55036 gene locus_tag LOCUS_55550 gene rpsR 54800 55036 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003949403.1 protein_id gnl|my_center|LOCUS_55550 55055 55501 gene locus_tag LOCUS_55560 gene rplI 55055 55501 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975023.1 protein_id gnl|my_center|LOCUS_55560 56955 55576 gene locus_tag LOCUS_55570 56955 55576 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485269.1 protein_id gnl|my_center|LOCUS_55570 57374 58090 gene locus_tag LOCUS_55580 57374 58090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_55580 58022 58047 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 58096 58878 gene locus_tag LOCUS_55590 58096 58878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_55590 58937 60325 gene locus_tag LOCUS_55600 58937 60325 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975020.1 protein_id gnl|my_center|LOCUS_55600 60844 60383 gene locus_tag LOCUS_55610 60844 60383 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029305.1 protein_id gnl|my_center|LOCUS_55610 61357 60893 gene locus_tag LOCUS_55620 61357 60893 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975018.1 protein_id gnl|my_center|LOCUS_55620 61500 62708 gene locus_tag LOCUS_55630 61500 62708 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029306.1 protein_id gnl|my_center|LOCUS_55630 63609 62743 gene locus_tag LOCUS_55640 63609 62743 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029307.1 protein_id gnl|my_center|LOCUS_55640 64266 63784 gene locus_tag LOCUS_55650 64266 63784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55650 65287 64355 gene locus_tag LOCUS_55660 65287 64355 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029308.1 protein_id gnl|my_center|LOCUS_55660 65239 65265 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 66657 65518 gene locus_tag LOCUS_55670 66657 65518 CDS product cystathionine gamma-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029309.1 protein_id gnl|my_center|LOCUS_55670 67120 66743 gene locus_tag LOCUS_55680 67120 66743 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975010.1 protein_id gnl|my_center|LOCUS_55680 67169 67486 gene locus_tag LOCUS_55690 67169 67486 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029310.1 protein_id gnl|my_center|LOCUS_55690 67663 67875 gene locus_tag LOCUS_55700 67663 67875 CDS product DUF5326 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029311.1 protein_id gnl|my_center|LOCUS_55700 68225 67824 gene locus_tag LOCUS_55710 68225 67824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55710 68200 68964 gene locus_tag LOCUS_55720 68200 68964 CDS product IclR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029312.1 protein_id gnl|my_center|LOCUS_55720 69062 69499 gene locus_tag LOCUS_55730 69062 69499 CDS product SsgA family sporulation/cell division regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975006.1 protein_id gnl|my_center|LOCUS_55730 71034 69631 gene locus_tag LOCUS_55740 71034 69631 CDS product YibE/F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029314.1 protein_id gnl|my_center|LOCUS_55740 71276 73078 gene locus_tag LOCUS_55750 gene thiC 71276 73078 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029315.1 protein_id gnl|my_center|LOCUS_55750 73959 73735 gene locus_tag LOCUS_55760 73959 73735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55760 74606 75520 gene locus_tag LOCUS_55770 74606 75520 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230494.1 protein_id gnl|my_center|LOCUS_55770 76897 75524 gene locus_tag LOCUS_55780 76897 75524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026468787.1 protein_id gnl|my_center|LOCUS_55780 77107 77664 gene locus_tag LOCUS_55790 77107 77664 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029317.1 protein_id gnl|my_center|LOCUS_55790 77979 78287 gene locus_tag LOCUS_55800 77979 78287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108990666.1 protein_id gnl|my_center|LOCUS_55800 79476 78697 gene locus_tag LOCUS_55810 79476 78697 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029319.1 protein_id gnl|my_center|LOCUS_55810 79643 79993 gene locus_tag LOCUS_55820 79643 79993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029320.1 protein_id gnl|my_center|LOCUS_55820 79993 81294 gene locus_tag LOCUS_55830 79993 81294 CDS product FtsK/SpoIIIE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030188.1 protein_id gnl|my_center|LOCUS_55830 81291 81488 gene locus_tag LOCUS_55840 81291 81488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029322.1 protein_id gnl|my_center|LOCUS_55840 82044 81796 gene locus_tag LOCUS_55850 82044 81796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55850 82081 83145 gene locus_tag LOCUS_55860 82081 83145 CDS product plasmid replication initiator protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108990145.1 protein_id gnl|my_center|LOCUS_55860 84849 83284 gene locus_tag LOCUS_55870 84849 83284 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029324.1 protein_id gnl|my_center|LOCUS_55870 84915 85055 gene locus_tag LOCUS_55880 84915 85055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55880 85970 85107 gene locus_tag LOCUS_55890 85970 85107 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029327.1 protein_id gnl|my_center|LOCUS_55890 87329 86163 gene locus_tag LOCUS_55900 gene sppA 87329 86163 CDS product Ser/Thr/Tyr protein phosphatase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029328.1 protein_id gnl|my_center|LOCUS_55900 88576 87548 gene locus_tag LOCUS_55910 88576 87548 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975000.1 protein_id gnl|my_center|LOCUS_55910 89081 90160 gene locus_tag LOCUS_55920 gene hisC 89081 90160 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029330.1 protein_id gnl|my_center|LOCUS_55920 90413 91921 gene locus_tag LOCUS_55930 90413 91921 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974998.1 protein_id gnl|my_center|LOCUS_55930 91942 92946 gene locus_tag LOCUS_55940 gene cydB 91942 92946 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029331.1 protein_id gnl|my_center|LOCUS_55940 92999 96532 gene locus_tag LOCUS_55950 gene cydD 92999 96532 CDS product thiol reductant ABC exporter subunit CydD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029332.1 protein_id gnl|my_center|LOCUS_55950 97462 96536 gene locus_tag LOCUS_55960 97462 96536 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974993.1 protein_id gnl|my_center|LOCUS_55960 98435 97533 gene locus_tag LOCUS_55970 98435 97533 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326709.1 protein_id gnl|my_center|LOCUS_55970 98937 98476 gene locus_tag LOCUS_55980 98937 98476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029337.1 protein_id gnl|my_center|LOCUS_55980 99497 98949 gene locus_tag LOCUS_55990 99497 98949 CDS product RNA 2'-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029338.1 protein_id gnl|my_center|LOCUS_55990 101429 99672 gene locus_tag LOCUS_56000 101429 99672 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029339.1 protein_id gnl|my_center|LOCUS_56000 101656 102630 gene locus_tag LOCUS_56010 101656 102630 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974987.1 protein_id gnl|my_center|LOCUS_56010 102620 103537 gene locus_tag LOCUS_56020 102620 103537 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974986.1 protein_id gnl|my_center|LOCUS_56020 103534 104466 gene locus_tag LOCUS_56030 103534 104466 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974985.1 protein_id gnl|my_center|LOCUS_56030 103726 103746 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 104477 105232 gene locus_tag LOCUS_56040 104477 105232 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974984.1 protein_id gnl|my_center|LOCUS_56040 104976 105011 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 105352 105594 gene locus_tag LOCUS_56050 105352 105594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56050 105887 105974 gene locus_tag LOCUS_t00610 105887 105974 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 106844 106008 gene locus_tag LOCUS_56060 106844 106008 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029342.1 protein_id gnl|my_center|LOCUS_56060 108118 106841 gene locus_tag LOCUS_56070 gene serS 108118 106841 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974982.1 protein_id gnl|my_center|LOCUS_56070 109642 108710 gene locus_tag LOCUS_56080 gene pheA 109642 108710 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974981.1 protein_id gnl|my_center|LOCUS_56080 111033 109744 gene locus_tag LOCUS_56090 gene efeB 111033 109744 CDS product iron uptake transporter deferrochelatase/peroxidase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029343.1 protein_id gnl|my_center|LOCUS_56090 113060 111042 gene locus_tag LOCUS_56100 113060 111042 CDS product copper resistance protein CopC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029406.1 protein_id gnl|my_center|LOCUS_56100 113596 113075 gene locus_tag LOCUS_56110 113596 113075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56110 114267 113593 gene locus_tag LOCUS_56120 114267 113593 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974978.1 protein_id gnl|my_center|LOCUS_56120 113780 113800 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 115120 114374 gene locus_tag LOCUS_56130 115120 114374 CDS product YcnI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974977.1 protein_id gnl|my_center|LOCUS_56130 116192 115296 gene locus_tag LOCUS_56140 116192 115296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029346.1 protein_id gnl|my_center|LOCUS_56140 116493 116861 gene locus_tag LOCUS_56150 116493 116861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56150 118098 116824 gene locus_tag LOCUS_56160 118098 116824 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226021.1 protein_id gnl|my_center|LOCUS_56160 119681 118314 gene locus_tag LOCUS_56170 119681 118314 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029898.1 protein_id gnl|my_center|LOCUS_56170 121276 119792 gene locus_tag LOCUS_56180 121276 119792 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974973.1 protein_id gnl|my_center|LOCUS_56180 120040 120060 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 122959 121412 gene locus_tag LOCUS_56190 122959 121412 CDS product PP2C family protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029348.1 protein_id gnl|my_center|LOCUS_56190 123464 124129 gene locus_tag LOCUS_56200 123464 124129 CDS product bifunctional DNA primase/polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974971.1 protein_id gnl|my_center|LOCUS_56200 124184 124906 gene locus_tag LOCUS_56210 124184 124906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029349.1 protein_id gnl|my_center|LOCUS_56210 124969 125184 gene locus_tag LOCUS_56220 124969 125184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56220 126142 125177 gene locus_tag LOCUS_56230 126142 125177 CDS product DUF5926 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974969.1 protein_id gnl|my_center|LOCUS_56230 126793 126242 gene locus_tag LOCUS_56240 126793 126242 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974968.1 protein_id gnl|my_center|LOCUS_56240 127987 127157 gene locus_tag LOCUS_56250 127987 127157 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974967.1 protein_id gnl|my_center|LOCUS_56250 128262 129815 gene locus_tag LOCUS_56260 128262 129815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56260 129857 129944 gene locus_tag LOCUS_t00620 129857 129944 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 130176 130592 gene locus_tag LOCUS_56270 130176 130592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56270 130786 130610 gene locus_tag LOCUS_56280 130786 130610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56280 131112 131948 gene locus_tag LOCUS_56290 131112 131948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56290 131769 131791 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 131909 132373 gene locus_tag LOCUS_56300 131909 132373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_56300 132987 132586 gene locus_tag LOCUS_56310 132987 132586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56310 133829 133371 gene locus_tag LOCUS_56320 133829 133371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029371.1 protein_id gnl|my_center|LOCUS_56320 134728 133847 gene locus_tag LOCUS_56330 134728 133847 CDS product bifunctional DNA primase/polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029372.1 protein_id gnl|my_center|LOCUS_56330 134860 135831 gene locus_tag LOCUS_56340 134860 135831 CDS product bifunctional MaoC family dehydratase N-terminal/OB-fold nucleic acid binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730957.1 protein_id gnl|my_center|LOCUS_56340 135828 136259 gene locus_tag LOCUS_56350 135828 136259 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730956.1 protein_id gnl|my_center|LOCUS_56350 136256 137419 gene locus_tag LOCUS_56360 136256 137419 CDS product lipid-transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224384.1 protein_id gnl|my_center|LOCUS_56360 137568 138137 gene locus_tag LOCUS_56370 137568 138137 CDS product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162495205.1 protein_id gnl|my_center|LOCUS_56370 138341 139999 gene locus_tag LOCUS_56380 138341 139999 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029376.1 protein_id gnl|my_center|LOCUS_56380 141200 140013 gene locus_tag LOCUS_56390 141200 140013 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029377.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_56390 141373 141951 gene locus_tag LOCUS_56400 141373 141951 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029378.1 protein_id gnl|my_center|LOCUS_56400 146214 141991 gene locus_tag LOCUS_56410 146214 141991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_56410 146915 146409 gene locus_tag LOCUS_56420 146915 146409 CDS product SSI family serine proteinase inhibitor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029380.1 protein_id gnl|my_center|LOCUS_56420 147087 147178 gene locus_tag LOCUS_t00630 147087 147178 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 147376 147449 gene locus_tag LOCUS_t00640 147376 147449 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 147647 148108 gene locus_tag LOCUS_56430 147647 148108 CDS product DUF6234 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173668745.1 protein_id gnl|my_center|LOCUS_56430 149026 148190 gene locus_tag LOCUS_56440 149026 148190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56440 149539 149096 gene locus_tag LOCUS_56450 149539 149096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229068.1 protein_id gnl|my_center|LOCUS_56450 150040 149786 gene locus_tag LOCUS_56460 150040 149786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028395.1 protein_id gnl|my_center|LOCUS_56460 150163 150879 gene locus_tag LOCUS_56470 150163 150879 CDS product DUF5919 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229650.1 protein_id gnl|my_center|LOCUS_56470 150882 151352 gene locus_tag LOCUS_56480 150882 151352 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110618.1 protein_id gnl|my_center|LOCUS_56480 151899 151477 gene locus_tag LOCUS_56490 151899 151477 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031220.1 protein_id gnl|my_center|LOCUS_56490 152665 151931 gene locus_tag LOCUS_56500 gene aqpS 152665 151931 CDS product aquaglyceroporin AqpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969025.1 protein_id gnl|my_center|LOCUS_56500 >Feature sequence019 <1 744 gene locus_tag LOCUS_56510 <1 744 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003973461.1:acyl-CoA carboxylase subunit beta note possible pseudo, frameshifted 618 658 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 705 893 gene locus_tag LOCUS_56520 705 893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_56520 970 1164 gene locus_tag LOCUS_56530 970 1164 CDS product acyl-CoA carboxylase epsilon subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030299.1 protein_id gnl|my_center|LOCUS_56530 1900 1319 gene locus_tag LOCUS_56540 1900 1319 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009314218.1 protein_id gnl|my_center|LOCUS_56540 2459 1881 gene locus_tag LOCUS_56550 2459 1881 CDS product DUF742 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973458.1 protein_id gnl|my_center|LOCUS_56550 2863 2558 gene locus_tag LOCUS_56560 2863 2558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_56560 2885 2909 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6180 3004 gene locus_tag LOCUS_56570 6180 3004 CDS product nitrate- and nitrite sensing domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030300.1 protein_id gnl|my_center|LOCUS_56570 7181 6660 gene locus_tag LOCUS_56580 7181 6660 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009314218.1 protein_id gnl|my_center|LOCUS_56580 7614 7216 gene locus_tag LOCUS_56590 7614 7216 CDS product DUF742 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973454.1 protein_id gnl|my_center|LOCUS_56590 8148 7726 gene locus_tag LOCUS_56600 8148 7726 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973453.1 protein_id gnl|my_center|LOCUS_56600 11886 8149 gene locus_tag LOCUS_56610 11886 8149 CDS product nitrate- and nitrite sensing domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030302.1 protein_id gnl|my_center|LOCUS_56610 9636 9563 gene locus_tag LOCUS_t00650 9636 9563 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 12513 12689 gene locus_tag LOCUS_56620 12513 12689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327338.1 protein_id gnl|my_center|LOCUS_56620 12882 13667 gene locus_tag LOCUS_56630 12882 13667 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973449.1 protein_id gnl|my_center|LOCUS_56630 13660 15144 gene locus_tag LOCUS_56640 gene gltX 13660 15144 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973448.1 protein_id gnl|my_center|LOCUS_56640 15489 15205 gene locus_tag LOCUS_56650 15489 15205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56650 15531 16265 gene locus_tag LOCUS_56660 15531 16265 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030303.1 protein_id gnl|my_center|LOCUS_56660 16360 16432 gene locus_tag LOCUS_t00660 16360 16432 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 16470 16543 gene locus_tag LOCUS_t00670 16470 16543 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 16572 16645 gene locus_tag LOCUS_t00680 16572 16645 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 16666 16738 gene locus_tag LOCUS_t00690 16666 16738 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 16766 16839 gene locus_tag LOCUS_t00700 16766 16839 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 17527 16883 gene locus_tag LOCUS_56670 17527 16883 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973445.1 protein_id gnl|my_center|LOCUS_56670 17616 18134 gene locus_tag LOCUS_56680 17616 18134 CDS product DUF4188 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030304.1 protein_id gnl|my_center|LOCUS_56680 18931 18215 gene locus_tag LOCUS_56690 gene ndgR 18931 18215 CDS product IclR family transcriptional regulator NdgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030305.1 protein_id gnl|my_center|LOCUS_56690 19120 20547 gene locus_tag LOCUS_56700 gene leuC 19120 20547 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973442.1 protein_id gnl|my_center|LOCUS_56700 20554 21147 gene locus_tag LOCUS_56710 gene leuD 20554 21147 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030306.1 protein_id gnl|my_center|LOCUS_56710 21412 21642 gene locus_tag LOCUS_56720 21412 21642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973440.1 protein_id gnl|my_center|LOCUS_56720 21779 22414 gene locus_tag LOCUS_56730 21779 22414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56730 22778 22575 gene locus_tag LOCUS_56740 22778 22575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030307.1 protein_id gnl|my_center|LOCUS_56740 23426 22788 gene locus_tag LOCUS_56750 gene cofC 23426 22788 CDS product 2-phospho-L-lactate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973437.1 protein_id gnl|my_center|LOCUS_56750 23581 24435 gene locus_tag LOCUS_56760 23581 24435 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973436.1 protein_id gnl|my_center|LOCUS_56760 24432 25442 gene locus_tag LOCUS_56770 24432 25442 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030308.1 protein_id gnl|my_center|LOCUS_56770 25502 26659 gene locus_tag LOCUS_56780 25502 26659 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973434.1 protein_id gnl|my_center|LOCUS_56780 27179 26697 gene locus_tag LOCUS_56790 27179 26697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56790 27433 27200 gene locus_tag LOCUS_56800 27433 27200 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973433.1 protein_id gnl|my_center|LOCUS_56800 27652 28617 gene locus_tag LOCUS_56810 27652 28617 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973432.1 protein_id gnl|my_center|LOCUS_56810 28614 29471 gene locus_tag LOCUS_56820 gene thiD 28614 29471 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973431.1 protein_id gnl|my_center|LOCUS_56820 29779 29594 gene locus_tag LOCUS_56830 gene rpmB 29779 29594 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973430.1 protein_id gnl|my_center|LOCUS_56830 30049 31746 gene locus_tag LOCUS_56840 30049 31746 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030309.1 protein_id gnl|my_center|LOCUS_56840 34956 32008 gene locus_tag LOCUS_56850 34956 32008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56850 36755 34923 gene locus_tag LOCUS_56860 36755 34923 CDS product HSP90 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027769.1 protein_id gnl|my_center|LOCUS_56860 36991 39174 gene locus_tag LOCUS_56870 gene recG 36991 39174 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973428.1 protein_id gnl|my_center|LOCUS_56870 39215 39802 gene locus_tag LOCUS_56880 gene rsmD 39215 39802 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030310.1 protein_id gnl|my_center|LOCUS_56880 39799 40308 gene locus_tag LOCUS_56890 gene coaD 39799 40308 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973426.1 protein_id gnl|my_center|LOCUS_56890 40481 40511 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 40517 41515 gene locus_tag LOCUS_56900 40517 41515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030311.1 protein_id gnl|my_center|LOCUS_56900 41683 42333 gene locus_tag LOCUS_56910 41683 42333 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973424.1 protein_id gnl|my_center|LOCUS_56910 42336 42509 gene locus_tag LOCUS_56920 gene rpmF 42336 42509 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006139588.1 protein_id gnl|my_center|LOCUS_56920 42529 44433 gene locus_tag LOCUS_56930 42529 44433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56930 43244 43272 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 44860 44465 gene locus_tag LOCUS_56940 44860 44465 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973421.1 protein_id gnl|my_center|LOCUS_56940 45008 45592 gene locus_tag LOCUS_56950 45008 45592 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895563.1 protein_id gnl|my_center|LOCUS_56950 46807 45638 gene locus_tag LOCUS_56960 46807 45638 CDS product CAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030314.1 protein_id gnl|my_center|LOCUS_56960 46976 47257 gene locus_tag LOCUS_56970 46976 47257 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973419.1 protein_id gnl|my_center|LOCUS_56970 47638 47841 gene locus_tag LOCUS_56980 47638 47841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56980 48089 51664 gene locus_tag LOCUS_56990 gene smc 48089 51664 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030315.1 protein_id gnl|my_center|LOCUS_56990 50705 50725 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 51922 53337 gene locus_tag LOCUS_57000 51922 53337 CDS product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971990.1 protein_id gnl|my_center|LOCUS_57000 54397 53426 gene locus_tag LOCUS_57010 54397 53426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57010 55928 54453 gene locus_tag LOCUS_57020 55928 54453 CDS product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973415.1 protein_id gnl|my_center|LOCUS_57020 56079 57290 gene locus_tag LOCUS_57030 gene ftsY 56079 57290 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164278219.1 protein_id gnl|my_center|LOCUS_57030 58075 57413 gene locus_tag LOCUS_57040 58075 57413 CDS product bifunctional DNA primase/polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030317.1 protein_id gnl|my_center|LOCUS_57040 58524 60038 gene locus_tag LOCUS_57050 58524 60038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030318.1 protein_id gnl|my_center|LOCUS_57050 58671 58691 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 60372 61712 gene locus_tag LOCUS_57060 60372 61712 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030319.1 protein_id gnl|my_center|LOCUS_57060 61709 62047 gene locus_tag LOCUS_57070 61709 62047 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051565.1 protein_id gnl|my_center|LOCUS_57070 62073 64565 gene locus_tag LOCUS_57080 62073 64565 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487177.1 protein_id gnl|my_center|LOCUS_57080 64654 66315 gene locus_tag LOCUS_57090 gene ffh 64654 66315 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327355.1 protein_id gnl|my_center|LOCUS_57090 64712 64743 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 66425 68404 gene locus_tag LOCUS_57100 gene ftsH 66425 68404 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030322.1 protein_id gnl|my_center|LOCUS_57100 69274 68420 gene locus_tag LOCUS_57110 69274 68420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030324.1 protein_id gnl|my_center|LOCUS_57110 69375 69842 gene locus_tag LOCUS_57120 69375 69842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57120 69976 70572 gene locus_tag LOCUS_57130 69976 70572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973403.1 protein_id gnl|my_center|LOCUS_57130 70883 71302 gene locus_tag LOCUS_57140 gene rpsP 70883 71302 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007444852.1 protein_id gnl|my_center|LOCUS_57140 71308 71547 gene locus_tag LOCUS_57150 71308 71547 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973401.1 protein_id gnl|my_center|LOCUS_57150 71716 72261 gene locus_tag LOCUS_57160 gene rimM 71716 72261 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973400.1 protein_id gnl|my_center|LOCUS_57160 72258 73091 gene locus_tag LOCUS_57170 gene trmD 72258 73091 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973399.1 protein_id gnl|my_center|LOCUS_57170 73226 73576 gene locus_tag LOCUS_57180 gene rplS 73226 73576 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973398.1 protein_id gnl|my_center|LOCUS_57180 73622 74383 gene locus_tag LOCUS_57190 gene lepB 73622 74383 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030325.1 protein_id gnl|my_center|LOCUS_57190 74376 75467 gene locus_tag LOCUS_57200 74376 75467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_57200 75355 76365 gene locus_tag LOCUS_57210 gene lepB 75355 76365 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973395.1 protein_id gnl|my_center|LOCUS_57210 76473 77249 gene locus_tag LOCUS_57220 gene lepB 76473 77249 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030327.1 protein_id gnl|my_center|LOCUS_57220 77239 77772 gene locus_tag LOCUS_57230 77239 77772 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327363.1 protein_id gnl|my_center|LOCUS_57230 77829 78137 gene locus_tag LOCUS_57240 77829 78137 CDS product DUF2469 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003965949.1 protein_id gnl|my_center|LOCUS_57240 78324 78695 gene locus_tag LOCUS_57250 78324 78695 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030872622.1 protein_id gnl|my_center|LOCUS_57250 78695 80320 gene locus_tag LOCUS_57260 78695 80320 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030329.1 protein_id gnl|my_center|LOCUS_57260 80317 81687 gene locus_tag LOCUS_57270 gene dprA 80317 81687 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487183.1 protein_id gnl|my_center|LOCUS_57270 81969 82811 gene locus_tag LOCUS_57280 gene whiG 81969 82811 CDS product RNA polymerase sigma factor WhiG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973389.1 protein_id gnl|my_center|LOCUS_57280 82882 83439 gene locus_tag LOCUS_57290 82882 83439 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973388.1 protein_id gnl|my_center|LOCUS_57290 83448 83472 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 84179 83532 gene locus_tag LOCUS_57300 84179 83532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57300 84522 85409 gene locus_tag LOCUS_57310 gene rpsB 84522 85409 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106517497.1 protein_id gnl|my_center|LOCUS_57310 85573 86409 gene locus_tag LOCUS_57320 gene tsf 85573 86409 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973385.1 protein_id gnl|my_center|LOCUS_57320 86611 87369 gene locus_tag LOCUS_57330 gene pyrH 86611 87369 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973384.1 protein_id gnl|my_center|LOCUS_57330 87565 88122 gene locus_tag LOCUS_57340 gene frr 87565 88122 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973383.1 protein_id gnl|my_center|LOCUS_57340 88122 89294 gene locus_tag LOCUS_57350 88122 89294 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973382.1 protein_id gnl|my_center|LOCUS_57350 89427 90530 gene locus_tag LOCUS_57360 gene rlmN 89427 90530 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973380.1 protein_id gnl|my_center|LOCUS_57360 89536 89557 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 90861 91943 gene locus_tag LOCUS_57370 90861 91943 CDS product thiamine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487181.1 protein_id gnl|my_center|LOCUS_57370 91919 94705 gene locus_tag LOCUS_57380 91919 94705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57380 93010 93030 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 93472 93499 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 94618 94652 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 95471 94809 gene locus_tag LOCUS_57390 95471 94809 CDS product LAETG motif-containing sortase-dependent surface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030364.1 protein_id gnl|my_center|LOCUS_57390 96119 95712 gene locus_tag LOCUS_57400 96119 95712 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973373.1 protein_id gnl|my_center|LOCUS_57400 98275 96230 gene locus_tag LOCUS_57410 98275 96230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57410 99000 98257 gene locus_tag LOCUS_57420 99000 98257 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973371.1 protein_id gnl|my_center|LOCUS_57420 100647 99268 gene locus_tag LOCUS_57430 100647 99268 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973370.1 protein_id gnl|my_center|LOCUS_57430 101147 100632 gene locus_tag LOCUS_57440 101147 100632 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973369.1 protein_id gnl|my_center|LOCUS_57440 101339 102778 gene locus_tag LOCUS_57450 101339 102778 CDS product gamma-aminobutyraldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030368.1 protein_id gnl|my_center|LOCUS_57450 102976 104202 gene locus_tag LOCUS_57460 102976 104202 CDS product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030369.1 protein_id gnl|my_center|LOCUS_57460 103059 103083 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 104216 104818 gene locus_tag LOCUS_57470 104216 104818 CDS product HXXEE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030370.1 protein_id gnl|my_center|LOCUS_57470 105455 104772 gene locus_tag LOCUS_57480 105455 104772 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973364.1 protein_id gnl|my_center|LOCUS_57480 106580 105531 gene locus_tag LOCUS_57490 106580 105531 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030372.1 protein_id gnl|my_center|LOCUS_57490 106848 107567 gene locus_tag LOCUS_57500 106848 107567 CDS product DUF4190 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973362.1 protein_id gnl|my_center|LOCUS_57500 107672 108133 gene locus_tag LOCUS_57510 107672 108133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57510 108972 108370 gene locus_tag LOCUS_57520 108972 108370 CDS product NADAR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166680960.1 protein_id gnl|my_center|LOCUS_57520 109144 110694 gene locus_tag LOCUS_57530 109144 110694 CDS product gamma-aminobutyraldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030374.1 protein_id gnl|my_center|LOCUS_57530 110745 111992 gene locus_tag LOCUS_57540 110745 111992 CDS product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973358.1 protein_id gnl|my_center|LOCUS_57540 111998 113152 gene locus_tag LOCUS_57550 111998 113152 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973357.1 protein_id gnl|my_center|LOCUS_57550 113152 114081 gene locus_tag LOCUS_57560 113152 114081 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030376.1 protein_id gnl|my_center|LOCUS_57560 114082 114882 gene locus_tag LOCUS_57570 114082 114882 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973355.1 protein_id gnl|my_center|LOCUS_57570 114977 116500 gene locus_tag LOCUS_57580 114977 116500 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030377.1 protein_id gnl|my_center|LOCUS_57580 116323 116344 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 116562 117020 gene locus_tag LOCUS_57590 116562 117020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030378.1 protein_id gnl|my_center|LOCUS_57590 117135 118010 gene locus_tag LOCUS_57600 117135 118010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57600 118000 118353 gene locus_tag LOCUS_57610 118000 118353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57610 119029 118292 gene locus_tag LOCUS_57620 119029 118292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57620 120765 119431 gene locus_tag LOCUS_57630 gene gabT 120765 119431 CDS product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973349.1 protein_id gnl|my_center|LOCUS_57630 121068 123539 gene locus_tag LOCUS_57640 121068 123539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57640 123674 125350 gene locus_tag LOCUS_57650 123674 125350 CDS product PucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030383.1 protein_id gnl|my_center|LOCUS_57650 125154 125182 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 125510 126958 gene locus_tag LOCUS_57660 125510 126958 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030384.1 protein_id gnl|my_center|LOCUS_57660 129141 127057 gene locus_tag LOCUS_57670 129141 127057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_57670 129356 129138 gene locus_tag LOCUS_57680 129356 129138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57680 129443 129468 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 129494 130168 gene locus_tag LOCUS_57690 129494 130168 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803937.1 protein_id gnl|my_center|LOCUS_57690 130583 130131 gene locus_tag LOCUS_57700 130583 130131 CDS product adenylyltransferase/cytidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930108.1 protein_id gnl|my_center|LOCUS_57700 130720 132033 gene locus_tag LOCUS_57710 130720 132033 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162139561.1 protein_id gnl|my_center|LOCUS_57710 132030 133679 gene locus_tag LOCUS_57720 132030 133679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57720 133676 134905 gene locus_tag LOCUS_57730 133676 134905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978468.1 protein_id gnl|my_center|LOCUS_57730 136331 134865 gene locus_tag LOCUS_57740 136331 134865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57740 136426 136995 gene locus_tag LOCUS_57750 136426 136995 CDS product DapH/DapD/GlmU-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036462518.1 protein_id gnl|my_center|LOCUS_57750 136992 138107 gene locus_tag LOCUS_57760 136992 138107 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730916.1 protein_id gnl|my_center|LOCUS_57760 138851 138171 gene locus_tag LOCUS_57770 138851 138171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57770 141118 138851 gene locus_tag LOCUS_57780 141118 138851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57780 142385 141372 gene locus_tag LOCUS_57790 gene gmd 142385 141372 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407639.1 protein_id gnl|my_center|LOCUS_57790 142516 143499 gene locus_tag LOCUS_57800 142516 143499 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868775.1 protein_id gnl|my_center|LOCUS_57800 143501 143528 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 145049 143595 gene locus_tag LOCUS_57810 145049 143595 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803920.1 protein_id gnl|my_center|LOCUS_57810 145183 145206 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 145512 147500 gene locus_tag LOCUS_57820 145512 147500 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030396.1 protein_id gnl|my_center|LOCUS_57820 147835 149097 gene locus_tag LOCUS_57830 gene dxr 147835 149097 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973332.1 protein_id gnl|my_center|LOCUS_57830 149094 150398 gene locus_tag LOCUS_57840 149094 150398 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030397.1 protein_id gnl|my_center|LOCUS_57840 >Feature sequence020 345 1352 gene locus_tag LOCUS_57850 gene trpS 345 1352 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975499.1 protein_id gnl|my_center|LOCUS_57850 2222 1413 gene locus_tag LOCUS_57860 gene proC 2222 1413 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975496.1 protein_id gnl|my_center|LOCUS_57860 3097 2291 gene locus_tag LOCUS_57870 3097 2291 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028918.1 protein_id gnl|my_center|LOCUS_57870 3846 3094 gene locus_tag LOCUS_57880 3846 3094 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028919.1 protein_id gnl|my_center|LOCUS_57880 4767 3961 gene locus_tag LOCUS_57890 4767 3961 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028920.1 protein_id gnl|my_center|LOCUS_57890 5638 5117 gene locus_tag LOCUS_57900 5638 5117 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028921.1 protein_id gnl|my_center|LOCUS_57900 6030 5710 gene locus_tag LOCUS_57910 6030 5710 CDS product SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326518.1 protein_id gnl|my_center|LOCUS_57910 6323 6129 gene locus_tag LOCUS_57920 6323 6129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57920 6243 8408 gene locus_tag LOCUS_57930 6243 8408 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028924.1 protein_id gnl|my_center|LOCUS_57930 10327 8474 gene locus_tag LOCUS_57940 gene ilvD 10327 8474 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028925.1 protein_id gnl|my_center|LOCUS_57940 11064 10456 gene locus_tag LOCUS_57950 11064 10456 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975488.1 protein_id gnl|my_center|LOCUS_57950 11879 11061 gene locus_tag LOCUS_57960 11879 11061 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975487.1 protein_id gnl|my_center|LOCUS_57960 12943 11936 gene locus_tag LOCUS_57970 12943 11936 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028926.1 protein_id gnl|my_center|LOCUS_57970 13159 13965 gene locus_tag LOCUS_57980 13159 13965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975485.1 protein_id gnl|my_center|LOCUS_57980 15776 14052 gene locus_tag LOCUS_57990 15776 14052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172595308.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_57990 15940 17349 gene locus_tag LOCUS_58000 gene radA 15940 17349 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028928.1 protein_id gnl|my_center|LOCUS_58000 17432 18556 gene locus_tag LOCUS_58010 gene disA 17432 18556 CDS product DNA integrity scanning diadenylate cyclase DisA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975482.1 protein_id gnl|my_center|LOCUS_58010 19453 18626 gene locus_tag LOCUS_58020 19453 18626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191851224.1 protein_id gnl|my_center|LOCUS_58020 20057 20091 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 20179 20652 gene locus_tag LOCUS_58030 20179 20652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_58030 21015 21554 gene locus_tag LOCUS_58040 21015 21554 CDS product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975479.1 protein_id gnl|my_center|LOCUS_58040 21542 22195 gene locus_tag LOCUS_58050 21542 22195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173943984.1 protein_id gnl|my_center|LOCUS_58050 22438 23139 gene locus_tag LOCUS_58060 gene cseB 22438 23139 CDS product two-component system response regulator CseB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975477.1 protein_id gnl|my_center|LOCUS_58060 23151 24500 gene locus_tag LOCUS_58070 23151 24500 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028932.1 protein_id gnl|my_center|LOCUS_58070 24992 24546 gene locus_tag LOCUS_58080 24992 24546 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972459.1 protein_id gnl|my_center|LOCUS_58080 25560 25084 gene locus_tag LOCUS_58090 25560 25084 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030981.1 protein_id gnl|my_center|LOCUS_58090 27267 25657 gene locus_tag LOCUS_58100 27267 25657 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028938.1 protein_id gnl|my_center|LOCUS_58100 27409 28005 gene locus_tag LOCUS_58110 27409 28005 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975467.1 protein_id gnl|my_center|LOCUS_58110 28692 28111 gene locus_tag LOCUS_58120 28692 28111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58120 29149 29790 gene locus_tag LOCUS_58130 29149 29790 CDS product HAD family acid phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975463.1 protein_id gnl|my_center|LOCUS_58130 32363 29955 gene locus_tag LOCUS_58140 32363 29955 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975461.1 protein_id gnl|my_center|LOCUS_58140 30099 30126 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 32868 33548 gene locus_tag LOCUS_58150 32868 33548 CDS product SCO3374 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028943.1 protein_id gnl|my_center|LOCUS_58150 33799 33527 gene locus_tag LOCUS_58160 33799 33527 CDS product Lsr2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975458.1 protein_id gnl|my_center|LOCUS_58160 33853 33877 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 34628 34095 gene locus_tag LOCUS_58170 34628 34095 CDS product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975457.1 protein_id gnl|my_center|LOCUS_58170 35126 34638 gene locus_tag LOCUS_58180 35126 34638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58180 35458 35270 gene locus_tag LOCUS_58190 35458 35270 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028944.1 protein_id gnl|my_center|LOCUS_58190 36145 35513 gene locus_tag LOCUS_58200 36145 35513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028945.1 protein_id gnl|my_center|LOCUS_58200 37259 36462 gene locus_tag LOCUS_58210 37259 36462 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975453.1 protein_id gnl|my_center|LOCUS_58210 37822 37265 gene locus_tag LOCUS_58220 37822 37265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_58220 37779 37807 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 40028 38283 gene locus_tag LOCUS_58230 40028 38283 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028946.1 protein_id gnl|my_center|LOCUS_58230 41026 40025 gene locus_tag LOCUS_58240 gene panC 41026 40025 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975450.1 protein_id gnl|my_center|LOCUS_58240 41253 41023 gene locus_tag LOCUS_58250 41253 41023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58250 42440 41250 gene locus_tag LOCUS_58260 42440 41250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58260 42602 43816 gene locus_tag LOCUS_58270 42602 43816 CDS product beta-eliminating lyase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028948.1 protein_id gnl|my_center|LOCUS_58270 43872 44999 gene locus_tag LOCUS_58280 43872 44999 CDS product DUF5937 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028949.1 protein_id gnl|my_center|LOCUS_58280 44838 44858 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 45682 45041 gene locus_tag LOCUS_58290 45682 45041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975445.1 protein_id gnl|my_center|LOCUS_58290 46429 45758 gene locus_tag LOCUS_58300 46429 45758 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975444.1 protein_id gnl|my_center|LOCUS_58300 47698 46529 gene locus_tag LOCUS_58310 47698 46529 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975443.1 protein_id gnl|my_center|LOCUS_58310 47853 48941 gene locus_tag LOCUS_58320 47853 48941 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028950.1 protein_id gnl|my_center|LOCUS_58320 48424 48444 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 50036 48906 gene locus_tag LOCUS_58330 50036 48906 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975441.1 protein_id gnl|my_center|LOCUS_58330 50089 50592 gene locus_tag LOCUS_58340 50089 50592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58340 50589 52043 gene locus_tag LOCUS_58350 50589 52043 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013786.1 protein_id gnl|my_center|LOCUS_58350 53623 52040 gene locus_tag LOCUS_58360 53623 52040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58360 54872 53745 gene locus_tag LOCUS_58370 54872 53745 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975437.1 protein_id gnl|my_center|LOCUS_58370 55100 55957 gene locus_tag LOCUS_58380 55100 55957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_58380 55865 55887 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 55954 56937 gene locus_tag LOCUS_58390 55954 56937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_58390 57122 58033 gene locus_tag LOCUS_58400 gene folP 57122 58033 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975435.1 protein_id gnl|my_center|LOCUS_58400 58030 58533 gene locus_tag LOCUS_58410 58030 58533 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975434.1 protein_id gnl|my_center|LOCUS_58410 58537 58563 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 58801 58828 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 58861 59220 gene locus_tag LOCUS_58420 gene folB 58861 59220 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028954.1 protein_id gnl|my_center|LOCUS_58420 59217 59828 gene locus_tag LOCUS_58430 gene folK 59217 59828 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975432.1 protein_id gnl|my_center|LOCUS_58430 59882 60370 gene locus_tag LOCUS_58440 59882 60370 CDS product DUF3180 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975431.1 protein_id gnl|my_center|LOCUS_58440 61012 60407 gene locus_tag LOCUS_58450 gene folE 61012 60407 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975430.1 protein_id gnl|my_center|LOCUS_58450 63248 61131 gene locus_tag LOCUS_58460 gene ftsH 63248 61131 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030867756.1 protein_id gnl|my_center|LOCUS_58460 63910 63356 gene locus_tag LOCUS_58470 gene hpt 63910 63356 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007452004.1 protein_id gnl|my_center|LOCUS_58470 65421 63991 gene locus_tag LOCUS_58480 65421 63991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58480 66715 65615 gene locus_tag LOCUS_58490 66715 65615 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975426.1 protein_id gnl|my_center|LOCUS_58490 68016 66871 gene locus_tag LOCUS_58500 68016 66871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_58500 68177 68557 gene locus_tag LOCUS_58510 68177 68557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58510 68190 68217 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 68571 69086 gene locus_tag LOCUS_58520 68571 69086 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975424.1 protein_id gnl|my_center|LOCUS_58520 69319 69080 gene locus_tag LOCUS_58530 69319 69080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58530 69213 71012 gene locus_tag LOCUS_58540 69213 71012 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975423.1 protein_id gnl|my_center|LOCUS_58540 70257 70283 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 72046 71009 gene locus_tag LOCUS_58550 72046 71009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58550 72474 72632 gene locus_tag LOCUS_58560 72474 72632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_58560 73447 72686 gene locus_tag LOCUS_58570 73447 72686 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975420.1 protein_id gnl|my_center|LOCUS_58570 73569 74876 gene locus_tag LOCUS_58580 73569 74876 CDS product ion channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000903118.1 protein_id gnl|my_center|LOCUS_58580 74560 74583 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 74968 76380 gene locus_tag LOCUS_58590 74968 76380 CDS product glutamate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028961.1 protein_id gnl|my_center|LOCUS_58590 77027 76464 gene locus_tag LOCUS_58600 77027 76464 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223116.1 protein_id gnl|my_center|LOCUS_58600 78572 77112 gene locus_tag LOCUS_58610 78572 77112 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028965.1 protein_id gnl|my_center|LOCUS_58610 79582 78758 gene locus_tag LOCUS_58620 79582 78758 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975412.1 protein_id gnl|my_center|LOCUS_58620 79938 80417 gene locus_tag LOCUS_58630 79938 80417 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028967.1 protein_id gnl|my_center|LOCUS_58630 80768 80520 gene locus_tag LOCUS_58640 80768 80520 CDS product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028968.1 protein_id gnl|my_center|LOCUS_58640 80777 80803 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 81455 80964 gene locus_tag LOCUS_58650 81455 80964 CDS product SRPBCC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226516.1 protein_id gnl|my_center|LOCUS_58650 82126 81452 gene locus_tag LOCUS_58660 82126 81452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58660 82509 82135 gene locus_tag LOCUS_58670 82509 82135 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226514.1 protein_id gnl|my_center|LOCUS_58670 82680 83150 gene locus_tag LOCUS_58680 82680 83150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58680 83243 83791 gene locus_tag LOCUS_58690 83243 83791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58690 84980 83850 gene locus_tag LOCUS_58700 84980 83850 CDS product DUF2786 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028973.1 protein_id gnl|my_center|LOCUS_58700 85122 85919 gene locus_tag LOCUS_58710 85122 85919 CDS product Clp protease N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028974.1 protein_id gnl|my_center|LOCUS_58710 85172 85203 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 85939 87684 gene locus_tag LOCUS_58720 85939 87684 CDS product bifunctional 3'-5' exonuclease/DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228747.1 protein_id gnl|my_center|LOCUS_58720 91001 87666 gene locus_tag LOCUS_58730 91001 87666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58730 92188 91271 gene locus_tag LOCUS_58740 92188 91271 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031159.1 protein_id gnl|my_center|LOCUS_58740 92358 93398 gene locus_tag LOCUS_58750 92358 93398 CDS product D-2-hydroxyacid dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028521.1 protein_id gnl|my_center|LOCUS_58750 93622 94602 gene locus_tag LOCUS_58760 93622 94602 CDS product tellurite resistance/C4-dicarboxylate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776255.1 protein_id gnl|my_center|LOCUS_58760 94974 94627 gene locus_tag LOCUS_58770 94974 94627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58770 95388 98417 gene locus_tag LOCUS_58780 95388 98417 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226576.1 protein_id gnl|my_center|LOCUS_58780 98579 98427 gene locus_tag LOCUS_58790 98579 98427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58790 99766 98675 gene locus_tag LOCUS_58800 99766 98675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58800 100400 99828 gene locus_tag LOCUS_58810 100400 99828 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742094.1 protein_id gnl|my_center|LOCUS_58810 101401 100406 gene locus_tag LOCUS_58820 101401 100406 CDS product threo-3-hydroxy-L-aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167520.1 protein_id gnl|my_center|LOCUS_58820 102680 101388 gene locus_tag LOCUS_58830 102680 101388 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105034.1 protein_id gnl|my_center|LOCUS_58830 103732 102677 gene locus_tag LOCUS_58840 103732 102677 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973236.1 protein_id gnl|my_center|LOCUS_58840 105818 103773 gene locus_tag LOCUS_58850 105818 103773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58850 107615 105831 gene locus_tag LOCUS_58860 107615 105831 CDS product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122985.1 protein_id gnl|my_center|LOCUS_58860 109453 107615 gene locus_tag LOCUS_58870 gene asnB 109453 107615 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533124.1 protein_id gnl|my_center|LOCUS_58870 107701 107733 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 109707 111032 gene locus_tag LOCUS_58880 109707 111032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58880 111029 114205 gene locus_tag LOCUS_58890 111029 114205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58890 114225 114944 gene locus_tag LOCUS_58900 114225 114944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_58900 114907 114929 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 114941 115507 gene locus_tag LOCUS_58910 114941 115507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_58910 115410 118121 gene locus_tag LOCUS_58920 115410 118121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_58920 115443 115464 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 116499 116531 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 118048 118073 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 118109 120193 gene locus_tag LOCUS_58930 118109 120193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_58930 118915 118950 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 120313 121629 gene locus_tag LOCUS_58940 120313 121629 CDS product KamA family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881057.1 protein_id gnl|my_center|LOCUS_58940 122136 122060 gene locus_tag LOCUS_t00710 122136 122060 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 123384 122245 gene locus_tag LOCUS_58950 123384 122245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58950 123622 123659 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 125248 124043 gene locus_tag LOCUS_58960 125248 124043 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975394.1 protein_id gnl|my_center|LOCUS_58960 128701 125372 gene locus_tag LOCUS_58970 128701 125372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58970 131694 128824 gene locus_tag LOCUS_58980 gene topA 131694 128824 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029075.1 protein_id gnl|my_center|LOCUS_58980 132275 131952 gene locus_tag LOCUS_58990 132275 131952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58990 134065 132515 gene locus_tag LOCUS_59000 134065 132515 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975390.1 protein_id gnl|my_center|LOCUS_59000 134759 134172 gene locus_tag LOCUS_59010 134759 134172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975389.1 protein_id gnl|my_center|LOCUS_59010 137379 134974 gene locus_tag LOCUS_59020 137379 134974 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029076.1 protein_id gnl|my_center|LOCUS_59020 138143 137712 gene locus_tag LOCUS_59030 138143 137712 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975387.1 protein_id gnl|my_center|LOCUS_59030 138590 138249 gene locus_tag LOCUS_59040 gene bldG 138590 138249 CDS product anti-sigma factor antagonist BldG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975386.1 protein_id gnl|my_center|LOCUS_59040 138947 141139 gene locus_tag LOCUS_59050 138947 141139 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485160.1 protein_id gnl|my_center|LOCUS_59050 141603 141136 gene locus_tag LOCUS_59060 141603 141136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_59060 142022 141600 gene locus_tag LOCUS_59070 142022 141600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59070 142248 142009 gene locus_tag LOCUS_59080 142248 142009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59080 143089 142265 gene locus_tag LOCUS_59090 143089 142265 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029081.1 protein_id gnl|my_center|LOCUS_59090 143607 143086 gene locus_tag LOCUS_59100 143607 143086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_59100 144038 143604 gene locus_tag LOCUS_59110 144038 143604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_59110 143613 143644 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 145356 144031 gene locus_tag LOCUS_59120 145356 144031 CDS product TadA family conjugal transfer-associated ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037897599.1 protein_id gnl|my_center|LOCUS_59120 146519 145413 gene locus_tag LOCUS_59130 146519 145413 CDS product septum formation initiator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029084.1 protein_id gnl|my_center|LOCUS_59130 147100 147933 gene locus_tag LOCUS_59140 147100 147933 CDS product HAD-IB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270110.1 protein_id gnl|my_center|LOCUS_59140 149163 148339 gene locus_tag LOCUS_59150 149163 148339 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975377.1 protein_id gnl|my_center|LOCUS_59150 149264 150244 gene locus_tag LOCUS_59160 149264 150244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326561.1 protein_id gnl|my_center|LOCUS_59160 >Feature sequence021 2045 864 gene locus_tag LOCUS_59170 2045 864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59170 2265 4892 gene locus_tag LOCUS_59180 2265 4892 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486976.1 protein_id gnl|my_center|LOCUS_59180 5481 4963 gene locus_tag LOCUS_59190 5481 4963 CDS product DUF1990 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173943975.1 protein_id gnl|my_center|LOCUS_59190 7208 5553 gene locus_tag LOCUS_59200 7208 5553 CDS product M4 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030250.1 protein_id gnl|my_center|LOCUS_59200 9508 7463 gene locus_tag LOCUS_59210 9508 7463 CDS product M4 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973551.1 protein_id gnl|my_center|LOCUS_59210 10565 9831 gene locus_tag LOCUS_59220 10565 9831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59220 12463 10604 gene locus_tag LOCUS_59230 12463 10604 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030254.1 protein_id gnl|my_center|LOCUS_59230 14322 12460 gene locus_tag LOCUS_59240 14322 12460 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030255.1 protein_id gnl|my_center|LOCUS_59240 14528 15433 gene locus_tag LOCUS_59250 14528 15433 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327302.1 protein_id gnl|my_center|LOCUS_59250 15430 16164 gene locus_tag LOCUS_59260 15430 16164 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973545.1 protein_id gnl|my_center|LOCUS_59260 16172 17440 gene locus_tag LOCUS_59270 16172 17440 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870027.1 protein_id gnl|my_center|LOCUS_59270 17430 18086 gene locus_tag LOCUS_59280 17430 18086 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030258.1 protein_id gnl|my_center|LOCUS_59280 20319 18094 gene locus_tag LOCUS_59290 gene glgX 20319 18094 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486968.1 protein_id gnl|my_center|LOCUS_59290 20661 21737 gene locus_tag LOCUS_59300 20661 21737 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030260.1 protein_id gnl|my_center|LOCUS_59300 21963 22736 gene locus_tag LOCUS_59310 21963 22736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_59310 22630 22658 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 22712 23170 gene locus_tag LOCUS_59320 22712 23170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_59320 23261 24028 gene locus_tag LOCUS_59330 23261 24028 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030262.1 protein_id gnl|my_center|LOCUS_59330 24334 24837 gene locus_tag LOCUS_59340 24334 24837 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_079178808.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_59340 24933 25724 gene locus_tag LOCUS_59350 24933 25724 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225443.1 protein_id gnl|my_center|LOCUS_59350 25724 26989 gene locus_tag LOCUS_59360 25724 26989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225442.1 protein_id gnl|my_center|LOCUS_59360 26815 26836 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 26986 27900 gene locus_tag LOCUS_59370 26986 27900 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030266.1 protein_id gnl|my_center|LOCUS_59370 27960 28172 gene locus_tag LOCUS_59380 27960 28172 CDS product EF-hand domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973534.1 protein_id gnl|my_center|LOCUS_59380 28308 28342 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 28344 29006 gene locus_tag LOCUS_59390 28344 29006 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973533.1 protein_id gnl|my_center|LOCUS_59390 29576 29025 gene locus_tag LOCUS_59400 29576 29025 CDS product glycoside hydrolase family 25 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973532.1 protein_id gnl|my_center|LOCUS_59400 30705 29671 gene locus_tag LOCUS_59410 30705 29671 CDS product phosphatidylinositol-specific phospholipase C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230297.1 protein_id gnl|my_center|LOCUS_59410 32158 30791 gene locus_tag LOCUS_59420 32158 30791 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030269.1 protein_id gnl|my_center|LOCUS_59420 33565 32288 gene locus_tag LOCUS_59430 33565 32288 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973528.1 protein_id gnl|my_center|LOCUS_59430 33954 33577 gene locus_tag LOCUS_59440 gene gcvH 33954 33577 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973527.1 protein_id gnl|my_center|LOCUS_59440 35213 34074 gene locus_tag LOCUS_59450 gene gcvT 35213 34074 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973526.1 protein_id gnl|my_center|LOCUS_59450 35670 35362 gene locus_tag LOCUS_59460 35670 35362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59460 35639 36361 gene locus_tag LOCUS_59470 35639 36361 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030270.1 protein_id gnl|my_center|LOCUS_59470 36500 37303 gene locus_tag LOCUS_59480 36500 37303 CDS product enhanced serine sensitivity protein SseB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973524.1 protein_id gnl|my_center|LOCUS_59480 37406 38200 gene locus_tag LOCUS_59490 37406 38200 CDS product enhanced serine sensitivity protein SseB C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030271.1 protein_id gnl|my_center|LOCUS_59490 38524 39531 gene locus_tag LOCUS_59500 38524 39531 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973522.1 protein_id gnl|my_center|LOCUS_59500 39641 41395 gene locus_tag LOCUS_59510 39641 41395 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973521.1 protein_id gnl|my_center|LOCUS_59510 41507 42505 gene locus_tag LOCUS_59520 41507 42505 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973520.1 protein_id gnl|my_center|LOCUS_59520 42502 43599 gene locus_tag LOCUS_59530 42502 43599 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973519.1 protein_id gnl|my_center|LOCUS_59530 43596 44948 gene locus_tag LOCUS_59540 43596 44948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59540 45412 44957 gene locus_tag LOCUS_59550 45412 44957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59550 45309 46700 gene locus_tag LOCUS_59560 45309 46700 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174854953.1 protein_id gnl|my_center|LOCUS_59560 46767 47423 gene locus_tag LOCUS_59570 46767 47423 CDS product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973517.1 protein_id gnl|my_center|LOCUS_59570 48573 47332 gene locus_tag LOCUS_59580 48573 47332 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975437.1 protein_id gnl|my_center|LOCUS_59580 48747 49607 gene locus_tag LOCUS_59590 48747 49607 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327314.1 protein_id gnl|my_center|LOCUS_59590 49875 49594 gene locus_tag LOCUS_59600 49875 49594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_59600 50207 49884 gene locus_tag LOCUS_59610 50207 49884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59610 49967 49992 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 50305 51297 gene locus_tag LOCUS_59620 50305 51297 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223035.1 protein_id gnl|my_center|LOCUS_59620 50318 50346 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 51943 51320 gene locus_tag LOCUS_59630 51943 51320 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973515.1 protein_id gnl|my_center|LOCUS_59630 52067 52231 gene locus_tag LOCUS_59640 52067 52231 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973514.1 protein_id gnl|my_center|LOCUS_59640 52333 52599 gene locus_tag LOCUS_59650 52333 52599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973513.1 protein_id gnl|my_center|LOCUS_59650 52921 52951 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 52966 54135 gene locus_tag LOCUS_59660 52966 54135 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030274.1 protein_id gnl|my_center|LOCUS_59660 54201 54437 gene locus_tag LOCUS_59670 54201 54437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59670 54434 54844 gene locus_tag LOCUS_59680 54434 54844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59680 54873 56003 gene locus_tag LOCUS_59690 gene mnmA 54873 56003 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973510.1 protein_id gnl|my_center|LOCUS_59690 57100 56306 gene locus_tag LOCUS_59700 57100 56306 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973509.1 protein_id gnl|my_center|LOCUS_59700 57487 57164 gene locus_tag LOCUS_59710 57487 57164 CDS product DUF427 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973508.1 protein_id gnl|my_center|LOCUS_59710 57523 58101 gene locus_tag LOCUS_59720 57523 58101 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870058.1 protein_id gnl|my_center|LOCUS_59720 58117 58815 gene locus_tag LOCUS_59730 58117 58815 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870060.1 protein_id gnl|my_center|LOCUS_59730 58834 58864 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 59031 59987 gene locus_tag LOCUS_59740 59031 59987 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030277.1 protein_id gnl|my_center|LOCUS_59740 59997 62198 gene locus_tag LOCUS_59750 gene ligA 59997 62198 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030278.1 protein_id gnl|my_center|LOCUS_59750 62461 64716 gene locus_tag LOCUS_59760 gene rmdB 62461 64716 CDS product cyclic Di-GMP phosphodiesterase RmdB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030279.1 protein_id gnl|my_center|LOCUS_59760 65076 65372 gene locus_tag LOCUS_59770 gene gatC 65076 65372 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973500.1 protein_id gnl|my_center|LOCUS_59770 65379 66887 gene locus_tag LOCUS_59780 gene gatA 65379 66887 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973499.1 protein_id gnl|my_center|LOCUS_59780 66884 67126 gene locus_tag LOCUS_59790 66884 67126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007444751.1 protein_id gnl|my_center|LOCUS_59790 67143 68489 gene locus_tag LOCUS_59800 gene gatB 67143 68489 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030281.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_59800 68292 68329 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 68468 68695 gene locus_tag LOCUS_59810 68468 68695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_59810 68837 69214 gene locus_tag LOCUS_59820 68837 69214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59820 69610 69635 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 69734 71719 gene locus_tag LOCUS_59830 69734 71719 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030282.1 protein_id gnl|my_center|LOCUS_59830 71697 72272 gene locus_tag LOCUS_59840 71697 72272 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973495.1 protein_id gnl|my_center|LOCUS_59840 72310 72906 gene locus_tag LOCUS_59850 72310 72906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030283.1 protein_id gnl|my_center|LOCUS_59850 73131 73316 gene locus_tag LOCUS_59860 73131 73316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59860 73313 76489 gene locus_tag LOCUS_59870 73313 76489 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486951.1 protein_id gnl|my_center|LOCUS_59870 76543 76570 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 77885 76740 gene locus_tag LOCUS_59880 77885 76740 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486947.1 protein_id gnl|my_center|LOCUS_59880 79043 78045 gene locus_tag LOCUS_59890 79043 78045 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870088.1 protein_id gnl|my_center|LOCUS_59890 79122 79760 gene locus_tag LOCUS_59900 79122 79760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_59900 79588 79610 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 79646 80107 gene locus_tag LOCUS_59910 79646 80107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_59910 80517 83951 gene locus_tag LOCUS_59920 80517 83951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59920 84194 86038 gene locus_tag LOCUS_59930 84194 86038 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973484.1 protein_id gnl|my_center|LOCUS_59930 86081 86608 gene locus_tag LOCUS_59940 gene ilvN 86081 86608 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973483.1 protein_id gnl|my_center|LOCUS_59940 86728 87726 gene locus_tag LOCUS_59950 gene ilvC 86728 87726 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973482.1 protein_id gnl|my_center|LOCUS_59950 88003 88944 gene locus_tag LOCUS_59960 88003 88944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_59960 88799 88820 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 88850 89614 gene locus_tag LOCUS_59970 88850 89614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_59970 91254 89698 gene locus_tag LOCUS_59980 91254 89698 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870095.1 protein_id gnl|my_center|LOCUS_59980 91343 91954 gene locus_tag LOCUS_59990 91343 91954 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973479.1 protein_id gnl|my_center|LOCUS_59990 93174 91951 gene locus_tag LOCUS_60000 93174 91951 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973478.1 protein_id gnl|my_center|LOCUS_60000 93035 93061 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 93338 94264 gene locus_tag LOCUS_60010 93338 94264 CDS product proline dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973477.1 protein_id gnl|my_center|LOCUS_60010 94370 95599 gene locus_tag LOCUS_60020 94370 95599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_60020 95532 95556 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 95631 96026 gene locus_tag LOCUS_60030 95631 96026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_60030 96359 96490 gene locus_tag LOCUS_60040 96359 96490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030289.1 protein_id gnl|my_center|LOCUS_60040 96573 97616 gene locus_tag LOCUS_60050 96573 97616 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030290.1 protein_id gnl|my_center|LOCUS_60050 97870 98958 gene locus_tag LOCUS_60060 97870 98958 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030291.1 protein_id gnl|my_center|LOCUS_60060 99286 99993 gene locus_tag LOCUS_60070 gene ureA 99286 99993 CDS product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030293.1 protein_id gnl|my_center|LOCUS_60070 99990 101711 gene locus_tag LOCUS_60080 99990 101711 CDS product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030294.1 protein_id gnl|my_center|LOCUS_60080 101723 102763 gene locus_tag LOCUS_60090 101723 102763 CDS product agmatine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973469.1 protein_id gnl|my_center|LOCUS_60090 102801 103421 gene locus_tag LOCUS_60100 102801 103421 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973468.1 protein_id gnl|my_center|LOCUS_60100 103749 105353 gene locus_tag LOCUS_60110 gene cimA 103749 105353 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030295.1 protein_id gnl|my_center|LOCUS_60110 106006 105407 gene locus_tag LOCUS_60120 106006 105407 CDS product GPP34 family phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027096.1 protein_id gnl|my_center|LOCUS_60120 107900 106023 gene locus_tag LOCUS_60130 107900 106023 CDS product ricin-type beta-trefoil lectin domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284089.1 protein_id gnl|my_center|LOCUS_60130 108173 111193 gene locus_tag LOCUS_60140 108173 111193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60140 111294 112706 gene locus_tag LOCUS_60150 111294 112706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973466.1 protein_id gnl|my_center|LOCUS_60150 114346 112799 gene locus_tag LOCUS_60160 114346 112799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60160 114454 114478 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 115351 114734 gene locus_tag LOCUS_60170 115351 114734 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973463.1 protein_id gnl|my_center|LOCUS_60170 115612 116118 gene locus_tag LOCUS_60180 115612 116118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227099.1 protein_id gnl|my_center|LOCUS_60180 116562 118892 gene locus_tag LOCUS_60190 116562 118892 CDS product polysaccharide lyase 8 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030298.1 protein_id gnl|my_center|LOCUS_60190 >Feature sequence022 1534 2661 gene locus_tag LOCUS_60200 gene iroB 1534 2661 CDS product salmochelin biosynthesis C-glycosyltransferase IroB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001221113.1 protein_id gnl|my_center|LOCUS_60200 4401 2803 gene locus_tag LOCUS_60210 4401 2803 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229590.1 protein_id gnl|my_center|LOCUS_60210 4952 4398 gene locus_tag LOCUS_60220 4952 4398 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229589.1 protein_id gnl|my_center|LOCUS_60220 4689 4718 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5608 5048 gene locus_tag LOCUS_60230 5608 5048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60230 5764 7035 gene locus_tag LOCUS_60240 5764 7035 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230183.1 protein_id gnl|my_center|LOCUS_60240 6161 6184 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7028 7717 gene locus_tag LOCUS_60250 7028 7717 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230184.1 protein_id gnl|my_center|LOCUS_60250 10245 7789 gene locus_tag LOCUS_60260 10245 7789 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223082.1 protein_id gnl|my_center|LOCUS_60260 10307 10328 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11483 10770 gene locus_tag LOCUS_60270 11483 10770 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222578.1 protein_id gnl|my_center|LOCUS_60270 14772 11746 gene locus_tag LOCUS_60280 14772 11746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60280 15658 14990 gene locus_tag LOCUS_60290 15658 14990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60290 15821 16885 gene locus_tag LOCUS_60300 15821 16885 CDS product biotin/lipoate A/B protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327718.1 protein_id gnl|my_center|LOCUS_60300 17019 17708 gene locus_tag LOCUS_60310 17019 17708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030904.1 protein_id gnl|my_center|LOCUS_60310 19257 17731 gene locus_tag LOCUS_60320 19257 17731 CDS product NCS1 family nucleobase:cation symporter-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270301.1 protein_id gnl|my_center|LOCUS_60320 20395 19376 gene locus_tag LOCUS_60330 20395 19376 CDS product TIGR03842 family LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030901.1 protein_id gnl|my_center|LOCUS_60330 21075 20407 gene locus_tag LOCUS_60340 21075 20407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_60340 21108 21141 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 21471 21917 gene locus_tag LOCUS_60350 21471 21917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60350 22735 21893 gene locus_tag LOCUS_60360 22735 21893 CDS product apolipoprotein acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972565.1 protein_id gnl|my_center|LOCUS_60360 24517 22892 gene locus_tag LOCUS_60370 24517 22892 CDS product PucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030899.1 protein_id gnl|my_center|LOCUS_60370 25897 24614 gene locus_tag LOCUS_60380 25897 24614 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222142.1 protein_id gnl|my_center|LOCUS_60380 26736 25894 gene locus_tag LOCUS_60390 26736 25894 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972568.1 protein_id gnl|my_center|LOCUS_60390 27199 26948 gene locus_tag LOCUS_60400 27199 26948 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972569.1 protein_id gnl|my_center|LOCUS_60400 27252 28019 gene locus_tag LOCUS_60410 gene map 27252 28019 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972570.1 protein_id gnl|my_center|LOCUS_60410 28145 28156 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 28270 30816 gene locus_tag LOCUS_60420 28270 30816 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030897.1 protein_id gnl|my_center|LOCUS_60420 32693 30882 gene locus_tag LOCUS_60430 gene ggt 32693 30882 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030896.1 protein_id gnl|my_center|LOCUS_60430 32825 33583 gene locus_tag LOCUS_60440 32825 33583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972573.1 protein_id gnl|my_center|LOCUS_60440 33742 35310 gene locus_tag LOCUS_60450 33742 35310 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035939.1 protein_id gnl|my_center|LOCUS_60450 36132 35686 gene locus_tag LOCUS_60460 36132 35686 CDS product DUF6278 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972582.1 protein_id gnl|my_center|LOCUS_60460 36959 36180 gene locus_tag LOCUS_60470 36959 36180 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030841.1 protein_id gnl|my_center|LOCUS_60470 37656 37021 gene locus_tag LOCUS_60480 37656 37021 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972584.1 protein_id gnl|my_center|LOCUS_60480 39061 37742 gene locus_tag LOCUS_60490 39061 37742 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030840.1 protein_id gnl|my_center|LOCUS_60490 39437 41161 gene locus_tag LOCUS_60500 39437 41161 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973282.1 protein_id gnl|my_center|LOCUS_60500 41935 41531 gene locus_tag LOCUS_60510 41935 41531 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030865215.1 protein_id gnl|my_center|LOCUS_60510 42336 42262 gene locus_tag LOCUS_t00720 42336 42262 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 42338 42366 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 43429 42590 gene locus_tag LOCUS_60520 43429 42590 CDS product RNA polymerase sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978261.1 protein_id gnl|my_center|LOCUS_60520 44795 43656 gene locus_tag LOCUS_60530 44795 43656 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229362.1 protein_id gnl|my_center|LOCUS_60530 44928 45938 gene locus_tag LOCUS_60540 44928 45938 CDS product NADPH oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950854.1 protein_id gnl|my_center|LOCUS_60540 45946 47064 gene locus_tag LOCUS_60550 45946 47064 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191279629.1 protein_id gnl|my_center|LOCUS_60550 47197 47799 gene locus_tag LOCUS_60560 47197 47799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_60560 47703 47728 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 47745 47960 gene locus_tag LOCUS_60570 47745 47960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_60570 48395 48057 gene locus_tag LOCUS_60580 48395 48057 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973104.1 protein_id gnl|my_center|LOCUS_60580 49157 49178 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 49204 49521 gene locus_tag LOCUS_60590 49204 49521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974276.1 protein_id gnl|my_center|LOCUS_60590 50545 50219 gene locus_tag LOCUS_60600 50545 50219 CDS product SCO5918 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973102.1 protein_id gnl|my_center|LOCUS_60600 50997 50596 gene locus_tag LOCUS_60610 50997 50596 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030532.1 protein_id gnl|my_center|LOCUS_60610 52539 51043 gene locus_tag LOCUS_60620 52539 51043 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973100.1 protein_id gnl|my_center|LOCUS_60620 53090 52887 gene locus_tag LOCUS_60630 53090 52887 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974279.1 protein_id gnl|my_center|LOCUS_60630 53953 53711 gene locus_tag LOCUS_60640 53953 53711 CDS product DUF5302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027163.1 protein_id gnl|my_center|LOCUS_60640 55541 54126 gene locus_tag LOCUS_60650 55541 54126 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973100.1 protein_id gnl|my_center|LOCUS_60650 56315 55911 gene locus_tag LOCUS_60660 56315 55911 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978004.1 protein_id gnl|my_center|LOCUS_60660 56450 56470 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 58450 56609 gene locus_tag LOCUS_60670 58450 56609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60670 58800 58453 gene locus_tag LOCUS_60680 58800 58453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60680 59612 58797 gene locus_tag LOCUS_60690 59612 58797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60690 59881 59609 gene locus_tag LOCUS_60700 59881 59609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60700 60189 59878 gene locus_tag LOCUS_60710 60189 59878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60710 60449 60186 gene locus_tag LOCUS_60720 60449 60186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60720 60919 60446 gene locus_tag LOCUS_60730 60919 60446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60730 61283 62230 gene locus_tag LOCUS_60740 61283 62230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977141.1 protein_id gnl|my_center|LOCUS_60740 64922 62241 gene locus_tag LOCUS_60750 64922 62241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60750 67834 64922 gene locus_tag LOCUS_60760 67834 64922 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030777.1 protein_id gnl|my_center|LOCUS_60760 68415 67942 gene locus_tag LOCUS_60770 68415 67942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972665.1 protein_id gnl|my_center|LOCUS_60770 68496 68585 gene locus_tag LOCUS_t00730 68496 68585 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 69671 68523 gene locus_tag LOCUS_60780 69671 68523 CDS product ROK family glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030775.1 protein_id gnl|my_center|LOCUS_60780 70644 69808 gene locus_tag LOCUS_60790 70644 69808 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030774.1 protein_id gnl|my_center|LOCUS_60790 71681 70641 gene locus_tag LOCUS_60800 71681 70641 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972668.1 protein_id gnl|my_center|LOCUS_60800 72682 71678 gene locus_tag LOCUS_60810 72682 71678 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030773.1 protein_id gnl|my_center|LOCUS_60810 73653 72916 gene locus_tag LOCUS_60820 73653 72916 CDS product myo-inositol degradation transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030772.1 protein_id gnl|my_center|LOCUS_60820 73709 73745 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 73820 74842 gene locus_tag LOCUS_60830 73820 74842 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972671.1 protein_id gnl|my_center|LOCUS_60830 76108 74927 gene locus_tag LOCUS_60840 76108 74927 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_078653353.1 protein_id gnl|my_center|LOCUS_60840 76877 76179 gene locus_tag LOCUS_60850 76877 76179 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030771.1 protein_id gnl|my_center|LOCUS_60850 77061 78041 gene locus_tag LOCUS_60860 77061 78041 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027388.1 protein_id gnl|my_center|LOCUS_60860 79524 78244 gene locus_tag LOCUS_60870 79524 78244 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030770.1 protein_id gnl|my_center|LOCUS_60870 80232 79606 gene locus_tag LOCUS_60880 80232 79606 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230676.1 protein_id gnl|my_center|LOCUS_60880 81146 80319 gene locus_tag LOCUS_60890 81146 80319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60890 82319 81189 gene locus_tag LOCUS_60900 gene alc 82319 81189 CDS product allantoicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030765.1 protein_id gnl|my_center|LOCUS_60900 83692 82352 gene locus_tag LOCUS_60910 gene allB 83692 82352 CDS product allantoinase AllB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972680.1 protein_id gnl|my_center|LOCUS_60910 83933 84730 gene locus_tag LOCUS_60920 gene allR 83933 84730 CDS product allantoin degradation transcriptional regulator AllR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972681.1 protein_id gnl|my_center|LOCUS_60920 85485 84814 gene locus_tag LOCUS_60930 85485 84814 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977459.1 protein_id gnl|my_center|LOCUS_60930 86516 85482 gene locus_tag LOCUS_60940 86516 85482 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027750.1 protein_id gnl|my_center|LOCUS_60940 86651 87835 gene locus_tag LOCUS_60950 86651 87835 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027751.1 protein_id gnl|my_center|LOCUS_60950 87832 88470 gene locus_tag LOCUS_60960 87832 88470 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977456.1 protein_id gnl|my_center|LOCUS_60960 88772 88512 gene locus_tag LOCUS_60970 88772 88512 CDS product DUF5955 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972682.1 protein_id gnl|my_center|LOCUS_60970 88980 89624 gene locus_tag LOCUS_60980 88980 89624 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030764.1 protein_id gnl|my_center|LOCUS_60980 89844 91469 gene locus_tag LOCUS_60990 gene aceB 89844 91469 CDS product malate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030763.1 protein_id gnl|my_center|LOCUS_60990 92500 91586 gene locus_tag LOCUS_61000 92500 91586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972685.1 protein_id gnl|my_center|LOCUS_61000 92751 93041 gene locus_tag LOCUS_61010 92751 93041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_61010 92932 93291 gene locus_tag LOCUS_61020 92932 93291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_61020 93390 93854 gene locus_tag LOCUS_61030 93390 93854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61030 93991 94446 gene locus_tag LOCUS_61040 93991 94446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61040 96060 94534 gene locus_tag LOCUS_61050 96060 94534 CDS product IucA/IucC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030750.1 protein_id gnl|my_center|LOCUS_61050 96154 97686 gene locus_tag LOCUS_61060 96154 97686 CDS product IucA/IucC family siderophore biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030749.1 protein_id gnl|my_center|LOCUS_61060 97696 98961 gene locus_tag LOCUS_61070 97696 98961 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030748.1 protein_id gnl|my_center|LOCUS_61070 98961 99800 gene locus_tag LOCUS_61080 98961 99800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972703.1 protein_id gnl|my_center|LOCUS_61080 100490 99855 gene locus_tag LOCUS_61090 100490 99855 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972704.1 protein_id gnl|my_center|LOCUS_61090 100557 101786 gene locus_tag LOCUS_61100 100557 101786 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972705.1 protein_id gnl|my_center|LOCUS_61100 101994 102524 gene locus_tag LOCUS_61110 101994 102524 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972709.1 protein_id gnl|my_center|LOCUS_61110 102841 103500 gene locus_tag LOCUS_61120 102841 103500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030745.1 protein_id gnl|my_center|LOCUS_61120 103554 103976 gene locus_tag LOCUS_61130 103554 103976 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030744.1 protein_id gnl|my_center|LOCUS_61130 105473 104052 gene locus_tag LOCUS_61140 105473 104052 CDS product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972712.1 protein_id gnl|my_center|LOCUS_61140 107130 105754 gene locus_tag LOCUS_61150 107130 105754 CDS product 8-oxoguanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030742.1 protein_id gnl|my_center|LOCUS_61150 108072 107152 gene locus_tag LOCUS_61160 gene pucL 108072 107152 CDS product urate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972716.1 protein_id gnl|my_center|LOCUS_61160 108484 108080 gene locus_tag LOCUS_61170 gene uraH 108484 108080 CDS product hydroxyisourate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030741.1 protein_id gnl|my_center|LOCUS_61170 109000 108488 gene locus_tag LOCUS_61180 gene uraD 109000 108488 CDS product 2-oxo-4-hydroxy-4-carboxy-5-ureidoimidazoline decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030740.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_61180 109588 109226 gene locus_tag LOCUS_61190 109588 109226 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972719.1 protein_id gnl|my_center|LOCUS_61190 109866 109585 gene locus_tag LOCUS_61200 109866 109585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063646595.1 protein_id gnl|my_center|LOCUS_61200 110031 110861 gene locus_tag LOCUS_61210 110031 110861 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972721.1 protein_id gnl|my_center|LOCUS_61210 110905 111798 gene locus_tag LOCUS_61220 110905 111798 CDS product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972722.1 protein_id gnl|my_center|LOCUS_61220 112257 112493 gene locus_tag LOCUS_61230 112257 112493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270281.1 protein_id gnl|my_center|LOCUS_61230 114382 112598 gene locus_tag LOCUS_61240 gene gcl 114382 112598 CDS product glyoxylate carboligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030737.1 protein_id gnl|my_center|LOCUS_61240 114662 115345 gene locus_tag LOCUS_61250 114662 115345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030736.1 protein_id gnl|my_center|LOCUS_61250 <116910 115486 gene locus_tag LOCUS_61260 <116910 115486 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_146237205.1:PKD domain-containing protein >Feature sequence023 843 202 gene locus_tag LOCUS_61270 843 202 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975875.1 protein_id gnl|my_center|LOCUS_61270 1546 1094 gene locus_tag LOCUS_61280 1546 1094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61280 3330 1525 gene locus_tag LOCUS_61290 3330 1525 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975874.1 protein_id gnl|my_center|LOCUS_61290 5106 3604 gene locus_tag LOCUS_61300 5106 3604 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076054423.1 protein_id gnl|my_center|LOCUS_61300 5263 5335 gene locus_tag LOCUS_t00740 5263 5335 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 6007 6711 gene locus_tag LOCUS_61310 6007 6711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61310 6954 6781 gene locus_tag LOCUS_61320 6954 6781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61320 7086 7349 gene locus_tag LOCUS_61330 7086 7349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61330 8518 8114 gene locus_tag LOCUS_61340 8518 8114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61340 8579 8611 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9999 9424 gene locus_tag LOCUS_61350 9999 9424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61350 12423 10111 gene locus_tag LOCUS_61360 12423 10111 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028673.1 protein_id gnl|my_center|LOCUS_61360 14168 12420 gene locus_tag LOCUS_61370 14168 12420 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028674.1 protein_id gnl|my_center|LOCUS_61370 15058 14165 gene locus_tag LOCUS_61380 15058 14165 CDS product FAD binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030865474.1 protein_id gnl|my_center|LOCUS_61380 17012 15312 gene locus_tag LOCUS_61390 17012 15312 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028675.1 protein_id gnl|my_center|LOCUS_61390 17417 17133 gene locus_tag LOCUS_61400 17417 17133 CDS product DUF3039 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030402030.1 protein_id gnl|my_center|LOCUS_61400 18039 17458 gene locus_tag LOCUS_61410 18039 17458 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030865482.1 protein_id gnl|my_center|LOCUS_61410 18306 19646 gene locus_tag LOCUS_61420 gene murA 18306 19646 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975861.1 protein_id gnl|my_center|LOCUS_61420 20058 19777 gene locus_tag LOCUS_61430 20058 19777 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003950507.1 protein_id gnl|my_center|LOCUS_61430 21824 20391 gene locus_tag LOCUS_61440 21824 20391 CDS product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975860.1 protein_id gnl|my_center|LOCUS_61440 24433 22130 gene locus_tag LOCUS_61450 24433 22130 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975859.1 protein_id gnl|my_center|LOCUS_61450 25333 24518 gene locus_tag LOCUS_61460 gene rsuA 25333 24518 CDS product anti-sigma U factor RsuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975858.1 protein_id gnl|my_center|LOCUS_61460 25818 25330 gene locus_tag LOCUS_61470 25818 25330 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975857.1 protein_id gnl|my_center|LOCUS_61470 26805 26203 gene locus_tag LOCUS_61480 26805 26203 CDS product CGNR zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028679.1 protein_id gnl|my_center|LOCUS_61480 28181 26982 gene locus_tag LOCUS_61490 28181 26982 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028682.1 protein_id gnl|my_center|LOCUS_61490 29709 28327 gene locus_tag LOCUS_61500 29709 28327 CDS product NarK family nitrate/nitrite MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028683.1 protein_id gnl|my_center|LOCUS_61500 28885 28908 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 31356 29806 gene locus_tag LOCUS_61510 31356 29806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61510 31901 31446 gene locus_tag LOCUS_61520 31901 31446 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973043.1 protein_id gnl|my_center|LOCUS_61520 32128 32982 gene locus_tag LOCUS_61530 32128 32982 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973979.1 protein_id gnl|my_center|LOCUS_61530 33229 33023 gene locus_tag LOCUS_61540 33229 33023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61540 33626 33363 gene locus_tag LOCUS_61550 33626 33363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61550 34368 34078 gene locus_tag LOCUS_61560 34368 34078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61560 35090 34779 gene locus_tag LOCUS_61570 35090 34779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61570 41594 35112 gene locus_tag LOCUS_61580 41594 35112 CDS product RHS repeat-associated core domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030747.1 protein_id gnl|my_center|LOCUS_61580 45108 41737 gene locus_tag LOCUS_61590 45108 41737 CDS product LamG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184834092.1 protein_id gnl|my_center|LOCUS_61590 45181 45537 gene locus_tag LOCUS_61600 45181 45537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61600 45206 45228 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 45975 46475 gene locus_tag LOCUS_61610 45975 46475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61610 47716 46520 gene locus_tag LOCUS_61620 47716 46520 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975851.1 protein_id gnl|my_center|LOCUS_61620 50127 47731 gene locus_tag LOCUS_61630 50127 47731 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028686.1 protein_id gnl|my_center|LOCUS_61630 51422 50127 gene locus_tag LOCUS_61640 51422 50127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61640 52220 51573 gene locus_tag LOCUS_61650 52220 51573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_61650 52459 52481 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 52658 53929 gene locus_tag LOCUS_61660 52658 53929 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484859.1 protein_id gnl|my_center|LOCUS_61660 54546 54156 gene locus_tag LOCUS_tm00010 54546 54156 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 55123 54644 gene locus_tag LOCUS_61670 gene smpB 55123 54644 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975846.1 protein_id gnl|my_center|LOCUS_61670 55521 55189 gene locus_tag LOCUS_61680 55521 55189 CDS product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978605.1 protein_id gnl|my_center|LOCUS_61680 55620 55645 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 56891 55710 gene locus_tag LOCUS_61690 56891 55710 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173668732.1 protein_id gnl|my_center|LOCUS_61690 57917 56970 gene locus_tag LOCUS_61700 gene ftsX 57917 56970 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975844.1 protein_id gnl|my_center|LOCUS_61700 57799 57828 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 58649 57960 gene locus_tag LOCUS_61710 gene ftsE 58649 57960 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975843.1 protein_id gnl|my_center|LOCUS_61710 58918 59109 gene locus_tag LOCUS_61720 58918 59109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975842.1 protein_id gnl|my_center|LOCUS_61720 60189 59263 gene locus_tag LOCUS_61730 60189 59263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61730 61570 60458 gene locus_tag LOCUS_61740 gene prfB 61570 60458 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975840.1 protein_id gnl|my_center|LOCUS_61740 63040 61805 gene locus_tag LOCUS_61750 63040 61805 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028691.1 protein_id gnl|my_center|LOCUS_61750 64900 63176 gene locus_tag LOCUS_61760 64900 63176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61760 65363 69046 gene locus_tag LOCUS_61770 65363 69046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_61770 65460 65480 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 69287 70624 gene locus_tag LOCUS_61780 69287 70624 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975833.1 protein_id gnl|my_center|LOCUS_61780 70630 71994 gene locus_tag LOCUS_61790 70630 71994 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030865510.1 protein_id gnl|my_center|LOCUS_61790 71991 72899 gene locus_tag LOCUS_61800 71991 72899 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975831.1 protein_id gnl|my_center|LOCUS_61800 73442 72999 gene locus_tag LOCUS_61810 73442 72999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61810 73458 75665 gene locus_tag LOCUS_61820 73458 75665 CDS product bifunctional glycosyltransferase family 2 protein/CDP-glycerol:glycerophosphate glycerophosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028695.1 protein_id gnl|my_center|LOCUS_61820 75674 77929 gene locus_tag LOCUS_61830 75674 77929 CDS product bifunctional glycosyltransferase/CDP-glycerol:glycerophosphate glycerophosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028696.1 protein_id gnl|my_center|LOCUS_61830 77938 79344 gene locus_tag LOCUS_61840 77938 79344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028697.1 protein_id gnl|my_center|LOCUS_61840 79809 79396 gene locus_tag LOCUS_61850 79809 79396 CDS product organic hydroperoxide resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975825.1 protein_id gnl|my_center|LOCUS_61850 79928 80446 gene locus_tag LOCUS_61860 79928 80446 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028699.1 protein_id gnl|my_center|LOCUS_61860 80515 81819 gene locus_tag LOCUS_61870 80515 81819 CDS product glycosyltransferase family 87 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326026.1 protein_id gnl|my_center|LOCUS_61870 81864 83465 gene locus_tag LOCUS_61880 81864 83465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61880 83539 84519 gene locus_tag LOCUS_61890 gene galE 83539 84519 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975823.1 protein_id gnl|my_center|LOCUS_61890 85223 84588 gene locus_tag LOCUS_61900 85223 84588 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229516.1 protein_id gnl|my_center|LOCUS_61900 85314 86309 gene locus_tag LOCUS_61910 85314 86309 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975816.1 protein_id gnl|my_center|LOCUS_61910 86302 87111 gene locus_tag LOCUS_61920 86302 87111 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975815.1 protein_id gnl|my_center|LOCUS_61920 88661 87147 gene locus_tag LOCUS_61930 88661 87147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028698.1 protein_id gnl|my_center|LOCUS_61930 93830 88887 gene locus_tag LOCUS_61940 93830 88887 CDS product NAD-glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028707.1 protein_id gnl|my_center|LOCUS_61940 95074 94382 gene locus_tag LOCUS_61950 95074 94382 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028708.1 protein_id gnl|my_center|LOCUS_61950 95602 95081 gene locus_tag LOCUS_61960 95602 95081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028709.1 protein_id gnl|my_center|LOCUS_61960 95860 96537 gene locus_tag LOCUS_61970 95860 96537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61970 99613 96797 gene locus_tag LOCUS_61980 gene secA 99613 96797 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975807.1 protein_id gnl|my_center|LOCUS_61980 99886 100455 gene locus_tag LOCUS_61990 99886 100455 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028711.1 protein_id gnl|my_center|LOCUS_61990 100553 101728 gene locus_tag LOCUS_62000 100553 101728 CDS product crosslink repair DNA glycosylase YcaQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028712.1 protein_id gnl|my_center|LOCUS_62000 102501 101755 gene locus_tag LOCUS_62010 102501 101755 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975804.1 protein_id gnl|my_center|LOCUS_62010 103397 102708 gene locus_tag LOCUS_62020 gene raiA 103397 102708 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975803.1 protein_id gnl|my_center|LOCUS_62020 104568 103711 gene locus_tag LOCUS_62030 104568 103711 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028713.1 protein_id gnl|my_center|LOCUS_62030 106513 104645 gene locus_tag LOCUS_62040 106513 104645 CDS product LpqB family beta-propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028714.1 protein_id gnl|my_center|LOCUS_62040 108596 106503 gene locus_tag LOCUS_62050 gene mtrB 108596 106503 CDS product two-component system sensor histidine kinase MtrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028715.1 protein_id gnl|my_center|LOCUS_62050 109275 108598 gene locus_tag LOCUS_62060 gene mtrA 109275 108598 CDS product two-component system response regulator MtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975799.1 protein_id gnl|my_center|LOCUS_62060 110572 109430 gene locus_tag LOCUS_62070 gene mtnA 110572 109430 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028716.1 protein_id gnl|my_center|LOCUS_62070 110713 112143 gene locus_tag LOCUS_62080 110713 112143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62080 112638 112674 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 112677 112964 gene locus_tag LOCUS_62090 112677 112964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_62090 112961 114157 gene locus_tag LOCUS_62100 112961 114157 CDS product DUF4350 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484831.1 protein_id gnl|my_center|LOCUS_62100 114154 115146 gene locus_tag LOCUS_62110 114154 115146 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037897409.1 protein_id gnl|my_center|LOCUS_62110 115146 116456 gene locus_tag LOCUS_62120 115146 116456 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028719.1 protein_id gnl|my_center|LOCUS_62120 >Feature sequence024 746 1378 gene locus_tag LOCUS_62130 746 1378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_62130 3170 1749 gene locus_tag LOCUS_62140 3170 1749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62140 4672 3167 gene locus_tag LOCUS_62150 4672 3167 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257847.1 protein_id gnl|my_center|LOCUS_62150 6550 4679 gene locus_tag LOCUS_62160 6550 4679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62160 6852 6547 gene locus_tag LOCUS_62170 gene nuoK 6852 6547 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257849.1 protein_id gnl|my_center|LOCUS_62170 7421 6849 gene locus_tag LOCUS_62180 7421 6849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62180 8365 7436 gene locus_tag LOCUS_62190 gene nuoH 8365 7436 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071280.1 protein_id gnl|my_center|LOCUS_62190 8642 8358 gene locus_tag LOCUS_62200 8642 8358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62200 9808 8618 gene locus_tag LOCUS_62210 9808 8618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62210 8651 8676 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10149 9799 gene locus_tag LOCUS_62220 10149 9799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62220 11103 10798 gene locus_tag LOCUS_62230 11103 10798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62230 11249 11557 gene locus_tag LOCUS_62240 11249 11557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62240 11661 12542 gene locus_tag LOCUS_62250 11661 12542 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227738.1 protein_id gnl|my_center|LOCUS_62250 12664 12446 gene locus_tag LOCUS_62260 12664 12446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62260 14612 12870 gene locus_tag LOCUS_62270 14612 12870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62270 15717 14962 gene locus_tag LOCUS_62280 15717 14962 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065921482.1 protein_id gnl|my_center|LOCUS_62280 16445 15894 gene locus_tag LOCUS_62290 16445 15894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62290 17328 16996 gene locus_tag LOCUS_62300 17328 16996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_62300 17912 17304 gene locus_tag LOCUS_62310 17912 17304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_62310 19102 17909 gene locus_tag LOCUS_62320 19102 17909 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189740062.1 protein_id gnl|my_center|LOCUS_62320 19401 19099 gene locus_tag LOCUS_62330 19401 19099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62330 19417 19785 gene locus_tag LOCUS_62340 19417 19785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62340 20082 21416 gene locus_tag LOCUS_62350 20082 21416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62350 24480 21667 gene locus_tag LOCUS_62360 24480 21667 CDS product SpoIIE family protein phosphatase/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186009676.1 protein_id gnl|my_center|LOCUS_62360 24733 24488 gene locus_tag LOCUS_62370 24733 24488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62370 24855 25409 gene locus_tag LOCUS_62380 24855 25409 CDS product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972606.1 protein_id gnl|my_center|LOCUS_62380 25676 25455 gene locus_tag LOCUS_62390 25676 25455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62390 26014 25676 gene locus_tag LOCUS_62400 26014 25676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_62400 26187 26035 gene locus_tag LOCUS_62410 26187 26035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62410 26342 27094 gene locus_tag LOCUS_62420 26342 27094 CDS product DUF4142 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027588.1 protein_id gnl|my_center|LOCUS_62420 27325 29133 gene locus_tag LOCUS_62430 27325 29133 CDS product copper resistance protein CopC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029406.1 protein_id gnl|my_center|LOCUS_62430 29359 31047 gene locus_tag LOCUS_62440 29359 31047 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189745032.1 protein_id gnl|my_center|LOCUS_62440 31651 31142 gene locus_tag LOCUS_62450 31651 31142 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487439.1 protein_id gnl|my_center|LOCUS_62450 31739 32245 gene locus_tag LOCUS_62460 31739 32245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62460 32898 33104 gene locus_tag LOCUS_62470 32898 33104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62470 33101 33253 gene locus_tag LOCUS_62480 33101 33253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62480 34036 33332 gene locus_tag LOCUS_62490 34036 33332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62490 34415 35242 gene locus_tag LOCUS_62500 34415 35242 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028597.1 protein_id gnl|my_center|LOCUS_62500 35896 35390 gene locus_tag LOCUS_62510 35896 35390 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084105.1 protein_id gnl|my_center|LOCUS_62510 36070 36936 gene locus_tag LOCUS_62520 gene lgt 36070 36936 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971316.1 protein_id gnl|my_center|LOCUS_62520 38995 37511 gene locus_tag LOCUS_62530 38995 37511 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257475.1 protein_id gnl|my_center|LOCUS_62530 39639 39064 gene locus_tag LOCUS_62540 39639 39064 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027252.1 protein_id gnl|my_center|LOCUS_62540 40513 39764 gene locus_tag LOCUS_62550 40513 39764 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027251.1 protein_id gnl|my_center|LOCUS_62550 40875 40510 gene locus_tag LOCUS_62560 40875 40510 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897834.1 protein_id gnl|my_center|LOCUS_62560 41465 42838 gene locus_tag LOCUS_62570 41465 42838 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896784.1 protein_id gnl|my_center|LOCUS_62570 43206 43493 gene locus_tag LOCUS_62580 43206 43493 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978241.1 protein_id gnl|my_center|LOCUS_62580 45593 43512 gene locus_tag LOCUS_62590 45593 43512 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484486.1 protein_id gnl|my_center|LOCUS_62590 46208 45846 gene locus_tag LOCUS_62600 46208 45846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62600 46304 46984 gene locus_tag LOCUS_62610 46304 46984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62610 47413 49575 gene locus_tag LOCUS_62620 47413 49575 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487058.1 protein_id gnl|my_center|LOCUS_62620 49662 49695 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 50277 50732 gene locus_tag LOCUS_62630 50277 50732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62630 51792 51229 gene locus_tag LOCUS_62640 51792 51229 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226963.1 protein_id gnl|my_center|LOCUS_62640 52789 51851 gene locus_tag LOCUS_62650 52789 51851 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226026.1 protein_id gnl|my_center|LOCUS_62650 52903 53208 gene locus_tag LOCUS_62660 52903 53208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62660 54037 53198 gene locus_tag LOCUS_62670 54037 53198 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031675.1 protein_id gnl|my_center|LOCUS_62670 53520 53546 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 54913 54416 gene locus_tag LOCUS_62680 54913 54416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62680 56021 55323 gene locus_tag LOCUS_62690 56021 55323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62690 55911 56237 gene locus_tag LOCUS_62700 55911 56237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62700 56486 57364 gene locus_tag LOCUS_62710 56486 57364 CDS product ketopantoate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189804125.1 protein_id gnl|my_center|LOCUS_62710 57364 58314 gene locus_tag LOCUS_62720 57364 58314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62720 58625 59602 gene locus_tag LOCUS_62730 58625 59602 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223629.1 protein_id gnl|my_center|LOCUS_62730 59993 60020 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 60076 60222 gene locus_tag LOCUS_62740 60076 60222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62740 60219 60965 gene locus_tag LOCUS_62750 60219 60965 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030862601.1 protein_id gnl|my_center|LOCUS_62750 62438 61179 gene locus_tag LOCUS_62760 62438 61179 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228776.1 protein_id gnl|my_center|LOCUS_62760 61973 61999 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 62486 63910 gene locus_tag LOCUS_62770 62486 63910 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034283916.1 protein_id gnl|my_center|LOCUS_62770 64330 64360 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 65830 64655 gene locus_tag LOCUS_62780 65830 64655 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226268.1 protein_id gnl|my_center|LOCUS_62780 65556 65582 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 66351 66554 gene locus_tag LOCUS_62790 66351 66554 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973099.1 protein_id gnl|my_center|LOCUS_62790 66787 68268 gene locus_tag LOCUS_62800 66787 68268 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973100.1 protein_id gnl|my_center|LOCUS_62800 68313 68612 gene locus_tag LOCUS_62810 68313 68612 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029815.1 protein_id gnl|my_center|LOCUS_62810 69496 69846 gene locus_tag LOCUS_62820 69496 69846 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974275.1 protein_id gnl|my_center|LOCUS_62820 69982 70677 gene locus_tag LOCUS_62830 69982 70677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62830 70959 71441 gene locus_tag LOCUS_62840 70959 71441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62840 72774 71512 gene locus_tag LOCUS_62850 72774 71512 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029167.1 protein_id gnl|my_center|LOCUS_62850 73583 72774 gene locus_tag LOCUS_62860 73583 72774 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975248.1 protein_id gnl|my_center|LOCUS_62860 73947 73747 gene locus_tag LOCUS_62870 73947 73747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62870 73886 74107 gene locus_tag LOCUS_62880 73886 74107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62880 74674 74705 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 74879 75598 gene locus_tag LOCUS_62890 74879 75598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62890 76267 75887 gene locus_tag LOCUS_62900 76267 75887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62900 76417 77367 gene locus_tag LOCUS_62910 76417 77367 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026972.1 protein_id gnl|my_center|LOCUS_62910 77758 77360 gene locus_tag LOCUS_62920 77758 77360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62920 78843 77755 gene locus_tag LOCUS_62930 78843 77755 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031881.1 protein_id gnl|my_center|LOCUS_62930 80426 78837 gene locus_tag LOCUS_62940 80426 78837 CDS product PP2C family protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191850187.1 protein_id gnl|my_center|LOCUS_62940 81287 80688 gene locus_tag LOCUS_62950 81287 80688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62950 82369 81716 gene locus_tag LOCUS_62960 82369 81716 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870827.1 protein_id gnl|my_center|LOCUS_62960 83331 82471 gene locus_tag LOCUS_62970 83331 82471 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978333.1 protein_id gnl|my_center|LOCUS_62970 83627 85048 gene locus_tag LOCUS_62980 83627 85048 CDS product cellulose binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027188.1 protein_id gnl|my_center|LOCUS_62980 86475 85216 gene locus_tag LOCUS_62990 86475 85216 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973241.1 protein_id gnl|my_center|LOCUS_62990 86967 86482 gene locus_tag LOCUS_63000 86967 86482 CDS product TrkA C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973240.1 protein_id gnl|my_center|LOCUS_63000 87172 88371 gene locus_tag LOCUS_63010 87172 88371 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026891.1 protein_id gnl|my_center|LOCUS_63010 88382 89317 gene locus_tag LOCUS_63020 88382 89317 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162495068.1 protein_id gnl|my_center|LOCUS_63020 89934 89377 gene locus_tag LOCUS_63030 89934 89377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63030 91112 90075 gene locus_tag LOCUS_63040 91112 90075 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029688.1 protein_id gnl|my_center|LOCUS_63040 91184 91648 gene locus_tag LOCUS_63050 91184 91648 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974464.1 protein_id gnl|my_center|LOCUS_63050 91268 91290 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 92573 91737 gene locus_tag LOCUS_63060 92573 91737 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223953.1 protein_id gnl|my_center|LOCUS_63060 92670 93236 gene locus_tag LOCUS_63070 92670 93236 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486482.1 protein_id gnl|my_center|LOCUS_63070 93864 93319 gene locus_tag LOCUS_63080 93864 93319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63080 94638 94081 gene locus_tag LOCUS_63090 94638 94081 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031866.1 protein_id gnl|my_center|LOCUS_63090 94731 95234 gene locus_tag LOCUS_63100 94731 95234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63100 95581 95195 gene locus_tag LOCUS_63110 95581 95195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63110 97041 95611 gene locus_tag LOCUS_63120 97041 95611 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023175504.1 protein_id gnl|my_center|LOCUS_63120 96585 96608 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 97116 98012 gene locus_tag LOCUS_63130 97116 98012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162495146.1 protein_id gnl|my_center|LOCUS_63130 98662 98051 gene locus_tag LOCUS_63140 98662 98051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63140 99437 98676 gene locus_tag LOCUS_63150 99437 98676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63150 100102 99872 gene locus_tag LOCUS_63160 100102 99872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63160 100011 100709 gene locus_tag LOCUS_63170 100011 100709 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222251.1 protein_id gnl|my_center|LOCUS_63170 100808 101878 gene locus_tag LOCUS_63180 100808 101878 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977567.1 protein_id gnl|my_center|LOCUS_63180 >Feature sequence025 460 2607 gene locus_tag LOCUS_63190 460 2607 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027807.1 protein_id gnl|my_center|LOCUS_63190 3299 2757 gene locus_tag LOCUS_63200 3299 2757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027806.1 protein_id gnl|my_center|LOCUS_63200 3466 4458 gene locus_tag LOCUS_63210 gene fmt 3466 4458 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027805.1 protein_id gnl|my_center|LOCUS_63210 4629 6047 gene locus_tag LOCUS_63220 4629 6047 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977354.1 protein_id gnl|my_center|LOCUS_63220 7575 6028 gene locus_tag LOCUS_63230 7575 6028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63230 7774 8460 gene locus_tag LOCUS_63240 gene rpe 7774 8460 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977361.1 protein_id gnl|my_center|LOCUS_63240 8599 9582 gene locus_tag LOCUS_63250 8599 9582 CDS product sugar-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977362.1 protein_id gnl|my_center|LOCUS_63250 9866 11308 gene locus_tag LOCUS_63260 9866 11308 CDS product GuaB1 family IMP dehydrogenase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164279790.1 protein_id gnl|my_center|LOCUS_63260 11605 13104 gene locus_tag LOCUS_63270 11605 13104 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027796.1 protein_id gnl|my_center|LOCUS_63270 13115 13567 gene locus_tag LOCUS_63280 13115 13567 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977367.1 protein_id gnl|my_center|LOCUS_63280 13747 16194 gene locus_tag LOCUS_63290 13747 16194 CDS product nitrate- and nitrite sensing domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027618.1 protein_id gnl|my_center|LOCUS_63290 16181 16639 gene locus_tag LOCUS_63300 16181 16639 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977676.1 protein_id gnl|my_center|LOCUS_63300 16647 17030 gene locus_tag LOCUS_63310 16647 17030 CDS product DUF742 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977426.1 protein_id gnl|my_center|LOCUS_63310 17202 17225 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 17368 18156 gene locus_tag LOCUS_63320 17368 18156 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027793.1 protein_id gnl|my_center|LOCUS_63320 18620 18641 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 18777 19934 gene locus_tag LOCUS_63330 18777 19934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_63330 20890 19961 gene locus_tag LOCUS_63340 20890 19961 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977372.1 protein_id gnl|my_center|LOCUS_63340 21649 20927 gene locus_tag LOCUS_63350 21649 20927 CDS product DUF5995 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977373.1 protein_id gnl|my_center|LOCUS_63350 23134 21734 gene locus_tag LOCUS_63360 23134 21734 CDS product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977375.1 protein_id gnl|my_center|LOCUS_63360 23330 23788 gene locus_tag LOCUS_63370 23330 23788 CDS product hotdog domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977376.1 protein_id gnl|my_center|LOCUS_63370 24959 23748 gene locus_tag LOCUS_63380 24959 23748 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977377.1 protein_id gnl|my_center|LOCUS_63380 25143 26366 gene locus_tag LOCUS_63390 25143 26366 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977378.1 protein_id gnl|my_center|LOCUS_63390 27309 26476 gene locus_tag LOCUS_63400 27309 26476 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027790.1 protein_id gnl|my_center|LOCUS_63400 27836 28444 gene locus_tag LOCUS_63410 27836 28444 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977382.1 protein_id gnl|my_center|LOCUS_63410 28441 29085 gene locus_tag LOCUS_63420 28441 29085 CDS product nicotinamide mononucleotide transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977383.1 protein_id gnl|my_center|LOCUS_63420 29082 30371 gene locus_tag LOCUS_63430 29082 30371 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977384.1 protein_id gnl|my_center|LOCUS_63430 30395 30880 gene locus_tag LOCUS_63440 gene ribH 30395 30880 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977385.1 protein_id gnl|my_center|LOCUS_63440 30915 31187 gene locus_tag LOCUS_63450 30915 31187 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027788.1 protein_id gnl|my_center|LOCUS_63450 31238 32086 gene locus_tag LOCUS_63460 gene hisG 31238 32086 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977387.1 protein_id gnl|my_center|LOCUS_63460 32100 32576 gene locus_tag LOCUS_63470 32100 32576 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977388.1 protein_id gnl|my_center|LOCUS_63470 32856 34202 gene locus_tag LOCUS_63480 32856 34202 CDS product CNNM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977389.1 protein_id gnl|my_center|LOCUS_63480 34199 35284 gene locus_tag LOCUS_63490 34199 35284 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977390.1 protein_id gnl|my_center|LOCUS_63490 37205 35325 gene locus_tag LOCUS_63500 37205 35325 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027787.1 protein_id gnl|my_center|LOCUS_63500 38309 37704 gene locus_tag LOCUS_63510 38309 37704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63510 37836 37860 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 38585 39541 gene locus_tag LOCUS_63520 38585 39541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972141.1 protein_id gnl|my_center|LOCUS_63520 39550 39572 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 39614 41173 gene locus_tag LOCUS_63530 39614 41173 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230797.1 protein_id gnl|my_center|LOCUS_63530 41509 42867 gene locus_tag LOCUS_63540 41509 42867 CDS product peptidase C39 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162495115.1 protein_id gnl|my_center|LOCUS_63540 43255 43288 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 43343 43723 gene locus_tag LOCUS_63550 43343 43723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_63550 43922 45124 gene locus_tag LOCUS_63560 43922 45124 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027782.1 protein_id gnl|my_center|LOCUS_63560 45338 45087 gene locus_tag LOCUS_63570 45338 45087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027781.1 protein_id gnl|my_center|LOCUS_63570 46139 45705 gene locus_tag LOCUS_63580 46139 45705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977399.1 protein_id gnl|my_center|LOCUS_63580 46338 46778 gene locus_tag LOCUS_63590 46338 46778 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019983923.1 protein_id gnl|my_center|LOCUS_63590 47447 48487 gene locus_tag LOCUS_63600 47447 48487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_63600 47633 47663 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 49043 49843 gene locus_tag LOCUS_63610 49043 49843 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027779.1 protein_id gnl|my_center|LOCUS_63610 49885 50451 gene locus_tag LOCUS_63620 49885 50451 CDS product FxsA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977403.1 protein_id gnl|my_center|LOCUS_63620 50923 50549 gene locus_tag LOCUS_63630 50923 50549 CDS product RNA polymerase-binding protein RbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977404.1 protein_id gnl|my_center|LOCUS_63630 52549 51203 gene locus_tag LOCUS_63640 52549 51203 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027778.1 protein_id gnl|my_center|LOCUS_63640 53376 52609 gene locus_tag LOCUS_63650 53376 52609 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977406.1 protein_id gnl|my_center|LOCUS_63650 54026 53373 gene locus_tag LOCUS_63660 54026 53373 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027777.1 protein_id gnl|my_center|LOCUS_63660 54126 55625 gene locus_tag LOCUS_63670 54126 55625 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977408.1 protein_id gnl|my_center|LOCUS_63670 57225 55645 gene locus_tag LOCUS_63680 57225 55645 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027776.1 protein_id gnl|my_center|LOCUS_63680 57463 57269 gene locus_tag LOCUS_63690 57463 57269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977410.1 protein_id gnl|my_center|LOCUS_63690 57790 58182 gene locus_tag LOCUS_63700 57790 58182 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325767.1 protein_id gnl|my_center|LOCUS_63700 58507 59379 gene locus_tag LOCUS_63710 58507 59379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_63710 59212 59234 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 59412 59948 gene locus_tag LOCUS_63720 59412 59948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_63720 60107 61234 gene locus_tag LOCUS_63730 60107 61234 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742121.1 protein_id gnl|my_center|LOCUS_63730 61231 62445 gene locus_tag LOCUS_63740 61231 62445 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222448.1 protein_id gnl|my_center|LOCUS_63740 63448 62546 gene locus_tag LOCUS_63750 63448 62546 CDS product biotin-dependent carboxyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046421936.1 protein_id gnl|my_center|LOCUS_63750 62784 62816 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 64071 63445 gene locus_tag LOCUS_63760 64071 63445 CDS product allophanate hydrolase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027119.1 protein_id gnl|my_center|LOCUS_63760 64826 64068 gene locus_tag LOCUS_63770 64826 64068 CDS product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027118.1 protein_id gnl|my_center|LOCUS_63770 65779 64847 gene locus_tag LOCUS_63780 65779 64847 CDS product putative hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027775.1 protein_id gnl|my_center|LOCUS_63780 67101 65776 gene locus_tag LOCUS_63790 67101 65776 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027774.1 protein_id gnl|my_center|LOCUS_63790 67233 67928 gene locus_tag LOCUS_63800 67233 67928 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027773.1 protein_id gnl|my_center|LOCUS_63800 68070 68132 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 68174 69724 gene locus_tag LOCUS_63810 68174 69724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977417.1 protein_id gnl|my_center|LOCUS_63810 69573 69596 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 69795 70685 gene locus_tag LOCUS_63820 69795 70685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027772.1 protein_id gnl|my_center|LOCUS_63820 70735 75537 gene locus_tag LOCUS_63830 70735 75537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63830 75877 75521 gene locus_tag LOCUS_63840 75877 75521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63840 76430 75963 gene locus_tag LOCUS_63850 76430 75963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027767.1 protein_id gnl|my_center|LOCUS_63850 76812 79802 gene locus_tag LOCUS_63860 76812 79802 CDS product nitrate- and nitrite sensing domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027766.1 protein_id gnl|my_center|LOCUS_63860 79799 80233 gene locus_tag LOCUS_63870 79799 80233 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977425.1 protein_id gnl|my_center|LOCUS_63870 80243 80638 gene locus_tag LOCUS_63880 80243 80638 CDS product DUF742 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977426.1 protein_id gnl|my_center|LOCUS_63880 80663 84325 gene locus_tag LOCUS_63890 80663 84325 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899883.1 protein_id gnl|my_center|LOCUS_63890 82797 82820 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 84306 84911 gene locus_tag LOCUS_63900 84306 84911 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977427.1 protein_id gnl|my_center|LOCUS_63900 86541 85021 gene locus_tag LOCUS_63910 gene glpK 86541 85021 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977165.1 protein_id gnl|my_center|LOCUS_63910 88095 86905 gene locus_tag LOCUS_63920 88095 86905 CDS product lipid-transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057979.1 protein_id gnl|my_center|LOCUS_63920 88573 88112 gene locus_tag LOCUS_63930 88573 88112 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189804300.1 protein_id gnl|my_center|LOCUS_63930 88632 89315 gene locus_tag LOCUS_63940 88632 89315 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977430.1 protein_id gnl|my_center|LOCUS_63940 91687 89306 gene locus_tag LOCUS_63950 91687 89306 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027761.1 protein_id gnl|my_center|LOCUS_63950 91901 93868 gene locus_tag LOCUS_63960 91901 93868 CDS product acetoacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027760.1 protein_id gnl|my_center|LOCUS_63960 95197 93878 gene locus_tag LOCUS_63970 95197 93878 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027746.1 protein_id gnl|my_center|LOCUS_63970 95310 96521 gene locus_tag LOCUS_63980 95310 96521 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225085.1 protein_id gnl|my_center|LOCUS_63980 96525 97436 gene locus_tag LOCUS_63990 96525 97436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977433.1 protein_id gnl|my_center|LOCUS_63990 99188 97518 gene locus_tag LOCUS_64000 gene ptsP 99188 97518 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977434.1 protein_id gnl|my_center|LOCUS_64000 99715 99266 gene locus_tag LOCUS_64010 99715 99266 CDS product PTS glucose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977435.1 protein_id gnl|my_center|LOCUS_64010 >Feature sequence026 2874 1264 gene locus_tag LOCUS_64020 gene lbuL 2874 1264 CDS product linear/branched/unsaturated fatty acid:CoA ligase LbuL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030732.1 protein_id gnl|my_center|LOCUS_64020 4544 2871 gene locus_tag LOCUS_64030 gene ibuL 4544 2871 CDS product isobutyrate:CoA ligase IbuL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030731.1 protein_id gnl|my_center|LOCUS_64030 4669 5589 gene locus_tag LOCUS_64040 4669 5589 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030730.1 protein_id gnl|my_center|LOCUS_64040 5777 8218 gene locus_tag LOCUS_64050 5777 8218 CDS product cbb3-type cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776827.1 protein_id gnl|my_center|LOCUS_64050 5872 5901 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8215 8589 gene locus_tag LOCUS_64060 8215 8589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64060 8685 9467 gene locus_tag LOCUS_64070 8685 9467 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929996.1 protein_id gnl|my_center|LOCUS_64070 9844 9527 gene locus_tag LOCUS_64080 9844 9527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64080 10143 12923 gene locus_tag LOCUS_64090 10143 12923 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030729.1 protein_id gnl|my_center|LOCUS_64090 13211 14002 gene locus_tag LOCUS_64100 13211 14002 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223943.1 protein_id gnl|my_center|LOCUS_64100 15221 14085 gene locus_tag LOCUS_64110 15221 14085 CDS product winged helix DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030728.1 protein_id gnl|my_center|LOCUS_64110 15723 15298 gene locus_tag LOCUS_64120 15723 15298 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027424.1 protein_id gnl|my_center|LOCUS_64120 16297 15749 gene locus_tag LOCUS_64130 16297 15749 CDS product TIGR03668 family PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226497.1 protein_id gnl|my_center|LOCUS_64130 16435 17175 gene locus_tag LOCUS_64140 16435 17175 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005062896.1 protein_id gnl|my_center|LOCUS_64140 17217 18176 gene locus_tag LOCUS_64150 17217 18176 CDS product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030727.1 protein_id gnl|my_center|LOCUS_64150 18256 18573 gene locus_tag LOCUS_64160 18256 18573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64160 19598 18702 gene locus_tag LOCUS_64170 19598 18702 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030726.1 protein_id gnl|my_center|LOCUS_64170 20473 19595 gene locus_tag LOCUS_64180 20473 19595 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030725.1 protein_id gnl|my_center|LOCUS_64180 21541 20534 gene locus_tag LOCUS_64190 21541 20534 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162483893.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_64190 23319 21916 gene locus_tag LOCUS_64200 gene rfaE2 23319 21916 CDS product D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270276.1 protein_id gnl|my_center|LOCUS_64200 23905 23321 gene locus_tag LOCUS_64210 23905 23321 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030722.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_64210 25189 23963 gene locus_tag LOCUS_64220 25189 23963 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030721.1 protein_id gnl|my_center|LOCUS_64220 26139 25186 gene locus_tag LOCUS_64230 26139 25186 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030720.1 protein_id gnl|my_center|LOCUS_64230 27122 26136 gene locus_tag LOCUS_64240 27122 26136 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030719.1 protein_id gnl|my_center|LOCUS_64240 27748 27119 gene locus_tag LOCUS_64250 27748 27119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_64250 28791 27745 gene locus_tag LOCUS_64260 28791 27745 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030717.1 protein_id gnl|my_center|LOCUS_64260 28313 28342 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 30425 28788 gene locus_tag LOCUS_64270 30425 28788 CDS product carbamoyltransferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226120.1 protein_id gnl|my_center|LOCUS_64270 31628 30666 gene locus_tag LOCUS_64280 31628 30666 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030715.1 protein_id gnl|my_center|LOCUS_64280 31798 32601 gene locus_tag LOCUS_64290 31798 32601 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162495273.1 protein_id gnl|my_center|LOCUS_64290 32602 32630 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 32704 33144 gene locus_tag LOCUS_64300 32704 33144 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030713.1 protein_id gnl|my_center|LOCUS_64300 33331 33642 gene locus_tag LOCUS_64310 33331 33642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64310 33639 35588 gene locus_tag LOCUS_64320 gene feoB 33639 35588 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640041.1 protein_id gnl|my_center|LOCUS_64320 35596 36132 gene locus_tag LOCUS_64330 35596 36132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64330 36700 36200 gene locus_tag LOCUS_64340 36700 36200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64340 37599 36769 gene locus_tag LOCUS_64350 37599 36769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64350 38183 38773 gene locus_tag LOCUS_64360 38183 38773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64360 38770 39690 gene locus_tag LOCUS_64370 gene cysK 38770 39690 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257225.1 protein_id gnl|my_center|LOCUS_64370 40600 39683 gene locus_tag LOCUS_64380 40600 39683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64380 40654 40980 gene locus_tag LOCUS_64390 40654 40980 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808563.1 protein_id gnl|my_center|LOCUS_64390 42186 40984 gene locus_tag LOCUS_64400 42186 40984 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030710.1 protein_id gnl|my_center|LOCUS_64400 42086 42115 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 43703 42246 gene locus_tag LOCUS_64410 43703 42246 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030709.1 protein_id gnl|my_center|LOCUS_64410 46289 43866 gene locus_tag LOCUS_64420 46289 43866 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030708.1 protein_id gnl|my_center|LOCUS_64420 46900 46292 gene locus_tag LOCUS_64430 46900 46292 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030707.1 protein_id gnl|my_center|LOCUS_64430 47823 46900 gene locus_tag LOCUS_64440 47823 46900 CDS product FAD binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030706.1 protein_id gnl|my_center|LOCUS_64440 47698 47727 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 48063 49835 gene locus_tag LOCUS_64450 48063 49835 CDS product PucR family transcriptional regulator ligand-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030705.1 protein_id gnl|my_center|LOCUS_64450 48100 48123 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 49946 50752 gene locus_tag LOCUS_64460 49946 50752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972756.1 protein_id gnl|my_center|LOCUS_64460 50902 51411 gene locus_tag LOCUS_64470 50902 51411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225541.1 protein_id gnl|my_center|LOCUS_64470 52826 51948 gene locus_tag LOCUS_64480 52826 51948 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030697.1 protein_id gnl|my_center|LOCUS_64480 52992 53825 gene locus_tag LOCUS_64490 52992 53825 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030696.1 protein_id gnl|my_center|LOCUS_64490 54107 55144 gene locus_tag LOCUS_64500 54107 55144 CDS product DUF2637 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030695.1 protein_id gnl|my_center|LOCUS_64500 55687 55229 gene locus_tag LOCUS_64510 55687 55229 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030865215.1 protein_id gnl|my_center|LOCUS_64510 57830 56088 gene locus_tag LOCUS_64520 57830 56088 CDS product pyruvate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030693.1 protein_id gnl|my_center|LOCUS_64520 59069 57948 gene locus_tag LOCUS_64530 59069 57948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_64530 58984 59586 gene locus_tag LOCUS_64540 58984 59586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64540 59969 59994 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 60045 61037 gene locus_tag LOCUS_64550 60045 61037 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030691.1 protein_id gnl|my_center|LOCUS_64550 60216 60146 gene locus_tag LOCUS_t00750 60216 60146 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 62377 60995 gene locus_tag LOCUS_64560 62377 60995 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227054.1 protein_id gnl|my_center|LOCUS_64560 63051 62611 gene locus_tag LOCUS_64570 63051 62611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_64570 62623 62645 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 64415 63048 gene locus_tag LOCUS_64580 64415 63048 CDS product AlkA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030688.1 protein_id gnl|my_center|LOCUS_64580 65792 64683 gene locus_tag LOCUS_64590 gene rsgA 65792 64683 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030687.1 protein_id gnl|my_center|LOCUS_64590 68872 66188 gene locus_tag LOCUS_64600 gene ppdK 68872 66188 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026926.1 protein_id gnl|my_center|LOCUS_64600 69790 68888 gene locus_tag LOCUS_64610 69790 68888 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978666.1 protein_id gnl|my_center|LOCUS_64610 70756 69977 gene locus_tag LOCUS_64620 gene narI 70756 69977 CDS product respiratory nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730339.1 protein_id gnl|my_center|LOCUS_64620 71430 70753 gene locus_tag LOCUS_64630 71430 70753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64630 73133 71427 gene locus_tag LOCUS_64640 gene narH 73133 71427 CDS product nitrate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730341.1 protein_id gnl|my_center|LOCUS_64640 76894 73133 gene locus_tag LOCUS_64650 76894 73133 CDS product nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972444.1 protein_id gnl|my_center|LOCUS_64650 77593 77132 gene locus_tag LOCUS_64660 77593 77132 CDS product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978655.1 protein_id gnl|my_center|LOCUS_64660 78881 77655 gene locus_tag LOCUS_64670 78881 77655 CDS product NarK/NasA family nitrate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026930.1 protein_id gnl|my_center|LOCUS_64670 79249 79671 gene locus_tag LOCUS_64680 79249 79671 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978653.1 protein_id gnl|my_center|LOCUS_64680 80717 79689 gene locus_tag LOCUS_64690 80717 79689 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026931.1 protein_id gnl|my_center|LOCUS_64690 81366 80923 gene locus_tag LOCUS_64700 81366 80923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64700 84044 81366 gene locus_tag LOCUS_64710 84044 81366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64710 85312 84041 gene locus_tag LOCUS_64720 85312 84041 CDS product TIGR04053 family radical SAM/SPASM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879900.1 protein_id gnl|my_center|LOCUS_64720 85665 86357 gene locus_tag LOCUS_64730 85665 86357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_64730 86287 86309 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 86318 89386 gene locus_tag LOCUS_64740 86318 89386 CDS product nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026932.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_64740 89388 90923 gene locus_tag LOCUS_64750 gene narH 89388 90923 CDS product nitrate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026933.1 protein_id gnl|my_center|LOCUS_64750 90920 91699 gene locus_tag LOCUS_64760 gene narJ 90920 91699 CDS product nitrate reductase molybdenum cofactor assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026934.1 protein_id gnl|my_center|LOCUS_64760 91696 92445 gene locus_tag LOCUS_64770 gene narI 91696 92445 CDS product respiratory nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026935.1 protein_id gnl|my_center|LOCUS_64770 92442 93047 gene locus_tag LOCUS_64780 92442 93047 CDS product vitamin K epoxide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728325.1 protein_id gnl|my_center|LOCUS_64780 93177 94079 gene locus_tag LOCUS_64790 93177 94079 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730463.1 protein_id gnl|my_center|LOCUS_64790 94102 94434 gene locus_tag LOCUS_64800 94102 94434 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256234.1 protein_id gnl|my_center|LOCUS_64800 95728 94523 gene locus_tag LOCUS_64810 95728 94523 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971715.1 protein_id gnl|my_center|LOCUS_64810 96944 95922 gene locus_tag LOCUS_64820 96944 95922 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026893.1 protein_id gnl|my_center|LOCUS_64820 >Feature sequence027 573 1856 gene locus_tag LOCUS_64830 573 1856 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973528.1 protein_id gnl|my_center|LOCUS_64830 1921 3303 gene locus_tag LOCUS_64840 1921 3303 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030269.1 protein_id gnl|my_center|LOCUS_64840 3418 4278 gene locus_tag LOCUS_64850 gene fdhD 3418 4278 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031006.1 protein_id gnl|my_center|LOCUS_64850 4275 5633 gene locus_tag LOCUS_64860 gene mshA 4275 5633 CDS product D-inositol-3-phosphate glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326818.1 protein_id gnl|my_center|LOCUS_64860 5630 7081 gene locus_tag LOCUS_64870 5630 7081 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225315.1 protein_id gnl|my_center|LOCUS_64870 7078 8085 gene locus_tag LOCUS_64880 7078 8085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225316.1 protein_id gnl|my_center|LOCUS_64880 8082 9194 gene locus_tag LOCUS_64890 gene menC 8082 9194 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225317.1 protein_id gnl|my_center|LOCUS_64890 9353 11080 gene locus_tag LOCUS_64900 9353 11080 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226313.1 protein_id gnl|my_center|LOCUS_64900 14680 11141 gene locus_tag LOCUS_64910 14680 11141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64910 16603 14738 gene locus_tag LOCUS_64920 16603 14738 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388350.1 protein_id gnl|my_center|LOCUS_64920 17087 16836 gene locus_tag LOCUS_64930 17087 16836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_64930 17782 17105 gene locus_tag LOCUS_64940 17782 17105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_64940 17108 17133 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 18729 17779 gene locus_tag LOCUS_64950 18729 17779 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972807.1 protein_id gnl|my_center|LOCUS_64950 20933 18726 gene locus_tag LOCUS_64960 20933 18726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64960 21054 21974 gene locus_tag LOCUS_64970 21054 21974 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971613.1 protein_id gnl|my_center|LOCUS_64970 21992 23167 gene locus_tag LOCUS_64980 21992 23167 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031728.1 protein_id gnl|my_center|LOCUS_64980 23263 23961 gene locus_tag LOCUS_64990 23263 23961 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971612.1 protein_id gnl|my_center|LOCUS_64990 23958 24923 gene locus_tag LOCUS_65000 23958 24923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_65000 24835 25464 gene locus_tag LOCUS_65010 24835 25464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_65010 25461 25982 gene locus_tag LOCUS_65020 25461 25982 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031730.1 protein_id gnl|my_center|LOCUS_65020 27460 26060 gene locus_tag LOCUS_65030 27460 26060 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225318.1 protein_id gnl|my_center|LOCUS_65030 28654 27641 gene locus_tag LOCUS_65040 28654 27641 CDS product PD40 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227740.1 protein_id gnl|my_center|LOCUS_65040 28535 28561 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 30039 28651 gene locus_tag LOCUS_65050 30039 28651 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223772.1 protein_id gnl|my_center|LOCUS_65050 32160 30052 gene locus_tag LOCUS_65060 32160 30052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65060 35466 32647 gene locus_tag LOCUS_65070 35466 32647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65070 32914 32940 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 35783 36853 gene locus_tag LOCUS_65080 35783 36853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65080 38248 36914 gene locus_tag LOCUS_65090 38248 36914 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028932.1 protein_id gnl|my_center|LOCUS_65090 38993 38250 gene locus_tag LOCUS_65100 gene cseB 38993 38250 CDS product two-component system response regulator CseB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975477.1 protein_id gnl|my_center|LOCUS_65100 40204 39170 gene locus_tag LOCUS_65110 40204 39170 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226238.1 protein_id gnl|my_center|LOCUS_65110 41115 40201 gene locus_tag LOCUS_65120 41115 40201 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226237.1 protein_id gnl|my_center|LOCUS_65120 40957 40983 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 43679 41412 gene locus_tag LOCUS_65130 43679 41412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65130 44122 44802 gene locus_tag LOCUS_65140 44122 44802 CDS product DUF4232 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109034961.1 protein_id gnl|my_center|LOCUS_65140 45448 45170 gene locus_tag LOCUS_65150 45448 45170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65150 45506 45527 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 46398 45853 gene locus_tag LOCUS_65160 46398 45853 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975857.1 protein_id gnl|my_center|LOCUS_65160 47401 46577 gene locus_tag LOCUS_65170 47401 46577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65170 48238 47447 gene locus_tag LOCUS_65180 48238 47447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65180 48411 49019 gene locus_tag LOCUS_65190 48411 49019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65190 49016 49285 gene locus_tag LOCUS_65200 49016 49285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65200 49378 49689 gene locus_tag LOCUS_65210 49378 49689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65210 49707 50465 gene locus_tag LOCUS_65220 49707 50465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066466137.1 protein_id gnl|my_center|LOCUS_65220 50467 51795 gene locus_tag LOCUS_65230 50467 51795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65230 51957 53450 gene locus_tag LOCUS_65240 51957 53450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068083.1 protein_id gnl|my_center|LOCUS_65240 53447 55051 gene locus_tag LOCUS_65250 53447 55051 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080790597.1 protein_id gnl|my_center|LOCUS_65250 55039 56841 gene locus_tag LOCUS_65260 55039 56841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65260 57509 57117 gene locus_tag LOCUS_65270 57509 57117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65270 59241 57784 gene locus_tag LOCUS_65280 59241 57784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65280 59396 59794 gene locus_tag LOCUS_65290 59396 59794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65290 59919 61013 gene locus_tag LOCUS_65300 59919 61013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65300 62955 61240 gene locus_tag LOCUS_65310 62955 61240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_65310 64174 62909 gene locus_tag LOCUS_65320 64174 62909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_65320 63074 63105 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 64628 65722 gene locus_tag LOCUS_65330 64628 65722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65330 65536 65558 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 65653 66186 gene locus_tag LOCUS_65340 65653 66186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65340 66597 66391 gene locus_tag LOCUS_65350 66597 66391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65350 66647 66850 gene locus_tag LOCUS_65360 66647 66850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65360 68181 66781 gene locus_tag LOCUS_65370 68181 66781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65370 68641 68240 gene locus_tag LOCUS_65380 68641 68240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65380 69185 68988 gene locus_tag LOCUS_65390 69185 68988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65390 69215 71134 gene locus_tag LOCUS_65400 69215 71134 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031484.1 protein_id gnl|my_center|LOCUS_65400 71268 72002 gene locus_tag LOCUS_65410 71268 72002 CDS product trypsin-like serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016328090.1 protein_id gnl|my_center|LOCUS_65410 73096 72095 gene locus_tag LOCUS_65420 73096 72095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65420 73449 73694 gene locus_tag LOCUS_65430 73449 73694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65430 73915 74343 gene locus_tag LOCUS_65440 73915 74343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65440 74545 74976 gene locus_tag LOCUS_65450 74545 74976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65450 74988 75254 gene locus_tag LOCUS_65460 74988 75254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65460 >Feature sequence028 545 784 gene locus_tag LOCUS_65470 545 784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65470 781 1113 gene locus_tag LOCUS_65480 781 1113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65480 1879 2199 gene locus_tag LOCUS_65490 1879 2199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038535289.1 protein_id gnl|my_center|LOCUS_65490 2752 2327 gene locus_tag LOCUS_65500 2752 2327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65500 3648 2836 gene locus_tag LOCUS_65510 3648 2836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65510 4048 5298 gene locus_tag LOCUS_65520 4048 5298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65520 5677 5438 gene locus_tag LOCUS_65530 5677 5438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65530 8062 6539 gene locus_tag LOCUS_65540 8062 6539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65540 8251 9477 gene locus_tag LOCUS_65550 8251 9477 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224859.1 protein_id gnl|my_center|LOCUS_65550 9745 10230 gene locus_tag LOCUS_65560 9745 10230 CDS product DUF2975 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026883.1 protein_id gnl|my_center|LOCUS_65560 10230 10457 gene locus_tag LOCUS_65570 10230 10457 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978728.1 protein_id gnl|my_center|LOCUS_65570 10582 10752 gene locus_tag LOCUS_65580 10582 10752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972469.1 protein_id gnl|my_center|LOCUS_65580 11337 11358 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12072 11638 gene locus_tag LOCUS_65590 12072 11638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65590 13419 12247 gene locus_tag LOCUS_65600 13419 12247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65600 13714 13511 gene locus_tag LOCUS_65610 13714 13511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65610 15343 13877 gene locus_tag LOCUS_65620 15343 13877 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226774.1 protein_id gnl|my_center|LOCUS_65620 15195 15215 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 16074 15340 gene locus_tag LOCUS_65630 16074 15340 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973245.1 protein_id gnl|my_center|LOCUS_65630 16660 16508 gene locus_tag LOCUS_65640 16660 16508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65640 17101 17445 gene locus_tag LOCUS_65650 17101 17445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65650 18062 17652 gene locus_tag LOCUS_65660 18062 17652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004993226.1 protein_id gnl|my_center|LOCUS_65660 20038 18059 gene locus_tag LOCUS_65670 20038 18059 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030938.1 protein_id gnl|my_center|LOCUS_65670 20147 20545 gene locus_tag LOCUS_65680 20147 20545 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030937.1 protein_id gnl|my_center|LOCUS_65680 20893 23007 gene locus_tag LOCUS_65690 20893 23007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65690 23132 23284 gene locus_tag LOCUS_65700 23132 23284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65700 23908 23417 gene locus_tag LOCUS_65710 23908 23417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_65710 23955 23982 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 25204 24059 gene locus_tag LOCUS_65720 25204 24059 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975538.1 protein_id gnl|my_center|LOCUS_65720 26009 25335 gene locus_tag LOCUS_65730 26009 25335 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545169.1 protein_id gnl|my_center|LOCUS_65730 27976 26426 gene locus_tag LOCUS_65740 27976 26426 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093091.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_65740 28239 28003 gene locus_tag LOCUS_65750 28239 28003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_65750 30153 28717 gene locus_tag LOCUS_65760 30153 28717 CDS product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244055.1 protein_id gnl|my_center|LOCUS_65760 30308 30613 gene locus_tag LOCUS_65770 30308 30613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65770 30930 31373 gene locus_tag LOCUS_65780 30930 31373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65780 31906 31580 gene locus_tag LOCUS_65790 31906 31580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65790 32207 32710 gene locus_tag LOCUS_65800 32207 32710 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189749484.1 protein_id gnl|my_center|LOCUS_65800 32968 33735 gene locus_tag LOCUS_65810 32968 33735 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065921482.1 protein_id gnl|my_center|LOCUS_65810 34846 35052 gene locus_tag LOCUS_65820 34846 35052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65820 35822 35583 gene locus_tag LOCUS_65830 35822 35583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65830 36486 36196 gene locus_tag LOCUS_65840 36486 36196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65840 37159 37665 gene locus_tag LOCUS_65850 37159 37665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65850 37779 37627 gene locus_tag LOCUS_65860 37779 37627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65860 38322 38017 gene locus_tag LOCUS_65870 38322 38017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65870 38657 38397 gene locus_tag LOCUS_65880 38657 38397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65880 40121 39807 gene locus_tag LOCUS_65890 40121 39807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65890 40397 40984 gene locus_tag LOCUS_65900 40397 40984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65900 41829 40906 gene locus_tag LOCUS_65910 41829 40906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65910 42275 41973 gene locus_tag LOCUS_65920 42275 41973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65920 48595 42284 gene locus_tag LOCUS_65930 48595 42284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65930 48998 49019 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 49401 49174 gene locus_tag LOCUS_65940 49401 49174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_65940 49525 49797 gene locus_tag LOCUS_65950 49525 49797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65950 50808 49858 gene locus_tag LOCUS_65960 50808 49858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65960 51598 53415 gene locus_tag LOCUS_65970 51598 53415 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029699.1 protein_id gnl|my_center|LOCUS_65970 54163 54777 gene locus_tag LOCUS_65980 54163 54777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65980 54828 55160 gene locus_tag LOCUS_65990 54828 55160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65990 55160 55381 gene locus_tag LOCUS_66000 55160 55381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66000 55840 56199 gene locus_tag LOCUS_66010 55840 56199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66010 56475 56831 gene locus_tag LOCUS_66020 56475 56831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_66020 56720 57688 gene locus_tag LOCUS_66030 56720 57688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_66030 58000 58248 gene locus_tag LOCUS_66040 58000 58248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_66040 58220 58855 gene locus_tag LOCUS_66050 58220 58855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_66050 59043 58888 gene locus_tag LOCUS_66060 59043 58888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66060 59562 59146 gene locus_tag LOCUS_66070 59562 59146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66070 59881 61950 gene locus_tag LOCUS_66080 59881 61950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66080 61999 62727 gene locus_tag LOCUS_66090 61999 62727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66090 63170 63364 gene locus_tag LOCUS_66100 63170 63364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66100 63439 63777 gene locus_tag LOCUS_66110 63439 63777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_66110 >Feature sequence029 363 584 gene locus_tag LOCUS_66120 363 584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66120 821 627 gene locus_tag LOCUS_66130 821 627 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973854.1 protein_id gnl|my_center|LOCUS_66130 1006 3117 gene locus_tag LOCUS_66140 1006 3117 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030068.1 protein_id gnl|my_center|LOCUS_66140 4295 3246 gene locus_tag LOCUS_66150 4295 3246 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030067.1 protein_id gnl|my_center|LOCUS_66150 5262 4288 gene locus_tag LOCUS_66160 5262 4288 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030066.1 protein_id gnl|my_center|LOCUS_66160 6302 5271 gene locus_tag LOCUS_66170 6302 5271 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973858.1 protein_id gnl|my_center|LOCUS_66170 7218 6295 gene locus_tag LOCUS_66180 7218 6295 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973859.1 protein_id gnl|my_center|LOCUS_66180 8856 7225 gene locus_tag LOCUS_66190 8856 7225 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973860.1 protein_id gnl|my_center|LOCUS_66190 10236 9088 gene locus_tag LOCUS_66200 10236 9088 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030067.1 protein_id gnl|my_center|LOCUS_66200 11290 10229 gene locus_tag LOCUS_66210 11290 10229 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030066.1 protein_id gnl|my_center|LOCUS_66210 12240 11302 gene locus_tag LOCUS_66220 12240 11302 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973858.1 protein_id gnl|my_center|LOCUS_66220 13159 12233 gene locus_tag LOCUS_66230 13159 12233 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419701.1 protein_id gnl|my_center|LOCUS_66230 14964 13312 gene locus_tag LOCUS_66240 14964 13312 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973860.1 protein_id gnl|my_center|LOCUS_66240 13325 13354 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 17475 15568 gene locus_tag LOCUS_66250 gene typA 17475 15568 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973866.1 protein_id gnl|my_center|LOCUS_66250 19901 17655 gene locus_tag LOCUS_66260 19901 17655 CDS product ABC transporter family substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030064.1 protein_id gnl|my_center|LOCUS_66260 20260 20547 gene locus_tag LOCUS_66270 20260 20547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973869.1 protein_id gnl|my_center|LOCUS_66270 20572 21408 gene locus_tag LOCUS_66280 20572 21408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030062.1 protein_id gnl|my_center|LOCUS_66280 21433 23376 gene locus_tag LOCUS_66290 21433 23376 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030061.1 protein_id gnl|my_center|LOCUS_66290 23373 24143 gene locus_tag LOCUS_66300 23373 24143 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973872.1 protein_id gnl|my_center|LOCUS_66300 25328 24171 gene locus_tag LOCUS_66310 25328 24171 CDS product glycoside hydrolase family 18 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030060.1 protein_id gnl|my_center|LOCUS_66310 28005 25393 gene locus_tag LOCUS_66320 28005 25393 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030059.1 protein_id gnl|my_center|LOCUS_66320 28681 28253 gene locus_tag LOCUS_66330 28681 28253 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030058.1 protein_id gnl|my_center|LOCUS_66330 29360 28932 gene locus_tag LOCUS_66340 29360 28932 CDS product (deoxy)nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973876.1 protein_id gnl|my_center|LOCUS_66340 29580 29383 gene locus_tag LOCUS_66350 29580 29383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973877.1 protein_id gnl|my_center|LOCUS_66350 30735 29983 gene locus_tag LOCUS_66360 30735 29983 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973878.1 protein_id gnl|my_center|LOCUS_66360 31040 32146 gene locus_tag LOCUS_66370 31040 32146 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226442.1 protein_id gnl|my_center|LOCUS_66370 32249 34168 gene locus_tag LOCUS_66380 32249 34168 CDS product AarF/UbiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224706.1 protein_id gnl|my_center|LOCUS_66380 35702 34197 gene locus_tag LOCUS_66390 35702 34197 CDS product oligopeptide:H+ symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831502.1 protein_id gnl|my_center|LOCUS_66390 38309 36123 gene locus_tag LOCUS_66400 38309 36123 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229633.1 protein_id gnl|my_center|LOCUS_66400 38901 38416 gene locus_tag LOCUS_66410 38901 38416 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246360.1 protein_id gnl|my_center|LOCUS_66410 39479 38982 gene locus_tag LOCUS_66420 39479 38982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66420 39478 40731 gene locus_tag LOCUS_66430 39478 40731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66430 40728 42305 gene locus_tag LOCUS_66440 40728 42305 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004544143.1 protein_id gnl|my_center|LOCUS_66440 44128 42368 gene locus_tag LOCUS_66450 44128 42368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66450 44958 44128 gene locus_tag LOCUS_66460 44958 44128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66460 44606 44632 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 46409 44988 gene locus_tag LOCUS_66470 46409 44988 CDS product PD40 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093950374.1 protein_id gnl|my_center|LOCUS_66470 47104 46616 gene locus_tag LOCUS_66480 47104 46616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66480 47201 47731 gene locus_tag LOCUS_66490 47201 47731 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049832408.1 protein_id gnl|my_center|LOCUS_66490 48929 47706 gene locus_tag LOCUS_66500 48929 47706 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285235.1 protein_id gnl|my_center|LOCUS_66500 50449 48953 gene locus_tag LOCUS_66510 50449 48953 CDS product multicopper oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071802696.1 protein_id gnl|my_center|LOCUS_66510 49009 49035 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 50892 51833 gene locus_tag LOCUS_66520 50892 51833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66520 51918 52367 gene locus_tag LOCUS_66530 51918 52367 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226581.1 protein_id gnl|my_center|LOCUS_66530 52364 55735 gene locus_tag LOCUS_66540 52364 55735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66540 55735 57639 gene locus_tag LOCUS_66550 gene ibuL 55735 57639 CDS product isobutyrate:CoA ligase IbuL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030731.1 protein_id gnl|my_center|LOCUS_66550 57644 58096 gene locus_tag LOCUS_66560 57644 58096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66560 58501 58172 gene locus_tag LOCUS_66570 58501 58172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66570 59281 58595 gene locus_tag LOCUS_66580 59281 58595 CDS product N-acyl homoserine lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000216585.1 protein_id gnl|my_center|LOCUS_66580 59413 61212 gene locus_tag LOCUS_66590 59413 61212 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030046.1 protein_id gnl|my_center|LOCUS_66590 >Feature sequence030 972 118 gene locus_tag LOCUS_66600 972 118 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030936.1 protein_id gnl|my_center|LOCUS_66600 1387 1599 gene locus_tag LOCUS_66610 1387 1599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030583.1 protein_id gnl|my_center|LOCUS_66610 1731 2720 gene locus_tag LOCUS_66620 1731 2720 CDS product DUF2637 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173668830.1 protein_id gnl|my_center|LOCUS_66620 2894 2724 gene locus_tag LOCUS_66630 2894 2724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66630 2932 3393 gene locus_tag LOCUS_66640 2932 3393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_66640 3475 3888 gene locus_tag LOCUS_66650 3475 3888 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031220.1 protein_id gnl|my_center|LOCUS_66650 4723 5898 gene locus_tag LOCUS_66660 4723 5898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66660 6537 6136 gene locus_tag LOCUS_66670 6537 6136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66670 7975 8805 gene locus_tag LOCUS_66680 7975 8805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66680 9457 8888 gene locus_tag LOCUS_66690 9457 8888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66690 10221 9454 gene locus_tag LOCUS_66700 10221 9454 CDS product UTRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028876.1 protein_id gnl|my_center|LOCUS_66700 10693 10950 gene locus_tag LOCUS_66710 10693 10950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66710 10947 11480 gene locus_tag LOCUS_66720 10947 11480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029775.1 protein_id gnl|my_center|LOCUS_66720 11477 12484 gene locus_tag LOCUS_66730 11477 12484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66730 12484 12822 gene locus_tag LOCUS_66740 12484 12822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029773.1 protein_id gnl|my_center|LOCUS_66740 12899 14497 gene locus_tag LOCUS_66750 12899 14497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66750 14499 16610 gene locus_tag LOCUS_66760 14499 16610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66760 16808 17371 gene locus_tag LOCUS_66770 16808 17371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66770 17831 18739 gene locus_tag LOCUS_66780 17831 18739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66780 18736 19161 gene locus_tag LOCUS_66790 18736 19161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66790 19158 20387 gene locus_tag LOCUS_66800 19158 20387 CDS product DUF3631 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227939.1 protein_id gnl|my_center|LOCUS_66800 20497 20787 gene locus_tag LOCUS_66810 20497 20787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66810 20863 22143 gene locus_tag LOCUS_66820 20863 22143 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012477091.1 protein_id gnl|my_center|LOCUS_66820 22293 22208 gene locus_tag LOCUS_t00760 22293 22208 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 22527 24935 gene locus_tag LOCUS_66830 22527 24935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66830 25077 26330 gene locus_tag LOCUS_66840 gene purD 25077 26330 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029417.1 protein_id gnl|my_center|LOCUS_66840 26630 28483 gene locus_tag LOCUS_66850 26630 28483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029418.1 protein_id gnl|my_center|LOCUS_66850 26665 26689 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 28674 30221 gene locus_tag LOCUS_66860 28674 30221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974902.1 protein_id gnl|my_center|LOCUS_66860 30290 31189 gene locus_tag LOCUS_66870 30290 31189 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974901.1 protein_id gnl|my_center|LOCUS_66870 31307 31233 gene locus_tag LOCUS_t00770 31307 31233 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 31981 31331 gene locus_tag LOCUS_66880 31981 31331 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326755.1 protein_id gnl|my_center|LOCUS_66880 33267 31978 gene locus_tag LOCUS_66890 33267 31978 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029419.1 protein_id gnl|my_center|LOCUS_66890 34081 33284 gene locus_tag LOCUS_66900 34081 33284 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974898.1 protein_id gnl|my_center|LOCUS_66900 35046 34078 gene locus_tag LOCUS_66910 35046 34078 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974897.1 protein_id gnl|my_center|LOCUS_66910 35262 35187 gene locus_tag LOCUS_t00780 35262 35187 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 35869 35552 gene locus_tag LOCUS_66920 35869 35552 CDS product Lsr2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974896.1 protein_id gnl|my_center|LOCUS_66920 36258 36506 gene locus_tag LOCUS_66930 gene purS 36258 36506 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974895.1 protein_id gnl|my_center|LOCUS_66930 36503 37207 gene locus_tag LOCUS_66940 gene purQ 36503 37207 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974894.1 protein_id gnl|my_center|LOCUS_66940 37204 39462 gene locus_tag LOCUS_66950 gene purL 37204 39462 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974893.1 protein_id gnl|my_center|LOCUS_66950 39539 40336 gene locus_tag LOCUS_66960 39539 40336 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974888.1 protein_id gnl|my_center|LOCUS_66960 40525 42060 gene locus_tag LOCUS_66970 gene purF 40525 42060 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030872463.1 protein_id gnl|my_center|LOCUS_66970 42103 43182 gene locus_tag LOCUS_66980 gene purM 42103 43182 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974885.1 protein_id gnl|my_center|LOCUS_66980 43545 43294 gene locus_tag LOCUS_66990 43545 43294 CDS product DUF3073 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974884.1 protein_id gnl|my_center|LOCUS_66990 44939 43842 gene locus_tag LOCUS_67000 44939 43842 CDS product Glu/Leu/Phe/Val dehydrogenase dimerization domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029424.1 protein_id gnl|my_center|LOCUS_67000 45171 46040 gene locus_tag LOCUS_67010 45171 46040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974882.1 protein_id gnl|my_center|LOCUS_67010 46573 46779 gene locus_tag LOCUS_67020 gene bldC 46573 46779 CDS product developmental transcriptional regulator BldC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003949541.1 protein_id gnl|my_center|LOCUS_67020 47555 47313 gene locus_tag LOCUS_67030 47555 47313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67030 47857 47782 gene locus_tag LOCUS_t00790 47857 47782 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 49337 47979 gene locus_tag LOCUS_67040 49337 47979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_67040 49285 52488 gene locus_tag LOCUS_67050 49285 52488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67050 49367 49394 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 52237 52162 gene locus_tag LOCUS_t00800 52237 52162 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 52336 52261 gene locus_tag LOCUS_t00810 52336 52261 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 52446 52373 gene locus_tag LOCUS_t00820 52446 52373 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 54050 52527 gene locus_tag LOCUS_67060 54050 52527 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974879.1 protein_id gnl|my_center|LOCUS_67060 52987 53007 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 54180 54530 gene locus_tag LOCUS_67070 54180 54530 CDS product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029427.1 protein_id gnl|my_center|LOCUS_67070 54634 55167 gene locus_tag LOCUS_67080 54634 55167 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029428.1 protein_id gnl|my_center|LOCUS_67080 55419 57605 gene locus_tag LOCUS_67090 55419 57605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67090 57668 59212 gene locus_tag LOCUS_67100 57668 59212 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230797.1 protein_id gnl|my_center|LOCUS_67100 59301 59374 gene locus_tag LOCUS_t00830 59301 59374 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence031 260 544 gene locus_tag LOCUS_67110 260 544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67110 1027 1590 gene locus_tag LOCUS_67120 1027 1590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_67120 1395 1421 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4023 1612 gene locus_tag LOCUS_67130 4023 1612 CDS product Orn/Lys/Arg decarboxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229207.1 protein_id gnl|my_center|LOCUS_67130 4560 4183 gene locus_tag LOCUS_67140 4560 4183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221998.1 protein_id gnl|my_center|LOCUS_67140 4794 5093 gene locus_tag LOCUS_67150 4794 5093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67150 5490 5732 gene locus_tag LOCUS_67160 5490 5732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67160 5856 6152 gene locus_tag LOCUS_67170 5856 6152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67170 6318 6863 gene locus_tag LOCUS_67180 6318 6863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67180 7390 6884 gene locus_tag LOCUS_67190 7390 6884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_67190 7739 7410 gene locus_tag LOCUS_67200 7739 7410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67200 9050 7782 gene locus_tag LOCUS_67210 9050 7782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67210 10213 9533 gene locus_tag LOCUS_67220 10213 9533 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223479.1 protein_id gnl|my_center|LOCUS_67220 10161 10328 gene locus_tag LOCUS_67230 10161 10328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67230 10745 10416 gene locus_tag LOCUS_67240 10745 10416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67240 11049 12182 gene locus_tag LOCUS_67250 11049 12182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67250 12314 12670 gene locus_tag LOCUS_67260 12314 12670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67260 12944 12723 gene locus_tag LOCUS_67270 12944 12723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67270 13021 13473 gene locus_tag LOCUS_67280 13021 13473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67280 14522 13569 gene locus_tag LOCUS_67290 14522 13569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67290 14879 14553 gene locus_tag LOCUS_67300 14879 14553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67300 16490 15081 gene locus_tag LOCUS_67310 16490 15081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67310 16435 16605 gene locus_tag LOCUS_67320 16435 16605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67320 17531 16854 gene locus_tag LOCUS_67330 17531 16854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_67330 17663 17917 gene locus_tag LOCUS_67340 17663 17917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67340 17956 18573 gene locus_tag LOCUS_67350 17956 18573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67350 19796 19155 gene locus_tag LOCUS_67360 19796 19155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67360 19897 20889 gene locus_tag LOCUS_67370 19897 20889 CDS product 4,5-dihydroxyphthalate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093947496.1 protein_id gnl|my_center|LOCUS_67370 20965 21603 gene locus_tag LOCUS_67380 20965 21603 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839987.1 protein_id gnl|my_center|LOCUS_67380 21645 22082 gene locus_tag LOCUS_67390 21645 22082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67390 22603 22313 gene locus_tag LOCUS_67400 22603 22313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67400 22548 22571 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 22869 25589 gene locus_tag LOCUS_67410 22869 25589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67410 22891 22915 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 25589 27199 gene locus_tag LOCUS_67420 25589 27199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67420 27199 27645 gene locus_tag LOCUS_67430 27199 27645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67430 27528 28580 gene locus_tag LOCUS_67440 27528 28580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67440 27583 27608 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 29742 28810 gene locus_tag LOCUS_67450 29742 28810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977141.1 protein_id gnl|my_center|LOCUS_67450 30624 30262 gene locus_tag LOCUS_67460 30624 30262 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896562.1 protein_id gnl|my_center|LOCUS_67460 30763 31794 gene locus_tag LOCUS_67470 30763 31794 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266546.1 protein_id gnl|my_center|LOCUS_67470 31928 32302 gene locus_tag LOCUS_67480 31928 32302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67480 33230 32412 gene locus_tag LOCUS_67490 33230 32412 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191851039.1 protein_id gnl|my_center|LOCUS_67490 33682 33227 gene locus_tag LOCUS_67500 33682 33227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_67500 33694 33715 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 35397 34324 gene locus_tag LOCUS_67510 35397 34324 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527622.1 protein_id gnl|my_center|LOCUS_67510 36191 35580 gene locus_tag LOCUS_67520 36191 35580 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027402.1 protein_id gnl|my_center|LOCUS_67520 37068 36391 gene locus_tag LOCUS_67530 37068 36391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027403.1 protein_id gnl|my_center|LOCUS_67530 38200 37505 gene locus_tag LOCUS_67540 38200 37505 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164690918.1 protein_id gnl|my_center|LOCUS_67540 38961 38440 gene locus_tag LOCUS_67550 38961 38440 CDS product copper chaperone PCu(A)C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978000.1 protein_id gnl|my_center|LOCUS_67550 41000 38958 gene locus_tag LOCUS_67560 41000 38958 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027397.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_67560 40934 40961 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 41513 41256 gene locus_tag LOCUS_67570 41513 41256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67570 42462 41836 gene locus_tag LOCUS_67580 42462 41836 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031152.1 protein_id gnl|my_center|LOCUS_67580 43511 42552 gene locus_tag LOCUS_67590 43511 42552 CDS product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031151.1 protein_id gnl|my_center|LOCUS_67590 43762 44001 gene locus_tag LOCUS_67600 43762 44001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67600 46107 44218 gene locus_tag LOCUS_67610 46107 44218 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235624065.1 protein_id gnl|my_center|LOCUS_67610 46355 46855 gene locus_tag LOCUS_67620 46355 46855 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028746.1 protein_id gnl|my_center|LOCUS_67620 47134 47316 gene locus_tag LOCUS_67630 47134 47316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67630 47368 47724 gene locus_tag LOCUS_67640 47368 47724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67640 48583 47645 gene locus_tag LOCUS_67650 48583 47645 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228693.1 protein_id gnl|my_center|LOCUS_67650 48724 49512 gene locus_tag LOCUS_67660 48724 49512 CDS product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263858.1 protein_id gnl|my_center|LOCUS_67660 50001 49543 gene locus_tag LOCUS_67670 50001 49543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67670 51340 50099 gene locus_tag LOCUS_67680 51340 50099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67680 52348 51443 gene locus_tag LOCUS_67690 52348 51443 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970669.1 protein_id gnl|my_center|LOCUS_67690 52557 52584 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 52628 52843 gene locus_tag LOCUS_67700 52628 52843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67700 52902 53816 gene locus_tag LOCUS_67710 52902 53816 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228693.1 protein_id gnl|my_center|LOCUS_67710 54508 54146 gene locus_tag LOCUS_67720 54508 54146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67720 55167 54733 gene locus_tag LOCUS_67730 55167 54733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67730 55879 55337 gene locus_tag LOCUS_67740 55879 55337 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028365.1 protein_id gnl|my_center|LOCUS_67740 >Feature sequence032 1915 230 gene locus_tag LOCUS_67750 1915 230 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973282.1 protein_id gnl|my_center|LOCUS_67750 3005 2106 gene locus_tag LOCUS_67760 gene dapA 3005 2106 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030431.1 protein_id gnl|my_center|LOCUS_67760 3006 3035 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4033 3284 gene locus_tag LOCUS_67770 gene thyX 4033 3284 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030430.1 protein_id gnl|my_center|LOCUS_67770 4254 4487 gene locus_tag LOCUS_67780 4254 4487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973285.1 protein_id gnl|my_center|LOCUS_67780 4853 4877 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4882 5178 gene locus_tag LOCUS_67790 4882 5178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_67790 6460 5219 gene locus_tag LOCUS_67800 6460 5219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67800 5803 5824 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7915 6536 gene locus_tag LOCUS_67810 7915 6536 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973289.1 protein_id gnl|my_center|LOCUS_67810 10131 7912 gene locus_tag LOCUS_67820 10131 7912 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973290.1 protein_id gnl|my_center|LOCUS_67820 10760 10473 gene locus_tag LOCUS_67830 gene rpsO 10760 10473 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973291.1 protein_id gnl|my_center|LOCUS_67830 11088 11351 gene locus_tag LOCUS_67840 11088 11351 CDS product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030415.1 protein_id gnl|my_center|LOCUS_67840 12905 11409 gene locus_tag LOCUS_67850 12905 11409 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487446.1 protein_id gnl|my_center|LOCUS_67850 14503 12989 gene locus_tag LOCUS_67860 gene eccD 14503 12989 CDS product type VII secretion integral membrane protein EccD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270242.1 protein_id gnl|my_center|LOCUS_67860 14844 18833 gene locus_tag LOCUS_67870 14844 18833 CDS product type VII secretion protein EccC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030426.1 protein_id gnl|my_center|LOCUS_67870 15845 15865 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 19233 18931 gene locus_tag LOCUS_67880 19233 18931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67880 19633 19292 gene locus_tag LOCUS_67890 19633 19292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67890 21032 19776 gene locus_tag LOCUS_67900 gene mycP 21032 19776 CDS product type VII secretion-associated serine protease mycosin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030414.1 protein_id gnl|my_center|LOCUS_67900 22571 21048 gene locus_tag LOCUS_67910 gene eccB 22571 21048 CDS product type VII secretion protein EccB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030413.1 protein_id gnl|my_center|LOCUS_67910 22772 24118 gene locus_tag LOCUS_67920 gene eccE 22772 24118 CDS product type VII secretion protein EccE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487445.1 protein_id gnl|my_center|LOCUS_67920 24191 24215 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 24254 24964 gene locus_tag LOCUS_67930 24254 24964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030411.1 protein_id gnl|my_center|LOCUS_67930 25111 27993 gene locus_tag LOCUS_67940 25111 27993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67940 28293 28328 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 28453 30255 gene locus_tag LOCUS_67950 28453 30255 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030408.1 protein_id gnl|my_center|LOCUS_67950 30288 31172 gene locus_tag LOCUS_67960 30288 31172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_67960 31085 31110 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 31145 31393 gene locus_tag LOCUS_67970 31145 31393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_67970 31390 32352 gene locus_tag LOCUS_67980 31390 32352 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973312.1 protein_id gnl|my_center|LOCUS_67980 32349 33368 gene locus_tag LOCUS_67990 32349 33368 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030406.1 protein_id gnl|my_center|LOCUS_67990 33365 34402 gene locus_tag LOCUS_68000 33365 34402 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030405.1 protein_id gnl|my_center|LOCUS_68000 35401 34430 gene locus_tag LOCUS_68010 35401 34430 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973315.1 protein_id gnl|my_center|LOCUS_68010 39569 35577 gene locus_tag LOCUS_68020 39569 35577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68020 39701 39736 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 40760 39855 gene locus_tag LOCUS_68030 gene truB 40760 39855 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030403.1 protein_id gnl|my_center|LOCUS_68030 41218 40757 gene locus_tag LOCUS_68040 gene rbfA 41218 40757 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973318.1 protein_id gnl|my_center|LOCUS_68040 41605 41312 gene locus_tag LOCUS_68050 41605 41312 CDS product DUF503 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973319.1 protein_id gnl|my_center|LOCUS_68050 45059 41997 gene locus_tag LOCUS_68060 45059 41997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_68060 45505 45209 gene locus_tag LOCUS_68070 45505 45209 CDS product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973321.1 protein_id gnl|my_center|LOCUS_68070 46604 45606 gene locus_tag LOCUS_68080 gene nusA 46604 45606 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030401.1 protein_id gnl|my_center|LOCUS_68080 47104 46607 gene locus_tag LOCUS_68090 gene rimP 47104 46607 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973323.1 protein_id gnl|my_center|LOCUS_68090 47303 47980 gene locus_tag LOCUS_68100 47303 47980 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030400.1 protein_id gnl|my_center|LOCUS_68100 47977 48450 gene locus_tag LOCUS_68110 47977 48450 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030399.1 protein_id gnl|my_center|LOCUS_68110 48547 49446 gene locus_tag LOCUS_68120 48547 49446 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030398.1 protein_id gnl|my_center|LOCUS_68120 51196 49472 gene locus_tag LOCUS_68130 51196 49472 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973327.1 protein_id gnl|my_center|LOCUS_68130 50437 50460 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 51497 51270 gene locus_tag LOCUS_68140 51497 51270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_68140 51862 51455 gene locus_tag LOCUS_68150 51862 51455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_68150 51512 51534 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 52741 51893 gene locus_tag LOCUS_68160 52741 51893 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030873433.1 protein_id gnl|my_center|LOCUS_68160 52850 54841 gene locus_tag LOCUS_68170 52850 54841 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486025.1 protein_id gnl|my_center|LOCUS_68170 >Feature sequence033 <1 510 gene locus_tag LOCUS_68180 <1 510 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013226940.1:SDR family NAD(P)-dependent oxidoreductase 814 1518 gene locus_tag LOCUS_68190 814 1518 CDS product GAF and ANTAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031654.1 protein_id gnl|my_center|LOCUS_68190 1743 2069 gene locus_tag LOCUS_68200 1743 2069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038535289.1 protein_id gnl|my_center|LOCUS_68200 2178 3416 gene locus_tag LOCUS_68210 2178 3416 CDS product PP2C family protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031624.1 protein_id gnl|my_center|LOCUS_68210 3667 3691 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3705 4115 gene locus_tag LOCUS_68220 3705 4115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68220 6168 4774 gene locus_tag LOCUS_68230 6168 4774 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165781113.1 protein_id gnl|my_center|LOCUS_68230 6392 6165 gene locus_tag LOCUS_68240 6392 6165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68240 7149 8093 gene locus_tag LOCUS_68250 7149 8093 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729508.1 protein_id gnl|my_center|LOCUS_68250 8224 9840 gene locus_tag LOCUS_68260 8224 9840 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141163.1 protein_id gnl|my_center|LOCUS_68260 10726 9869 gene locus_tag LOCUS_68270 10726 9869 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731014.1 protein_id gnl|my_center|LOCUS_68270 11996 11013 gene locus_tag LOCUS_68280 11996 11013 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140840.1 protein_id gnl|my_center|LOCUS_68280 13052 12207 gene locus_tag LOCUS_68290 13052 12207 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229550.1 protein_id gnl|my_center|LOCUS_68290 12934 13155 gene locus_tag LOCUS_68300 12934 13155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68300 13183 13773 gene locus_tag LOCUS_68310 13183 13773 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978343.1 protein_id gnl|my_center|LOCUS_68310 14668 15054 gene locus_tag LOCUS_68320 14668 15054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68320 14909 14940 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 15214 15011 gene locus_tag LOCUS_68330 15214 15011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68330 15943 15329 gene locus_tag LOCUS_68340 15943 15329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68340 16868 16002 gene locus_tag LOCUS_68350 16868 16002 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027493.1 protein_id gnl|my_center|LOCUS_68350 17153 16914 gene locus_tag LOCUS_68360 17153 16914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68360 17231 17424 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 18486 18690 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 21543 19438 gene locus_tag LOCUS_68370 21543 19438 CDS product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729528.1 protein_id gnl|my_center|LOCUS_68370 19657 19683 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 20682 20705 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 21736 21545 gene locus_tag LOCUS_68380 21736 21545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68380 23038 21782 gene locus_tag LOCUS_68390 23038 21782 CDS product NADH-ubiquinone oxidoreductase-F iron-sulfur binding region domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730104.1 protein_id gnl|my_center|LOCUS_68390 23463 23035 gene locus_tag LOCUS_68400 23463 23035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68400 23876 25048 gene locus_tag LOCUS_68410 23876 25048 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920958.1 protein_id gnl|my_center|LOCUS_68410 25220 26344 gene locus_tag LOCUS_68420 25220 26344 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005666442.1 protein_id gnl|my_center|LOCUS_68420 26346 27239 gene locus_tag LOCUS_68430 26346 27239 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894683.1 protein_id gnl|my_center|LOCUS_68430 27236 28093 gene locus_tag LOCUS_68440 27236 28093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68440 27941 27981 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 28169 29101 gene locus_tag LOCUS_68450 28169 29101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_68450 29002 29030 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 29038 29277 gene locus_tag LOCUS_68460 29038 29277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68460 29312 30625 gene locus_tag LOCUS_68470 29312 30625 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225339.1 protein_id gnl|my_center|LOCUS_68470 30618 32051 gene locus_tag LOCUS_68480 30618 32051 CDS product gamma-aminobutyraldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223105.1 protein_id gnl|my_center|LOCUS_68480 33076 32504 gene locus_tag LOCUS_68490 33076 32504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68490 33751 33149 gene locus_tag LOCUS_68500 33751 33149 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227517.1 protein_id gnl|my_center|LOCUS_68500 33827 34645 gene locus_tag LOCUS_68510 33827 34645 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976615.1 protein_id gnl|my_center|LOCUS_68510 34717 35553 gene locus_tag LOCUS_68520 34717 35553 CDS product haloalkane dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228180.1 protein_id gnl|my_center|LOCUS_68520 35957 35685 gene locus_tag LOCUS_68530 35957 35685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68530 35998 36507 gene locus_tag LOCUS_68540 35998 36507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68540 36071 36104 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 37388 36810 gene locus_tag LOCUS_68550 37388 36810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68550 37630 37385 gene locus_tag LOCUS_68560 37630 37385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68560 38454 38287 gene locus_tag LOCUS_68570 38454 38287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971740.1 protein_id gnl|my_center|LOCUS_68570 38871 38587 gene locus_tag LOCUS_68580 38871 38587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68580 39100 39555 gene locus_tag LOCUS_68590 39100 39555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_68590 39552 39728 gene locus_tag LOCUS_68600 39552 39728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68600 40064 41143 gene locus_tag LOCUS_68610 40064 41143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68610 41600 42214 gene locus_tag LOCUS_68620 41600 42214 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259406.1 protein_id gnl|my_center|LOCUS_68620 42211 43722 gene locus_tag LOCUS_68630 42211 43722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68630 44124 43852 gene locus_tag LOCUS_68640 44124 43852 CDS product DUF4190 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971498.1 protein_id gnl|my_center|LOCUS_68640 44310 44334 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 45019 44447 gene locus_tag LOCUS_68650 45019 44447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68650 45090 45959 gene locus_tag LOCUS_68660 45090 45959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68660 46411 46094 gene locus_tag LOCUS_68670 46411 46094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68670 46679 47095 gene locus_tag LOCUS_68680 46679 47095 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029511.1 protein_id gnl|my_center|LOCUS_68680 47140 47421 gene locus_tag LOCUS_68690 47140 47421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68690 47163 47186 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 48013 47525 gene locus_tag LOCUS_68700 48013 47525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68700 48025 48543 gene locus_tag LOCUS_68710 48025 48543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68710 48556 49752 gene locus_tag LOCUS_68720 48556 49752 CDS product PP2C family protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_079030578.1 protein_id gnl|my_center|LOCUS_68720 50038 52866 gene locus_tag LOCUS_68730 50038 52866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68730 52920 53099 gene locus_tag LOCUS_68740 52920 53099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68740 53691 54479 gene locus_tag LOCUS_68750 53691 54479 CDS product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729731.1 protein_id gnl|my_center|LOCUS_68750 >Feature sequence034 263 416 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1050 2873 gene locus_tag LOCUS_68760 1050 2873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68760 4691 3177 gene locus_tag LOCUS_68770 4691 3177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68770 5946 4849 gene locus_tag LOCUS_68780 5946 4849 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225643939.1 protein_id gnl|my_center|LOCUS_68780 7220 5943 gene locus_tag LOCUS_68790 7220 5943 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064732171.1 protein_id gnl|my_center|LOCUS_68790 9024 8305 gene locus_tag LOCUS_68800 9024 8305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68800 9049 9723 gene locus_tag LOCUS_68810 9049 9723 CDS product TetR/AcrR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229251.1 protein_id gnl|my_center|LOCUS_68810 10170 9832 gene locus_tag LOCUS_68820 10170 9832 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013061280.1 protein_id gnl|my_center|LOCUS_68820 10281 11264 gene locus_tag LOCUS_68830 10281 11264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68830 11114 11138 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 13962 11719 gene locus_tag LOCUS_68840 13962 11719 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031418.1 protein_id gnl|my_center|LOCUS_68840 14333 15445 gene locus_tag LOCUS_68850 14333 15445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68850 15449 16189 gene locus_tag LOCUS_68860 15449 16189 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229954.1 protein_id gnl|my_center|LOCUS_68860 17244 17696 gene locus_tag LOCUS_68870 17244 17696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68870 17693 18004 gene locus_tag LOCUS_68880 17693 18004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68880 19254 18163 gene locus_tag LOCUS_68890 19254 18163 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225076.1 protein_id gnl|my_center|LOCUS_68890 19601 19780 gene locus_tag LOCUS_68900 19601 19780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68900 19944 22112 gene locus_tag LOCUS_68910 19944 22112 CDS product glycoside hydrolase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485975.1 protein_id gnl|my_center|LOCUS_68910 22123 22377 gene locus_tag LOCUS_68920 22123 22377 CDS product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039368.1 protein_id gnl|my_center|LOCUS_68920 22374 22748 gene locus_tag LOCUS_68930 22374 22748 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189749484.1 protein_id gnl|my_center|LOCUS_68930 23867 22785 gene locus_tag LOCUS_68940 23867 22785 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868074.1 protein_id gnl|my_center|LOCUS_68940 25558 24062 gene locus_tag LOCUS_68950 25558 24062 CDS product phage/plasmid primase, P4 family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030063223.1 protein_id gnl|my_center|LOCUS_68950 26446 25925 gene locus_tag LOCUS_68960 26446 25925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_68960 26927 26430 gene locus_tag LOCUS_68970 26927 26430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68970 26530 26551 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 28421 26940 gene locus_tag LOCUS_68980 28421 26940 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081393.1 protein_id gnl|my_center|LOCUS_68980 28767 28576 gene locus_tag LOCUS_68990 28767 28576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68990 28867 29175 gene locus_tag LOCUS_69000 28867 29175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69000 29465 30187 gene locus_tag LOCUS_69010 29465 30187 CDS product TetR/AcrR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225212.1 protein_id gnl|my_center|LOCUS_69010 30401 30577 gene locus_tag LOCUS_69020 30401 30577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69020 30592 31053 gene locus_tag LOCUS_69030 30592 31053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69030 32913 31120 gene locus_tag LOCUS_69040 32913 31120 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978119.1 protein_id gnl|my_center|LOCUS_69040 33834 33211 gene locus_tag LOCUS_69050 33834 33211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69050 35655 33847 gene locus_tag LOCUS_69060 35655 33847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69060 36034 35888 gene locus_tag LOCUS_69070 36034 35888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69070 36065 36090 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 37872 36409 gene locus_tag LOCUS_69080 37872 36409 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082635.1 protein_id gnl|my_center|LOCUS_69080 38557 38156 gene locus_tag LOCUS_69090 38557 38156 CDS product DUF6009 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184567623.1 protein_id gnl|my_center|LOCUS_69090 40080 38554 gene locus_tag LOCUS_69100 40080 38554 CDS product phage/plasmid primase, P4 family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030063223.1 protein_id gnl|my_center|LOCUS_69100 41117 40077 gene locus_tag LOCUS_69110 41117 40077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69110 41951 43270 gene locus_tag LOCUS_69120 41951 43270 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975272.1 protein_id gnl|my_center|LOCUS_69120 43781 46096 gene locus_tag LOCUS_69130 43781 46096 CDS product FdhF/YdeP family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028088.1 protein_id gnl|my_center|LOCUS_69130 46106 46126 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 46276 47361 gene locus_tag LOCUS_69140 46276 47361 CDS product S-(hydroxymethyl)mycothiol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027326.1 protein_id gnl|my_center|LOCUS_69140 47361 47993 gene locus_tag LOCUS_69150 47361 47993 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978121.1 protein_id gnl|my_center|LOCUS_69150 48187 48672 gene locus_tag LOCUS_69160 48187 48672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69160 48522 48547 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 48587 49735 gene locus_tag LOCUS_69170 48587 49735 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229319.1 protein_id gnl|my_center|LOCUS_69170 >Feature sequence035 95 700 gene locus_tag LOCUS_69180 95 700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69180 745 1803 gene locus_tag LOCUS_69190 745 1803 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026153082.1 protein_id gnl|my_center|LOCUS_69190 1868 2032 gene locus_tag LOCUS_69200 1868 2032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69200 2708 3121 gene locus_tag LOCUS_69210 2708 3121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_69210 3246 3794 gene locus_tag LOCUS_69220 3246 3794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69220 3791 3958 gene locus_tag LOCUS_69230 3791 3958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69230 3986 5035 gene locus_tag LOCUS_69240 3986 5035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_69240 4939 5583 gene locus_tag LOCUS_69250 4939 5583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_69250 5580 6068 gene locus_tag LOCUS_69260 5580 6068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69260 6582 7445 gene locus_tag LOCUS_69270 6582 7445 CDS product glutathione S-transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079769.1 protein_id gnl|my_center|LOCUS_69270 8557 8581 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8735 8950 gene locus_tag LOCUS_69280 8735 8950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_69280 8947 9744 gene locus_tag LOCUS_69290 8947 9744 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268065.1 protein_id gnl|my_center|LOCUS_69290 9810 10835 gene locus_tag LOCUS_69300 9810 10835 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086423.1 protein_id gnl|my_center|LOCUS_69300 10843 11649 gene locus_tag LOCUS_69310 10843 11649 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466913.1 protein_id gnl|my_center|LOCUS_69310 11873 13087 gene locus_tag LOCUS_69320 11873 13087 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728201.1 protein_id gnl|my_center|LOCUS_69320 13109 14482 gene locus_tag LOCUS_69330 13109 14482 CDS product NtaA/DmoA family FMN-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728200.1 protein_id gnl|my_center|LOCUS_69330 14479 16704 gene locus_tag LOCUS_69340 14479 16704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69340 16973 17527 gene locus_tag LOCUS_69350 gene ssuE 16973 17527 CDS product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808029.1 protein_id gnl|my_center|LOCUS_69350 17532 17693 gene locus_tag LOCUS_69360 17532 17693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69360 17718 18878 gene locus_tag LOCUS_69370 17718 18878 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728503.1 protein_id gnl|my_center|LOCUS_69370 19347 20570 gene locus_tag LOCUS_69380 19347 20570 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112212.1 protein_id gnl|my_center|LOCUS_69380 20619 21101 gene locus_tag LOCUS_69390 20619 21101 CDS product RrF2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406624.1 protein_id gnl|my_center|LOCUS_69390 21022 21045 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 24013 21254 gene locus_tag LOCUS_69400 24013 21254 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109035749.1 protein_id gnl|my_center|LOCUS_69400 24804 24010 gene locus_tag LOCUS_69410 24804 24010 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086062.1 protein_id gnl|my_center|LOCUS_69410 25720 24788 gene locus_tag LOCUS_69420 25720 24788 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086063.1 protein_id gnl|my_center|LOCUS_69420 27063 25717 gene locus_tag LOCUS_69430 27063 25717 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296526.1 protein_id gnl|my_center|LOCUS_69430 27306 27079 gene locus_tag LOCUS_69440 27306 27079 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005058882.1 protein_id gnl|my_center|LOCUS_69440 28146 27346 gene locus_tag LOCUS_69450 28146 27346 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005091866.1 protein_id gnl|my_center|LOCUS_69450 29395 28469 gene locus_tag LOCUS_69460 29395 28469 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030651.1 protein_id gnl|my_center|LOCUS_69460 30203 29382 gene locus_tag LOCUS_69470 30203 29382 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972825.1 protein_id gnl|my_center|LOCUS_69470 31329 30220 gene locus_tag LOCUS_69480 31329 30220 CDS product aliphatic sulfonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030652.1 protein_id gnl|my_center|LOCUS_69480 31794 31630 gene locus_tag LOCUS_69490 31794 31630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69490 32105 31788 gene locus_tag LOCUS_69500 32105 31788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69500 32162 32479 gene locus_tag LOCUS_69510 32162 32479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69510 33357 32821 gene locus_tag LOCUS_69520 33357 32821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69520 33398 33649 gene locus_tag LOCUS_69530 33398 33649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69530 33938 33964 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 34202 34450 gene locus_tag LOCUS_69540 34202 34450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69540 35798 34566 gene locus_tag LOCUS_69550 35798 34566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69550 36088 35879 gene locus_tag LOCUS_69560 36088 35879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69560 37167 36016 gene locus_tag LOCUS_69570 37167 36016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_69570 36109 36134 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 37817 37164 gene locus_tag LOCUS_69580 37817 37164 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086558972.1 protein_id gnl|my_center|LOCUS_69580 38228 38034 gene locus_tag LOCUS_69590 38228 38034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69590 38133 38390 gene locus_tag LOCUS_69600 38133 38390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69600 38669 38463 gene locus_tag LOCUS_69610 38669 38463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69610 40107 40673 gene locus_tag LOCUS_69620 40107 40673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69620 40817 41194 gene locus_tag LOCUS_69630 40817 41194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69630 41863 41399 gene locus_tag LOCUS_69640 41863 41399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69640 42671 42306 gene locus_tag LOCUS_69650 42671 42306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69650 42810 42998 gene locus_tag LOCUS_69660 42810 42998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69660 43894 44502 gene locus_tag LOCUS_69670 43894 44502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69670 44962 46800 gene locus_tag LOCUS_69680 44962 46800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69680 46968 47279 gene locus_tag LOCUS_69690 46968 47279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69690 >Feature sequence036 2049 79 gene locus_tag LOCUS_69700 2049 79 CDS product copper resistance protein CopC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029406.1 protein_id gnl|my_center|LOCUS_69700 2810 2157 gene locus_tag LOCUS_69710 2810 2157 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974913.1 protein_id gnl|my_center|LOCUS_69710 4933 2810 gene locus_tag LOCUS_69720 4933 2810 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029405.1 protein_id gnl|my_center|LOCUS_69720 5056 5682 gene locus_tag LOCUS_69730 5056 5682 CDS product HhH-GPD-type base excision DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974916.1 protein_id gnl|my_center|LOCUS_69730 7753 5951 gene locus_tag LOCUS_69740 7753 5951 CDS product DUF853 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730039.1 protein_id gnl|my_center|LOCUS_69740 6170 6192 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7858 8154 gene locus_tag LOCUS_69750 7858 8154 CDS product type II toxin-antitoxin system VapB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003999914.1 protein_id gnl|my_center|LOCUS_69750 8259 8915 gene locus_tag LOCUS_69760 8259 8915 CDS product LytR C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974920.1 protein_id gnl|my_center|LOCUS_69760 9573 8938 gene locus_tag LOCUS_69770 gene upp 9573 8938 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974921.1 protein_id gnl|my_center|LOCUS_69770 9535 9912 gene locus_tag LOCUS_69780 9535 9912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69780 9998 10180 gene locus_tag LOCUS_69790 9998 10180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69790 10198 10226 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10543 11085 gene locus_tag LOCUS_69800 10543 11085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974923.1 protein_id gnl|my_center|LOCUS_69800 11202 11633 gene locus_tag LOCUS_69810 gene tadA 11202 11633 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974924.1 protein_id gnl|my_center|LOCUS_69810 11712 11797 gene locus_tag LOCUS_t00840 11712 11797 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 13139 11862 gene locus_tag LOCUS_69820 13139 11862 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012477091.1 protein_id gnl|my_center|LOCUS_69820 13438 13220 gene locus_tag LOCUS_69830 13438 13220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69830 15283 13619 gene locus_tag LOCUS_69840 15283 13619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69840 16185 15280 gene locus_tag LOCUS_69850 16185 15280 CDS product bifunctional DNA primase/polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029372.1 protein_id gnl|my_center|LOCUS_69850 16736 16272 gene locus_tag LOCUS_69860 16736 16272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029768.1 protein_id gnl|my_center|LOCUS_69860 19067 16944 gene locus_tag LOCUS_69870 19067 16944 CDS product cell division protein FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227950.1 protein_id gnl|my_center|LOCUS_69870 19524 19207 gene locus_tag LOCUS_69880 19524 19207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69880 19768 19526 gene locus_tag LOCUS_69890 19768 19526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69890 20144 19809 gene locus_tag LOCUS_69900 20144 19809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029773.1 protein_id gnl|my_center|LOCUS_69900 21541 20144 gene locus_tag LOCUS_69910 21541 20144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69910 21290 21317 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 22005 22763 gene locus_tag LOCUS_69920 22005 22763 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189749510.1 protein_id gnl|my_center|LOCUS_69920 22760 23317 gene locus_tag LOCUS_69930 22760 23317 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189749509.1 protein_id gnl|my_center|LOCUS_69930 23638 23814 gene locus_tag LOCUS_69940 23638 23814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052836888.1 protein_id gnl|my_center|LOCUS_69940 23811 24107 gene locus_tag LOCUS_69950 23811 24107 CDS product Dabb family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974926.1 protein_id gnl|my_center|LOCUS_69950 24308 25150 gene locus_tag LOCUS_69960 24308 25150 CDS product RNA polymerase sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029398.1 protein_id gnl|my_center|LOCUS_69960 25397 26299 gene locus_tag LOCUS_69970 25397 26299 CDS product RNA polymerase sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974928.1 protein_id gnl|my_center|LOCUS_69970 26399 27223 gene locus_tag LOCUS_69980 26399 27223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69980 27454 27257 gene locus_tag LOCUS_69990 27454 27257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69990 27649 28143 gene locus_tag LOCUS_70000 27649 28143 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029397.1 protein_id gnl|my_center|LOCUS_70000 28229 30757 gene locus_tag LOCUS_70010 28229 30757 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029396.1 protein_id gnl|my_center|LOCUS_70010 30862 31683 gene locus_tag LOCUS_70020 30862 31683 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029395.1 protein_id gnl|my_center|LOCUS_70020 32406 31666 gene locus_tag LOCUS_70030 32406 31666 CDS product GAF and ANTAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029394.1 protein_id gnl|my_center|LOCUS_70030 33157 32435 gene locus_tag LOCUS_70040 33157 32435 CDS product ANTAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168715398.1 protein_id gnl|my_center|LOCUS_70040 33360 33752 gene locus_tag LOCUS_70050 33360 33752 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974935.1 protein_id gnl|my_center|LOCUS_70050 33820 34290 gene locus_tag LOCUS_70060 33820 34290 CDS product TIGR03618 family F420-dependent PPOX class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974936.1 protein_id gnl|my_center|LOCUS_70060 35154 34387 gene locus_tag LOCUS_70070 35154 34387 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029392.1 protein_id gnl|my_center|LOCUS_70070 37496 35295 gene locus_tag LOCUS_70080 37496 35295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70080 38881 37493 gene locus_tag LOCUS_70090 38881 37493 CDS product bifunctional glycosyltransferase family 2/GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029389.1 protein_id gnl|my_center|LOCUS_70090 40500 38878 gene locus_tag LOCUS_70100 40500 38878 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029388.1 protein_id gnl|my_center|LOCUS_70100 41237 40497 gene locus_tag LOCUS_70110 41237 40497 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030863629.1 protein_id gnl|my_center|LOCUS_70110 42368 41460 gene locus_tag LOCUS_70120 42368 41460 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029384.1 protein_id gnl|my_center|LOCUS_70120 42690 42469 gene locus_tag LOCUS_70130 42690 42469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_70130 43402 42665 gene locus_tag LOCUS_70140 43402 42665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_70140 42719 42749 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 44416 43523 gene locus_tag LOCUS_70150 44416 43523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70150 44802 44593 gene locus_tag LOCUS_70160 44802 44593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70160 44753 45478 gene locus_tag LOCUS_70170 44753 45478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70170 45947 46294 gene locus_tag LOCUS_70180 45947 46294 CDS product DUF1330 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224148.1 protein_id gnl|my_center|LOCUS_70180 >Feature sequence037 1699 74 gene locus_tag LOCUS_70190 1699 74 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728540.1 protein_id gnl|my_center|LOCUS_70190 1939 2418 gene locus_tag LOCUS_70200 1939 2418 CDS product MSMEG_6728 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971750.1 protein_id gnl|my_center|LOCUS_70200 3314 2484 gene locus_tag LOCUS_70210 3314 2484 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027270.1 protein_id gnl|my_center|LOCUS_70210 3445 4449 gene locus_tag LOCUS_70220 3445 4449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70220 4549 6240 gene locus_tag LOCUS_70230 4549 6240 CDS product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085144103.1 protein_id gnl|my_center|LOCUS_70230 6370 6651 gene locus_tag LOCUS_70240 6370 6651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70240 7929 6715 gene locus_tag LOCUS_70250 7929 6715 CDS product chitinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228833.1 protein_id gnl|my_center|LOCUS_70250 8119 9138 gene locus_tag LOCUS_70260 8119 9138 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977963.1 protein_id gnl|my_center|LOCUS_70260 9372 9202 gene locus_tag LOCUS_70270 9372 9202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70270 9604 10671 gene locus_tag LOCUS_70280 9604 10671 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037667537.1 protein_id gnl|my_center|LOCUS_70280 10876 11409 gene locus_tag LOCUS_70290 10876 11409 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031629.1 protein_id gnl|my_center|LOCUS_70290 11402 11935 gene locus_tag LOCUS_70300 11402 11935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_70300 11889 11917 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11920 13071 gene locus_tag LOCUS_70310 11920 13071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_70310 13400 13424 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 13425 13988 gene locus_tag LOCUS_70320 13425 13988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_70320 15252 14083 gene locus_tag LOCUS_70330 15252 14083 CDS product PP2C family protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225630519.1 protein_id gnl|my_center|LOCUS_70330 16382 15477 gene locus_tag LOCUS_70340 16382 15477 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226368.1 protein_id gnl|my_center|LOCUS_70340 18166 16388 gene locus_tag LOCUS_70350 18166 16388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70350 18403 20007 gene locus_tag LOCUS_70360 18403 20007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70360 20152 20448 gene locus_tag LOCUS_70370 20152 20448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70370 21445 20432 gene locus_tag LOCUS_70380 21445 20432 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978217.1 protein_id gnl|my_center|LOCUS_70380 21656 21727 gene locus_tag LOCUS_t00850 21656 21727 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 22838 21798 gene locus_tag LOCUS_70390 gene mgrA 22838 21798 CDS product L-glyceraldehyde 3-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971549.1 protein_id gnl|my_center|LOCUS_70390 23140 23793 gene locus_tag LOCUS_70400 23140 23793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70400 23911 25110 gene locus_tag LOCUS_70410 23911 25110 CDS product EfeM/EfeO family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086847669.1 protein_id gnl|my_center|LOCUS_70410 25107 26432 gene locus_tag LOCUS_70420 25107 26432 CDS product Dyp-type peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229345.1 protein_id gnl|my_center|LOCUS_70420 26645 28498 gene locus_tag LOCUS_70430 26645 28498 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229346.1 protein_id gnl|my_center|LOCUS_70430 29864 28530 gene locus_tag LOCUS_70440 29864 28530 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031634.1 protein_id gnl|my_center|LOCUS_70440 32840 30168 gene locus_tag LOCUS_70450 32840 30168 CDS product SpoIIE family protein phosphatase/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186009676.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_70450 30383 30413 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 33010 33038 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 33197 33361 gene locus_tag LOCUS_70460 gene rpmG 33197 33361 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978292.1 protein_id gnl|my_center|LOCUS_70460 35855 33405 gene locus_tag LOCUS_70470 35855 33405 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484486.1 protein_id gnl|my_center|LOCUS_70470 36493 36017 gene locus_tag LOCUS_70480 36493 36017 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005088503.1 protein_id gnl|my_center|LOCUS_70480 36452 36691 gene locus_tag LOCUS_70490 36452 36691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70490 38058 36613 gene locus_tag LOCUS_70500 38058 36613 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972104.1 protein_id gnl|my_center|LOCUS_70500 38398 39477 gene locus_tag LOCUS_70510 38398 39477 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975333.1 protein_id gnl|my_center|LOCUS_70510 39753 39508 gene locus_tag LOCUS_70520 39753 39508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70520 39841 40710 gene locus_tag LOCUS_70530 39841 40710 CDS product RNA polymerase sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030982.1 protein_id gnl|my_center|LOCUS_70530 41286 40870 gene locus_tag LOCUS_70540 41286 40870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70540 41482 42045 gene locus_tag LOCUS_70550 41482 42045 CDS product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226035.1 protein_id gnl|my_center|LOCUS_70550 42235 42780 gene locus_tag LOCUS_70560 42235 42780 CDS product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728973.1 protein_id gnl|my_center|LOCUS_70560 42777 43865 gene locus_tag LOCUS_70570 42777 43865 CDS product hydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225647.1 protein_id gnl|my_center|LOCUS_70570 >Feature sequence038 350 378 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 805 1188 gene locus_tag LOCUS_70580 805 1188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026927.1 protein_id gnl|my_center|LOCUS_70580 1201 1869 gene locus_tag LOCUS_70590 1201 1869 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026928.1 protein_id gnl|my_center|LOCUS_70590 2969 2007 gene locus_tag LOCUS_70600 2969 2007 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030866806.1 protein_id gnl|my_center|LOCUS_70600 3776 3171 gene locus_tag LOCUS_70610 3776 3171 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027252.1 protein_id gnl|my_center|LOCUS_70610 3889 4170 gene locus_tag LOCUS_70620 3889 4170 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978241.1 protein_id gnl|my_center|LOCUS_70620 5939 4572 gene locus_tag LOCUS_70630 5939 4572 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027250.1 protein_id gnl|my_center|LOCUS_70630 6376 6089 gene locus_tag LOCUS_70640 6376 6089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70640 7410 6424 gene locus_tag LOCUS_70650 7410 6424 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978666.1 protein_id gnl|my_center|LOCUS_70650 9933 7534 gene locus_tag LOCUS_70660 9933 7534 CDS product glycosyl hydrolase family 65 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027248.1 protein_id gnl|my_center|LOCUS_70660 10803 9940 gene locus_tag LOCUS_70670 10803 9940 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978710.1 protein_id gnl|my_center|LOCUS_70670 10990 13677 gene locus_tag LOCUS_70680 10990 13677 CDS product bifunctional GNAT family N-acetyltransferase/acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227290.1 protein_id gnl|my_center|LOCUS_70680 13884 16664 gene locus_tag LOCUS_70690 gene adhE 13884 16664 CDS product bifunctional acetaldehyde-CoA/alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000137036.1 protein_id gnl|my_center|LOCUS_70690 17564 18019 gene locus_tag LOCUS_70700 17564 18019 CDS product cyclic nucleotide-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030862045.1 protein_id gnl|my_center|LOCUS_70700 18073 18738 gene locus_tag LOCUS_70710 18073 18738 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030862048.1 protein_id gnl|my_center|LOCUS_70710 19541 18810 gene locus_tag LOCUS_70720 19541 18810 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978707.1 protein_id gnl|my_center|LOCUS_70720 20003 19563 gene locus_tag LOCUS_70730 20003 19563 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026920.1 protein_id gnl|my_center|LOCUS_70730 20883 20131 gene locus_tag LOCUS_70740 20883 20131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70740 22079 21009 gene locus_tag LOCUS_70750 22079 21009 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978698.1 protein_id gnl|my_center|LOCUS_70750 22484 23035 gene locus_tag LOCUS_70760 22484 23035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026904.1 protein_id gnl|my_center|LOCUS_70760 23285 24637 gene locus_tag LOCUS_70770 23285 24637 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403001.1 protein_id gnl|my_center|LOCUS_70770 25380 24868 gene locus_tag LOCUS_70780 25380 24868 CDS product flavodoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226004.1 protein_id gnl|my_center|LOCUS_70780 26140 25397 gene locus_tag LOCUS_70790 26140 25397 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026928.1 protein_id gnl|my_center|LOCUS_70790 26344 27147 gene locus_tag LOCUS_70800 gene ppk2 26344 27147 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978711.1 protein_id gnl|my_center|LOCUS_70800 28078 27194 gene locus_tag LOCUS_70810 28078 27194 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026921.1 protein_id gnl|my_center|LOCUS_70810 27489 27509 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 29106 28084 gene locus_tag LOCUS_70820 gene adhP 29106 28084 CDS product alcohol dehydrogenase AdhP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978667.1 protein_id gnl|my_center|LOCUS_70820 30056 29151 gene locus_tag LOCUS_70830 30056 29151 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978666.1 protein_id gnl|my_center|LOCUS_70830 30055 30315 gene locus_tag LOCUS_70840 30055 30315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70840 30312 31313 gene locus_tag LOCUS_70850 30312 31313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026922.1 protein_id gnl|my_center|LOCUS_70850 31499 33514 gene locus_tag LOCUS_70860 31499 33514 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029448.1 protein_id gnl|my_center|LOCUS_70860 33663 34094 gene locus_tag LOCUS_70870 33663 34094 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026899.1 protein_id gnl|my_center|LOCUS_70870 34856 34146 gene locus_tag LOCUS_70880 34856 34146 CDS product DUF4389 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409492.1 protein_id gnl|my_center|LOCUS_70880 35521 34853 gene locus_tag LOCUS_70890 35521 34853 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037896914.1 protein_id gnl|my_center|LOCUS_70890 36604 35714 gene locus_tag LOCUS_70900 36604 35714 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030862061.1 protein_id gnl|my_center|LOCUS_70900 >Feature sequence039 108 33 gene locus_tag LOCUS_t00860 108 33 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 652 164 gene locus_tag LOCUS_70910 652 164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70910 2199 796 gene locus_tag LOCUS_70920 2199 796 CDS product M6 family metalloprotease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975609.1 protein_id gnl|my_center|LOCUS_70920 2577 3230 gene locus_tag LOCUS_70930 2577 3230 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222789.1 protein_id gnl|my_center|LOCUS_70930 3452 5017 gene locus_tag LOCUS_70940 3452 5017 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975611.1 protein_id gnl|my_center|LOCUS_70940 5656 5135 gene locus_tag LOCUS_70950 5656 5135 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028826.1 protein_id gnl|my_center|LOCUS_70950 5767 6558 gene locus_tag LOCUS_70960 5767 6558 CDS product class III extradiol ring-cleavage dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975613.1 protein_id gnl|my_center|LOCUS_70960 7192 8079 gene locus_tag LOCUS_70970 7192 8079 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975615.1 protein_id gnl|my_center|LOCUS_70970 8497 9237 gene locus_tag LOCUS_70980 8497 9237 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028825.1 protein_id gnl|my_center|LOCUS_70980 10274 9234 gene locus_tag LOCUS_70990 10274 9234 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028824.1 protein_id gnl|my_center|LOCUS_70990 10388 11914 gene locus_tag LOCUS_71000 10388 11914 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975618.1 protein_id gnl|my_center|LOCUS_71000 12182 12943 gene locus_tag LOCUS_71010 12182 12943 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975619.1 protein_id gnl|my_center|LOCUS_71010 12940 13887 gene locus_tag LOCUS_71020 gene pfkB 12940 13887 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028823.1 protein_id gnl|my_center|LOCUS_71020 14758 13838 gene locus_tag LOCUS_71030 14758 13838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71030 14478 14508 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 14646 16214 gene locus_tag LOCUS_71040 14646 16214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_71040 16375 16409 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 16416 16604 gene locus_tag LOCUS_71050 16416 16604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71050 17382 16636 gene locus_tag LOCUS_71060 17382 16636 CDS product DUF6227 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975622.1 protein_id gnl|my_center|LOCUS_71060 18868 17558 gene locus_tag LOCUS_71070 18868 17558 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_079062058.1 protein_id gnl|my_center|LOCUS_71070 20027 19014 gene locus_tag LOCUS_71080 20027 19014 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028819.1 protein_id gnl|my_center|LOCUS_71080 21297 20032 gene locus_tag LOCUS_71090 21297 20032 CDS product low temperature requirement protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326457.1 protein_id gnl|my_center|LOCUS_71090 21372 21542 gene locus_tag LOCUS_71100 21372 21542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975626.1 protein_id gnl|my_center|LOCUS_71100 22017 21559 gene locus_tag LOCUS_71110 gene mscL 22017 21559 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975627.1 protein_id gnl|my_center|LOCUS_71110 22686 22075 gene locus_tag LOCUS_71120 22686 22075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028817.1 protein_id gnl|my_center|LOCUS_71120 22685 22915 gene locus_tag LOCUS_71130 22685 22915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71130 23837 22938 gene locus_tag LOCUS_71140 23837 22938 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975629.1 protein_id gnl|my_center|LOCUS_71140 24208 23900 gene locus_tag LOCUS_71150 24208 23900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71150 25682 24276 gene locus_tag LOCUS_71160 25682 24276 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975631.1 protein_id gnl|my_center|LOCUS_71160 27276 25804 gene locus_tag LOCUS_71170 27276 25804 CDS product potassium/proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975632.1 protein_id gnl|my_center|LOCUS_71170 26191 26217 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 27181 27393 gene locus_tag LOCUS_71180 27181 27393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71180 27548 30415 gene locus_tag LOCUS_71190 27548 30415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71190 31181 30540 gene locus_tag LOCUS_71200 31181 30540 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028815.1 protein_id gnl|my_center|LOCUS_71200 >Feature sequence040 251 1288 gene locus_tag LOCUS_71210 251 1288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_71210 897 927 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1269 1412 gene locus_tag LOCUS_71220 1269 1412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71220 1481 1554 gene locus_tag LOCUS_t00870 1481 1554 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1555 1588 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1828 3045 gene locus_tag LOCUS_71230 1828 3045 CDS product PP2C family protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326766.1 protein_id gnl|my_center|LOCUS_71230 3372 4403 gene locus_tag LOCUS_71240 3372 4403 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029440.1 protein_id gnl|my_center|LOCUS_71240 4519 5463 gene locus_tag LOCUS_71250 4519 5463 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230820.1 protein_id gnl|my_center|LOCUS_71250 6867 5476 gene locus_tag LOCUS_71260 6867 5476 CDS product PrsW family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029441.1 protein_id gnl|my_center|LOCUS_71260 7870 6878 gene locus_tag LOCUS_71270 gene trmB 7870 6878 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974862.1 protein_id gnl|my_center|LOCUS_71270 8737 7889 gene locus_tag LOCUS_71280 8737 7889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_71280 8832 8856 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10071 9274 gene locus_tag LOCUS_71290 10071 9274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_71290 10730 9993 gene locus_tag LOCUS_71300 10730 9993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_71300 10086 10131 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11424 13505 gene locus_tag LOCUS_71310 11424 13505 CDS product lasso peptide isopeptide bond-forming cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228688.1 protein_id gnl|my_center|LOCUS_71310 13719 16997 gene locus_tag LOCUS_71320 13719 16997 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485318.1 protein_id gnl|my_center|LOCUS_71320 18948 16984 gene locus_tag LOCUS_71330 18948 16984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71330 19891 19112 gene locus_tag LOCUS_71340 19891 19112 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029446.1 protein_id gnl|my_center|LOCUS_71340 20292 21665 gene locus_tag LOCUS_71350 20292 21665 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974853.1 protein_id gnl|my_center|LOCUS_71350 21854 23917 gene locus_tag LOCUS_71360 21854 23917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71360 23987 24802 gene locus_tag LOCUS_71370 23987 24802 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162494169.1 protein_id gnl|my_center|LOCUS_71370 26097 24820 gene locus_tag LOCUS_71380 26097 24820 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029449.1 protein_id gnl|my_center|LOCUS_71380 26196 26768 gene locus_tag LOCUS_71390 26196 26768 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974850.1 protein_id gnl|my_center|LOCUS_71390 >Feature sequence041 907 110 gene locus_tag LOCUS_71400 907 110 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229732.1 protein_id gnl|my_center|LOCUS_71400 1083 2750 gene locus_tag LOCUS_71410 gene betA 1083 2750 CDS product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229316.1 protein_id gnl|my_center|LOCUS_71410 3783 2911 gene locus_tag LOCUS_71420 gene purU 3783 2911 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974579.1 protein_id gnl|my_center|LOCUS_71420 4814 4449 gene locus_tag LOCUS_71430 4814 4449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71430 4905 4926 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5126 5491 gene locus_tag LOCUS_71440 5126 5491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_71440 5512 6600 gene locus_tag LOCUS_71450 5512 6600 CDS product glycine betaine/L-proline ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029893.1 protein_id gnl|my_center|LOCUS_71450 6600 8609 gene locus_tag LOCUS_71460 6600 8609 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029894.1 protein_id gnl|my_center|LOCUS_71460 8623 9579 gene locus_tag LOCUS_71470 8623 9579 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029895.1 protein_id gnl|my_center|LOCUS_71470 9791 12229 gene locus_tag LOCUS_71480 9791 12229 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229304.1 protein_id gnl|my_center|LOCUS_71480 12252 12887 gene locus_tag LOCUS_71490 12252 12887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_71490 12788 12812 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12880 13137 gene locus_tag LOCUS_71500 12880 13137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_71500 13196 14452 gene locus_tag LOCUS_71510 13196 14452 CDS product sarcosine oxidase subunit beta family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229309.1 protein_id gnl|my_center|LOCUS_71510 13892 13915 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 14649 17699 gene locus_tag LOCUS_71520 14649 17699 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229307.1 protein_id gnl|my_center|LOCUS_71520 14657 14679 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 17692 18294 gene locus_tag LOCUS_71530 17692 18294 CDS product sarcosine oxidase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205601.1 protein_id gnl|my_center|LOCUS_71530 18291 19280 gene locus_tag LOCUS_71540 gene folP 18291 19280 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467816.1 protein_id gnl|my_center|LOCUS_71540 20094 19348 gene locus_tag LOCUS_71550 20094 19348 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229732.1 protein_id gnl|my_center|LOCUS_71550 20540 21625 gene locus_tag LOCUS_71560 20540 21625 CDS product S-(hydroxymethyl)mycothiol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027326.1 protein_id gnl|my_center|LOCUS_71560 21729 22901 gene locus_tag LOCUS_71570 gene solA 21729 22901 CDS product N-methyl-L-tryptophan oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259547.1 protein_id gnl|my_center|LOCUS_71570 >Feature sequence042 12023 12058 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 15425 12561 gene locus_tag LOCUS_71580 15425 12561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_71580 17836 15425 gene locus_tag LOCUS_71590 17836 15425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_71590 15615 15643 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends <21404 17821 gene locus_tag LOCUS_71600 <21404 17821 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030786.1:type I polyketide synthase note possible pseudo, frameshifted 17872 17918 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence043 660 3407 gene locus_tag LOCUS_71610 660 3407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71610 3388 4335 gene locus_tag LOCUS_71620 3388 4335 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031095.1 protein_id gnl|my_center|LOCUS_71620 4332 5048 gene locus_tag LOCUS_71630 4332 5048 CDS product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031096.1 protein_id gnl|my_center|LOCUS_71630 5147 6805 gene locus_tag LOCUS_71640 5147 6805 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228710.1 protein_id gnl|my_center|LOCUS_71640 7477 6887 gene locus_tag LOCUS_71650 7477 6887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71650 7499 7523 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9086 8361 gene locus_tag LOCUS_71660 9086 8361 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229866.1 protein_id gnl|my_center|LOCUS_71660 10069 9083 gene locus_tag LOCUS_71670 gene rfbB 10069 9083 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978112.1 protein_id gnl|my_center|LOCUS_71670 11133 10066 gene locus_tag LOCUS_71680 11133 10066 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257837.1 protein_id gnl|my_center|LOCUS_71680 11757 11134 gene locus_tag LOCUS_71690 11757 11134 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727714.1 protein_id gnl|my_center|LOCUS_71690 12807 11761 gene locus_tag LOCUS_71700 gene rfbD 12807 11761 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417101.1 protein_id gnl|my_center|LOCUS_71700 12971 14158 gene locus_tag LOCUS_71710 12971 14158 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867784.1 protein_id gnl|my_center|LOCUS_71710 13089 13118 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 14155 15084 gene locus_tag LOCUS_71720 14155 15084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71720 15136 16065 gene locus_tag LOCUS_71730 gene fabD 15136 16065 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000032624.1 protein_id gnl|my_center|LOCUS_71730 <19975 16180 gene locus_tag LOCUS_71740 <19975 16180 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_206334115.1:type I polyketide synthase >Feature sequence044 1056 331 gene locus_tag LOCUS_71750 1056 331 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028804.1 protein_id gnl|my_center|LOCUS_71750 1688 1173 gene locus_tag LOCUS_71760 1688 1173 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975651.1 protein_id gnl|my_center|LOCUS_71760 4060 1838 gene locus_tag LOCUS_71770 4060 1838 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028805.1 protein_id gnl|my_center|LOCUS_71770 4769 4161 gene locus_tag LOCUS_71780 4769 4161 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975649.1 protein_id gnl|my_center|LOCUS_71780 4948 8403 gene locus_tag LOCUS_71790 4948 8403 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486705.1 protein_id gnl|my_center|LOCUS_71790 8704 8519 gene locus_tag LOCUS_71800 8704 8519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71800 9740 8838 gene locus_tag LOCUS_71810 9740 8838 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028807.1 protein_id gnl|my_center|LOCUS_71810 10723 9737 gene locus_tag LOCUS_71820 10723 9737 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028808.1 protein_id gnl|my_center|LOCUS_71820 12321 10720 gene locus_tag LOCUS_71830 12321 10720 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028809.1 protein_id gnl|my_center|LOCUS_71830 12506 13132 gene locus_tag LOCUS_71840 12506 13132 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975643.1 protein_id gnl|my_center|LOCUS_71840 13932 13129 gene locus_tag LOCUS_71850 13932 13129 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093456342.1 protein_id gnl|my_center|LOCUS_71850 14016 14501 gene locus_tag LOCUS_71860 14016 14501 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975641.1 protein_id gnl|my_center|LOCUS_71860 14674 14600 gene locus_tag LOCUS_t00880 14674 14600 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 16080 14749 gene locus_tag LOCUS_71870 16080 14749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975639.1 protein_id gnl|my_center|LOCUS_71870 16900 16265 gene locus_tag LOCUS_71880 16900 16265 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804925.1 protein_id gnl|my_center|LOCUS_71880 17418 16918 gene locus_tag LOCUS_71890 17418 16918 CDS product MogA/MoaB family molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028812.1 protein_id gnl|my_center|LOCUS_71890 17948 17415 gene locus_tag LOCUS_71900 gene moaC 17948 17415 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028813.1 protein_id gnl|my_center|LOCUS_71900 19357 18035 gene locus_tag LOCUS_71910 19357 18035 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486735.1 protein_id gnl|my_center|LOCUS_71910 >Feature sequence045 2112 427 gene locus_tag LOCUS_71920 2112 427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71920 4806 2125 gene locus_tag LOCUS_71930 4806 2125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71930 7078 7620 gene locus_tag LOCUS_71940 7078 7620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71940 7617 7808 gene locus_tag LOCUS_71950 7617 7808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71950 7924 7721 gene locus_tag LOCUS_71960 7924 7721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71960 8332 8075 gene locus_tag LOCUS_71970 8332 8075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71970 11142 8713 gene locus_tag LOCUS_71980 11142 8713 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201843320.1 protein_id gnl|my_center|LOCUS_71980 11698 11991 gene locus_tag LOCUS_71990 11698 11991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71990 12122 12289 gene locus_tag LOCUS_72000 12122 12289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971740.1 protein_id gnl|my_center|LOCUS_72000 >Feature sequence046 103 4275 gene locus_tag LOCUS_72010 103 4275 CDS product SCP1.201-like deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051747771.1 protein_id gnl|my_center|LOCUS_72010 4275 4820 gene locus_tag LOCUS_72020 4275 4820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72020 7118 5343 gene locus_tag LOCUS_72030 7118 5343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_72030 7966 7442 gene locus_tag LOCUS_72040 7966 7442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72040 >Feature sequence047 932 964 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence048 <1 4628 gene locus_tag LOCUS_72050 <1 4628 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013222547.1:type I polyketide synthase >Feature sequence049 206 994 gene locus_tag LOCUS_72060 206 994 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028866.1 protein_id gnl|my_center|LOCUS_72060 1385 1017 gene locus_tag LOCUS_72070 1385 1017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72070 1562 1918 gene locus_tag LOCUS_72080 1562 1918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028865.1 protein_id gnl|my_center|LOCUS_72080 1918 3294 gene locus_tag LOCUS_72090 1918 3294 CDS product FtsK/SpoIIIE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028864.1 protein_id gnl|my_center|LOCUS_72090 3329 3955 gene locus_tag LOCUS_72100 3329 3955 CDS product DUF2637 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030190.1 protein_id gnl|my_center|LOCUS_72100 4222 4413 gene locus_tag LOCUS_72110 4222 4413 CDS product mobile element transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226027129.1 protein_id gnl|my_center|LOCUS_72110 4430 4624 gene locus_tag LOCUS_72120 4430 4624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72120 4650 4898 gene locus_tag LOCUS_72130 4650 4898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72130 >Feature sequence050 1499 573 gene locus_tag LOCUS_72140 1499 573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_72140 699 724 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends <5098 1522 gene locus_tag LOCUS_72150 <5098 1522 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_206334115.1:type I polyketide synthase note possible pseudo, frameshifted >Feature sequence051 330 741 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence052 <4922 825 gene locus_tag LOCUS_72160 <4922 825 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015508323.1:type I polyketide synthase >Feature sequence053 >Feature sequence054 >Feature sequence055 <1 3138 gene locus_tag LOCUS_72170 <1 3138 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015508323.1:type I polyketide synthase note possible pseudo, internal stop codon, frameshifted 2706 2728 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence056 305 2464 gene locus_tag LOCUS_72180 305 2464 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031868.1 protein_id gnl|my_center|LOCUS_72180 2477 3034 gene locus_tag LOCUS_72190 2477 3034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971403.1 protein_id gnl|my_center|LOCUS_72190 3162 3386 gene locus_tag LOCUS_72200 3162 3386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72200 >Feature sequence057 <1 3324 gene locus_tag LOCUS_72210 <1 3324 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_206334115.1:type I polyketide synthase >Feature sequence058 >Feature sequence059 <3418 863 gene locus_tag LOCUS_72220 <3418 863 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_151771929.1:type I polyketide synthase >Feature sequence060 <1 1193 gene locus_tag LOCUS_72230 <1 1193 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_206334115.1:type I polyketide synthase >Feature sequence061 251 868 gene locus_tag LOCUS_72240 251 868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975789.1 protein_id gnl|my_center|LOCUS_72240 1903 911 gene locus_tag LOCUS_72250 1903 911 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975790.1 protein_id gnl|my_center|LOCUS_72250 2036 3043 gene locus_tag LOCUS_72260 2036 3043 CDS product stage II sporulation protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975791.1 protein_id gnl|my_center|LOCUS_72260 >Feature sequence062 455 482 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 598 2652 gene locus_tag LOCUS_72270 598 2652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_72270 2571 2599 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence063 596 63 gene locus_tag LOCUS_72280 596 63 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72280 905 1186 gene locus_tag LOCUS_72290 905 1186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72290 1292 1666 gene locus_tag LOCUS_72300 1292 1666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046584027.1 protein_id gnl|my_center|LOCUS_72300 1848 1693 gene locus_tag LOCUS_72310 1848 1693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72310 2301 2011 gene locus_tag LOCUS_72320 2301 2011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72320 2371 2407 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence064 277 319 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1491 634 gene locus_tag LOCUS_72330 gene metF 1491 634 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028143.1 protein_id gnl|my_center|LOCUS_72330 <2404 1488 gene locus_tag LOCUS_72340 <2404 1488 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011027904.1:methionine synthase >Feature sequence065 <2322 175 gene locus_tag LOCUS_72350 <2322 175 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030786.1:type I polyketide synthase note possible pseudo, frameshifted 465 501 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence066 799 823 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1919 933 gene locus_tag LOCUS_72360 1919 933 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326033.1 protein_id gnl|my_center|LOCUS_72360 >Feature sequence067 384 812 gene locus_tag LOCUS_72370 384 812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72370 806 1195 gene locus_tag LOCUS_72380 806 1195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72380 1237 1512 gene locus_tag LOCUS_72390 1237 1512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72390 1965 1678 gene locus_tag LOCUS_72400 1965 1678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72400 >Feature sequence068 >Feature sequence069 1 1824 gene locus_tag LOCUS_72410 1 1824 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894103.1 protein_id gnl|my_center|LOCUS_72410 >Feature sequence070 <1819 1113 gene locus_tag LOCUS_72420 <1819 1113 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_067456433.1:type I polyketide synthase >Feature sequence071 >Feature sequence072 1265 114 gene locus_tag LOCUS_72430 1265 114 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028858.1 protein_id gnl|my_center|LOCUS_72430 1447 1265 gene locus_tag LOCUS_72440 1447 1265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72440 >Feature sequence073 >Feature sequence074 >Feature sequence075 >Feature sequence076 >Feature sequence077 244 271 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence078 1366 176 gene locus_tag LOCUS_72450 1366 176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_72450 210 247 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence079 >Feature sequence080 652 683 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence081 >Feature sequence082 >Feature sequence083 >Feature sequence084 768 795 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence085 >Feature sequence086 >Feature sequence087 611 640 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence088 >Feature sequence089 >Feature sequence090 975 10 gene locus_tag LOCUS_72460 975 10 CDS product IS481 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_058916821.1 protein_id gnl|my_center|LOCUS_72460 >Feature sequence091 >Feature sequence092 >Feature sequence093 >Feature sequence094 610 789 gene locus_tag LOCUS_72470 610 789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72470 >Feature sequence095 >Feature sequence096 >Feature sequence097 >Feature sequence098 >Feature sequence099 >Feature sequence100 >Feature sequence101 >Feature sequence102 >Feature sequence103 >Feature sequence104 >Feature sequence105 >Feature sequence106 >Feature sequence107 353 186 gene locus_tag LOCUS_72480 353 186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72480 >Feature sequence108 >Feature sequence109 >Feature sequence110 >Feature sequence111 >Feature sequence112 >Feature sequence113 >Feature sequence114 >Feature sequence115 >Feature sequence116 >Feature sequence117 273 323 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence118 446 246 gene locus_tag LOCUS_72490 446 246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72490 >Feature sequence119 >Feature sequence120 >Feature sequence121 >Feature sequence122 >Feature sequence123 >Feature sequence124 >Feature sequence125 >Feature sequence126 >Feature sequence127 >Feature sequence128