COMMON DATATYPE type WGS KEYWORD keyword WGS KEYWORD keyword STANDARD_DRAFT DBLINK project biosample SUBMITTER ab_name ab_name ab_name contact email phone fax institute country city street zip REFERENCE title ab_name ab_name ab_name status Unpublished year COMMENT line Annotated by DFAST v.1.2.20 (https://dfast.nig.ac.jp) ST_COMMENT tagset_id Genome-Assembly-Data Assembly Method Genome Coverage Sequencing Technology sequence01 source 1..676634 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 979..2451 product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011787371.1 transl_table 11 codon_start 1 locus_tag LOCUS_00010 CDS complement(2525..3964) product GntR family transcriptional regulator MpaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113004.1 transl_table 11 codon_start 1 locus_tag LOCUS_00020 gene mapR CDS 4545..5267 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00030 CDS complement(5453..6034) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00040 CDS complement(6293..6442) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00050 CDS 6413..8254 product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225764.1 transl_table 11 codon_start 1 locus_tag LOCUS_00060 gene glmS CDS complement(8423..9838) product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261371.1 transl_table 11 codon_start 1 locus_tag LOCUS_00070 gene xseA CDS complement(9926..10723) product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545835.1 transl_table 11 codon_start 1 locus_tag LOCUS_00080 gene mazG CDS 11308..12084 product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007039689.1 transl_table 11 codon_start 1 locus_tag LOCUS_00090 gene kdsB CDS 12104..12961 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00100 CDS 13205..13609 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00110 CDS 13656..13880 product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095634.1 transl_table 11 codon_start 1 locus_tag LOCUS_00120 gene rpsR CDS 13900..14346 product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196065.1 transl_table 11 codon_start 1 locus_tag LOCUS_00130 gene rplI CDS complement(14628..15374) product SapC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639909.1 transl_table 11 codon_start 1 locus_tag LOCUS_00140 CDS complement(15466..16095) product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094903.1 transl_table 11 codon_start 1 locus_tag LOCUS_00150 CDS complement(16095..19031) product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112791.1 transl_table 11 codon_start 1 locus_tag LOCUS_00160 CDS complement(19401..20588) product oxalate decarboxylase family bicupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263596.1 transl_table 11 codon_start 1 locus_tag LOCUS_00170 CDS complement(20734..21450) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00180 CDS complement(21476..23287) product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992488.1 transl_table 11 codon_start 1 locus_tag LOCUS_00190 CDS complement(23800..25410) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00200 tRNA complement(25925..26015) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00010 CDS complement(26139..26804) product arginine ABC transporter permease ArtM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694264.1 transl_table 11 codon_start 1 locus_tag LOCUS_00210 gene artM CDS complement(26814..27560) product arginine ABC transporter permease ArtQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367517.1 transl_table 11 codon_start 1 locus_tag LOCUS_00220 gene artQ CDS complement(27635..28372) product ABC transporter substrate-binding protein ArtJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005048400.1 transl_table 11 codon_start 1 locus_tag LOCUS_00230 gene artJ CDS complement(28590..29315) product arginine ABC transporter ATP-binding protein ArtP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694261.1 transl_table 11 codon_start 1 locus_tag LOCUS_00240 gene artP CDS 29962..30807 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720152.1 transl_table 11 codon_start 1 locus_tag LOCUS_00250 CDS 30800..31207 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00260 CDS complement(32085..35279) product tetrathionate reductase subunit TtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816071.1 transl_table 11 codon_start 1 locus_tag LOCUS_00270 gene ttrA CDS complement(35398..36510) product tetrathionate reductase subunit TtrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170780.1 transl_table 11 codon_start 1 locus_tag LOCUS_00280 gene ttrC CDS complement(36507..37247) product tetrathionate reductase subunit TtrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170783.1 transl_table 11 codon_start 1 locus_tag LOCUS_00290 gene ttrB CDS 38070..39728 product tetrathionate respiration histidine kinase TtrS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816070.1 transl_table 11 codon_start 1 locus_tag LOCUS_00300 gene ttrS CDS 39821..40420 product tetrathionate respiration response regulator TtrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190927.1 transl_table 11 codon_start 1 locus_tag LOCUS_00310 gene ttrR CDS 40685..42514 product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272332.1 transl_table 11 codon_start 1 locus_tag LOCUS_00320 gene recQ CDS complement(42849..44210) product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014508984.1 transl_table 11 codon_start 1 locus_tag LOCUS_00330 CDS complement(44265..44531) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00340 CDS complement(44846..46564) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00350 CDS 46865..47188 product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096336.1 transl_table 11 codon_start 1 locus_tag LOCUS_00360 gene trxA CDS 47630..48616 product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_102990626.1 transl_table 11 codon_start 1 locus_tag LOCUS_00370 gene prfB CDS 48668..50026 product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094867.1 transl_table 11 codon_start 1 locus_tag LOCUS_00380 gene radA CDS 50330..51553 product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705313.1 transl_table 11 codon_start 1 locus_tag LOCUS_00390 CDS 51597..52190 product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084923.1 transl_table 11 codon_start 1 locus_tag LOCUS_00400 CDS complement(52328..64291) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00410 CDS 64681..66042 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00420 CDS complement(66175..66612) product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705855.1 transl_table 11 codon_start 1 locus_tag LOCUS_00430 CDS complement(66621..67349) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00440 CDS complement(67577..68455) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00450 CDS complement(68618..70834) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815626.1 transl_table 11 codon_start 1 locus_tag LOCUS_00460 CDS 71146..72570 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103773.1 transl_table 11 codon_start 1 locus_tag LOCUS_00470 CDS complement(72669..73622) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00480 CDS complement(73918..75009) product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143366.1 transl_table 11 codon_start 1 locus_tag LOCUS_00490 gene tal CDS complement(75237..76406) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00500 CDS complement(76913..78295) product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401567.1 transl_table 11 codon_start 1 locus_tag LOCUS_00510 gene argH CDS complement(78276..80483) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929884.1 transl_table 11 codon_start 1 locus_tag LOCUS_00520 CDS complement(80486..81238) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00530 CDS complement(81466..82803) product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114643.1 transl_table 11 codon_start 1 locus_tag LOCUS_00540 gene rsmB CDS complement(82804..83736) product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166852057.1 transl_table 11 codon_start 1 locus_tag LOCUS_00550 gene fmt CDS complement(83801..84319) product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768180.1 transl_table 11 codon_start 1 locus_tag LOCUS_00560 gene def CDS complement(84586..85809) product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691388.1 transl_table 11 codon_start 1 locus_tag LOCUS_00570 CDS complement(85960..87495) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00580 CDS complement(87505..88965) product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003706086.1 transl_table 11 codon_start 1 locus_tag LOCUS_00590 CDS complement(89307..89957) product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065267398.1 transl_table 11 codon_start 1 locus_tag LOCUS_00600 CDS complement(90135..91082) product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073218.1 transl_table 11 codon_start 1 locus_tag LOCUS_00610 gene hemH CDS complement(91320..92300) product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886970.1 transl_table 11 codon_start 1 locus_tag LOCUS_00620 CDS complement(92460..93542) product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094129.1 transl_table 11 codon_start 1 locus_tag LOCUS_00630 gene mraY CDS complement(93630..95000) product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957393.1 transl_table 11 codon_start 1 locus_tag LOCUS_00640 CDS complement(95005..96552) product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766562.1 transl_table 11 codon_start 1 locus_tag LOCUS_00650 CDS complement(96757..98490) product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010427469.1 transl_table 11 codon_start 1 locus_tag LOCUS_00660 CDS complement(98589..98906) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00670 CDS complement(98903..99838) product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005651812.1 transl_table 11 codon_start 1 locus_tag LOCUS_00680 gene rsmH CDS complement(100085..100507) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00690 CDS complement(100726..101325) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00700 CDS 101650..102444 product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099360.1 transl_table 11 codon_start 1 locus_tag LOCUS_00710 CDS complement(102487..103455) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00720 CDS complement(103452..104099) product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770616.1 transl_table 11 codon_start 1 locus_tag LOCUS_00730 gene tmk CDS complement(104146..105213) product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036223.1 transl_table 11 codon_start 1 locus_tag LOCUS_00740 gene mltG CDS complement(105213..106457) product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482767.1 transl_table 11 codon_start 1 locus_tag LOCUS_00750 gene fabF CDS complement(106608..106841) product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002814322.1 transl_table 11 codon_start 1 locus_tag LOCUS_00760 gene acpP CDS complement(106964..107698) product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106013.1 transl_table 11 codon_start 1 locus_tag LOCUS_00770 gene fabG CDS complement(107914..108630) product cell division protein ZapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818895.1 transl_table 11 codon_start 1 locus_tag LOCUS_00780 gene zapD CDS complement(108671..109288) product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029495251.1 transl_table 11 codon_start 1 locus_tag LOCUS_00790 gene coaE CDS complement(109316..110095) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00800 CDS complement(110092..111135) product type 4 pilus assembly protein PilG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216405.1 transl_table 11 codon_start 1 locus_tag LOCUS_00810 gene pilG tRNA complement(111376..111460) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00020 tRNA complement(111870..111954) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00030 CDS complement(111971..112294) product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000495557.1 transl_table 11 codon_start 1 locus_tag LOCUS_00820 gene secG CDS complement(112316..113065) product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948480.1 transl_table 11 codon_start 1 locus_tag LOCUS_00830 gene tpiA CDS 113257..114309 product rod shape-determining protein MreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002228205.1 transl_table 11 codon_start 1 locus_tag LOCUS_00840 gene mreB CDS 114548..115405 product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704376.1 transl_table 11 codon_start 1 locus_tag LOCUS_00850 gene mreC CDS 115392..115883 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00860 CDS 115891..118044 product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093191.1 transl_table 11 codon_start 1 locus_tag LOCUS_00870 gene mrdA CDS 118034..119170 product peptidoglycan glycosyltransferase MrdB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000781440.1 transl_table 11 codon_start 1 locus_tag LOCUS_00880 gene mrdB CDS 119170..120264 product lytic murein transglycosylase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399773.1 transl_table 11 codon_start 1 locus_tag LOCUS_00890 gene mltB CDS 120267..121415 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00900 CDS 121487..122602 product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555330.1 transl_table 11 codon_start 1 locus_tag LOCUS_00910 CDS 122707..124317 product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208912.1 transl_table 11 codon_start 1 locus_tag LOCUS_00920 gene pckA CDS complement(124483..125520) product 16S rRNA (guanine(1207)-N(2))-methyltransferase RsmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693888.1 transl_table 11 codon_start 1 locus_tag LOCUS_00930 gene rsmC CDS complement(125504..126232) product 16S rRNA pseudouridine(516) synthase RsuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694303.1 transl_table 11 codon_start 1 locus_tag LOCUS_00940 gene rsuA CDS complement(126225..128672) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00950 CDS 128906..129913 product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763270.1 transl_table 11 codon_start 1 locus_tag LOCUS_00960 CDS 130128..130607 product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707018.1 transl_table 11 codon_start 1 locus_tag LOCUS_00970 gene ybeY CDS 130742..131251 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00980 CDS 131942..133129 product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222042.1 transl_table 11 codon_start 1 locus_tag LOCUS_00990 CDS 133308..134981 product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389132.1 transl_table 11 codon_start 1 locus_tag LOCUS_01000 gene pta CDS 135169..135612 product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420637.1 transl_table 11 codon_start 1 locus_tag LOCUS_01010 CDS 135593..135931 product RnfH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021421.1 transl_table 11 codon_start 1 locus_tag LOCUS_01020 CDS complement(136212..136682) product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004407330.1 transl_table 11 codon_start 1 locus_tag LOCUS_01030 CDS complement(136798..138408) product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946915.1 transl_table 11 codon_start 1 locus_tag LOCUS_01040 CDS 138726..140693 product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110216.1 transl_table 11 codon_start 1 locus_tag LOCUS_01050 gene tkt CDS 141316..141696 product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003015446.1 transl_table 11 codon_start 1 locus_tag LOCUS_01060 gene yajC CDS 141820..144660 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01070 CDS 145001..148276 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01080 CDS 148412..149797 product leucyl aminopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957670.1 transl_table 11 codon_start 1 locus_tag LOCUS_01090 CDS 150118..151368 product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971674.1 transl_table 11 codon_start 1 locus_tag LOCUS_01100 CDS 152035..153504 product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218844.1 transl_table 11 codon_start 1 locus_tag LOCUS_01110 CDS complement(153881..154561) product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688628.1 transl_table 11 codon_start 1 locus_tag LOCUS_01120 gene ung CDS 154638..155024 product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095221.1 transl_table 11 codon_start 1 locus_tag LOCUS_01130 gene crcB CDS complement(155340..156434) product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693776.1 transl_table 11 codon_start 1 locus_tag LOCUS_01140 gene ychF CDS complement(156453..157004) product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099278.1 transl_table 11 codon_start 1 locus_tag LOCUS_01150 gene pth CDS complement(157096..157755) product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948352.1 transl_table 11 codon_start 1 locus_tag LOCUS_01160 CDS complement(157837..160080) product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703506.1 transl_table 11 codon_start 1 locus_tag LOCUS_01170 gene parC CDS complement(160261..160926) product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038434.1 transl_table 11 codon_start 1 locus_tag LOCUS_01180 CDS 161114..162373 product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112798.1 transl_table 11 codon_start 1 locus_tag LOCUS_01190 CDS 162871..163512 product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723344.1 transl_table 11 codon_start 1 locus_tag LOCUS_01200 CDS complement(163586..164965) product ATP-dependent RNA helicase DbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211084.1 transl_table 11 codon_start 1 locus_tag LOCUS_01210 gene dbpA CDS complement(165322..166254) product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687141.1 transl_table 11 codon_start 1 locus_tag LOCUS_01220 CDS complement(166308..167468) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001218394.1 transl_table 11 codon_start 1 locus_tag LOCUS_01230 CDS complement(167780..168454) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019084191.1 transl_table 11 codon_start 1 locus_tag LOCUS_01240 CDS complement(168458..169540) product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119636.1 transl_table 11 codon_start 1 locus_tag LOCUS_01250 CDS complement(169937..172012) product GTP diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073302.1 transl_table 11 codon_start 1 locus_tag LOCUS_01260 gene relA CDS 172706..173053 product DsrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003573038.1 transl_table 11 codon_start 1 locus_tag LOCUS_01270 CDS complement(173206..174135) product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000094011.1 transl_table 11 codon_start 1 locus_tag LOCUS_01280 CDS complement(174128..176185) product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478506.1 transl_table 11 codon_start 1 locus_tag LOCUS_01290 gene ligA CDS complement(176393..177445) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01300 CDS complement(177602..178729) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01310 CDS complement(178879..179535) product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093227.1 transl_table 11 codon_start 1 locus_tag LOCUS_01320 gene ubiX CDS complement(179741..180637) product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010981020.1 transl_table 11 codon_start 1 locus_tag LOCUS_01330 gene hslO CDS complement(180630..182219) product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809992.1 transl_table 11 codon_start 1 locus_tag LOCUS_01340 CDS 182317..184968 product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261298.1 transl_table 11 codon_start 1 locus_tag LOCUS_01350 gene mutS CDS 185077..185868 product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704754.1 transl_table 11 codon_start 1 locus_tag LOCUS_01360 gene ybfF tRNA 185957..186041 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00040 CDS complement(186389..186646) product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388730.1 transl_table 11 codon_start 1 locus_tag LOCUS_01370 CDS 186854..187498 product YoaK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674956.1 transl_table 11 codon_start 1 locus_tag LOCUS_01380 CDS complement(187808..188197) product SUF system Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919725.1 transl_table 11 codon_start 1 locus_tag LOCUS_01390 CDS complement(188257..188703) product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141374.1 transl_table 11 codon_start 1 locus_tag LOCUS_01400 CDS 189161..190030 product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815925.1 transl_table 11 codon_start 1 locus_tag LOCUS_01410 gene accD CDS 190269..191603 product bifunctional tetrahydrofolate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000584581.1 transl_table 11 codon_start 1 locus_tag LOCUS_01420 gene folC CDS 191596..192483 product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036165.1 transl_table 11 codon_start 1 locus_tag LOCUS_01430 CDS 192533..193135 product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957874.1 transl_table 11 codon_start 1 locus_tag LOCUS_01440 CDS 193314..194003 product bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113434.1 transl_table 11 codon_start 1 locus_tag LOCUS_01450 CDS 194384..195109 product YciK family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208030.1 transl_table 11 codon_start 1 locus_tag LOCUS_01460 CDS 195164..196642 product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948371.1 transl_table 11 codon_start 1 locus_tag LOCUS_01470 CDS 196635..198059 product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958524.1 transl_table 11 codon_start 1 locus_tag LOCUS_01480 CDS 198613..200544 product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025862385.1 transl_table 11 codon_start 1 locus_tag LOCUS_01490 CDS 200565..201167 product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071503.1 transl_table 11 codon_start 1 locus_tag LOCUS_01500 gene plsY CDS 201420..202964 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01510 CDS 203162..204121 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287494.1 transl_table 11 codon_start 1 locus_tag LOCUS_01520 CDS 204114..204887 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005304632.1 transl_table 11 codon_start 1 locus_tag LOCUS_01530 CDS 205060..205851 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01540 CDS 205942..206748 product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207254.1 transl_table 11 codon_start 1 locus_tag LOCUS_01550 CDS 206919..207920 product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482451.1 transl_table 11 codon_start 1 locus_tag LOCUS_01560 gene gshB CDS 208001..209062 product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000930034.1 transl_table 11 codon_start 1 locus_tag LOCUS_01570 CDS 209163..210029 product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038352.1 transl_table 11 codon_start 1 locus_tag LOCUS_01580 tRNA 210108..210184 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00050 CDS 210316..211347 product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951005.1 transl_table 11 codon_start 1 locus_tag LOCUS_01590 CDS 211580..213226 product glutamine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454579.1 transl_table 11 codon_start 1 locus_tag LOCUS_01600 gene glnS CDS 213229..213927 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207230.1 transl_table 11 codon_start 1 locus_tag LOCUS_01610 CDS 213924..214616 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085936.1 transl_table 11 codon_start 1 locus_tag LOCUS_01620 CDS complement(215221..216957) product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262668.1 transl_table 11 codon_start 1 locus_tag LOCUS_01630 gene dnaG CDS complement(217360..217803) product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190948.1 transl_table 11 codon_start 1 locus_tag LOCUS_01640 CDS complement(218024..219502) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01650 CDS complement(219634..220641) product tRNA dihydrouridine(20/20a) synthase DusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073658.1 transl_table 11 codon_start 1 locus_tag LOCUS_01660 gene dusA CDS complement(220922..222760) product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411788.1 transl_table 11 codon_start 1 locus_tag LOCUS_01670 gene rpoD CDS complement(222980..224059) product RNA polymerase sigma factor RpoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113871.1 transl_table 11 codon_start 1 locus_tag LOCUS_01680 gene rpoS CDS complement(224384..225553) product PatB family C-S lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257518.1 transl_table 11 codon_start 1 locus_tag LOCUS_01690 CDS complement(225766..227205) product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707191.1 transl_table 11 codon_start 1 locus_tag LOCUS_01700 CDS 227620..228393 product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816801.1 transl_table 11 codon_start 1 locus_tag LOCUS_01710 gene modA CDS 228826..229521 product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005158971.1 transl_table 11 codon_start 1 locus_tag LOCUS_01720 gene modB CDS 229572..230279 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01730 CDS 230579..231055 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01740 CDS complement(231326..231853) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01750 CDS complement(232222..233640) product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766607.1 transl_table 11 codon_start 1 locus_tag LOCUS_01760 CDS complement(234170..236350) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01770 CDS complement(236471..240280) product exodeoxyribonuclease V subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043027345.1 transl_table 11 codon_start 1 locus_tag LOCUS_01780 gene recB CDS complement(240592..241143) product Smr/MutS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957861.1 transl_table 11 codon_start 1 locus_tag LOCUS_01790 CDS complement(241185..241811) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01800 CDS 242307..243317 product glyoxylate/hydroxypyruvate reductase GhrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005161303.1 transl_table 11 codon_start 1 locus_tag LOCUS_01810 gene ghrA CDS 243481..243738 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01820 CDS complement(243860..244609) product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704663.1 transl_table 11 codon_start 1 locus_tag LOCUS_01830 gene rlmB CDS 244998..246326 product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000887578.1 transl_table 11 codon_start 1 locus_tag LOCUS_01840 CDS 246330..247340 product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528683.1 transl_table 11 codon_start 1 locus_tag LOCUS_01850 CDS complement(247911..248996) product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704732.1 transl_table 11 codon_start 1 locus_tag LOCUS_01860 gene fbaA CDS complement(249333..250532) product alanine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947188.1 transl_table 11 codon_start 1 locus_tag LOCUS_01870 gene alaC CDS 251169..253010 product ribosome-dependent GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000570668.1 transl_table 11 codon_start 1 locus_tag LOCUS_01880 gene typA CDS complement(253355..253663) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01890 CDS complement(254279..255253) product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225592.1 transl_table 11 codon_start 1 locus_tag LOCUS_01900 gene nagZ CDS complement(255575..256381) product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043921634.1 transl_table 11 codon_start 1 locus_tag LOCUS_01910 CDS complement(256437..257495) product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261596.1 transl_table 11 codon_start 1 locus_tag LOCUS_01920 gene ruvB CDS complement(257735..258547) product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687811.1 transl_table 11 codon_start 1 locus_tag LOCUS_01930 gene folE2 CDS complement(258767..259282) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01940 CDS 259643..260554 product lipid A biosynthesis lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114803.1 transl_table 11 codon_start 1 locus_tag LOCUS_01950 CDS 260925..261449 product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087475.1 transl_table 11 codon_start 1 locus_tag LOCUS_01960 gene fabA CDS 261470..262690 product beta-ketoacyl-ACP synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769613.1 transl_table 11 codon_start 1 locus_tag LOCUS_01970 gene fabB CDS complement(263089..264768) product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002439581.1 transl_table 11 codon_start 1 locus_tag LOCUS_01980 CDS complement(264849..266357) product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732584.1 transl_table 11 codon_start 1 locus_tag LOCUS_01990 gene glpK CDS complement(266582..267430) product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001103743.1 transl_table 11 codon_start 1 locus_tag LOCUS_02000 CDS complement(267881..268912) product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103565.1 transl_table 11 codon_start 1 locus_tag LOCUS_02010 CDS complement(268927..269580) product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113296.1 transl_table 11 codon_start 1 locus_tag LOCUS_02020 CDS complement(270168..270638) product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649848.1 transl_table 11 codon_start 1 locus_tag LOCUS_02030 gene rlmH CDS complement(270728..271057) product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071401.1 transl_table 11 codon_start 1 locus_tag LOCUS_02040 gene rsfS CDS 271224..272504 product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071513.1 transl_table 11 codon_start 1 locus_tag LOCUS_02050 gene hemL CDS 272517..273197 product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005739815.1 transl_table 11 codon_start 1 locus_tag LOCUS_02060 gene rpe CDS 274266..275369 product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209981.1 transl_table 11 codon_start 1 locus_tag LOCUS_02070 CDS 275494..275730 product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096556.1 transl_table 11 codon_start 1 locus_tag LOCUS_02080 gene rpmB CDS 275741..275896 product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208990.1 transl_table 11 codon_start 1 locus_tag LOCUS_02090 gene rpmG CDS complement(276209..276397) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02100 CDS 276443..279199 product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113794.1 transl_table 11 codon_start 1 locus_tag LOCUS_02110 CDS 280079..281479 product alanine/glycine:cation symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356603.1 transl_table 11 codon_start 1 locus_tag LOCUS_02120 CDS 281713..282018 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02130 CDS complement(282838..287187) product autotransporter adhesin EhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001491890.1 transl_table 11 codon_start 1 locus_tag LOCUS_02140 gene ehaA CDS complement(288117..291659) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02150 CDS complement(292163..293359) product linear amide C-N hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207030.1 transl_table 11 codon_start 1 locus_tag LOCUS_02160 CDS complement(294026..295984) product PhoX family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097695.1 transl_table 11 codon_start 1 locus_tag LOCUS_02170 CDS 296309..297673 product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015670.1 transl_table 11 codon_start 1 locus_tag LOCUS_02180 CDS complement(298117..298449) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02190 CDS complement(298789..299574) product HesA/MoeB/ThiF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_114935810.1 transl_table 11 codon_start 1 locus_tag LOCUS_02200 CDS 299717..300256 product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769770.1 transl_table 11 codon_start 1 locus_tag LOCUS_02210 gene hslV CDS 300457..301797 product HslU--HslV peptidase ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707776.1 transl_table 11 codon_start 1 locus_tag LOCUS_02220 gene hslU CDS complement(301995..303134) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530620.1 transl_table 11 codon_start 1 locus_tag LOCUS_02230 CDS complement(303372..305036) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02240 CDS complement(305153..305512) product YajD family HNH nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071871.1 transl_table 11 codon_start 1 locus_tag LOCUS_02250 CDS 305936..306184 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02260 CDS 306326..307597 product multifunctional CCA addition/repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207256.1 transl_table 11 codon_start 1 locus_tag LOCUS_02270 tRNA 307668..307744 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00060 tRNA 307782..307858 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00070 tRNA 307924..307999 product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00080 tRNA 308072..308148 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00090 CDS 308646..309095 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02280 CDS complement(309215..310630) product multidrug transporter subunit MdtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099391.1 transl_table 11 codon_start 1 locus_tag LOCUS_02290 gene mdtD CDS 311477..312325 product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073596.1 transl_table 11 codon_start 1 locus_tag LOCUS_02300 gene prmC CDS 312449..313255 product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976286.1 transl_table 11 codon_start 1 locus_tag LOCUS_02310 CDS complement(313529..314410) product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219495.1 transl_table 11 codon_start 1 locus_tag LOCUS_02320 gene htpX CDS complement(314865..315236) product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946144.1 transl_table 11 codon_start 1 locus_tag LOCUS_02330 gene rplS CDS complement(315326..315946) product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816405.1 transl_table 11 codon_start 1 locus_tag LOCUS_02340 CDS complement(316595..317242) product ADP-ribose diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024943166.1 transl_table 11 codon_start 1 locus_tag LOCUS_02350 gene nudF CDS complement(317342..317968) product YcbK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295932.1 transl_table 11 codon_start 1 locus_tag LOCUS_02360 CDS 318351..319745 product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417345.1 transl_table 11 codon_start 1 locus_tag LOCUS_02370 CDS complement(320171..320899) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02380 CDS complement(320963..321496) product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199927.1 transl_table 11 codon_start 1 locus_tag LOCUS_02390 gene mlaD CDS complement(321607..322239) product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693388.1 transl_table 11 codon_start 1 locus_tag LOCUS_02400 gene rnhB CDS complement(322524..323729) product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262425.1 transl_table 11 codon_start 1 locus_tag LOCUS_02410 gene lpxB CDS complement(324180..324968) product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690038.1 transl_table 11 codon_start 1 locus_tag LOCUS_02420 gene lpxA CDS complement(324968..325429) product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071795.1 transl_table 11 codon_start 1 locus_tag LOCUS_02430 gene fabZ CDS complement(325626..326681) product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098585.1 transl_table 11 codon_start 1 locus_tag LOCUS_02440 gene lpxD CDS complement(326668..327207) product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690321.1 transl_table 11 codon_start 1 locus_tag LOCUS_02450 CDS complement(327228..329762) product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266976.1 transl_table 11 codon_start 1 locus_tag LOCUS_02460 gene bamA CDS complement(329853..331226) product sigma E protease regulator RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456697.1 transl_table 11 codon_start 1 locus_tag LOCUS_02470 gene rseP CDS complement(331255..332442) product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000811923.1 transl_table 11 codon_start 1 locus_tag LOCUS_02480 gene ispC CDS complement(332507..333382) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02490 CDS complement(333389..334057) product (2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368162.1 transl_table 11 codon_start 1 locus_tag LOCUS_02500 gene ispU CDS complement(334118..334675) product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947438.1 transl_table 11 codon_start 1 locus_tag LOCUS_02510 gene frr CDS complement(335176..335904) product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036563.1 transl_table 11 codon_start 1 locus_tag LOCUS_02520 gene pyrH CDS complement(336231..336719) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02530 CDS 336983..337792 product tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406500.1 transl_table 11 codon_start 1 locus_tag LOCUS_02540 gene trmJ CDS 337974..338759 product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100615.1 transl_table 11 codon_start 1 locus_tag LOCUS_02550 gene cysE CDS complement(339010..339672) product FCD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722382.1 transl_table 11 codon_start 1 locus_tag LOCUS_02560 CDS complement(339755..340321) product malonate decarboxylase holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287544.1 transl_table 11 codon_start 1 locus_tag LOCUS_02570 CDS complement(340363..342042) product biotin-independent malonate decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287546.1 transl_table 11 codon_start 1 locus_tag LOCUS_02580 gene mdcD CDS complement(342032..342331) product malonate decarboxylase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287548.1 transl_table 11 codon_start 1 locus_tag LOCUS_02590 CDS complement(342312..343247) product triphosphoribosyl-dephospho-CoA synthase MdcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287541.1 transl_table 11 codon_start 1 locus_tag LOCUS_02600 gene mdcB CDS complement(343248..344888) product malonate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287549.1 transl_table 11 codon_start 1 locus_tag LOCUS_02610 gene mdcA CDS complement(344885..345799) product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002329655.1 transl_table 11 codon_start 1 locus_tag LOCUS_02620 CDS complement(345810..347393) product purine/pyrimidine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000847027.1 transl_table 11 codon_start 1 locus_tag LOCUS_02630 CDS complement(347518..348615) product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870059.1 transl_table 11 codon_start 1 locus_tag LOCUS_02640 CDS complement(349003..351888) product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206955.1 transl_table 11 codon_start 1 locus_tag LOCUS_02650 CDS 352550..354238 product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000790168.1 transl_table 11 codon_start 1 locus_tag LOCUS_02660 gene lepA CDS 354294..355130 product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930929.1 transl_table 11 codon_start 1 locus_tag LOCUS_02670 gene lepB CDS 355132..355800 product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693887.1 transl_table 11 codon_start 1 locus_tag LOCUS_02680 gene rnc CDS 355802..356692 product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071558.1 transl_table 11 codon_start 1 locus_tag LOCUS_02690 gene era CDS 356817..357755 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419994.1 transl_table 11 codon_start 1 locus_tag LOCUS_02700 CDS 358061..359119 product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765632.1 transl_table 11 codon_start 1 locus_tag LOCUS_02710 CDS 359043..359699 product aminotransferase class IV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107438.1 transl_table 11 codon_start 1 locus_tag LOCUS_02720 CDS complement(359745..360593) product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406331.1 transl_table 11 codon_start 1 locus_tag LOCUS_02730 gene purU CDS 361242..362480 product uracil-xanthine permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225164.1 transl_table 11 codon_start 1 locus_tag LOCUS_02740 CDS 362631..363842 product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946634.1 transl_table 11 codon_start 1 locus_tag LOCUS_02750 gene mutY CDS 363993..366734 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02760 CDS 366856..367632 product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) ApaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261098.1 transl_table 11 codon_start 1 locus_tag LOCUS_02770 gene apaH CDS 367862..368482 product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096980.1 transl_table 11 codon_start 1 locus_tag LOCUS_02780 gene yihA CDS 368472..369455 product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815870.1 transl_table 11 codon_start 1 locus_tag LOCUS_02790 gene glk CDS 369470..370303 product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001056719.1 transl_table 11 codon_start 1 locus_tag LOCUS_02800 CDS 370438..371262 product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000016631.1 transl_table 11 codon_start 1 locus_tag LOCUS_02810 gene truA CDS 371591..372598 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02820 CDS 372795..373580 product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040933466.1 transl_table 11 codon_start 1 locus_tag LOCUS_02830 CDS 373740..374111 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02840 CDS 374264..374896 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02850 CDS complement(374977..376053) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118385.1 transl_table 11 codon_start 1 locus_tag LOCUS_02860 CDS 376512..377153 product RnfABCDGE type electron transport complex subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020399.1 transl_table 11 codon_start 1 locus_tag LOCUS_02870 CDS 377269..378072 product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005739136.1 transl_table 11 codon_start 1 locus_tag LOCUS_02880 gene nth CDS complement(378391..379446) product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946868.1 transl_table 11 codon_start 1 locus_tag LOCUS_02890 CDS complement(379446..380219) product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707415.1 transl_table 11 codon_start 1 locus_tag LOCUS_02900 CDS complement(380319..380855) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02910 CDS complement(381046..381324) product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043034.1 transl_table 11 codon_start 1 locus_tag LOCUS_02920 CDS complement(381455..383905) product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005493728.1 transl_table 11 codon_start 1 locus_tag LOCUS_02930 gene lon CDS 384089..386131 product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957630.1 transl_table 11 codon_start 1 locus_tag LOCUS_02940 gene uvrB CDS 386260..387093 product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958646.1 transl_table 11 codon_start 1 locus_tag LOCUS_02950 gene proC CDS 387779..388342 product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003013795.1 transl_table 11 codon_start 1 locus_tag LOCUS_02960 CDS 388587..389099 product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001134566.1 transl_table 11 codon_start 1 locus_tag LOCUS_02970 gene tadA CDS 389162..390295 product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192347.1 transl_table 11 codon_start 1 locus_tag LOCUS_02980 gene zapE CDS 390553..393552 product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399302.1 transl_table 11 codon_start 1 locus_tag LOCUS_02990 CDS 393785..394753 product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196428.1 transl_table 11 codon_start 1 locus_tag LOCUS_03000 CDS 395111..396196 product putative sulfate exporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642118.1 transl_table 11 codon_start 1 locus_tag LOCUS_03010 CDS complement(396249..396908) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03020 CDS complement(397011..398189) product bifunctional tRNA (adenosine(37)-C2)-methyltransferase TrmG/ribosomal RNA large subunit methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444483.1 transl_table 11 codon_start 1 locus_tag LOCUS_03030 CDS complement(398282..398719) product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020029.1 transl_table 11 codon_start 1 locus_tag LOCUS_03040 gene ndk CDS complement(398848..399753) product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082604.1 transl_table 11 codon_start 1 locus_tag LOCUS_03050 CDS complement(399945..401852) product TonB-dependent vitamin B12 receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112350.1 transl_table 11 codon_start 1 locus_tag LOCUS_03060 gene btuB CDS complement(402149..403246) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209211630.1 transl_table 11 codon_start 1 locus_tag LOCUS_03070 CDS complement(403259..404002) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478119.1 transl_table 11 codon_start 1 locus_tag LOCUS_03080 CDS complement(404135..405097) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03090 CDS complement(405099..405836) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03100 CDS complement(406139..408112) product DNA helicase Rep inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455214.1 transl_table 11 codon_start 1 locus_tag LOCUS_03110 gene rep CDS complement(408129..409103) product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195206.1 transl_table 11 codon_start 1 locus_tag LOCUS_03120 CDS 409437..410390 product arsenic resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105579.1 transl_table 11 codon_start 1 locus_tag LOCUS_03130 CDS 410442..410672 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03140 CDS 410834..412507 product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113905.1 transl_table 11 codon_start 1 locus_tag LOCUS_03150 gene recN CDS complement(412830..416891) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03160 CDS complement(417382..417819) product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764092.1 transl_table 11 codon_start 1 locus_tag LOCUS_03170 CDS 417861..419036 product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010634306.1 transl_table 11 codon_start 1 locus_tag LOCUS_03180 gene tgt CDS 419206..420261 product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092864.1 transl_table 11 codon_start 1 locus_tag LOCUS_03190 gene lptF CDS 420293..421330 product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764084.1 transl_table 11 codon_start 1 locus_tag LOCUS_03200 gene lptG CDS complement(421638..422936) product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460670.1 transl_table 11 codon_start 1 locus_tag LOCUS_03210 CDS complement(423004..424059) product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460668.1 transl_table 11 codon_start 1 locus_tag LOCUS_03220 gene hflC CDS complement(424078..425424) product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266497.1 transl_table 11 codon_start 1 locus_tag LOCUS_03230 gene hflK CDS complement(425704..427020) product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957944.1 transl_table 11 codon_start 1 locus_tag LOCUS_03240 gene hflX CDS complement(427140..427406) product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036893.1 transl_table 11 codon_start 1 locus_tag LOCUS_03250 gene hfq CDS 427717..428514 product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016356.1 transl_table 11 codon_start 1 locus_tag LOCUS_03260 CDS 428781..429578 product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694086.1 transl_table 11 codon_start 1 locus_tag LOCUS_03270 CDS 429910..430674 product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003706583.1 transl_table 11 codon_start 1 locus_tag LOCUS_03280 gene yaaA CDS 431001..431537 product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456987.1 transl_table 11 codon_start 1 locus_tag LOCUS_03290 gene orn CDS 431689..432171 product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001283269.1 transl_table 11 codon_start 1 locus_tag LOCUS_03300 gene pgpA CDS 432186..432800 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03310 CDS 432877..433983 product MlaE family lipid ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772900.1 transl_table 11 codon_start 1 locus_tag LOCUS_03320 CDS 433996..434823 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013650221.1 transl_table 11 codon_start 1 locus_tag LOCUS_03330 CDS 434807..435751 product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947761.1 transl_table 11 codon_start 1 locus_tag LOCUS_03340 CDS 435889..436482 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03350 CDS 436509..437372 product DUF4743 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387967.1 transl_table 11 codon_start 1 locus_tag LOCUS_03360 CDS complement(437711..439195) product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799204.1 transl_table 11 codon_start 1 locus_tag LOCUS_03370 CDS 439395..440294 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03380 CDS 440472..441983 product threonine ammonia-lyase, biosynthetic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110582.1 transl_table 11 codon_start 1 locus_tag LOCUS_03390 gene ilvA CDS complement(442242..443198) product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116992.1 transl_table 11 codon_start 1 locus_tag LOCUS_03400 gene ispH CDS complement(443191..443817) product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002223159.1 transl_table 11 codon_start 1 locus_tag LOCUS_03410 CDS complement(444027..444557) product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009387467.1 transl_table 11 codon_start 1 locus_tag LOCUS_03420 gene lspA CDS complement(444550..447408) product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005488695.1 transl_table 11 codon_start 1 locus_tag LOCUS_03430 gene ileS CDS complement(447418..448359) product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477935.1 transl_table 11 codon_start 1 locus_tag LOCUS_03440 gene ribF CDS complement(448421..448804) product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004397026.1 transl_table 11 codon_start 1 locus_tag LOCUS_03450 gene rplQ CDS complement(448834..449838) product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116730.1 transl_table 11 codon_start 1 locus_tag LOCUS_03460 gene rpoA CDS complement(449899..450519) product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215455.1 transl_table 11 codon_start 1 locus_tag LOCUS_03470 gene rpsD CDS complement(450547..450936) product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093689.1 transl_table 11 codon_start 1 locus_tag LOCUS_03480 gene rpsK CDS complement(450959..451312) product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070630.1 transl_table 11 codon_start 1 locus_tag LOCUS_03490 gene rpsM CDS complement(451518..452942) product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703640.1 transl_table 11 codon_start 1 locus_tag LOCUS_03500 gene secY CDS complement(452945..453379) product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957463.1 transl_table 11 codon_start 1 locus_tag LOCUS_03510 gene rplO CDS complement(453394..453576) product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215447.1 transl_table 11 codon_start 1 locus_tag LOCUS_03520 gene rpmD CDS complement(453580..454098) product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703641.1 transl_table 11 codon_start 1 locus_tag LOCUS_03530 gene rpsE CDS complement(454114..454467) product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070627.1 transl_table 11 codon_start 1 locus_tag LOCUS_03540 gene rplR CDS complement(454477..455013) product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116801.1 transl_table 11 codon_start 1 locus_tag LOCUS_03550 gene rplF CDS complement(455027..455425) product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185153.1 transl_table 11 codon_start 1 locus_tag LOCUS_03560 gene rpsH CDS complement(455437..455742) product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400428.1 transl_table 11 codon_start 1 locus_tag LOCUS_03570 gene rpsN CDS complement(455760..456302) product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010371090.1 transl_table 11 codon_start 1 locus_tag LOCUS_03580 gene rplE CDS complement(456498..456731) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03590 CDS complement(456750..457118) product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307975.1 transl_table 11 codon_start 1 locus_tag LOCUS_03600 gene rplN CDS complement(457121..457390) product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201274.1 transl_table 11 codon_start 1 locus_tag LOCUS_03610 gene rpsQ CDS complement(457390..457599) product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003017801.1 transl_table 11 codon_start 1 locus_tag LOCUS_03620 gene rpmC CDS complement(457615..458028) product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036127.1 transl_table 11 codon_start 1 locus_tag LOCUS_03630 gene rplP CDS complement(458031..458723) product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036126.1 transl_table 11 codon_start 1 locus_tag LOCUS_03640 gene rpsC CDS complement(458739..459071) product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003486710.1 transl_table 11 codon_start 1 locus_tag LOCUS_03650 gene rplV CDS complement(459086..459358) product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003027195.1 transl_table 11 codon_start 1 locus_tag LOCUS_03660 gene rpsS CDS complement(459382..460206) product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070620.1 transl_table 11 codon_start 1 locus_tag LOCUS_03670 gene rplB CDS complement(460206..460514) product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021599.1 transl_table 11 codon_start 1 locus_tag LOCUS_03680 gene rplW CDS complement(460511..461119) product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002049755.1 transl_table 11 codon_start 1 locus_tag LOCUS_03690 gene rplD CDS complement(461119..461772) product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103877.1 transl_table 11 codon_start 1 locus_tag LOCUS_03700 gene rplC CDS complement(461851..462162) product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417222.1 transl_table 11 codon_start 1 locus_tag LOCUS_03710 gene rpsJ CDS complement(462216..463406) product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115146.1 transl_table 11 codon_start 1 locus_tag LOCUS_03720 gene tuf CDS complement(463526..465625) product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957451.1 transl_table 11 codon_start 1 locus_tag LOCUS_03730 gene fusA CDS complement(465730..466200) product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005306266.1 transl_table 11 codon_start 1 locus_tag LOCUS_03740 gene rpsG CDS complement(466255..466629) product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093744.1 transl_table 11 codon_start 1 locus_tag LOCUS_03750 gene rpsL CDS complement(466738..467529) product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649892.1 transl_table 11 codon_start 1 locus_tag LOCUS_03760 gene fdhD CDS complement(467590..468774) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03770 CDS complement(468831..469790) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03780 CDS complement(469783..470064) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03790 CDS 470410..470724 product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005304210.1 transl_table 11 codon_start 1 locus_tag LOCUS_03800 gene rplU CDS 470750..471010 product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007650346.1 transl_table 11 codon_start 1 locus_tag LOCUS_03810 gene rpmA CDS 471096..472223 product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948349.1 transl_table 11 codon_start 1 locus_tag LOCUS_03820 gene obgE CDS complement(472476..474287) product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192702.1 transl_table 11 codon_start 1 locus_tag LOCUS_03830 gene lpdA CDS complement(474299..475993) product dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205154.1 transl_table 11 codon_start 1 locus_tag LOCUS_03840 gene aceF CDS complement(476244..478916) product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811941.1 transl_table 11 codon_start 1 locus_tag LOCUS_03850 gene aceE CDS complement(479457..479882) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03860 CDS 480534..481583 product methionine ABC transporter ATP-binding protein MetN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459161.1 transl_table 11 codon_start 1 locus_tag LOCUS_03870 gene metN CDS 481669..482346 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317371.1 transl_table 11 codon_start 1 locus_tag LOCUS_03880 CDS 482553..483443 product diaminopimelate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203408.1 transl_table 11 codon_start 1 locus_tag LOCUS_03890 CDS 483988..484767 product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815192.1 transl_table 11 codon_start 1 locus_tag LOCUS_03900 CDS 484938..485201 product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308808.1 transl_table 11 codon_start 1 locus_tag LOCUS_03910 gene rpsT CDS complement(485434..485994) product Sua5/YciO/YrdC/YwlC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704272.1 transl_table 11 codon_start 1 locus_tag LOCUS_03920 CDS complement(485996..487471) product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064300.1 transl_table 11 codon_start 1 locus_tag LOCUS_03930 CDS complement(487518..488873) product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817382.1 transl_table 11 codon_start 1 locus_tag LOCUS_03940 gene gorA CDS complement(488994..489593) product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094151.1 transl_table 11 codon_start 1 locus_tag LOCUS_03950 CDS complement(489943..490509) product phosphoheptose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070670.1 transl_table 11 codon_start 1 locus_tag LOCUS_03960 CDS complement(490582..491460) product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704351.1 transl_table 11 codon_start 1 locus_tag LOCUS_03970 gene rpoH CDS 491832..494159 product NADP-dependent oxaloacetate-decarboxylating malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098212.1 transl_table 11 codon_start 1 locus_tag LOCUS_03980 gene maeB CDS 494375..495073 product amidase activator ActS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369803.1 transl_table 11 codon_start 1 locus_tag LOCUS_03990 gene actS CDS complement(495205..496728) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04000 CDS complement(496821..497213) product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035728.1 transl_table 11 codon_start 1 locus_tag LOCUS_04010 gene rpsI CDS complement(497234..497662) product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000847559.1 transl_table 11 codon_start 1 locus_tag LOCUS_04020 gene rplM CDS 498272..499069 product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816565.1 transl_table 11 codon_start 1 locus_tag LOCUS_04030 CDS complement(499308..501083) product fructose-specific PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037515.1 transl_table 11 codon_start 1 locus_tag LOCUS_04040 CDS complement(501087..502046) product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389724.1 transl_table 11 codon_start 1 locus_tag LOCUS_04050 gene pfkB CDS complement(502043..504601) product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336984.1 transl_table 11 codon_start 1 locus_tag LOCUS_04060 gene ptsP CDS 505006..506460 product DUF4139 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011342568.1 transl_table 11 codon_start 1 locus_tag LOCUS_04070 CDS 506627..507682 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04080 CDS 507775..508347 product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583271.1 transl_table 11 codon_start 1 locus_tag LOCUS_04090 CDS 508524..509345 product 4,5-DOPA dioxygenase extradiol inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324092.1 transl_table 11 codon_start 1 locus_tag LOCUS_04100 gene ygiD CDS complement(509526..510845) product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174847132.1 transl_table 11 codon_start 1 locus_tag LOCUS_04110 CDS complement(510857..512446) product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385648.1 transl_table 11 codon_start 1 locus_tag LOCUS_04120 CDS complement(512457..512990) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04130 CDS 513508..515820 product heme/hemoglobin uptake receptor PhuR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113453.1 transl_table 11 codon_start 1 locus_tag LOCUS_04140 gene phuR CDS complement(515825..515995) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04150 CDS 516036..516947 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04160 CDS 516951..517964 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013844765.1 transl_table 11 codon_start 1 locus_tag LOCUS_04170 CDS 517964..518761 product heme ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815405.1 transl_table 11 codon_start 1 locus_tag LOCUS_04180 CDS 518895..519677 product HugZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112758.1 transl_table 11 codon_start 1 locus_tag LOCUS_04190 CDS complement(519933..522227) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112509.1 transl_table 11 codon_start 1 locus_tag LOCUS_04200 CDS complement(522859..524688) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895539.1 transl_table 11 codon_start 1 locus_tag LOCUS_04210 CDS complement(524797..526284) product malate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083116.1 transl_table 11 codon_start 1 locus_tag LOCUS_04220 gene mqo CDS complement(526286..526717) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083117.1 transl_table 11 codon_start 1 locus_tag LOCUS_04230 CDS complement(527108..527674) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04240 CDS complement(528222..529856) product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206039.1 transl_table 11 codon_start 1 locus_tag LOCUS_04250 CDS complement(530056..531519) product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206038.1 transl_table 11 codon_start 1 locus_tag LOCUS_04260 CDS complement(531713..532504) product aspartate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206037.1 transl_table 11 codon_start 1 locus_tag LOCUS_04270 CDS complement(532572..533384) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703442.1 transl_table 11 codon_start 1 locus_tag LOCUS_04280 CDS complement(533572..534375) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206036.1 transl_table 11 codon_start 1 locus_tag LOCUS_04290 CDS complement(534495..535016) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206035.1 transl_table 11 codon_start 1 locus_tag LOCUS_04300 CDS complement(535219..536448) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206034.1 transl_table 11 codon_start 1 locus_tag LOCUS_04310 CDS complement(536759..537967) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206033.1 transl_table 11 codon_start 1 locus_tag LOCUS_04320 CDS complement(538065..538997) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206032.1 transl_table 11 codon_start 1 locus_tag LOCUS_04330 CDS complement(539018..539794) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098651.1 transl_table 11 codon_start 1 locus_tag LOCUS_04340 CDS complement(539807..540877) product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005070727.1 transl_table 11 codon_start 1 locus_tag LOCUS_04350 CDS complement(540905..541204) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005070730.1 transl_table 11 codon_start 1 locus_tag LOCUS_04360 CDS complement(541488..541802) product non-heme iron oxygenase ferredoxin subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117586.1 transl_table 11 codon_start 1 locus_tag LOCUS_04370 CDS 542143..542931 product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206030.1 transl_table 11 codon_start 1 locus_tag LOCUS_04380 CDS complement(543283..544731) product tRNA 5-hydroxyuridine modification protein YegQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222142.1 transl_table 11 codon_start 1 locus_tag LOCUS_04390 gene yegQ CDS complement(545024..546802) product N-acetylglutaminylglutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975341.1 transl_table 11 codon_start 1 locus_tag LOCUS_04400 CDS complement(546888..547205) product iron-sulfur cluster assembly protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482998.1 transl_table 11 codon_start 1 locus_tag LOCUS_04410 gene iscA CDS 547503..547745 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04420 CDS 547729..548001 product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016227.1 transl_table 11 codon_start 1 locus_tag LOCUS_04430 CDS complement(548372..549139) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04440 CDS 549352..550035 product thiaminase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001198338.1 transl_table 11 codon_start 1 locus_tag LOCUS_04450 gene tenA CDS 550324..550833 product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003348749.1 transl_table 11 codon_start 1 locus_tag LOCUS_04460 gene coaD CDS 550842..551921 product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244608.1 transl_table 11 codon_start 1 locus_tag LOCUS_04470 gene queG CDS complement(552129..553427) product CitMHS family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001083499.1 transl_table 11 codon_start 1 locus_tag LOCUS_04480 CDS 554259..554924 product DUF1345 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175175.1 transl_table 11 codon_start 1 locus_tag LOCUS_04490 CDS 555054..555386 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04500 CDS 555534..556814 product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000289498.1 transl_table 11 codon_start 1 locus_tag LOCUS_04510 CDS 556816..558087 product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261026.1 transl_table 11 codon_start 1 locus_tag LOCUS_04520 CDS 558093..558821 product lipooligosaccharide biosynthesis galactosyltransferase LsgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694186.1 transl_table 11 codon_start 1 locus_tag LOCUS_04530 gene lsgD CDS 558823..560121 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107916.1 transl_table 11 codon_start 1 locus_tag LOCUS_04540 CDS 560087..561013 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679062.1 transl_table 11 codon_start 1 locus_tag LOCUS_04550 CDS 561015..561827 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208054.1 transl_table 11 codon_start 1 locus_tag LOCUS_04560 CDS complement(561926..563008) product GumC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930608.1 transl_table 11 codon_start 1 locus_tag LOCUS_04570 CDS 563437..564075 product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947046.1 transl_table 11 codon_start 1 locus_tag LOCUS_04580 CDS 564393..565556 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04590 CDS 565553..566701 product lipopolysaccharide 1,6-galactosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000683964.1 transl_table 11 codon_start 1 locus_tag LOCUS_04600 gene waaB CDS 566977..567768 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546270.1 transl_table 11 codon_start 1 locus_tag LOCUS_04610 CDS complement(567765..568730) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04620 CDS 568875..570005 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04630 CDS complement(570057..571721) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04640 CDS 572229..574298 product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260903.1 transl_table 11 codon_start 1 locus_tag LOCUS_04650 gene glyS CDS 574382..575083 product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769732.1 transl_table 11 codon_start 1 locus_tag LOCUS_04660 gene gmhB CDS 575163..576014 product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190040.1 transl_table 11 codon_start 1 locus_tag LOCUS_04670 CDS 576030..576659 product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693161.1 transl_table 11 codon_start 1 locus_tag LOCUS_04680 gene rsmD CDS complement(576894..577604) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04690 CDS complement(577597..577806) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04700 CDS complement(578112..578444) product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213446.1 transl_table 11 codon_start 1 locus_tag LOCUS_04710 CDS 579378..580433 product thiamine ABC transporter substrate binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214274.1 transl_table 11 codon_start 1 locus_tag LOCUS_04720 gene thiB CDS 580460..582112 product thiamine/thiamine pyrophosphate ABC transporter permease ThiP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214276.1 transl_table 11 codon_start 1 locus_tag LOCUS_04730 gene thiP CDS 582096..582818 product thiamine ABC transporter ATP-binding protein ThiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046051608.1 transl_table 11 codon_start 1 locus_tag LOCUS_04740 gene thiQ CDS 583286..585244 product bifunctional 2',3'-cyclic-nucleotide 2'-phosphodiesterase/3'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815434.1 transl_table 11 codon_start 1 locus_tag LOCUS_04750 CDS complement(585406..585810) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04760 CDS complement(585967..586416) product bis(5'-nucleosyl)-tetraphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761848.1 transl_table 11 codon_start 1 locus_tag LOCUS_04770 CDS complement(586420..587508) product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010635049.1 transl_table 11 codon_start 1 locus_tag LOCUS_04780 gene hemE CDS 587933..588703 product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005615972.1 transl_table 11 codon_start 1 locus_tag LOCUS_04790 gene rpsB CDS 588806..589669 product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021614.1 transl_table 11 codon_start 1 locus_tag LOCUS_04800 gene tsf CDS 590175..591572 product H(+)/Cl(-) exchange transporter ClcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368182.1 transl_table 11 codon_start 1 locus_tag LOCUS_04810 gene clcA tRNA complement(592405..592480) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00100 CDS complement(592942..594171) product divalent metal cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215592.1 transl_table 11 codon_start 1 locus_tag LOCUS_04820 CDS 594240..594422 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04830 CDS complement(594494..595288) product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815133.1 transl_table 11 codon_start 1 locus_tag LOCUS_04840 CDS complement(595310..596275) product biotin-dependent carboxyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097548.1 transl_table 11 codon_start 1 locus_tag LOCUS_04850 CDS complement(596272..596943) product 5-oxoprolinase subunit PxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694217.1 transl_table 11 codon_start 1 locus_tag LOCUS_04860 gene pxpB CDS 597687..599714 product ligand-gated channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707645.1 transl_table 11 codon_start 1 locus_tag LOCUS_04870 CDS 600070..601275 product sodium/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105930.1 transl_table 11 codon_start 1 locus_tag LOCUS_04880 gene gltS CDS complement(601652..604879) product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225779.1 transl_table 11 codon_start 1 locus_tag LOCUS_04890 gene carB CDS complement(604889..605458) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04900 CDS complement(606095..606781) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04910 CDS complement(606924..607493) product molybdopterin adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005647046.1 transl_table 11 codon_start 1 locus_tag LOCUS_04920 gene mog CDS complement(607657..609120) product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813916.1 transl_table 11 codon_start 1 locus_tag LOCUS_04930 gene nuoN CDS complement(609133..610647) product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037648.1 transl_table 11 codon_start 1 locus_tag LOCUS_04940 CDS complement(610657..612690) product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951337.1 transl_table 11 codon_start 1 locus_tag LOCUS_04950 gene nuoL CDS complement(612693..613001) product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813920.1 transl_table 11 codon_start 1 locus_tag LOCUS_04960 gene nuoK CDS complement(613003..613680) product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813921.1 transl_table 11 codon_start 1 locus_tag LOCUS_04970 CDS complement(613690..614181) product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003017376.1 transl_table 11 codon_start 1 locus_tag LOCUS_04980 gene nuoI CDS complement(614203..615255) product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948471.1 transl_table 11 codon_start 1 locus_tag LOCUS_04990 gene nuoH CDS complement(615256..617586) product NADH-quinone oxidoreductase subunit NuoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958230.1 transl_table 11 codon_start 1 locus_tag LOCUS_05000 gene nuoG CDS complement(617586..618872) product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015443944.1 transl_table 11 codon_start 1 locus_tag LOCUS_05010 gene nuoF CDS complement(618872..619393) product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037655.1 transl_table 11 codon_start 1 locus_tag LOCUS_05020 gene nuoE CDS complement(619425..620684) product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185833.1 transl_table 11 codon_start 1 locus_tag LOCUS_05030 CDS complement(620692..621390) product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037657.1 transl_table 11 codon_start 1 locus_tag LOCUS_05040 CDS complement(621398..621883) product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215610.1 transl_table 11 codon_start 1 locus_tag LOCUS_05050 CDS complement(621874..622227) product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958235.1 transl_table 11 codon_start 1 locus_tag LOCUS_05060 CDS 622425..623645 product M20 aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039088.1 transl_table 11 codon_start 1 locus_tag LOCUS_05070 CDS 624004..625713 product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102377.1 transl_table 11 codon_start 1 locus_tag LOCUS_05080 CDS complement(626215..626943) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478795.1 transl_table 11 codon_start 1 locus_tag LOCUS_05090 gene tsaB CDS complement(627099..627266) product zinc-finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958359.1 transl_table 11 codon_start 1 locus_tag LOCUS_05100 CDS complement(627303..628973) product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110721.1 transl_table 11 codon_start 1 locus_tag LOCUS_05110 gene ettA CDS 629500..630489 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05120 CDS 630973..631656 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231824.1 transl_table 11 codon_start 1 locus_tag LOCUS_05130 CDS 631807..632778 product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808591.1 transl_table 11 codon_start 1 locus_tag LOCUS_05140 gene phnD CDS complement(632690..634057) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05150 CDS 634355..634879 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05160 CDS complement(635367..636065) product threonine export protein RhtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000928819.1 transl_table 11 codon_start 1 locus_tag LOCUS_05170 gene rhtC CDS complement(636240..637157) product Kdo hydroxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050158480.1 transl_table 11 codon_start 1 locus_tag LOCUS_05180 CDS complement(637371..638645) product anhydro-N-acetylmuramic acid kinase AnmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000276045.1 transl_table 11 codon_start 1 locus_tag LOCUS_05190 gene anmK CDS complement(638646..639557) product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000180252.1 transl_table 11 codon_start 1 locus_tag LOCUS_05200 gene murQ CDS complement(639822..640475) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05210 CDS complement(640782..642371) product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037984.1 transl_table 11 codon_start 1 locus_tag LOCUS_05220 CDS 642601..643041 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268338.1 transl_table 11 codon_start 1 locus_tag LOCUS_05230 CDS complement(643237..646470) product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706711.1 transl_table 11 codon_start 1 locus_tag LOCUS_05240 CDS complement(646541..647698) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943335.1 transl_table 11 codon_start 1 locus_tag LOCUS_05250 CDS complement(647877..648323) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05260 CDS complement(648953..649624) product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457672.1 transl_table 11 codon_start 1 locus_tag LOCUS_05270 gene ccmB CDS complement(649617..650261) product cytochrome c biogenesis heme-transporting ATPase CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000525596.1 transl_table 11 codon_start 1 locus_tag LOCUS_05280 gene ccmA CDS complement(650265..651647) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05290 CDS complement(651653..652177) product cytochrome c-type biogenesis protein CcmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705303.1 transl_table 11 codon_start 1 locus_tag LOCUS_05300 CDS complement(652177..652737) product DsbE family thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001035064.1 transl_table 11 codon_start 1 locus_tag LOCUS_05310 CDS complement(652747..654720) product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703211.1 transl_table 11 codon_start 1 locus_tag LOCUS_05320 CDS complement(654868..655395) product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107323.1 transl_table 11 codon_start 1 locus_tag LOCUS_05330 gene ccmE CDS complement(655382..655552) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05340 CDS complement(655819..656610) product heme ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387799.1 transl_table 11 codon_start 1 locus_tag LOCUS_05350 CDS 656922..658043 product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174136.1 transl_table 11 codon_start 1 locus_tag LOCUS_05360 CDS 658056..658349 product proton-translocating transhydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227778.1 transl_table 11 codon_start 1 locus_tag LOCUS_05370 CDS 658353..659750 product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227779.1 transl_table 11 codon_start 1 locus_tag LOCUS_05380 CDS 660082..660795 product 6-hydroxyaminopurine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001270237.1 transl_table 11 codon_start 1 locus_tag LOCUS_05390 gene yiiM CDS complement(660931..663684) product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703926.1 transl_table 11 codon_start 1 locus_tag LOCUS_05400 gene polA CDS complement(663965..664774) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693253.1 transl_table 11 codon_start 1 locus_tag LOCUS_05410 CDS 665733..667514 product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224947.1 transl_table 11 codon_start 1 locus_tag LOCUS_05420 gene aspS CDS 668046..668390 product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814883.1 transl_table 11 codon_start 1 locus_tag LOCUS_05430 gene erpA CDS 668664..669581 product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038004.1 transl_table 11 codon_start 1 locus_tag LOCUS_05440 CDS 669584..670033 product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529725.1 transl_table 11 codon_start 1 locus_tag LOCUS_05450 CDS 670017..671183 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05460 CDS 671249..672628 product GTPase/DUF3482 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112966.1 transl_table 11 codon_start 1 locus_tag LOCUS_05470 CDS complement(672657..674585) product 2',3'-cyclic-nucleotide 2'-phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694555.1 transl_table 11 codon_start 1 locus_tag LOCUS_05480 gene cpdB CDS complement(674613..675701) product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003019960.1 transl_table 11 codon_start 1 locus_tag LOCUS_05490 gene prfA CDS 675801..676100 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05500 sequence02 source 1..590019 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 442..1203 product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261499.1 transl_table 11 codon_start 1 locus_tag LOCUS_05510 CDS 1474..4986 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05520 CDS complement(5456..7093) product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092223.1 transl_table 11 codon_start 1 locus_tag LOCUS_05530 CDS 7278..8009 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05540 CDS 8020..8736 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05550 CDS 8930..12355 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957676.1 transl_table 11 codon_start 1 locus_tag LOCUS_05560 CDS complement(12929..14140) product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003363593.1 transl_table 11 codon_start 1 locus_tag LOCUS_05570 CDS complement(14238..15617) product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768190.1 transl_table 11 codon_start 1 locus_tag LOCUS_05580 gene trkA CDS 16015..17649 product 5'-nucleotidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903241.1 transl_table 11 codon_start 1 locus_tag LOCUS_05590 CDS 18363..19394 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05600 CDS 19414..20706 product AmpG family muropeptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056626.1 transl_table 11 codon_start 1 locus_tag LOCUS_05610 CDS complement(20888..21073) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05620 CDS 21770..22768 product MDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000481249.1 transl_table 11 codon_start 1 locus_tag LOCUS_05630 CDS complement(22849..23355) product 4-hydroxyphenylacetate 3-monooxygenase reductase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001175460.1 transl_table 11 codon_start 1 locus_tag LOCUS_05640 CDS complement(23603..24484) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05650 CDS complement(24528..25286) product sulfate transporter CysZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213487.1 transl_table 11 codon_start 1 locus_tag LOCUS_05660 gene cysZ CDS complement(25518..26024) product type 3 dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459612.1 transl_table 11 codon_start 1 locus_tag LOCUS_05670 gene folA CDS complement(26062..26247) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05680 CDS 26443..27423 product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406703.1 transl_table 11 codon_start 1 locus_tag LOCUS_05690 gene pssA CDS 27553..28641 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05700 CDS 28715..29185 product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095025.1 transl_table 11 codon_start 1 locus_tag LOCUS_05710 gene rimI CDS 29396..29614 product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222784.1 transl_table 11 codon_start 1 locus_tag LOCUS_05720 CDS 29709..31439 product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771237.1 transl_table 11 codon_start 1 locus_tag LOCUS_05730 gene recJ CDS 31836..33347 product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369856.1 transl_table 11 codon_start 1 locus_tag LOCUS_05740 CDS 33533..34534 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05750 CDS 34690..35154 product outer membrane lipoprotein SlyB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000597196.1 transl_table 11 codon_start 1 locus_tag LOCUS_05760 gene slyB CDS complement(35330..36565) product tryptophan permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074198.1 transl_table 11 codon_start 1 locus_tag LOCUS_05770 gene mtr CDS 37617..39074 product Na+/H+ antiporter NhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000711547.1 transl_table 11 codon_start 1 locus_tag LOCUS_05780 gene nhaC CDS 39959..40909 product petrobactin ABC transporter permease YclN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234491.1 transl_table 11 codon_start 1 locus_tag LOCUS_05790 gene yclN CDS 40906..41883 product petrobactin ABC transporter permease YclO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246705.1 transl_table 11 codon_start 1 locus_tag LOCUS_05800 gene yclO CDS 41884..42642 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948720.1 transl_table 11 codon_start 1 locus_tag LOCUS_05810 CDS 42845..43825 product petrobactin ABC transporter substrate-binding protein YclQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246619.1 transl_table 11 codon_start 1 locus_tag LOCUS_05820 gene yclQ CDS complement(44118..44429) product YqfO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092679.1 transl_table 11 codon_start 1 locus_tag LOCUS_05830 CDS complement(44513..44674) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05840 CDS 44796..45167 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05850 CDS 45179..45838 product bifunctional tRNA pseudouridine(32) synthase/23S rRNA pseudouridine(746) synthase RluA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000525176.1 transl_table 11 codon_start 1 locus_tag LOCUS_05860 gene rluA CDS complement(45857..47140) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004556566.1 transl_table 11 codon_start 1 locus_tag LOCUS_05870 CDS complement(47447..48619) product M20 aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114014.1 transl_table 11 codon_start 1 locus_tag LOCUS_05880 CDS 48875..49936 product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681843.1 transl_table 11 codon_start 1 locus_tag LOCUS_05890 CDS 50329..50835 product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000024529.1 transl_table 11 codon_start 1 locus_tag LOCUS_05900 gene tpx CDS 51421..52461 product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099410.1 transl_table 11 codon_start 1 locus_tag LOCUS_05910 gene pstS CDS 52862..53797 product phosphate ABC transporter permease PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215558.1 transl_table 11 codon_start 1 locus_tag LOCUS_05920 gene pstC CDS 53797..54714 product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001251985.1 transl_table 11 codon_start 1 locus_tag LOCUS_05930 gene pstA CDS 54885..55739 product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004713904.1 transl_table 11 codon_start 1 locus_tag LOCUS_05940 gene pstB CDS 55908..56636 product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008500182.1 transl_table 11 codon_start 1 locus_tag LOCUS_05950 gene phoU CDS complement(56792..57877) product NADH:flavin oxidoreductase/NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705363.1 transl_table 11 codon_start 1 locus_tag LOCUS_05960 CDS complement(58133..59422) product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704551.1 transl_table 11 codon_start 1 locus_tag LOCUS_05970 gene phoR CDS complement(59607..60299) product phosphate response regulator transcription factor PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004099401.1 transl_table 11 codon_start 1 locus_tag LOCUS_05980 gene phoB CDS complement(60670..61995) product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707078.1 transl_table 11 codon_start 1 locus_tag LOCUS_05990 gene glmM CDS 62397..63362 product complex I NDUFA9 subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065041.1 transl_table 11 codon_start 1 locus_tag LOCUS_06000 CDS 63747..64202 product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102984.1 transl_table 11 codon_start 1 locus_tag LOCUS_06010 gene dut CDS 64635..65837 product cyanate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268358.1 transl_table 11 codon_start 1 locus_tag LOCUS_06020 CDS 66300..67367 product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213431.1 transl_table 11 codon_start 1 locus_tag LOCUS_06030 gene leuB CDS 67642..68781 product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111187.1 transl_table 11 codon_start 1 locus_tag LOCUS_06040 gene asd CDS 69372..69710 product YegP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001350529.1 transl_table 11 codon_start 1 locus_tag LOCUS_06050 CDS complement(69850..72012) product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100007.1 transl_table 11 codon_start 1 locus_tag LOCUS_06060 CDS 72561..73031 product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093668.1 transl_table 11 codon_start 1 locus_tag LOCUS_06070 gene bfr CDS 73166..73642 product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213535.1 transl_table 11 codon_start 1 locus_tag LOCUS_06080 gene bfr CDS complement(73797..74006) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06090 CDS 74253..75218 product EF-P lysine aminoacylase EpmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036753.1 transl_table 11 codon_start 1 locus_tag LOCUS_06100 gene epmA CDS complement(75428..75868) product CopD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958512.1 transl_table 11 codon_start 1 locus_tag LOCUS_06110 CDS 76017..77243 product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688953.1 transl_table 11 codon_start 1 locus_tag LOCUS_06120 gene ispG CDS 77218..78048 product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927735.1 transl_table 11 codon_start 1 locus_tag LOCUS_06130 gene trmB CDS 78246..79556 product arsenical efflux pump membrane protein ArsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209408.1 transl_table 11 codon_start 1 locus_tag LOCUS_06140 CDS complement(79603..80130) product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260985.1 transl_table 11 codon_start 1 locus_tag LOCUS_06150 gene greB CDS complement(80209..82350) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06160 CDS 83316..83615 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06170 CDS 83759..84910 product lipopolysaccharide assembly protein LapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262297.1 transl_table 11 codon_start 1 locus_tag LOCUS_06180 gene lapB CDS 85107..86453 product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948105.1 transl_table 11 codon_start 1 locus_tag LOCUS_06190 CDS 86667..86810 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06200 CDS complement(87074..87853) product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525454.1 transl_table 11 codon_start 1 locus_tag LOCUS_06210 CDS 88179..89063 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036906.1 transl_table 11 codon_start 1 locus_tag LOCUS_06220 CDS complement(89256..90341) product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052451755.1 transl_table 11 codon_start 1 locus_tag LOCUS_06230 gene dinB CDS complement(90407..91039) product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098408.1 transl_table 11 codon_start 1 locus_tag LOCUS_06240 CDS complement(91215..93572) product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136429007.1 transl_table 11 codon_start 1 locus_tag LOCUS_06250 gene rnr CDS complement(94189..95148) product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000570555.1 transl_table 11 codon_start 1 locus_tag LOCUS_06260 gene lpxK CDS complement(95168..95953) product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080709.1 transl_table 11 codon_start 1 locus_tag LOCUS_06270 CDS 96248..96685 product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103447.1 transl_table 11 codon_start 1 locus_tag LOCUS_06280 gene dtd CDS complement(96741..97736) product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130426.1 transl_table 11 codon_start 1 locus_tag LOCUS_06290 CDS complement(98081..98416) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06300 CDS complement(98557..99144) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06310 CDS complement(99505..100023) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06320 CDS 100395..103433 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06330 CDS complement(103926..106511) product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100324.1 transl_table 11 codon_start 1 locus_tag LOCUS_06340 gene leuS CDS 106937..107707 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118209.1 transl_table 11 codon_start 1 locus_tag LOCUS_06350 CDS 107918..109711 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06360 CDS 109922..110134 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06370 CDS 110174..110548 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06380 CDS 110851..111897 product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001123164.1 transl_table 11 codon_start 1 locus_tag LOCUS_06390 CDS 111897..112877 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001223662.1 transl_table 11 codon_start 1 locus_tag LOCUS_06400 CDS 112877..113650 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006995898.1 transl_table 11 codon_start 1 locus_tag LOCUS_06410 CDS 113761..114612 product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694515.1 transl_table 11 codon_start 1 locus_tag LOCUS_06420 CDS 114839..117091 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014640133.1 transl_table 11 codon_start 1 locus_tag LOCUS_06430 CDS complement(117275..118123) product ModD protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814376.1 transl_table 11 codon_start 1 locus_tag LOCUS_06440 gene modD CDS 118085..118237 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06450 CDS complement(118285..119646) product two-component system sensor histidine kinase RstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096876.1 transl_table 11 codon_start 1 locus_tag LOCUS_06460 gene rstB CDS complement(119715..120503) product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082360.1 transl_table 11 codon_start 1 locus_tag LOCUS_06470 CDS 120740..121381 product MtnX-like HAD-IB family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816647.1 transl_table 11 codon_start 1 locus_tag LOCUS_06480 CDS 121549..122412 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527983.1 transl_table 11 codon_start 1 locus_tag LOCUS_06490 CDS 122409..122768 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06500 CDS 122768..123184 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06510 CDS complement(123284..124231) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06520 CDS complement(124244..125320) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06530 CDS complement(125455..126840) product acetyl ornithine aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868396.1 transl_table 11 codon_start 1 locus_tag LOCUS_06540 CDS complement(127169..127912) product MipA/OmpV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211680.1 transl_table 11 codon_start 1 locus_tag LOCUS_06550 CDS 128660..130192 product AbgT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000202034.1 transl_table 11 codon_start 1 locus_tag LOCUS_06560 CDS 130390..131577 product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888346.1 transl_table 11 codon_start 1 locus_tag LOCUS_06570 CDS complement(131827..132441) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06580 CDS complement(132640..133029) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06590 CDS complement(133061..133747) product DsbA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000687920.1 transl_table 11 codon_start 1 locus_tag LOCUS_06600 CDS 133970..134413 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06610 CDS complement(134779..134994) product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421025.1 transl_table 11 codon_start 1 locus_tag LOCUS_06620 gene rpsU CDS complement(135154..136452) product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001198386.1 transl_table 11 codon_start 1 locus_tag LOCUS_06630 gene tig tRNA complement(136696..136779) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00110 CDS complement(136989..137708) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063645.1 transl_table 11 codon_start 1 locus_tag LOCUS_06640 CDS 137979..138689 product TIGR04211 family SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369636.1 transl_table 11 codon_start 1 locus_tag LOCUS_06650 CDS 139090..139959 product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225833.1 transl_table 11 codon_start 1 locus_tag LOCUS_06660 CDS 140107..140937 product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225833.1 transl_table 11 codon_start 1 locus_tag LOCUS_06670 CDS complement(141113..141772) product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368017.1 transl_table 11 codon_start 1 locus_tag LOCUS_06680 CDS 142148..142966 product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225833.1 transl_table 11 codon_start 1 locus_tag LOCUS_06690 CDS 143318..144736 product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338095.1 transl_table 11 codon_start 1 locus_tag LOCUS_06700 CDS 144865..145350 product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038378.1 transl_table 11 codon_start 1 locus_tag LOCUS_06710 CDS 145751..146215 product DIP1984 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460334.1 transl_table 11 codon_start 1 locus_tag LOCUS_06720 CDS 146525..147514 product type I-F CRISPR-associated endonuclease Cas1f inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210191.1 transl_table 11 codon_start 1 locus_tag LOCUS_06730 gene cas1f CDS 147516..150467 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06740 CDS 150460..151437 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06750 CDS 151446..152471 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06760 CDS 152484..153107 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06770 repeat_region 153239..157949 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttaaccgccacataggcggcttagaaa CDS complement(158024..159307) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932556.1 transl_table 11 codon_start 1 locus_tag LOCUS_06780 CDS complement(159728..160909) product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989507.1 transl_table 11 codon_start 1 locus_tag LOCUS_06790 CDS 161370..162263 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171845.1 transl_table 11 codon_start 1 locus_tag LOCUS_06800 CDS complement(162340..162543) product YqaE/Pmp3 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417846.1 transl_table 11 codon_start 1 locus_tag LOCUS_06810 CDS 163023..164303 product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242993.1 transl_table 11 codon_start 1 locus_tag LOCUS_06820 gene purD CDS 164968..167109 product choline BCCT transporter BetT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096496.1 transl_table 11 codon_start 1 locus_tag LOCUS_06830 gene betT CDS complement(167397..168398) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06840 CDS complement(168654..169535) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816712.1 transl_table 11 codon_start 1 locus_tag LOCUS_06850 CDS 169825..170043 product copper chaperone CopZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076661.1 transl_table 11 codon_start 1 locus_tag LOCUS_06860 gene copZ CDS complement(170350..171198) product deoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461720.1 transl_table 11 codon_start 1 locus_tag LOCUS_06870 gene endA CDS 171822..172055 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06880 note possible pseudo, frameshifted CDS 172196..172459 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06890 note possible pseudo, frameshifted CDS 172537..173586 product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817249.1 transl_table 11 codon_start 1 locus_tag LOCUS_06900 CDS complement(173663..174034) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06910 CDS complement(174070..175350) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06920 CDS 175840..176286 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704430.1 transl_table 11 codon_start 1 locus_tag LOCUS_06930 CDS complement(176616..177212) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06940 CDS 177347..178381 product lipoate--protein ligase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706765.1 transl_table 11 codon_start 1 locus_tag LOCUS_06950 CDS 179148..180638 product arginine/agmatine antiporter AaxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010892188.1 transl_table 11 codon_start 1 locus_tag LOCUS_06960 gene aaxC CDS 180794..182062 product phosphatidylserine decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548475.1 transl_table 11 codon_start 1 locus_tag LOCUS_06970 CDS 182585..184495 product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185742.1 transl_table 11 codon_start 1 locus_tag LOCUS_06980 gene htpG CDS 185180..190039 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06990 CDS complement(190296..191819) product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206973.1 transl_table 11 codon_start 1 locus_tag LOCUS_07000 CDS complement(192303..192677) product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482613.1 transl_table 11 codon_start 1 locus_tag LOCUS_07010 CDS complement(192903..193358) product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208527.1 transl_table 11 codon_start 1 locus_tag LOCUS_07020 CDS complement(193491..193925) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293649.1 transl_table 11 codon_start 1 locus_tag LOCUS_07030 CDS complement(194215..195210) product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479552.1 transl_table 11 codon_start 1 locus_tag LOCUS_07040 gene gap CDS complement(195332..196825) product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092867.1 transl_table 11 codon_start 1 locus_tag LOCUS_07050 CDS complement(197208..198551) product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771098.1 transl_table 11 codon_start 1 locus_tag LOCUS_07060 gene miaB CDS complement(198699..199586) product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707735.1 transl_table 11 codon_start 1 locus_tag LOCUS_07070 gene pgeF CDS complement(199570..200562) product 23S rRNA pseudouridine(1911/1915/1917) synthase RluD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005075271.1 transl_table 11 codon_start 1 locus_tag LOCUS_07080 gene rluD CDS 200619..201452 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07090 CDS 201713..202993 product lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957353.1 transl_table 11 codon_start 1 locus_tag LOCUS_07100 gene waaA CDS 203486..205705 product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942111.1 transl_table 11 codon_start 1 locus_tag LOCUS_07110 CDS complement(205862..206965) product DUF481 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120892.1 transl_table 11 codon_start 1 locus_tag LOCUS_07120 CDS complement(207181..208020) product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004407968.1 transl_table 11 codon_start 1 locus_tag LOCUS_07130 CDS complement(208052..208573) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07140 CDS 208995..209489 product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921116.1 transl_table 11 codon_start 1 locus_tag LOCUS_07150 gene purE CDS 209495..210607 product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000196812.1 transl_table 11 codon_start 1 locus_tag LOCUS_07160 gene purK CDS 210716..214474 product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836287.1 transl_table 11 codon_start 1 locus_tag LOCUS_07170 CDS 214502..215209 product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016809.1 transl_table 11 codon_start 1 locus_tag LOCUS_07180 CDS 215209..216609 product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113604.1 transl_table 11 codon_start 1 locus_tag LOCUS_07190 gene purF CDS 216610..217620 product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242485.1 transl_table 11 codon_start 1 locus_tag LOCUS_07200 gene purM CDS 217620..218186 product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000088592.1 transl_table 11 codon_start 1 locus_tag LOCUS_07210 gene purN CDS 218506..220047 product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000745439.1 transl_table 11 codon_start 1 locus_tag LOCUS_07220 gene purH CDS complement(220399..221310) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07230 CDS complement(221428..222729) product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816798.1 transl_table 11 codon_start 1 locus_tag LOCUS_07240 gene bioA CDS 222992..224209 product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097501.1 transl_table 11 codon_start 1 locus_tag LOCUS_07250 gene bioF CDS 224228..225187 product malonyl-ACP O-methyltransferase BioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000079913.1 transl_table 11 codon_start 1 locus_tag LOCUS_07260 gene bioC CDS 225251..225940 product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704797.1 transl_table 11 codon_start 1 locus_tag LOCUS_07270 gene bioD CDS complement(225970..227622) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07280 CDS 228111..229367 product PLP-dependent transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202226.1 transl_table 11 codon_start 1 locus_tag LOCUS_07290 CDS complement(229692..230330) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688682.1 transl_table 11 codon_start 1 locus_tag LOCUS_07300 CDS 230702..231136 product TOBE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000301062.1 transl_table 11 codon_start 1 locus_tag LOCUS_07310 CDS 231229..231687 product heat shock protein HslJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296048.1 transl_table 11 codon_start 1 locus_tag LOCUS_07320 gene hslJ CDS 231914..232528 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002041261.1 transl_table 11 codon_start 1 locus_tag LOCUS_07330 CDS 232829..233368 product DUF308 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788598.1 transl_table 11 codon_start 1 locus_tag LOCUS_07340 CDS 234016..235185 product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249379.1 transl_table 11 codon_start 1 locus_tag LOCUS_07350 gene ribD CDS 235188..235820 product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398505.1 transl_table 11 codon_start 1 locus_tag LOCUS_07360 gene ribE CDS 235875..237092 product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987154.1 transl_table 11 codon_start 1 locus_tag LOCUS_07370 CDS 237271..237735 product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811752.1 transl_table 11 codon_start 1 locus_tag LOCUS_07380 gene ribE CDS 237903..240578 product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268414.1 transl_table 11 codon_start 1 locus_tag LOCUS_07390 gene acnA CDS 240840..241058 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07400 CDS complement(241490..242641) product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918338.1 transl_table 11 codon_start 1 locus_tag LOCUS_07410 gene nhaA CDS 243191..244546 product YjiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066807.1 transl_table 11 codon_start 1 locus_tag LOCUS_07420 CDS complement(244679..245257) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07430 CDS 245665..247071 product dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121651148.1 transl_table 11 codon_start 1 locus_tag LOCUS_07440 gene hydA CDS 247074..247958 product Abi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083539905.1 transl_table 11 codon_start 1 locus_tag LOCUS_07450 CDS complement(248092..248784) product respiratory nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191967.1 transl_table 11 codon_start 1 locus_tag LOCUS_07460 gene narI CDS complement(248795..249472) product nitrate reductase molybdenum cofactor assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192818.1 transl_table 11 codon_start 1 locus_tag LOCUS_07470 gene narJ CDS complement(249482..251032) product nitrate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524710.1 transl_table 11 codon_start 1 locus_tag LOCUS_07480 gene narH CDS complement(251214..254927) product nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004555870.1 transl_table 11 codon_start 1 locus_tag LOCUS_07490 CDS complement(255234..256604) product NarK family nitrate/nitrite MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012468297.1 transl_table 11 codon_start 1 locus_tag LOCUS_07500 CDS complement(256780..258006) product nitrate/nitrite transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524713.1 transl_table 11 codon_start 1 locus_tag LOCUS_07510 CDS complement(258162..258863) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688682.1 transl_table 11 codon_start 1 locus_tag LOCUS_07520 CDS complement(258960..260852) product type IV pili methyl-accepting chemotaxis transducer N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550179.1 transl_table 11 codon_start 1 locus_tag LOCUS_07530 CDS 261202..261612 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07540 CDS 261955..266055 product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105494.1 transl_table 11 codon_start 1 locus_tag LOCUS_07550 gene hrpA CDS 266349..267899 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07560 CDS 268478..269374 product multidrug efflux transcriptional repressor AdeL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207232.1 transl_table 11 codon_start 1 locus_tag LOCUS_07570 gene adeL CDS complement(269678..270907) product serine/threonine transporter SstT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706271.1 transl_table 11 codon_start 1 locus_tag LOCUS_07580 gene sstT CDS complement(270979..271485) product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706917.1 transl_table 11 codon_start 1 locus_tag LOCUS_07590 gene ruvX CDS complement(271482..272033) product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243940.1 transl_table 11 codon_start 1 locus_tag LOCUS_07600 CDS complement(272030..274591) product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816045.1 transl_table 11 codon_start 1 locus_tag LOCUS_07610 gene pepN CDS complement(275095..275637) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07620 CDS complement(275828..276682) product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768855.1 transl_table 11 codon_start 1 locus_tag LOCUS_07630 gene murI CDS complement(276713..277216) product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180984760.1 transl_table 11 codon_start 1 locus_tag LOCUS_07640 gene mraZ CDS complement(277425..279434) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07650 CDS complement(279888..281204) product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811011.1 transl_table 11 codon_start 1 locus_tag LOCUS_07660 CDS complement(281276..282277) product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225756.1 transl_table 11 codon_start 1 locus_tag LOCUS_07670 CDS complement(282315..283877) product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462538.1 transl_table 11 codon_start 1 locus_tag LOCUS_07680 gene gshA CDS complement(284252..284923) product ribonuclease T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092070.1 transl_table 11 codon_start 1 locus_tag LOCUS_07690 gene rnt CDS complement(285144..286385) product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036185.1 transl_table 11 codon_start 1 locus_tag LOCUS_07700 gene clpX CDS complement(286605..287225) product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552734.1 transl_table 11 codon_start 1 locus_tag LOCUS_07710 gene clpP CDS 287627..288727 product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207406.1 transl_table 11 codon_start 1 locus_tag LOCUS_07720 gene serC CDS 289134..291341 product carboxy terminal-processing peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104769.1 transl_table 11 codon_start 1 locus_tag LOCUS_07730 CDS 291544..292656 product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097080.1 transl_table 11 codon_start 1 locus_tag LOCUS_07740 gene mnmA CDS 292906..294792 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007247023.1 transl_table 11 codon_start 1 locus_tag LOCUS_07750 CDS 295452..296384 product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387038.1 transl_table 11 codon_start 1 locus_tag LOCUS_07760 CDS 296570..297526 product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722692.1 transl_table 11 codon_start 1 locus_tag LOCUS_07770 CDS 297539..298486 product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000932389.1 transl_table 11 codon_start 1 locus_tag LOCUS_07780 CDS complement(298828..299145) product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209612434.1 transl_table 11 codon_start 1 locus_tag LOCUS_07790 CDS complement(299317..299682) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07800 CDS complement(299916..300266) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07810 CDS complement(300337..302235) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002223143.1 transl_table 11 codon_start 1 locus_tag LOCUS_07820 CDS complement(302313..302555) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07830 tRNA complement(302642..302717) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00120 CDS 303054..304718 product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042661416.1 transl_table 11 codon_start 1 locus_tag LOCUS_07840 CDS 305081..305953 product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687345.1 transl_table 11 codon_start 1 locus_tag LOCUS_07850 tRNA complement(306048..306123) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00130 CDS 306418..307746 product glutamate/aspartate:proton symporter GltP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209033.1 transl_table 11 codon_start 1 locus_tag LOCUS_07860 gene gltP tRNA complement(307933..308008) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00140 CDS 308344..310188 product protein-disulfide reductase DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478597.1 transl_table 11 codon_start 1 locus_tag LOCUS_07870 CDS 310474..311796 product anaerobic C4-dicarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175570.1 transl_table 11 codon_start 1 locus_tag LOCUS_07880 CDS complement(312127..313404) product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037922.1 transl_table 11 codon_start 1 locus_tag LOCUS_07890 gene murA CDS complement(313404..313643) product BolA/IbaG family iron-sulfur metabolism protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199917.1 transl_table 11 codon_start 1 locus_tag LOCUS_07900 CDS 314249..315958 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07910 CDS complement(316507..317283) product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037280.1 transl_table 11 codon_start 1 locus_tag LOCUS_07920 CDS complement(317363..319165) product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037281.1 transl_table 11 codon_start 1 locus_tag LOCUS_07930 gene sdhA CDS complement(319328..319729) product succinate dehydrogenase, hydrophobic membrane anchor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037282.1 transl_table 11 codon_start 1 locus_tag LOCUS_07940 gene sdhD CDS complement(319743..320132) product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382963.1 transl_table 11 codon_start 1 locus_tag LOCUS_07950 gene sdhC CDS complement(320280..322238) product MacB family efflux pump subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050129821.1 transl_table 11 codon_start 1 locus_tag LOCUS_07960 CDS complement(322270..323475) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815858.1 transl_table 11 codon_start 1 locus_tag LOCUS_07970 CDS 324250..325152 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07980 CDS complement(325305..328175) product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112752.1 transl_table 11 codon_start 1 locus_tag LOCUS_07990 gene secA CDS complement(328453..329568) product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807457.1 transl_table 11 codon_start 1 locus_tag LOCUS_08000 gene proB CDS 330085..331509 product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951104.1 transl_table 11 codon_start 1 locus_tag LOCUS_08010 gene leuC CDS 331528..332184 product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222556.1 transl_table 11 codon_start 1 locus_tag LOCUS_08020 gene leuD CDS complement(332272..332913) product carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947903.1 transl_table 11 codon_start 1 locus_tag LOCUS_08030 CDS 333586..336192 product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112602.1 transl_table 11 codon_start 1 locus_tag LOCUS_08040 gene alaS CDS 336895..338007 product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524995.1 transl_table 11 codon_start 1 locus_tag LOCUS_08050 CDS 338413..341172 product ribosome-associated ATPase/putative transporter RbbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114043.1 transl_table 11 codon_start 1 locus_tag LOCUS_08060 gene rbbA CDS 341174..342304 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188525.1 transl_table 11 codon_start 1 locus_tag LOCUS_08070 CDS complement(342414..342971) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208694.1 transl_table 11 codon_start 1 locus_tag LOCUS_08080 CDS complement(343113..343595) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08090 CDS 344017..345420 product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096878.1 transl_table 11 codon_start 1 locus_tag LOCUS_08100 gene fumC CDS complement(345553..346542) product ornithine cyclodeaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000960316.1 transl_table 11 codon_start 1 locus_tag LOCUS_08110 CDS complement(346594..347877) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015489.1 transl_table 11 codon_start 1 locus_tag LOCUS_08120 CDS 348877..352056 product bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase PutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114187.1 transl_table 11 codon_start 1 locus_tag LOCUS_08130 gene putA CDS 352359..353957 product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018503.1 transl_table 11 codon_start 1 locus_tag LOCUS_08140 gene putP CDS complement(354055..354285) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08150 CDS 354387..356483 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08160 CDS complement(356958..357833) product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356757.1 transl_table 11 codon_start 1 locus_tag LOCUS_08170 CDS complement(357936..361382) product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267260.1 transl_table 11 codon_start 1 locus_tag LOCUS_08180 gene smc CDS 361825..363291 product cation:dicarboxylase symporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861591.1 transl_table 11 codon_start 1 locus_tag LOCUS_08190 CDS 364003..364713 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08200 CDS complement(364813..365367) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08210 CDS 365794..367062 product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317946.1 transl_table 11 codon_start 1 locus_tag LOCUS_08220 gene serS CDS 367285..367536 product YfhL family 4Fe-4S dicluster ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195247.1 transl_table 11 codon_start 1 locus_tag LOCUS_08230 CDS 367777..368967 product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267417.1 transl_table 11 codon_start 1 locus_tag LOCUS_08240 CDS 369092..370294 product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111696676.1 transl_table 11 codon_start 1 locus_tag LOCUS_08250 gene tyrS CDS 370427..370750 product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092272.1 transl_table 11 codon_start 1 locus_tag LOCUS_08260 CDS 370754..371743 product small ribosomal subunit biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039215125.1 transl_table 11 codon_start 1 locus_tag LOCUS_08270 gene rsgA CDS complement(371754..373145) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206929.1 transl_table 11 codon_start 1 locus_tag LOCUS_08280 CDS complement(373267..374058) product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209801.1 transl_table 11 codon_start 1 locus_tag LOCUS_08290 gene thiD CDS complement(374101..374772) product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816649.1 transl_table 11 codon_start 1 locus_tag LOCUS_08300 gene thiE CDS complement(374992..375819) product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001195613.1 transl_table 11 codon_start 1 locus_tag LOCUS_08310 gene thiM CDS complement(375958..376800) product 23S rRNA (adenine(2030)-N(6))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602562.1 transl_table 11 codon_start 1 locus_tag LOCUS_08320 gene rlmJ CDS 377130..378035 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08330 CDS complement(378340..379689) product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119617.1 transl_table 11 codon_start 1 locus_tag LOCUS_08340 CDS complement(380303..380821) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08350 CDS complement(380975..382414) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08360 CDS complement(382404..383018) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08370 CDS complement(383108..383368) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08380 CDS complement(384598..386970) product DNA helicase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958624.1 transl_table 11 codon_start 1 locus_tag LOCUS_08390 gene uvrD CDS 387184..387675 product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193006244.1 transl_table 11 codon_start 1 locus_tag LOCUS_08400 CDS 388913..390133 product glycine betaine/L-proline ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767787.1 transl_table 11 codon_start 1 locus_tag LOCUS_08410 CDS 390136..391017 product proline/glycine betaine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763296.1 transl_table 11 codon_start 1 locus_tag LOCUS_08420 CDS 391167..392012 product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763297.1 transl_table 11 codon_start 1 locus_tag LOCUS_08430 CDS 392620..392793 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08440 CDS 392972..394162 product pentaheme c-type cytochrome TorC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005422246.1 transl_table 11 codon_start 1 locus_tag LOCUS_08450 gene torC CDS 394209..396731 product trimethylamine-N-oxide reductase TorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462326.1 transl_table 11 codon_start 1 locus_tag LOCUS_08460 gene torA CDS 397074..397757 product molecular chaperone TorD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457256.1 transl_table 11 codon_start 1 locus_tag LOCUS_08470 gene torD CDS 397952..399676 product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815882.1 transl_table 11 codon_start 1 locus_tag LOCUS_08480 CDS 400474..401859 product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815881.1 transl_table 11 codon_start 1 locus_tag LOCUS_08490 CDS complement(401930..402226) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08500 CDS complement(402302..403189) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000423058.1 transl_table 11 codon_start 1 locus_tag LOCUS_08510 CDS 403655..404689 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002182372.1 transl_table 11 codon_start 1 locus_tag LOCUS_08520 CDS 404852..405631 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08530 CDS 405824..406432 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971267.1 transl_table 11 codon_start 1 locus_tag LOCUS_08540 CDS complement(406651..407007) product ArsC family reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693817.1 transl_table 11 codon_start 1 locus_tag LOCUS_08550 CDS 407593..408477 product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930841.1 transl_table 11 codon_start 1 locus_tag LOCUS_08560 CDS 408981..409763 product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216078.1 transl_table 11 codon_start 1 locus_tag LOCUS_08570 gene deoC CDS 409796..411022 product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815520.1 transl_table 11 codon_start 1 locus_tag LOCUS_08580 gene deoB CDS complement(411449..412423) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000947043.1 transl_table 11 codon_start 1 locus_tag LOCUS_08590 CDS complement(412852..414105) product xanthosine/proton symporter XapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020390.1 transl_table 11 codon_start 1 locus_tag LOCUS_08600 gene xapB CDS complement(414127..414948) product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078448.1 transl_table 11 codon_start 1 locus_tag LOCUS_08610 CDS complement(415154..415630) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08620 CDS complement(415689..416126) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08630 CDS complement(416435..417103) product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211889.1 transl_table 11 codon_start 1 locus_tag LOCUS_08640 gene hisIE CDS complement(417523..418296) product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000880125.1 transl_table 11 codon_start 1 locus_tag LOCUS_08650 gene hisF CDS complement(418281..419015) product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000586403.1 transl_table 11 codon_start 1 locus_tag LOCUS_08660 gene hisA CDS complement(419016..420104) product bifunctional histidinol-phosphatase/imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000080105.1 transl_table 11 codon_start 1 locus_tag LOCUS_08670 gene hisB CDS complement(420264..421418) product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211894.1 transl_table 11 codon_start 1 locus_tag LOCUS_08680 gene hisC CDS complement(421520..422836) product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005669329.1 transl_table 11 codon_start 1 locus_tag LOCUS_08690 gene hisD CDS complement(422926..423819) product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211896.1 transl_table 11 codon_start 1 locus_tag LOCUS_08700 gene hisG CDS complement(424283..425137) product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687896.1 transl_table 11 codon_start 1 locus_tag LOCUS_08710 gene panC CDS complement(425287..426099) product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071160.1 transl_table 11 codon_start 1 locus_tag LOCUS_08720 gene panB CDS 426273..426869 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424276.1 transl_table 11 codon_start 1 locus_tag LOCUS_08730 CDS 426963..428108 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08740 CDS complement(428690..430213) product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113846.1 transl_table 11 codon_start 1 locus_tag LOCUS_08750 gene lysS CDS complement(431337..432797) product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037330.1 transl_table 11 codon_start 1 locus_tag LOCUS_08760 gene guaB CDS 432949..433512 product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090349.1 transl_table 11 codon_start 1 locus_tag LOCUS_08770 gene pgsA CDS complement(433798..435081) product C4-dicarboxylate TRAP transporter large permease protein DctM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105529.1 transl_table 11 codon_start 1 locus_tag LOCUS_08780 gene dctM CDS complement(435231..435905) product C4-dicarboxylate TRAP transporter small permease protein DctQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105527.1 transl_table 11 codon_start 1 locus_tag LOCUS_08790 gene dctQ CDS complement(436053..437057) product C4-dicarboxylate TRAP substrate-binding protein DctP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105525.1 transl_table 11 codon_start 1 locus_tag LOCUS_08800 gene dctP CDS complement(437496..438890) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812351.1 transl_table 11 codon_start 1 locus_tag LOCUS_08810 CDS 439140..439844 product 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000689868.1 transl_table 11 codon_start 1 locus_tag LOCUS_08820 gene mtnN CDS 440123..441514 product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086774.1 transl_table 11 codon_start 1 locus_tag LOCUS_08830 CDS complement(441632..443509) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08840 CDS 443896..444447 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08850 CDS complement(444543..445376) product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243397.1 transl_table 11 codon_start 1 locus_tag LOCUS_08860 CDS complement(445655..446632) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08870 CDS complement(446897..447427) product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691371.1 transl_table 11 codon_start 1 locus_tag LOCUS_08880 gene ybaK CDS 447585..447770 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08890 CDS complement(447887..448738) product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989896.1 transl_table 11 codon_start 1 locus_tag LOCUS_08900 gene pdxS CDS 449040..450407 product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009925710.1 transl_table 11 codon_start 1 locus_tag LOCUS_08910 CDS complement(450348..451769) product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388393.1 transl_table 11 codon_start 1 locus_tag LOCUS_08920 CDS complement(451860..452090) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08930 CDS complement(452191..452673) product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330815.1 transl_table 11 codon_start 1 locus_tag LOCUS_08940 CDS 453143..453787 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08950 CDS 454123..454386 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08960 CDS complement(454800..456173) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08970 CDS complement(456393..457193) product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808614.1 transl_table 11 codon_start 1 locus_tag LOCUS_08980 gene nadE CDS complement(457224..458354) product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000658369.1 transl_table 11 codon_start 1 locus_tag LOCUS_08990 tRNA complement(458644..458720) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00150 tRNA complement(459025..459101) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00160 CDS complement(459276..461129) product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084436.1 transl_table 11 codon_start 1 locus_tag LOCUS_09000 gene ilvD CDS complement(461377..461823) product YchJ family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810229.1 transl_table 11 codon_start 1 locus_tag LOCUS_09010 CDS 462204..464690 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09020 CDS complement(464720..465481) product DNA-binding transcriptional repressor YgbI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212058.1 transl_table 11 codon_start 1 locus_tag LOCUS_09030 gene ygbI CDS complement(466138..467562) product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207537.1 transl_table 11 codon_start 1 locus_tag LOCUS_09040 gene gatB CDS complement(467701..469152) product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772005.1 transl_table 11 codon_start 1 locus_tag LOCUS_09050 gene gatA CDS complement(469366..469653) product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106543.1 transl_table 11 codon_start 1 locus_tag LOCUS_09060 gene gatC CDS complement(469678..469959) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09070 CDS complement(469956..472433) product heavy metal translocating P-type ATPase metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072346.1 transl_table 11 codon_start 1 locus_tag LOCUS_09080 CDS complement(472659..473492) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09090 CDS 473634..473819 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09100 CDS complement(473876..475306) product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244349.1 transl_table 11 codon_start 1 locus_tag LOCUS_09110 gene ccoG CDS complement(475686..476726) product cytochrome-c oxidase, cbb3-type subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006316282.1 transl_table 11 codon_start 1 locus_tag LOCUS_09120 gene ccoP CDS complement(476769..476996) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09130 CDS complement(477052..477879) product cytochrome-c oxidase, cbb3-type subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391078.1 transl_table 11 codon_start 1 locus_tag LOCUS_09140 gene ccoO CDS complement(477896..479353) product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072351.1 transl_table 11 codon_start 1 locus_tag LOCUS_09150 gene ccoN CDS complement(479541..480902) product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555756.1 transl_table 11 codon_start 1 locus_tag LOCUS_09160 CDS complement(481089..482102) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262666.1 transl_table 11 codon_start 1 locus_tag LOCUS_09170 gene tsaD CDS complement(482243..482620) product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706544.1 transl_table 11 codon_start 1 locus_tag LOCUS_09180 CDS complement(482750..482896) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09190 CDS 483085..485652 product DNA topoisomerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038837.1 transl_table 11 codon_start 1 locus_tag LOCUS_09200 CDS 485886..487265 product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087262.1 transl_table 11 codon_start 1 locus_tag LOCUS_09210 CDS 487395..488171 product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582354.1 transl_table 11 codon_start 1 locus_tag LOCUS_09220 CDS 488737..488907 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09230 CDS 488907..490823 product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770882.1 transl_table 11 codon_start 1 locus_tag LOCUS_09240 gene dnaK CDS 491150..492307 product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209249.1 transl_table 11 codon_start 1 locus_tag LOCUS_09250 gene dnaJ CDS complement(492645..493901) product Bcr/CflA family multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003159295.1 transl_table 11 codon_start 1 locus_tag LOCUS_09260 CDS 494162..495526 product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225718.1 transl_table 11 codon_start 1 locus_tag LOCUS_09270 gene cysS CDS 495523..495798 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09280 CDS 496062..497132 product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706197.1 transl_table 11 codon_start 1 locus_tag LOCUS_09290 gene aroC CDS 497212..498888 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09300 CDS 499653..501038 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532501.1 transl_table 11 codon_start 1 locus_tag LOCUS_09310 CDS 501019..501273 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09320 CDS 501449..501922 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09330 CDS 502490..503821 product putrescine/proton symporter PlaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019203.1 transl_table 11 codon_start 1 locus_tag LOCUS_09340 gene plaP CDS complement(504114..505946) product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113792.1 transl_table 11 codon_start 1 locus_tag LOCUS_09350 CDS complement(506386..506973) product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706500.1 transl_table 11 codon_start 1 locus_tag LOCUS_09360 CDS complement(507178..507414) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09370 CDS complement(507651..508478) product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000443067.1 transl_table 11 codon_start 1 locus_tag LOCUS_09380 gene trpA CDS complement(508480..509664) product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076940213.1 transl_table 11 codon_start 1 locus_tag LOCUS_09390 gene trpB CDS complement(509771..511165) product bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050075568.1 transl_table 11 codon_start 1 locus_tag LOCUS_09400 gene trpCF CDS complement(511278..512372) product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215980.1 transl_table 11 codon_start 1 locus_tag LOCUS_09410 gene trpD CDS complement(512777..513820) product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532392.1 transl_table 11 codon_start 1 locus_tag LOCUS_09420 CDS 514076..514864 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09430 CDS complement(515020..516210) product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109126.1 transl_table 11 codon_start 1 locus_tag LOCUS_09440 CDS 516601..517665 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986194.1 transl_table 11 codon_start 1 locus_tag LOCUS_09450 CDS 517665..518414 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837221.1 transl_table 11 codon_start 1 locus_tag LOCUS_09460 CDS 518541..519560 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016726.1 transl_table 11 codon_start 1 locus_tag LOCUS_09470 CDS complement(519857..521110) product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390206.1 transl_table 11 codon_start 1 locus_tag LOCUS_09480 CDS complement(521164..522339) product voltage-gated potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005164236.1 transl_table 11 codon_start 1 locus_tag LOCUS_09490 gene kch CDS complement(522746..523741) product urea transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212233.1 transl_table 11 codon_start 1 locus_tag LOCUS_09500 gene yut CDS complement(523958..525031) product urease accessory protein UreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815718.1 transl_table 11 codon_start 1 locus_tag LOCUS_09510 CDS complement(525225..525857) product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004390399.1 transl_table 11 codon_start 1 locus_tag LOCUS_09520 gene ureG CDS complement(525992..526738) product urease accessory protein UreF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212231.1 transl_table 11 codon_start 1 locus_tag LOCUS_09530 CDS complement(526811..527533) product urease accessory protein UreE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172973.1 transl_table 11 codon_start 1 locus_tag LOCUS_09540 gene ureE CDS complement(527708..529426) product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815716.1 transl_table 11 codon_start 1 locus_tag LOCUS_09550 CDS complement(529543..530112) product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212228.1 transl_table 11 codon_start 1 locus_tag LOCUS_09560 gene ureB CDS complement(530203..530505) product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215288.1 transl_table 11 codon_start 1 locus_tag LOCUS_09570 CDS 530965..531987 product ribose operon transcriptional repressor RbsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000104051.1 transl_table 11 codon_start 1 locus_tag LOCUS_09580 gene rbsR CDS 532254..533714 product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902866.1 transl_table 11 codon_start 1 locus_tag LOCUS_09590 CDS 533971..535131 product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870021.1 transl_table 11 codon_start 1 locus_tag LOCUS_09600 CDS 535759..536685 product iron/manganese ABC transporter substrate-binding protein YfeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170110.1 transl_table 11 codon_start 1 locus_tag LOCUS_09610 gene yfeA CDS 536682..537671 product iron/manganese ABC transporter ATP-binding protein YfeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170112.1 transl_table 11 codon_start 1 locus_tag LOCUS_09620 gene yfeB CDS 537671..538552 product iron/manganese ABC transporter permease subunit YfeC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211844.1 transl_table 11 codon_start 1 locus_tag LOCUS_09630 gene yfeC CDS 538549..539397 product iron/manganese ABC transporter permease subunit YfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170116.1 transl_table 11 codon_start 1 locus_tag LOCUS_09640 gene yfeD CDS complement(539741..541294) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09650 CDS complement(541701..543569) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09660 CDS 544332..545018 product isoprenoid biosynthesis glyoxalase ElbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703608.1 transl_table 11 codon_start 1 locus_tag LOCUS_09670 gene elbB CDS complement(545330..545509) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09680 CDS 545472..546755 product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_222944447.1 transl_table 11 codon_start 1 locus_tag LOCUS_09690 CDS 546987..548729 product acetolactate synthase 3 catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185769.1 transl_table 11 codon_start 1 locus_tag LOCUS_09700 CDS 548741..549253 product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114824.1 transl_table 11 codon_start 1 locus_tag LOCUS_09710 gene ilvN CDS 549587..550603 product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218988.1 transl_table 11 codon_start 1 locus_tag LOCUS_09720 gene ilvC CDS 550846..552210 product 3-deoxy-7-phosphoheptulonate synthase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971738.1 transl_table 11 codon_start 1 locus_tag LOCUS_09730 CDS 552291..553250 product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036549.1 transl_table 11 codon_start 1 locus_tag LOCUS_09740 CDS 553540..554418 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980911.1 transl_table 11 codon_start 1 locus_tag LOCUS_09750 CDS 554559..555578 product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310751.1 transl_table 11 codon_start 1 locus_tag LOCUS_09760 CDS 555856..557013 product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918422.1 transl_table 11 codon_start 1 locus_tag LOCUS_09770 gene nagA CDS 557038..557940 product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551287.1 transl_table 11 codon_start 1 locus_tag LOCUS_09780 CDS complement(557998..558915) product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925707.1 transl_table 11 codon_start 1 locus_tag LOCUS_09790 gene ttcA CDS complement(559071..560894) product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015443940.1 transl_table 11 codon_start 1 locus_tag LOCUS_09800 gene ftsH CDS complement(561421..562047) product 23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071426.1 transl_table 11 codon_start 1 locus_tag LOCUS_09810 gene rlmE CDS complement(562264..562599) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09820 CDS 562598..562906 product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244068.1 transl_table 11 codon_start 1 locus_tag LOCUS_09830 gene yhbY CDS complement(563102..563830) product bifunctional protein-disulfide isomerase/oxidoreductase DsbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071231.1 transl_table 11 codon_start 1 locus_tag LOCUS_09840 gene dsbC CDS complement(564059..564967) product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765876.1 transl_table 11 codon_start 1 locus_tag LOCUS_09850 gene xerD CDS 565428..567314 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09860 CDS 567594..568409 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09870 CDS complement(568507..568749) product DUF3820 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092249.1 transl_table 11 codon_start 1 locus_tag LOCUS_09880 CDS complement(568822..570150) product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244945.1 transl_table 11 codon_start 1 locus_tag LOCUS_09890 gene mnmE CDS complement(570269..572014) product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114648.1 transl_table 11 codon_start 1 locus_tag LOCUS_09900 gene yidC CDS complement(572058..572267) product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001307474.1 transl_table 11 codon_start 1 locus_tag LOCUS_09910 gene yidD CDS complement(572355..572747) product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100251.1 transl_table 11 codon_start 1 locus_tag LOCUS_09920 gene rnpA CDS complement(572885..573019) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09930 CDS complement(573242..574450) product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084948.1 transl_table 11 codon_start 1 locus_tag LOCUS_09940 gene metK CDS complement(575112..576794) product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113805.1 transl_table 11 codon_start 1 locus_tag LOCUS_09950 gene leuA CDS complement(577398..577664) product oxidative damage protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768500.1 transl_table 11 codon_start 1 locus_tag LOCUS_09960 CDS complement(577950..578909) product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931310.1 transl_table 11 codon_start 1 locus_tag LOCUS_09970 tRNA complement(579035..579109) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00170 CDS 579321..579878 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09980 CDS 579972..580826 product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105711.1 transl_table 11 codon_start 1 locus_tag LOCUS_09990 gene ispE CDS complement(580908..582455) product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986940.1 transl_table 11 codon_start 1 locus_tag LOCUS_10000 CDS complement(582710..583285) product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760704.1 transl_table 11 codon_start 1 locus_tag LOCUS_10010 gene xpt CDS complement(583507..584106) product 2OG-Fe(II) oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002031361.1 transl_table 11 codon_start 1 locus_tag LOCUS_10020 CDS 584341..586248 product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243180.1 transl_table 11 codon_start 1 locus_tag LOCUS_10030 CDS 586368..587027 product 7-cyano-7-deazaguanine/7-aminomethyl-7-deazaguanine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187489.1 transl_table 11 codon_start 1 locus_tag LOCUS_10040 CDS complement(587189..588337) product cyclopropane fatty acyl phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210940.1 transl_table 11 codon_start 1 locus_tag LOCUS_10050 gene cfa CDS complement(588546..589499) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10060 CDS complement(589527..589850) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10070 sequence03 source 1..402097 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 579..1511 product DUF808 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263160.1 transl_table 11 codon_start 1 locus_tag LOCUS_10080 CDS complement(1795..3204) product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069468.1 transl_table 11 codon_start 1 locus_tag LOCUS_10090 gene der CDS complement(3213..4355) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10100 CDS complement(4383..5000) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10110 CDS complement(5014..6294) product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703166.1 transl_table 11 codon_start 1 locus_tag LOCUS_10120 gene hisS CDS complement(6352..7878) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10130 CDS complement(7879..8649) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10140 CDS complement(9049..10032) product alpha-L-glutamate ligase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161797774.1 transl_table 11 codon_start 1 locus_tag LOCUS_10150 CDS complement(10037..11620) product inactive transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087809.1 transl_table 11 codon_start 1 locus_tag LOCUS_10160 CDS complement(11828..12292) product ATP-dependent zinc protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402218.1 transl_table 11 codon_start 1 locus_tag LOCUS_10170 CDS 12907..15225 product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819165.1 transl_table 11 codon_start 1 locus_tag LOCUS_10180 CDS 15570..15992 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10190 CDS complement(16032..17828) product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233473.1 transl_table 11 codon_start 1 locus_tag LOCUS_10200 gene thiC CDS 18438..18860 product pyrimidine dimer DNA glycosylase/endonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125640.1 transl_table 11 codon_start 1 locus_tag LOCUS_10210 CDS 19055..19927 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097658.1 transl_table 11 codon_start 1 locus_tag LOCUS_10220 CDS 20131..21486 product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294246.1 transl_table 11 codon_start 1 locus_tag LOCUS_10230 gene brnQ CDS complement(21740..23656) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10240 CDS complement(23571..23750) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10250 CDS complement(23966..24385) product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208113.1 transl_table 11 codon_start 1 locus_tag LOCUS_10260 CDS 24603..25547 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089701.1 transl_table 11 codon_start 1 locus_tag LOCUS_10270 CDS complement(26258..29125) product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123510.1 transl_table 11 codon_start 1 locus_tag LOCUS_10280 CDS 29782..32169 product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101982.1 transl_table 11 codon_start 1 locus_tag LOCUS_10290 gene lon CDS 33058..34284 product porin PorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980936.1 transl_table 11 codon_start 1 locus_tag LOCUS_10300 gene porA CDS 34653..35825 product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206653.1 transl_table 11 codon_start 1 locus_tag LOCUS_10310 CDS 36404..37663 product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523873.1 transl_table 11 codon_start 1 locus_tag LOCUS_10320 CDS 38099..39223 product trimeric porin PorB.IB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951356.1 transl_table 11 codon_start 1 locus_tag LOCUS_10330 gene porB CDS 39749..40909 product porin Omp38 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184655.1 transl_table 11 codon_start 1 locus_tag LOCUS_10340 gene omp38 CDS 41299..41613 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10350 CDS 41965..42957 product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001076190.1 transl_table 11 codon_start 1 locus_tag LOCUS_10360 gene gpsA CDS 43113..44123 product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704123.1 transl_table 11 codon_start 1 locus_tag LOCUS_10370 gene hemB CDS complement(44400..44582) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10380 CDS 44832..46289 product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260910.1 transl_table 11 codon_start 1 locus_tag LOCUS_10390 CDS 46617..47333 product envelope stress response regulator transcription factor CpxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862004.1 transl_table 11 codon_start 1 locus_tag LOCUS_10400 gene cpxR CDS 47400..48746 product envelope stress sensor histidine kinase CpxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001239207.1 transl_table 11 codon_start 1 locus_tag LOCUS_10410 gene cpxA CDS complement(48798..49604) product phosphodiester glycosidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480270.1 transl_table 11 codon_start 1 locus_tag LOCUS_10420 CDS complement(49713..50483) product inositol-1-monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016350372.1 transl_table 11 codon_start 1 locus_tag LOCUS_10430 gene suhB CDS complement(50738..52300) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10440 CDS complement(52316..53158) product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070673.1 transl_table 11 codon_start 1 locus_tag LOCUS_10450 gene rsmI CDS 53215..53568 product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217775.1 transl_table 11 codon_start 1 locus_tag LOCUS_10460 CDS complement(54031..55326) product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070424.1 transl_table 11 codon_start 1 locus_tag LOCUS_10470 gene dnaA CDS complement(55480..56262) product lipid asymmetry maintenance ABC transporter permease subunit MlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931637.1 transl_table 11 codon_start 1 locus_tag LOCUS_10480 gene mlaE CDS complement(56259..57056) product phospholipid ABC transporter ATP-binding protein MlaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000083183.1 transl_table 11 codon_start 1 locus_tag LOCUS_10490 gene mlaF CDS complement(57262..57780) product disulfide bond formation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036135.1 transl_table 11 codon_start 1 locus_tag LOCUS_10500 tRNA complement(58052..58127) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00180 tRNA complement(58132..58207) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00190 CDS 59194..59742 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10510 CDS 59964..62429 product fimbrial biogenesis outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000277116.1 transl_table 11 codon_start 1 locus_tag LOCUS_10520 CDS 62436..63173 product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209596.1 transl_table 11 codon_start 1 locus_tag LOCUS_10530 CDS 63755..64315 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10540 CDS complement(64696..65118) product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005304459.1 transl_table 11 codon_start 1 locus_tag LOCUS_10550 gene dksA CDS complement(65571..65954) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10560 CDS complement(66141..66893) product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851754.1 transl_table 11 codon_start 1 locus_tag LOCUS_10570 gene dapB CDS complement(67162..67746) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10580 CDS 68285..68914 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10590 CDS 69134..69694 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10600 CDS 70007..72439 product fimbrial biogenesis outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000277116.1 transl_table 11 codon_start 1 locus_tag LOCUS_10610 CDS 72452..73159 product fimbria/pilus periplasmic chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095778.1 transl_table 11 codon_start 1 locus_tag LOCUS_10620 CDS 73281..74441 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10630 tRNA complement(74851..74941) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00200 CDS complement(75040..75768) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10640 CDS complement(75964..76743) product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162618313.1 transl_table 11 codon_start 1 locus_tag LOCUS_10650 gene hisN CDS complement(76981..77874) product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097276.1 transl_table 11 codon_start 1 locus_tag LOCUS_10660 gene glyQ CDS complement(78101..80422) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10670 CDS 80597..80800 product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016351725.1 transl_table 11 codon_start 1 locus_tag LOCUS_10680 gene xseB CDS 80826..81701 product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140419.1 transl_table 11 codon_start 1 locus_tag LOCUS_10690 CDS 81716..83632 product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037575.1 transl_table 11 codon_start 1 locus_tag LOCUS_10700 gene dxs CDS 84149..87106 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10710 repeat_region 85905..86092 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ccggcaatggttccggcaat CDS complement(87250..87975) product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260978.1 transl_table 11 codon_start 1 locus_tag LOCUS_10720 gene rph CDS complement(88011..88202) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10730 CDS complement(88451..88669) product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947496.1 transl_table 11 codon_start 1 locus_tag LOCUS_10740 gene infA tRNA complement(88698..88774) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00210 CDS complement(88987..90480) product AdeC/AdeK/OprM family multidrug efflux complex outer membrane factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268788.1 transl_table 11 codon_start 1 locus_tag LOCUS_10750 CDS complement(90620..91123) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10760 CDS 91299..92537 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10770 CDS complement(92663..93205) product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922248.1 transl_table 11 codon_start 1 locus_tag LOCUS_10780 CDS complement(93343..93531) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10790 CDS 93569..94120 product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038393.1 transl_table 11 codon_start 1 locus_tag LOCUS_10800 CDS 94504..95205 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10810 CDS complement(95437..96180) product tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073641.1 transl_table 11 codon_start 1 locus_tag LOCUS_10820 gene tcdA CDS complement(96371..96949) product superoxide dismutase [Fe] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064087.1 transl_table 11 codon_start 1 locus_tag LOCUS_10830 gene sodB CDS complement(97076..97525) product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093308.1 transl_table 11 codon_start 1 locus_tag LOCUS_10840 gene nusB CDS complement(97624..101733) product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093745.1 transl_table 11 codon_start 1 locus_tag LOCUS_10850 gene rpoC CDS complement(101795..105925) product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114335.1 transl_table 11 codon_start 1 locus_tag LOCUS_10860 gene rpoB CDS complement(106151..106522) product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946072.1 transl_table 11 codon_start 1 locus_tag LOCUS_10870 gene rplL CDS complement(106600..107109) product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199864.1 transl_table 11 codon_start 1 locus_tag LOCUS_10880 gene rplJ CDS complement(107328..108017) product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005065788.1 transl_table 11 codon_start 1 locus_tag LOCUS_10890 gene rplA CDS complement(108019..108450) product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093751.1 transl_table 11 codon_start 1 locus_tag LOCUS_10900 gene rplK CDS complement(108668..109195) product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287510.1 transl_table 11 codon_start 1 locus_tag LOCUS_10910 gene nusG CDS complement(109205..109642) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10920 tRNA complement(109744..109819) product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00220 CDS complement(109841..111031) product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115146.1 transl_table 11 codon_start 1 locus_tag LOCUS_10930 gene tuf tRNA complement(111075..111150) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00230 tRNA complement(111157..111230) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00240 CDS complement(111399..113360) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10940 CDS complement(113546..114469) product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965131.1 transl_table 11 codon_start 1 locus_tag LOCUS_10950 gene metA CDS complement(114900..116183) product homocysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272631.1 transl_table 11 codon_start 1 locus_tag LOCUS_10960 CDS complement(116556..117950) product guanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104657.1 transl_table 11 codon_start 1 locus_tag LOCUS_10970 gene guaD CDS complement(118021..118428) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10980 CDS complement(118619..119158) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10990 CDS 119472..120617 product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000765133.1 transl_table 11 codon_start 1 locus_tag LOCUS_11000 CDS 120630..123875 product SMC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001247465.1 transl_table 11 codon_start 1 locus_tag LOCUS_11010 CDS 124046..124486 product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461101.1 transl_table 11 codon_start 1 locus_tag LOCUS_11020 CDS 124611..127973 product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113980.1 transl_table 11 codon_start 1 locus_tag LOCUS_11030 gene mfd CDS 128205..129548 product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207971.1 transl_table 11 codon_start 1 locus_tag LOCUS_11040 gene glmU CDS 129798..130112 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11050 CDS complement(130499..131209) product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530319.1 transl_table 11 codon_start 1 locus_tag LOCUS_11060 CDS complement(131316..132167) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693198.1 transl_table 11 codon_start 1 locus_tag LOCUS_11070 CDS complement(132545..133147) product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704156.1 transl_table 11 codon_start 1 locus_tag LOCUS_11080 CDS complement(133381..134886) product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038949.1 transl_table 11 codon_start 1 locus_tag LOCUS_11090 CDS 135090..136031 product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053942.1 transl_table 11 codon_start 1 locus_tag LOCUS_11100 CDS 136224..137003 product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000506501.1 transl_table 11 codon_start 1 locus_tag LOCUS_11110 gene fabI CDS 137809..139026 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207259.1 transl_table 11 codon_start 1 locus_tag LOCUS_11120 CDS complement(139126..141330) product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001247858.1 transl_table 11 codon_start 1 locus_tag LOCUS_11130 gene priA CDS complement(141659..142864) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11140 CDS complement(143081..143974) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040246.1 transl_table 11 codon_start 1 locus_tag LOCUS_11150 CDS complement(143988..144260) product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037355.1 transl_table 11 codon_start 1 locus_tag LOCUS_11160 CDS complement(144457..145080) product septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210640.1 transl_table 11 codon_start 1 locus_tag LOCUS_11170 CDS complement(145055..145996) product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706105.1 transl_table 11 codon_start 1 locus_tag LOCUS_11180 gene fabD CDS complement(146274..147227) product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036218.1 transl_table 11 codon_start 1 locus_tag LOCUS_11190 CDS complement(147239..148285) product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947122.1 transl_table 11 codon_start 1 locus_tag LOCUS_11200 gene plsX CDS complement(148401..148595) product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210931.1 transl_table 11 codon_start 1 locus_tag LOCUS_11210 gene rpmF CDS complement(148671..149186) product 23S rRNA accumulation protein YceD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705036.1 transl_table 11 codon_start 1 locus_tag LOCUS_11220 gene yceD CDS complement(149259..149738) product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719152.1 transl_table 11 codon_start 1 locus_tag LOCUS_11230 gene moaC CDS complement(149850..150299) product YcgN family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337389.1 transl_table 11 codon_start 1 locus_tag LOCUS_11240 CDS complement(150501..151664) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11250 CDS complement(151710..152120) product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006309922.1 transl_table 11 codon_start 1 locus_tag LOCUS_11260 CDS complement(152638..152925) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11270 CDS complement(152936..153187) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11280 CDS complement(153204..154418) product 2-octaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105378.1 transl_table 11 codon_start 1 locus_tag LOCUS_11290 CDS complement(154591..155760) product 2-octaprenyl-6-methoxyphenyl hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206100.1 transl_table 11 codon_start 1 locus_tag LOCUS_11300 gene ubiH CDS complement(156041..156805) product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218216.1 transl_table 11 codon_start 1 locus_tag LOCUS_11310 gene map CDS complement(156900..157466) product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948641.1 transl_table 11 codon_start 1 locus_tag LOCUS_11320 gene dcd CDS complement(157574..158677) product iron-sulfur cluster carrier protein ApbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193796.1 transl_table 11 codon_start 1 locus_tag LOCUS_11330 gene apbC CDS complement(158847..159347) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070930.1 transl_table 11 codon_start 1 locus_tag LOCUS_11340 gene tsaE CDS complement(159412..160797) product multidrug efflux MATE transporter AbeM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208268.1 transl_table 11 codon_start 1 locus_tag LOCUS_11350 gene abeM CDS complement(161064..162881) product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113354.1 transl_table 11 codon_start 1 locus_tag LOCUS_11360 gene uvrC CDS 163062..163541 product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969811.1 transl_table 11 codon_start 1 locus_tag LOCUS_11370 CDS complement(163677..164822) product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262601.1 transl_table 11 codon_start 1 locus_tag LOCUS_11380 CDS complement(164957..166237) product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262600.1 transl_table 11 codon_start 1 locus_tag LOCUS_11390 CDS 166466..166813 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11400 note possible pseudo, frameshifted CDS 167032..167172 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11410 note possible pseudo, frameshifted CDS complement(167165..167470) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11420 CDS complement(167476..168531) product HaeII family restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003686885.1 transl_table 11 codon_start 1 locus_tag LOCUS_11430 CDS complement(168521..169489) product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951379.1 transl_table 11 codon_start 1 locus_tag LOCUS_11440 CDS complement(169648..170163) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11450 note possible pseudo, frameshifted CDS complement(170168..170491) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11460 note possible pseudo, frameshifted CDS 170606..170911 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11470 CDS complement(170945..172882) product 23S rRNA 5-hydroxycytidine C2501 synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001313806.1 transl_table 11 codon_start 1 locus_tag LOCUS_11480 gene rlhA CDS complement(173114..174430) product ferric reductase-like transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101595.1 transl_table 11 codon_start 1 locus_tag LOCUS_11490 CDS complement(174764..174916) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11500 CDS complement(174926..177634) product decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965961.1 transl_table 11 codon_start 1 locus_tag LOCUS_11510 CDS complement(178187..178972) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11520 CDS 179284..179796 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11530 CDS 179823..181418 product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385648.1 transl_table 11 codon_start 1 locus_tag LOCUS_11540 CDS 181422..182873 product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174847132.1 transl_table 11 codon_start 1 locus_tag LOCUS_11550 CDS complement(183230..184315) product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_212090561.1 transl_table 11 codon_start 1 locus_tag LOCUS_11560 CDS complement(184343..185113) product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000931981.1 transl_table 11 codon_start 1 locus_tag LOCUS_11570 gene thiG CDS complement(185115..185360) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11580 CDS complement(185350..186063) product thiazole tautomerase TenI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232908.1 transl_table 11 codon_start 1 locus_tag LOCUS_11590 gene tenI CDS complement(186503..187627) product sodium-potassium/proton antiporter ChaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096238.1 transl_table 11 codon_start 1 locus_tag LOCUS_11600 gene chaA CDS complement(188021..189076) product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_155710829.1 transl_table 11 codon_start 1 locus_tag LOCUS_11610 CDS complement(189565..190539) product octaprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261094.1 transl_table 11 codon_start 1 locus_tag LOCUS_11620 gene ispB CDS complement(190720..191610) product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174849043.1 transl_table 11 codon_start 1 locus_tag LOCUS_11630 CDS complement(191829..192506) product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206373.1 transl_table 11 codon_start 1 locus_tag LOCUS_11640 CDS 192846..194240 product succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246615.1 transl_table 11 codon_start 1 locus_tag LOCUS_11650 gene gabD CDS 194821..196152 product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000373050.1 transl_table 11 codon_start 1 locus_tag LOCUS_11660 gene gdhA CDS 196215..196379 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11670 CDS 196575..197165 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11680 CDS 197228..197704 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11690 repeat_region 198141..198526 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcttaatcccttttcaaacagggcatgattctgac CDS 198828..199457 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11700 CDS complement(199572..200576) product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926825.1 transl_table 11 codon_start 1 locus_tag LOCUS_11710 gene dprA CDS complement(200740..201072) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11720 CDS complement(201123..201452) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11730 repeat_region 201652..202092 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq aatcccttttcaaacagggcatgatcccgac CDS complement(202313..202576) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11740 CDS complement(202573..203586) product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546247.1 transl_table 11 codon_start 1 locus_tag LOCUS_11750 gene cas1 CDS complement(203611..203886) product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545199.1 transl_table 11 codon_start 1 locus_tag LOCUS_11760 gene cas2 CDS complement(203980..204921) product CRISPR system precrRNA processing endoribonuclease RAMP protein Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545643.1 transl_table 11 codon_start 1 locus_tag LOCUS_11770 gene cas6 CDS complement(204993..205301) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11780 CDS complement(205342..205563) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11790 CDS complement(206263..207321) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11800 CDS complement(207332..207712) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11810 CDS complement(207715..208599) product type III-B CRISPR module RAMP protein Cmr4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229141.1 transl_table 11 codon_start 1 locus_tag LOCUS_11820 gene cmr4 CDS complement(208690..209880) product type III-B CRISPR module-associated protein Cmr3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229143.1 transl_table 11 codon_start 1 locus_tag LOCUS_11830 CDS complement(209882..211738) product type III-B CRISPR-associated protein Cas10/Cmr2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229144.1 transl_table 11 codon_start 1 locus_tag LOCUS_11840 gene cas10 CDS complement(211748..212989) product type III-B CRISPR module RAMP protein Cmr1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229142.1 transl_table 11 codon_start 1 locus_tag LOCUS_11850 gene cmr1 CDS complement(213029..214165) product CRISPR-associated ring nuclease Csm6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545465.1 transl_table 11 codon_start 1 locus_tag LOCUS_11860 gene csm6 CDS complement(214158..215312) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11870 CDS complement(215482..215799) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11880 CDS 216077..218128 product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693902.1 transl_table 11 codon_start 1 locus_tag LOCUS_11890 gene recG CDS complement(218213..219187) product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775782.1 transl_table 11 codon_start 1 locus_tag LOCUS_11900 CDS complement(219450..220259) product putative hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925131.1 transl_table 11 codon_start 1 locus_tag LOCUS_11910 CDS 220679..221473 product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108359.1 transl_table 11 codon_start 1 locus_tag LOCUS_11920 CDS 221767..222915 product L-threonine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104943.1 transl_table 11 codon_start 1 locus_tag LOCUS_11930 gene yiaY CDS complement(223342..224454) product glycerol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815496.1 transl_table 11 codon_start 1 locus_tag LOCUS_11940 CDS complement(224839..225759) product Dyp-type peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098206.1 transl_table 11 codon_start 1 locus_tag LOCUS_11950 CDS 226142..226645 product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268734.1 transl_table 11 codon_start 1 locus_tag LOCUS_11960 CDS 226741..227418 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105021.1 transl_table 11 codon_start 1 locus_tag LOCUS_11970 CDS 227617..229269 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11980 CDS 229531..230280 product MipA/OmpV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000163762.1 transl_table 11 codon_start 1 locus_tag LOCUS_11990 CDS complement(230414..231619) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12000 CDS complement(231612..232805) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000679653.1 transl_table 11 codon_start 1 locus_tag LOCUS_12010 CDS complement(232934..233923) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091837.1 transl_table 11 codon_start 1 locus_tag LOCUS_12020 CDS complement(234494..235753) product D-amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705114.1 transl_table 11 codon_start 1 locus_tag LOCUS_12030 CDS complement(235824..236717) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705115.1 transl_table 11 codon_start 1 locus_tag LOCUS_12040 CDS 236703..236879 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12050 CDS 237352..237546 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12060 CDS 237677..237847 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12070 CDS 238272..238532 product DUF2798 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338670.1 transl_table 11 codon_start 1 locus_tag LOCUS_12080 CDS complement(238720..240810) product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707071.1 transl_table 11 codon_start 1 locus_tag LOCUS_12090 gene pnp CDS complement(240826..241002) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12100 CDS complement(241151..241417) product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369527.1 transl_table 11 codon_start 1 locus_tag LOCUS_12110 gene rpsO CDS complement(241508..242083) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12120 CDS complement(242085..243308) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405098.1 transl_table 11 codon_start 1 locus_tag LOCUS_12130 CDS 243584..244375 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12140 CDS complement(244379..246559) product bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260973.1 transl_table 11 codon_start 1 locus_tag LOCUS_12150 gene spoT CDS complement(246683..246913) product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116990.1 transl_table 11 codon_start 1 locus_tag LOCUS_12160 gene rpoZ CDS complement(247261..247908) product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098317.1 transl_table 11 codon_start 1 locus_tag LOCUS_12170 gene gmk CDS 248071..248655 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12180 CDS 249070..250983 product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114649.1 transl_table 11 codon_start 1 locus_tag LOCUS_12190 gene mnmG CDS 250991..254302 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12200 CDS 254534..255388 product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809626.1 transl_table 11 codon_start 1 locus_tag LOCUS_12210 gene folP CDS 255660..257606 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261067.1 transl_table 11 codon_start 1 locus_tag LOCUS_12220 CDS 258170..259078 product cytochrome o ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818324.1 transl_table 11 codon_start 1 locus_tag LOCUS_12230 gene cyoA CDS 259105..261108 product cytochrome o ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000467158.1 transl_table 11 codon_start 1 locus_tag LOCUS_12240 gene cyoB CDS 261108..261719 product cytochrome o ubiquinol oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706742.1 transl_table 11 codon_start 1 locus_tag LOCUS_12250 CDS 261716..262102 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12260 CDS 262219..263100 product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367961.1 transl_table 11 codon_start 1 locus_tag LOCUS_12270 gene cyoE CDS 263390..264151 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222631.1 transl_table 11 codon_start 1 locus_tag LOCUS_12280 CDS 264338..265237 product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732488.1 transl_table 11 codon_start 1 locus_tag LOCUS_12290 CDS complement(265329..266150) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12300 CDS complement(266304..267377) product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112284.1 transl_table 11 codon_start 1 locus_tag LOCUS_12310 gene alr CDS complement(267518..268177) product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087105.1 transl_table 11 codon_start 1 locus_tag LOCUS_12320 CDS 268422..269162 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12330 CDS 269322..270350 product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767561.1 transl_table 11 codon_start 1 locus_tag LOCUS_12340 CDS 270507..270896 product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479566.1 transl_table 11 codon_start 1 locus_tag LOCUS_12350 CDS complement(271286..271867) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12360 CDS 272164..274464 product bifunctional acyl-ACP--phospholipid O-acyltransferase/long-chain-fatty-acid--ACP ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000899007.1 transl_table 11 codon_start 1 locus_tag LOCUS_12370 gene aas CDS 274489..275715 product lysophospholipid transporter LplT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816987.1 transl_table 11 codon_start 1 locus_tag LOCUS_12380 gene lplT CDS complement(275957..277201) product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211633.1 transl_table 11 codon_start 1 locus_tag LOCUS_12390 gene pepT CDS complement(277385..278962) product AbgT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211634.1 transl_table 11 codon_start 1 locus_tag LOCUS_12400 CDS complement(279267..280790) product DUF853 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704217.1 transl_table 11 codon_start 1 locus_tag LOCUS_12410 CDS 281569..282570 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12420 CDS complement(282932..285067) product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004538477.1 transl_table 11 codon_start 1 locus_tag LOCUS_12430 gene metG CDS complement(285216..285689) product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219242.1 transl_table 11 codon_start 1 locus_tag LOCUS_12440 gene ispF CDS complement(285686..286414) product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005655267.1 transl_table 11 codon_start 1 locus_tag LOCUS_12450 gene ispD CDS 286561..287385 product shikimate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694543.1 transl_table 11 codon_start 1 locus_tag LOCUS_12460 CDS complement(287433..287675) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12470 CDS complement(287793..288098) product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005491075.1 transl_table 11 codon_start 1 locus_tag LOCUS_12480 gene ihfB CDS complement(288343..290010) product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140318.1 transl_table 11 codon_start 1 locus_tag LOCUS_12490 gene rpsA CDS complement(290258..290929) product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367471.1 transl_table 11 codon_start 1 locus_tag LOCUS_12500 gene cmk CDS 291207..292136 product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703979.1 transl_table 11 codon_start 1 locus_tag LOCUS_12510 gene hemC CDS 292123..294555 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12520 CDS 294558..296039 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12530 CDS complement(296340..297431) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12540 CDS complement(297687..298883) product aspartate/tyrosine/aromatic aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104588.1 transl_table 11 codon_start 1 locus_tag LOCUS_12550 CDS complement(298898..300706) product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957983.1 transl_table 11 codon_start 1 locus_tag LOCUS_12560 CDS complement(300727..302790) product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809633.1 transl_table 11 codon_start 1 locus_tag LOCUS_12570 gene ppk1 CDS complement(302857..303270) product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770045.1 transl_table 11 codon_start 1 locus_tag LOCUS_12580 CDS complement(303283..304671) product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074330.1 transl_table 11 codon_start 1 locus_tag LOCUS_12590 gene atpD CDS complement(304716..305615) product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262900.1 transl_table 11 codon_start 1 locus_tag LOCUS_12600 gene atpG CDS complement(305660..307207) product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948668.1 transl_table 11 codon_start 1 locus_tag LOCUS_12610 gene atpA CDS complement(307239..307817) product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114070.1 transl_table 11 codon_start 1 locus_tag LOCUS_12620 CDS complement(307845..308315) product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001024691.1 transl_table 11 codon_start 1 locus_tag LOCUS_12630 CDS complement(308392..308625) product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214801.1 transl_table 11 codon_start 1 locus_tag LOCUS_12640 gene atpE CDS complement(308699..309520) product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004538602.1 transl_table 11 codon_start 1 locus_tag LOCUS_12650 gene atpB CDS complement(309529..309882) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12660 CDS complement(309967..310845) product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003315951.1 transl_table 11 codon_start 1 locus_tag LOCUS_12670 CDS complement(310842..311627) product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377884.1 transl_table 11 codon_start 1 locus_tag LOCUS_12680 CDS complement(311911..312543) product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369001.1 transl_table 11 codon_start 1 locus_tag LOCUS_12690 gene rsmG CDS complement(312783..313988) product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000397387.1 transl_table 11 codon_start 1 locus_tag LOCUS_12700 gene moeA CDS complement(313990..314667) product molybdenum cofactor guanylyltransferase MobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213171.1 transl_table 11 codon_start 1 locus_tag LOCUS_12710 gene mobA CDS complement(314702..315166) product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532478.1 transl_table 11 codon_start 1 locus_tag LOCUS_12720 CDS complement(315171..315419) product molybdopterin synthase sulfur carrier subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000598590.1 transl_table 11 codon_start 1 locus_tag LOCUS_12730 gene moaD CDS complement(315616..316512) product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222859.1 transl_table 11 codon_start 1 locus_tag LOCUS_12740 CDS complement(316513..317238) product zinc ABC transporter ATP-binding protein AztA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532307.1 transl_table 11 codon_start 1 locus_tag LOCUS_12750 gene aztA CDS 317741..318094 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12760 CDS 318186..318968 product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771252.1 transl_table 11 codon_start 1 locus_tag LOCUS_12770 CDS 319116..320555 product bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693548.1 transl_table 11 codon_start 1 locus_tag LOCUS_12780 gene hldE CDS 320832..321404 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12790 note possible pseudo, frameshifted CDS 321493..321837 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12800 note possible pseudo, frameshifted CDS 322238..323164 product 23S rRNA pseudouridine(955/2504/2580) synthase RluC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693754.1 transl_table 11 codon_start 1 locus_tag LOCUS_12810 gene rluC CDS 323389..323790 product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814639.1 transl_table 11 codon_start 1 locus_tag LOCUS_12820 gene ybgC CDS 323805..324506 product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000123084.1 transl_table 11 codon_start 1 locus_tag LOCUS_12830 gene tolQ CDS 324560..324988 product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086126.1 transl_table 11 codon_start 1 locus_tag LOCUS_12840 gene tolR CDS 325018..326094 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12850 CDS 326132..326830 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12860 CDS complement(327679..328260) product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192241.1 transl_table 11 codon_start 1 locus_tag LOCUS_12870 CDS complement(328475..332125) product ribonuclease E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895645.1 transl_table 11 codon_start 1 locus_tag LOCUS_12880 gene rne CDS complement(332698..333432) product penicillin-binding protein activator LpoP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095080.1 transl_table 11 codon_start 1 locus_tag LOCUS_12890 gene lpoP CDS complement(333539..335890) product penicillin-binding protein 1B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100154.1 transl_table 11 codon_start 1 locus_tag LOCUS_12900 gene mrcB CDS 336242..337051 product CNNM family magnesium/cobalt transport protein CorC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071409.1 transl_table 11 codon_start 1 locus_tag LOCUS_12910 gene corC tRNA 337226..337302 product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00250 CDS 337496..338473 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12920 CDS complement(338482..339390) product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480058.1 transl_table 11 codon_start 1 locus_tag LOCUS_12930 gene miaA CDS 339478..340446 product lysine-2,3-aminomutase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387977.1 transl_table 11 codon_start 1 locus_tag LOCUS_12940 CDS complement(340472..341074) product high frequency lysogenization protein HflD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767416.1 transl_table 11 codon_start 1 locus_tag LOCUS_12950 gene hflD CDS complement(341311..342861) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265659.1 transl_table 11 codon_start 1 locus_tag LOCUS_12960 tRNA 343382..343456 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00260 tRNA complement(343722..343811) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00270 CDS 343988..344752 product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548752.1 transl_table 11 codon_start 1 locus_tag LOCUS_12970 CDS complement(344821..345831) product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246535.1 transl_table 11 codon_start 1 locus_tag LOCUS_12980 gene xerC CDS complement(345922..347325) product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704801.1 transl_table 11 codon_start 1 locus_tag LOCUS_12990 gene aspA CDS complement(347381..347749) product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811999.1 transl_table 11 codon_start 1 locus_tag LOCUS_13000 CDS complement(347919..348227) product cell division topological specificity factor MinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091581.1 transl_table 11 codon_start 1 locus_tag LOCUS_13010 gene minE CDS complement(348230..349039) product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005163000.1 transl_table 11 codon_start 1 locus_tag LOCUS_13020 gene minD CDS complement(349266..349988) product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009874282.1 transl_table 11 codon_start 1 locus_tag LOCUS_13030 gene minC CDS complement(350071..350553) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406868.1 transl_table 11 codon_start 1 locus_tag LOCUS_13040 CDS 350779..351444 product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071382.1 transl_table 11 codon_start 1 locus_tag LOCUS_13050 gene rpiA CDS 351657..352289 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13060 CDS 352348..352815 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13070 CDS 352825..353547 product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073698.1 transl_table 11 codon_start 1 locus_tag LOCUS_13080 gene lptB CDS 353619..355037 product exodeoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211904.1 transl_table 11 codon_start 1 locus_tag LOCUS_13090 gene sbcB CDS 355074..355928 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13100 CDS 356003..356731 product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541081.1 transl_table 11 codon_start 1 locus_tag LOCUS_13110 CDS complement(357085..357615) product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930094.1 transl_table 11 codon_start 1 locus_tag LOCUS_13120 CDS complement(357808..359553) product lipid A ABC transporter ATP-binding protein/permease MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000052153.1 transl_table 11 codon_start 1 locus_tag LOCUS_13130 gene msbA CDS complement(359674..360180) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13140 CDS complement(360225..361496) product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038134.1 transl_table 11 codon_start 1 locus_tag LOCUS_13150 gene tolB CDS complement(361557..362108) product hypoxanthine-guanine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318214.1 transl_table 11 codon_start 1 locus_tag LOCUS_13160 CDS complement(362166..363416) product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073598.1 transl_table 11 codon_start 1 locus_tag LOCUS_13170 gene hemA CDS complement(363590..364156) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13180 CDS complement(364476..365954) product 4-hydroxy-3-polyprenylbenzoate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070851.1 transl_table 11 codon_start 1 locus_tag LOCUS_13190 gene ubiD CDS 366330..368021 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13200 CDS 368175..369209 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13210 CDS 369245..370126 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13220 CDS 370252..370914 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13230 CDS complement(370985..372358) product sodium-coupled multidrug efflux MATE transporter VmrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481584.1 transl_table 11 codon_start 1 locus_tag LOCUS_13240 gene vmrA CDS 372628..373554 product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389548.1 transl_table 11 codon_start 1 locus_tag LOCUS_13250 CDS complement(373723..375207) product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016944807.1 transl_table 11 codon_start 1 locus_tag LOCUS_13260 gene ppx CDS complement(375401..376189) product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815545.1 transl_table 11 codon_start 1 locus_tag LOCUS_13270 gene rsmA CDS complement(376471..377406) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13280 CDS 377390..377614 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13290 CDS 377628..378230 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13300 CDS 378240..379958 product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038936.1 transl_table 11 codon_start 1 locus_tag LOCUS_13310 gene argS CDS 380045..380773 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13320 CDS 380956..381528 product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037865.1 transl_table 11 codon_start 1 locus_tag LOCUS_13330 CDS complement(381673..382245) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366516.1 transl_table 11 codon_start 1 locus_tag LOCUS_13340 CDS complement(382417..383286) product arginase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705488.1 transl_table 11 codon_start 1 locus_tag LOCUS_13350 CDS 383610..384125 product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703433.1 transl_table 11 codon_start 1 locus_tag LOCUS_13360 CDS 384170..386404 product YccS family putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097254.1 transl_table 11 codon_start 1 locus_tag LOCUS_13370 gene yccS CDS 386769..388172 product nucleotide 5'-monophosphate nucleosidase PpnN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816970.1 transl_table 11 codon_start 1 locus_tag LOCUS_13380 gene ppnN CDS complement(388767..390410) product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729126.1 transl_table 11 codon_start 1 locus_tag LOCUS_13390 gene groL CDS complement(390504..390794) product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003304675.1 transl_table 11 codon_start 1 locus_tag LOCUS_13400 CDS 391060..392415 product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112342.1 transl_table 11 codon_start 1 locus_tag LOCUS_13410 CDS complement(393070..393510) product Cd(II)/Pb(II)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812014.1 transl_table 11 codon_start 1 locus_tag LOCUS_13420 gene cadR CDS 393692..396097 product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105404.1 transl_table 11 codon_start 1 locus_tag LOCUS_13430 CDS complement(396624..397019) product YgiW/YdeI family stress tolerance OB fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000731552.1 transl_table 11 codon_start 1 locus_tag LOCUS_13440 CDS complement(397080..397622) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13450 CDS complement(397843..399300) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207220.1 transl_table 11 codon_start 1 locus_tag LOCUS_13460 CDS complement(399385..400038) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207221.1 transl_table 11 codon_start 1 locus_tag LOCUS_13470 misc_feature complement(400261..>402097) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_052728129.1:YadA-like family protein locus_tag LOCUS_13480 sequence04 source 1..288670 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(302..466) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13490 CDS complement(517..1734) product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141373.1 transl_table 11 codon_start 1 locus_tag LOCUS_13500 CDS complement(1952..3034) product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946340.1 transl_table 11 codon_start 1 locus_tag LOCUS_13510 gene sufD CDS complement(3045..3815) product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037895.1 transl_table 11 codon_start 1 locus_tag LOCUS_13520 gene sufC CDS complement(3891..5348) product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141370.1 transl_table 11 codon_start 1 locus_tag LOCUS_13530 gene sufB CDS complement(5458..5880) product SUF system Fe-S cluster assembly regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141369.1 transl_table 11 codon_start 1 locus_tag LOCUS_13540 CDS complement(6065..7351) product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000036723.1 transl_table 11 codon_start 1 locus_tag LOCUS_13550 gene eno CDS complement(7465..8742) product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038338.1 transl_table 11 codon_start 1 locus_tag LOCUS_13560 CDS complement(8925..9956) product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963929.1 transl_table 11 codon_start 1 locus_tag LOCUS_13570 CDS complement(10352..10594) product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038339.1 transl_table 11 codon_start 1 locus_tag LOCUS_13580 CDS complement(10787..12043) product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769919.1 transl_table 11 codon_start 1 locus_tag LOCUS_13590 gene rho CDS complement(12257..12928) product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000364318.1 transl_table 11 codon_start 1 locus_tag LOCUS_13600 CDS complement(13066..13800) product lipoprotein-releasing ABC transporter ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207403.1 transl_table 11 codon_start 1 locus_tag LOCUS_13610 gene lolD CDS complement(13793..15130) product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119805.1 transl_table 11 codon_start 1 locus_tag LOCUS_13620 CDS complement(15295..15900) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13630 CDS 16739..18031 product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815452.1 transl_table 11 codon_start 1 locus_tag LOCUS_13640 CDS 18160..19602 product cation:dicarboxylase symporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861591.1 transl_table 11 codon_start 1 locus_tag LOCUS_13650 CDS 19747..21081 product CoA-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002665679.1 transl_table 11 codon_start 1 locus_tag LOCUS_13660 CDS complement(21278..22315) product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105191.1 transl_table 11 codon_start 1 locus_tag LOCUS_13670 gene holA CDS complement(22444..23031) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815883.1 transl_table 11 codon_start 1 locus_tag LOCUS_13680 CDS 23158..24666 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815884.1 transl_table 11 codon_start 1 locus_tag LOCUS_13690 CDS 24984..26270 product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926512.1 transl_table 11 codon_start 1 locus_tag LOCUS_13700 CDS 26410..27594 product M20 aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816039.1 transl_table 11 codon_start 1 locus_tag LOCUS_13710 CDS 27962..29452 product AbgT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903217.1 transl_table 11 codon_start 1 locus_tag LOCUS_13720 CDS 29697..30350 product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000828762.1 transl_table 11 codon_start 1 locus_tag LOCUS_13730 gene queC CDS 30352..30777 product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000941336.1 transl_table 11 codon_start 1 locus_tag LOCUS_13740 gene queD CDS 30774..31496 product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000036294.1 transl_table 11 codon_start 1 locus_tag LOCUS_13750 gene queE CDS 31929..33656 product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098265.1 transl_table 11 codon_start 1 locus_tag LOCUS_13760 CDS 33880..35607 product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098265.1 transl_table 11 codon_start 1 locus_tag LOCUS_13770 CDS complement(35829..36188) product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243874.1 transl_table 11 codon_start 1 locus_tag LOCUS_13780 CDS complement(36185..36541) product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000263260.1 transl_table 11 codon_start 1 locus_tag LOCUS_13790 tRNA 36884..36960 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00280 CDS 37043..37519 product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004411704.1 transl_table 11 codon_start 1 locus_tag LOCUS_13800 gene rimP CDS 37542..39035 product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095192.1 transl_table 11 codon_start 1 locus_tag LOCUS_13810 gene nusA CDS 39094..41763 product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000192207.1 transl_table 11 codon_start 1 locus_tag LOCUS_13820 gene infB CDS 41763..42182 product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829509.1 transl_table 11 codon_start 1 locus_tag LOCUS_13830 gene rbfA CDS 42166..43098 product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481564.1 transl_table 11 codon_start 1 locus_tag LOCUS_13840 gene truB CDS 43203..44456 product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189552.1 transl_table 11 codon_start 1 locus_tag LOCUS_13850 gene icd CDS complement(44846..45049) product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187926.1 transl_table 11 codon_start 1 locus_tag LOCUS_13860 CDS 45199..45693 product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693858.1 transl_table 11 codon_start 1 locus_tag LOCUS_13870 gene folK CDS 45814..46407 product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476167.1 transl_table 11 codon_start 1 locus_tag LOCUS_13880 CDS 46830..48152 product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001039275.1 transl_table 11 codon_start 1 locus_tag LOCUS_13890 gene brnQ CDS 48552..49322 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000759079.1 transl_table 11 codon_start 1 locus_tag LOCUS_13900 CDS 49784..51073 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13910 CDS 51076..51537 product GspG family T2SS major pseudopilin variant XcpT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119751.1 transl_table 11 codon_start 1 locus_tag LOCUS_13920 gene xcpT CDS 51563..52396 product tRNA pseudouridine(65) synthase TruC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098526.1 transl_table 11 codon_start 1 locus_tag LOCUS_13930 gene truC CDS complement(52593..55082) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13940 CDS complement(55619..56833) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693428.1 transl_table 11 codon_start 1 locus_tag LOCUS_13950 CDS 57200..57673 product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224865.1 transl_table 11 codon_start 1 locus_tag LOCUS_13960 gene queF CDS complement(57902..58297) product DUF1622 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386965.1 transl_table 11 codon_start 1 locus_tag LOCUS_13970 CDS complement(58303..58968) product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989825.1 transl_table 11 codon_start 1 locus_tag LOCUS_13980 gene pyrE CDS complement(58968..59678) product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723076.1 transl_table 11 codon_start 1 locus_tag LOCUS_13990 gene pyrF CDS 60467..61387 product siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287908.1 transl_table 11 codon_start 1 locus_tag LOCUS_14000 CDS 61930..63672 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14010 CDS 64311..65024 product fumarate/nitrate reduction transcriptional regulator Fnr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070077129.1 transl_table 11 codon_start 1 locus_tag LOCUS_14020 gene fnr CDS complement(65362..66579) product aromatic amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693687.1 transl_table 11 codon_start 1 locus_tag LOCUS_14030 tRNA 67042..67116 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00290 tRNA 67265..67339 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00300 CDS 67387..67560 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14040 CDS 67571..69493 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14050 tRNA 69559..69634 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00310 CDS complement(70040..70294) product succinate dehydrogenase assembly factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014507842.1 transl_table 11 codon_start 1 locus_tag LOCUS_14060 CDS 70647..71534 product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119634.1 transl_table 11 codon_start 1 locus_tag LOCUS_14070 gene prmA CDS 71538..72482 product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095402.1 transl_table 11 codon_start 1 locus_tag LOCUS_14080 gene dusB CDS 72613..72885 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14090 CDS 72994..73560 product elongation factor P-like protein YeiP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037000.1 transl_table 11 codon_start 1 locus_tag LOCUS_14100 gene yeiP CDS 73755..74339 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071912.1 transl_table 11 codon_start 1 locus_tag LOCUS_14110 CDS 74394..74870 product copper resistance protein NlpE N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000748182.1 transl_table 11 codon_start 1 locus_tag LOCUS_14120 CDS 75133..75636 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087890.1 transl_table 11 codon_start 1 locus_tag LOCUS_14130 CDS 75795..76667 product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262169.1 transl_table 11 codon_start 1 locus_tag LOCUS_14140 gene lpxH CDS 76775..77203 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14150 CDS 77215..77481 product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918714.1 transl_table 11 codon_start 1 locus_tag LOCUS_14160 gene grxC CDS 77585..78067 product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096050.1 transl_table 11 codon_start 1 locus_tag LOCUS_14170 gene secB CDS complement(78362..79183) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14180 CDS 79518..80756 product multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000093810.1 transl_table 11 codon_start 1 locus_tag LOCUS_14190 gene nadR CDS 80791..81561 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14200 CDS 81739..82017 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14210 CDS complement(82153..82932) product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963286.1 transl_table 11 codon_start 1 locus_tag LOCUS_14220 CDS 83290..84519 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14230 CDS 84844..87459 product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947476.1 transl_table 11 codon_start 1 locus_tag LOCUS_14240 gene clpB CDS 87711..88175 product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582738.1 transl_table 11 codon_start 1 locus_tag LOCUS_14250 CDS 88544..89989 product alanine/glycine:cation symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231542.1 transl_table 11 codon_start 1 locus_tag LOCUS_14260 CDS complement(90317..91171) product S1-like domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268646.1 transl_table 11 codon_start 1 locus_tag LOCUS_14270 CDS 91584..93053 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14280 CDS 93041..94000 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14290 CDS 94006..97362 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039227.1 transl_table 11 codon_start 1 locus_tag LOCUS_14300 CDS 97468..98739 product DUF2220 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209174.1 transl_table 11 codon_start 1 locus_tag LOCUS_14310 CDS complement(98910..99569) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704514.1 transl_table 11 codon_start 1 locus_tag LOCUS_14320 CDS complement(99720..104420) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14330 CDS complement(104780..106087) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190760.1 transl_table 11 codon_start 1 locus_tag LOCUS_14340 CDS 106479..107261 product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003693564.1 transl_table 11 codon_start 1 locus_tag LOCUS_14350 CDS 107493..110735 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14360 CDS 111099..112727 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209564.1 transl_table 11 codon_start 1 locus_tag LOCUS_14370 CDS 112911..113927 product dipeptide ABC transporter permease DppB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014830232.1 transl_table 11 codon_start 1 locus_tag LOCUS_14380 gene dppB CDS 113937..114899 product dipeptide ABC transporter permease DppC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209563.1 transl_table 11 codon_start 1 locus_tag LOCUS_14390 gene dppC CDS 114910..115932 product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196486.1 transl_table 11 codon_start 1 locus_tag LOCUS_14400 gene dppD CDS 115925..117052 product peptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026018078.1 transl_table 11 codon_start 1 locus_tag LOCUS_14410 CDS complement(117776..118507) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082761.1 transl_table 11 codon_start 1 locus_tag LOCUS_14420 CDS complement(118504..119196) product glutamate/aspartate ABC transporter permease GltK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167916.1 transl_table 11 codon_start 1 locus_tag LOCUS_14430 gene gltK CDS complement(119198..119926) product glutamate/aspartate ABC transporter permease GltJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020930.1 transl_table 11 codon_start 1 locus_tag LOCUS_14440 gene gltJ CDS complement(120237..121130) product glutamate/aspartate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531996.1 transl_table 11 codon_start 1 locus_tag LOCUS_14450 CDS 121487..122434 product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420966.1 transl_table 11 codon_start 1 locus_tag LOCUS_14460 gene rbsK CDS 122689..122880 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14470 CDS 123156..125465 product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211526.1 transl_table 11 codon_start 1 locus_tag LOCUS_14480 gene metE CDS complement(125660..126553) product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000873880.1 transl_table 11 codon_start 1 locus_tag LOCUS_14490 gene nfo CDS complement(126866..128659) product cation/acetate symporter ActP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000832573.1 transl_table 11 codon_start 1 locus_tag LOCUS_14500 gene actP CDS complement(128643..129002) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14510 CDS complement(129534..130910) product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009938468.1 transl_table 11 codon_start 1 locus_tag LOCUS_14520 gene hemN CDS 131245..132675 product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000099574.1 transl_table 11 codon_start 1 locus_tag LOCUS_14530 gene pyk tRNA 132763..132852 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00320 CDS 133743..134672 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14540 CDS 134769..137117 product dynamin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012774974.1 transl_table 11 codon_start 1 locus_tag LOCUS_14550 CDS 137126..138064 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14560 CDS 138079..141258 product DUF87 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263812.1 transl_table 11 codon_start 1 locus_tag LOCUS_14570 CDS 141252..141836 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14580 CDS 141823..142248 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14590 CDS complement(142399..142668) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14600 CDS complement(142680..142988) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14610 note possible pseudo, internal stop codon CDS 143554..145329 product anti-phage ZorAB system protein ZorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132365.1 transl_table 11 codon_start 1 locus_tag LOCUS_14620 gene zorA CDS 145345..146103 product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001252511.1 transl_table 11 codon_start 1 locus_tag LOCUS_14630 CDS 146105..147943 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14640 CDS 147947..151075 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14650 CDS 151451..154741 product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000401853.1 transl_table 11 codon_start 1 locus_tag LOCUS_14660 repeat_region 155258..155982 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcttaatcccttttcaaacagggcatgatcccgac CDS complement(156431..156691) product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002367773.1 transl_table 11 codon_start 1 locus_tag LOCUS_14670 CDS complement(156692..156913) product DUF6290 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775256.1 transl_table 11 codon_start 1 locus_tag LOCUS_14680 assembly_gap 157133..157145 estimated_length known gap_type within scaffold linkage_evidence paired-ends repeat_region 157226..157522 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcttaatcccttttcaaacagggc CDS 157845..158525 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14690 CDS 158646..160556 product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555499.1 transl_table 11 codon_start 1 locus_tag LOCUS_14700 CDS 160566..163631 product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922218.1 transl_table 11 codon_start 1 locus_tag LOCUS_14710 repeat_region 164142..165345 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcttaatcccttttcaaacagggcatgatcccgac CDS 166257..169058 product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112791.1 transl_table 11 codon_start 1 locus_tag LOCUS_14720 CDS 169042..169584 product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094903.1 transl_table 11 codon_start 1 locus_tag LOCUS_14730 CDS 169588..170907 product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112792.1 transl_table 11 codon_start 1 locus_tag LOCUS_14740 CDS 171104..171391 product DUF1294 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000871355.1 transl_table 11 codon_start 1 locus_tag LOCUS_14750 CDS 171779..174082 product TonB-dependent hemoglobin receptor HmbR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222141.1 transl_table 11 codon_start 1 locus_tag LOCUS_14760 gene hmbR CDS 174335..174985 product MarC family NAAT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000968968.1 transl_table 11 codon_start 1 locus_tag LOCUS_14770 CDS 175079..176029 product DUF5655 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205998.1 transl_table 11 codon_start 1 locus_tag LOCUS_14780 CDS complement(176131..176523) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14790 CDS complement(176624..177130) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14800 CDS complement(177314..177880) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14810 CDS complement(177889..178479) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14820 CDS complement(178498..178848) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14830 CDS complement(178845..179864) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14840 CDS 180603..182126 product phosphoethanolamine transferase EptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096920.1 transl_table 11 codon_start 1 locus_tag LOCUS_14850 gene eptA CDS 182472..183146 product two-component system response regulator PmrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210183.1 transl_table 11 codon_start 1 locus_tag LOCUS_14860 gene pmrA CDS 183143..184177 product two-component system sensor histidine kinase PmrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815443.1 transl_table 11 codon_start 1 locus_tag LOCUS_14870 gene pmrB CDS 184345..185613 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086508.1 transl_table 11 codon_start 1 locus_tag LOCUS_14880 CDS complement(185843..186778) product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356610.1 transl_table 11 codon_start 1 locus_tag LOCUS_14890 gene cysK CDS 187003..187443 product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003391911.1 transl_table 11 codon_start 1 locus_tag LOCUS_14900 CDS complement(187563..188726) product glutathionylspermidine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005160795.1 transl_table 11 codon_start 1 locus_tag LOCUS_14910 CDS complement(188730..189422) product DUF1190 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357252.1 transl_table 11 codon_start 1 locus_tag LOCUS_14920 CDS 189748..190371 product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184853.1 transl_table 11 codon_start 1 locus_tag LOCUS_14930 CDS complement(190502..191413) product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225833.1 transl_table 11 codon_start 1 locus_tag LOCUS_14940 CDS complement(191546..192613) product isopenicillin N synthase family oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050077838.1 transl_table 11 codon_start 1 locus_tag LOCUS_14950 CDS complement(193015..193893) product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706499.1 transl_table 11 codon_start 1 locus_tag LOCUS_14960 CDS 194236..195399 product L-lactate dehydrogenase LldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104946.1 transl_table 11 codon_start 1 locus_tag LOCUS_14970 gene lldA CDS complement(195491..196372) product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005306036.1 transl_table 11 codon_start 1 locus_tag LOCUS_14980 gene metF CDS 196996..197493 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262030.1 transl_table 11 codon_start 1 locus_tag LOCUS_14990 CDS 198007..201675 product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113602.1 transl_table 11 codon_start 1 locus_tag LOCUS_15000 gene metH CDS 202356..203846 product glycine betaine/L-proline transporter ProP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817168.1 transl_table 11 codon_start 1 locus_tag LOCUS_15010 gene proP CDS complement(204285..204884) product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262735.1 transl_table 11 codon_start 1 locus_tag LOCUS_15020 CDS 205442..205873 product CopY/TcrY family copper transport repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379040.1 transl_table 11 codon_start 1 locus_tag LOCUS_15030 CDS 205889..208348 product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289041.1 transl_table 11 codon_start 1 locus_tag LOCUS_15040 CDS complement(208465..209823) product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003692969.1 transl_table 11 codon_start 1 locus_tag LOCUS_15050 CDS complement(210206..211750) product acetyl-CoA hydrolase/transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000429812.1 transl_table 11 codon_start 1 locus_tag LOCUS_15060 CDS 212229..214430 product bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113961.1 transl_table 11 codon_start 1 locus_tag LOCUS_15070 gene rlmKL CDS 214532..214864 product H-NS histone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331338.1 transl_table 11 codon_start 1 locus_tag LOCUS_15080 CDS complement(214988..215806) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15090 CDS complement(215843..216448) product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112755.1 transl_table 11 codon_start 1 locus_tag LOCUS_15100 CDS complement(216515..217387) product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704199.1 transl_table 11 codon_start 1 locus_tag LOCUS_15110 gene ubiA CDS 217746..218732 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15120 CDS 218987..219577 product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475516.1 transl_table 11 codon_start 1 locus_tag LOCUS_15130 CDS complement(219897..221408) product carbon starvation CstA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000627647.1 transl_table 11 codon_start 1 locus_tag LOCUS_15140 CDS 222024..222500 product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100496.1 transl_table 11 codon_start 1 locus_tag LOCUS_15150 gene smpB CDS 222657..223607 product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225762.1 transl_table 11 codon_start 1 locus_tag LOCUS_15160 CDS 223700..224080 product SirB2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073594.1 transl_table 11 codon_start 1 locus_tag LOCUS_15170 tRNA 224354..224430 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00330 CDS complement(224918..225124) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15180 CDS complement(225238..226212) product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317890.1 transl_table 11 codon_start 1 locus_tag LOCUS_15190 gene moaA CDS complement(226249..227121) product LysR family transcriptional regulator OxyR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224776.1 transl_table 11 codon_start 1 locus_tag LOCUS_15200 gene oxyR CDS 227365..230220 product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526855.1 transl_table 11 codon_start 1 locus_tag LOCUS_15210 CDS 230492..231694 product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705800.1 transl_table 11 codon_start 1 locus_tag LOCUS_15220 gene odhB CDS 231887..233317 product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382001.1 transl_table 11 codon_start 1 locus_tag LOCUS_15230 gene lpdA CDS 233998..235107 product adenine-specific methyltransferase EcoRI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196835716.1 transl_table 11 codon_start 1 locus_tag LOCUS_15240 CDS 235108..235983 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890094.1 transl_table 11 codon_start 1 locus_tag LOCUS_15250 tRNA 236182..236256 product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00340 CDS 236351..236686 product MocE family 2Fe-2S type ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975101.1 transl_table 11 codon_start 1 locus_tag LOCUS_15260 CDS complement(236899..237984) product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225132.1 transl_table 11 codon_start 1 locus_tag LOCUS_15270 CDS complement(238311..238646) product zinc ribbon domain-containing protein YjdM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357741.1 transl_table 11 codon_start 1 locus_tag LOCUS_15280 CDS 238970..239698 product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208892.1 transl_table 11 codon_start 1 locus_tag LOCUS_15290 CDS complement(240025..241278) product sodium/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176022.1 transl_table 11 codon_start 1 locus_tag LOCUS_15300 gene gltS CDS 241810..242385 product outer membrane lipoprotein chaperone LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022568.1 transl_table 11 codon_start 1 locus_tag LOCUS_15310 gene lolA CDS 242388..243713 product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185515.1 transl_table 11 codon_start 1 locus_tag LOCUS_15320 CDS complement(243885..245309) product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098191.1 transl_table 11 codon_start 1 locus_tag LOCUS_15330 gene gltX CDS complement(245516..246328) product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704121.1 transl_table 11 codon_start 1 locus_tag LOCUS_15340 gene tatC CDS complement(246460..247290) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15350 CDS 247420..248769 product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460035.1 transl_table 11 codon_start 1 locus_tag LOCUS_15360 gene ffh CDS 248866..249912 product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267147.1 transl_table 11 codon_start 1 locus_tag LOCUS_15370 gene sppA CDS complement(250082..251002) product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852073.1 transl_table 11 codon_start 1 locus_tag LOCUS_15380 CDS complement(251051..251272) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15390 CDS 252160..253008 product ethanolamine utilization acetate kinase EutQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000733877.1 transl_table 11 codon_start 1 locus_tag LOCUS_15400 gene eutQ CDS 253052..253924 product ethanolamine utilization cob(I)yrinic acid a,c-diamide adenosyltransferase EutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651284.1 transl_table 11 codon_start 1 locus_tag LOCUS_15410 gene eutT CDS 253938..254936 product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000582977.1 transl_table 11 codon_start 1 locus_tag LOCUS_15420 gene pta CDS 255071..255367 product ethanolamine utilization microcompartment protein EutM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000387713.1 transl_table 11 codon_start 1 locus_tag LOCUS_15430 gene eutM CDS 255471..255767 product ethanolamine utilization microcompartment protein EutN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001522340.1 transl_table 11 codon_start 1 locus_tag LOCUS_15440 gene eutN CDS 255790..257241 product aldehyde dehydrogenase EutE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001075711.1 transl_table 11 codon_start 1 locus_tag LOCUS_15450 CDS 257281..258486 product ethanolamine utilization ethanol dehydrogenase EutG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001147519.1 transl_table 11 codon_start 1 locus_tag LOCUS_15460 gene eutG CDS 258645..259934 product ethanolamine utilization protein EutH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000512370.1 transl_table 11 codon_start 1 locus_tag LOCUS_15470 gene eutH CDS 259964..261391 product ethanolamine ammonia-lyase reactivating factor EutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001097523.1 transl_table 11 codon_start 1 locus_tag LOCUS_15480 gene eutA CDS 261408..262769 product ethanolamine ammonia-lyase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000769994.1 transl_table 11 codon_start 1 locus_tag LOCUS_15490 gene eutB CDS 262784..263710 product ethanolamine ammonia-lyase subunit EutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000372351.1 transl_table 11 codon_start 1 locus_tag LOCUS_15500 gene eutC CDS 263723..264382 product ethanolamine utilization microcompartment protein EutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001111027.1 transl_table 11 codon_start 1 locus_tag LOCUS_15510 gene eutL CDS 264515..265936 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15520 CDS 266040..267380 product SLBB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174847383.1 transl_table 11 codon_start 1 locus_tag LOCUS_15530 CDS 267384..267932 product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816702.1 transl_table 11 codon_start 1 locus_tag LOCUS_15540 CDS complement(268291..268758) product ethanolamine utilization acetate kinase EutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000820751.1 transl_table 11 codon_start 1 locus_tag LOCUS_15550 gene eutP CDS complement(268844..269191) product ethanolamine utilization microcompartment protein EutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000356956.1 transl_table 11 codon_start 1 locus_tag LOCUS_15560 gene eutS CDS complement(269227..270054) product ethanolamine utilization protein EutJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000929729.1 transl_table 11 codon_start 1 locus_tag LOCUS_15570 gene eutJ CDS complement(270075..270440) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15580 CDS 271042..272112 product HTH-type transcriptional regulator EutR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000753709.1 transl_table 11 codon_start 1 locus_tag LOCUS_15590 gene eutR CDS complement(272201..272992) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15600 CDS complement(273261..273845) product peroxidase-related enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267763.1 transl_table 11 codon_start 1 locus_tag LOCUS_15610 CDS complement(273842..274414) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762396.1 transl_table 11 codon_start 1 locus_tag LOCUS_15620 CDS complement(274411..275718) product acyl-CoA thioester hydrolase/BAAT C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538269.1 transl_table 11 codon_start 1 locus_tag LOCUS_15630 CDS complement(275847..277415) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267761.1 transl_table 11 codon_start 1 locus_tag LOCUS_15640 CDS complement(277536..278537) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267760.1 transl_table 11 codon_start 1 locus_tag LOCUS_15650 CDS complement(278534..279598) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267759.1 transl_table 11 codon_start 1 locus_tag LOCUS_15660 CDS complement(279598..280512) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267758.1 transl_table 11 codon_start 1 locus_tag LOCUS_15670 CDS complement(280509..281483) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267757.1 transl_table 11 codon_start 1 locus_tag LOCUS_15680 CDS 282038..283234 product MFS transporter TsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072662.1 transl_table 11 codon_start 1 locus_tag LOCUS_15690 gene tsgA CDS 283257..284222 product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706748.1 transl_table 11 codon_start 1 locus_tag LOCUS_15700 tmRNA complement(284422..284774) product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_tm00010 CDS complement(284793..285449) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15710 CDS complement(285479..286054) product DUF3108 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222212.1 transl_table 11 codon_start 1 locus_tag LOCUS_15720 CDS 286311..287312 product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689682.1 transl_table 11 codon_start 1 locus_tag LOCUS_15730 CDS complement(287470..288159) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15740 sequence05 source 1..270777 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..2260 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011035898.1:ESPR-type extended signal peptide-containing protein locus_tag LOCUS_15750 CDS complement(2391..3275) product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338398.1 transl_table 11 codon_start 1 locus_tag LOCUS_15760 gene folD CDS complement(3512..4372) product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094361.1 transl_table 11 codon_start 1 locus_tag LOCUS_15770 gene rapZ CDS complement(4501..4863) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15780 CDS complement(5005..8856) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15790 CDS 9364..10575 product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098395.1 transl_table 11 codon_start 1 locus_tag LOCUS_15800 CDS 10687..11298 product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794496.1 transl_table 11 codon_start 1 locus_tag LOCUS_15810 CDS complement(11498..12268) product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001230983.1 transl_table 11 codon_start 1 locus_tag LOCUS_15820 CDS complement(12830..13489) product YiiX/YebB-like N1pC/P60 family cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858707.1 transl_table 11 codon_start 1 locus_tag LOCUS_15830 CDS complement(13657..14082) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15840 CDS complement(14648..15652) product formamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000534771.1 transl_table 11 codon_start 1 locus_tag LOCUS_15850 CDS 16251..17111 product formate transporter FocA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211331.1 transl_table 11 codon_start 1 locus_tag LOCUS_15860 gene focA CDS 17158..19440 product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367478.1 transl_table 11 codon_start 1 locus_tag LOCUS_15870 gene pflB CDS 19568..19768 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15880 CDS 20114..21478 product HAAAP family serine/threonine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369950.1 transl_table 11 codon_start 1 locus_tag LOCUS_15890 CDS 21812..23182 product L-serine ammonia-lyase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626422.1 transl_table 11 codon_start 1 locus_tag LOCUS_15900 gene sdaB CDS complement(23373..24692) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113829.1 transl_table 11 codon_start 1 locus_tag LOCUS_15910 CDS 25215..25637 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15920 CDS complement(25798..26301) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15930 CDS complement(26416..27255) product penicillin-insensitive murein endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483061.1 transl_table 11 codon_start 1 locus_tag LOCUS_15940 gene mepA tRNA complement(27549..27625) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00350 tRNA complement(27705..27781) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00360 CDS 28007..28702 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15950 CDS complement(28823..29857) product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166238.1 transl_table 11 codon_start 1 locus_tag LOCUS_15960 gene corA CDS 30154..30372 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15970 CDS 30712..31260 product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095213.1 transl_table 11 codon_start 1 locus_tag LOCUS_15980 gene grpE CDS 31375..32208 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15990 CDS 32229..32450 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16000 CDS 32356..32775 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087171.1 transl_table 11 codon_start 1 locus_tag LOCUS_16010 CDS 32869..33345 product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369513.1 transl_table 11 codon_start 1 locus_tag LOCUS_16020 gene greA CDS 33389..34480 product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064634.1 transl_table 11 codon_start 1 locus_tag LOCUS_16030 CDS 34949..36124 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16040 CDS 36124..39267 product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814731.1 transl_table 11 codon_start 1 locus_tag LOCUS_16050 CDS 39666..40304 product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688623.1 transl_table 11 codon_start 1 locus_tag LOCUS_16060 gene lipB CDS 40539..41264 product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460301.1 transl_table 11 codon_start 1 locus_tag LOCUS_16070 CDS 41257..41604 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16080 CDS 41789..42187 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16090 CDS 42184..43074 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16100 CDS 43330..44292 product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393607.1 transl_table 11 codon_start 1 locus_tag LOCUS_16110 gene arcC CDS complement(44486..45478) product lipopolysaccharide heptosyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218264.1 transl_table 11 codon_start 1 locus_tag LOCUS_16120 gene waaC CDS complement(45624..46571) product HTH-type transcriptional activator AllS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460148.1 transl_table 11 codon_start 1 locus_tag LOCUS_16130 gene allS CDS complement(47165..48427) product DUF1116 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000495383.1 transl_table 11 codon_start 1 locus_tag LOCUS_16140 CDS complement(48440..50053) product acyl-CoA synthetase FdrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000580880.1 transl_table 11 codon_start 1 locus_tag LOCUS_16150 CDS 50439..51698 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355251.1 transl_table 11 codon_start 1 locus_tag LOCUS_16160 CDS 52139..53188 product ureidoglycolate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000703940.1 transl_table 11 codon_start 1 locus_tag LOCUS_16170 gene allD CDS 53604..54644 product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965686.1 transl_table 11 codon_start 1 locus_tag LOCUS_16180 gene argC CDS 54774..55994 product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965687.1 transl_table 11 codon_start 1 locus_tag LOCUS_16190 gene argJ CDS 56440..57321 product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393771.1 transl_table 11 codon_start 1 locus_tag LOCUS_16200 gene argB CDS 57633..58796 product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082331.1 transl_table 11 codon_start 1 locus_tag LOCUS_16210 CDS complement(59077..59835) product DNA-binding transcriptional repressor YgbI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212058.1 transl_table 11 codon_start 1 locus_tag LOCUS_16220 gene ygbI CDS 60034..61389 product GntP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000104441.1 transl_table 11 codon_start 1 locus_tag LOCUS_16230 CDS 61581..62480 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005665973.1 transl_table 11 codon_start 1 locus_tag LOCUS_16240 CDS 62542..63807 product 3-oxo-tetronate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000590392.1 transl_table 11 codon_start 1 locus_tag LOCUS_16250 CDS 63804..64496 product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168943.1 transl_table 11 codon_start 1 locus_tag LOCUS_16260 CDS 64501..65286 product hydroxypyruvate isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168948.1 transl_table 11 codon_start 1 locus_tag LOCUS_16270 CDS 65958..67391 product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211024.1 transl_table 11 codon_start 1 locus_tag LOCUS_16280 gene phoA CDS complement(67684..69039) product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002223021.1 transl_table 11 codon_start 1 locus_tag LOCUS_16290 gene accC CDS complement(69053..69523) product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110495.1 transl_table 11 codon_start 1 locus_tag LOCUS_16300 gene accB CDS complement(69587..70048) product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478606.1 transl_table 11 codon_start 1 locus_tag LOCUS_16310 gene aroQ CDS 70257..71159 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16320 CDS complement(71323..72297) product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245995.1 transl_table 11 codon_start 1 locus_tag LOCUS_16330 CDS complement(72369..72974) product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524160.1 transl_table 11 codon_start 1 locus_tag LOCUS_16340 CDS complement(73183..74430) product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112792.1 transl_table 11 codon_start 1 locus_tag LOCUS_16350 CDS complement(74436..74993) product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094903.1 transl_table 11 codon_start 1 locus_tag LOCUS_16360 CDS complement(74990..77791) product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112791.1 transl_table 11 codon_start 1 locus_tag LOCUS_16370 CDS 78119..79267 product low conductance mechanosensitive channel YnaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000559903.1 transl_table 11 codon_start 1 locus_tag LOCUS_16380 gene ynaI CDS complement(79369..80073) product histidine utilization repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000075034.1 transl_table 11 codon_start 1 locus_tag LOCUS_16390 gene hutC CDS 80689..82356 product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704355.1 transl_table 11 codon_start 1 locus_tag LOCUS_16400 CDS 82696..83946 product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163359289.1 transl_table 11 codon_start 1 locus_tag LOCUS_16410 gene hutI CDS 84131..85090 product formimidoylglutamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704790.1 transl_table 11 codon_start 1 locus_tag LOCUS_16420 gene hutG CDS 85469..87007 product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016650.1 transl_table 11 codon_start 1 locus_tag LOCUS_16430 gene hutH CDS 87517..88926 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817406.1 transl_table 11 codon_start 1 locus_tag LOCUS_16440 CDS complement(89359..89886) product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012220673.1 transl_table 11 codon_start 1 locus_tag LOCUS_16450 CDS 90301..90819 product thioesterase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269323.1 transl_table 11 codon_start 1 locus_tag LOCUS_16460 CDS 91005..92885 product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001218596.1 transl_table 11 codon_start 1 locus_tag LOCUS_16470 CDS 93048..93380 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16480 CDS complement(93429..93656) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16490 CDS 93849..94844 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001201234.1 transl_table 11 codon_start 1 locus_tag LOCUS_16500 CDS 94900..95745 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389858.1 transl_table 11 codon_start 1 locus_tag LOCUS_16510 CDS 95739..96494 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000620368.1 transl_table 11 codon_start 1 locus_tag LOCUS_16520 CDS 96636..97283 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16530 CDS 97361..98338 product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925707.1 transl_table 11 codon_start 1 locus_tag LOCUS_16540 gene ttcA CDS 98720..101002 product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367478.1 transl_table 11 codon_start 1 locus_tag LOCUS_16550 gene pflB CDS 101241..101981 product pyruvate formate lyase 1-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171041.1 transl_table 11 codon_start 1 locus_tag LOCUS_16560 gene pflA CDS complement(102280..103554) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16570 CDS 103598..103828 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16580 CDS complement(103722..104855) product toxic anion resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723133.1 transl_table 11 codon_start 1 locus_tag LOCUS_16590 CDS 105384..106697 product sn-glycerol-3-phosphate ABC transporter substrate-binding protein UgpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039943.1 transl_table 11 codon_start 1 locus_tag LOCUS_16600 gene ugpB CDS 106847..107728 product sn-glycerol-3-phosphate ABC transporter permease UgpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521921.1 transl_table 11 codon_start 1 locus_tag LOCUS_16610 gene ugpA CDS 107725..108570 product sn-glycerol-3-phosphate ABC transporter permease UgpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811259.1 transl_table 11 codon_start 1 locus_tag LOCUS_16620 gene ugpE CDS 108716..109837 product sn-glycerol-3-phosphate import ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930289.1 transl_table 11 codon_start 1 locus_tag LOCUS_16630 CDS 110352..111227 product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004568486.1 transl_table 11 codon_start 1 locus_tag LOCUS_16640 gene ugpQ CDS 111315..111494 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16650 CDS complement(111519..111740) product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720124.1 transl_table 11 codon_start 1 locus_tag LOCUS_16660 CDS 112130..112996 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16670 CDS complement(113009..113929) product lysine exporter LysO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705573.1 transl_table 11 codon_start 1 locus_tag LOCUS_16680 CDS 114186..114938 product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020411.1 transl_table 11 codon_start 1 locus_tag LOCUS_16690 CDS 114960..115442 product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947018.1 transl_table 11 codon_start 1 locus_tag LOCUS_16700 gene ruvC CDS 115439..116044 product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418603.1 transl_table 11 codon_start 1 locus_tag LOCUS_16710 gene ruvA CDS complement(116150..116575) product 8-oxo-dGTP diphosphatase MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461225.1 transl_table 11 codon_start 1 locus_tag LOCUS_16720 gene mutT CDS complement(116608..117804) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16730 CDS complement(117944..118231) product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640742.1 transl_table 11 codon_start 1 locus_tag LOCUS_16740 CDS complement(118385..118930) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16750 CDS complement(118920..120854) product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020096.1 transl_table 11 codon_start 1 locus_tag LOCUS_16760 CDS complement(121432..122064) product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860560.1 transl_table 11 codon_start 1 locus_tag LOCUS_16770 gene upp CDS complement(122347..122679) product monothiol glutaredoxin 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000108172.1 transl_table 11 codon_start 1 locus_tag LOCUS_16780 gene grxD CDS complement(122861..124132) product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114089.1 transl_table 11 codon_start 1 locus_tag LOCUS_16790 CDS complement(124199..125167) product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688622.1 transl_table 11 codon_start 1 locus_tag LOCUS_16800 gene lipA CDS 125398..125604 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16810 CDS 126798..127316 product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183173.1 transl_table 11 codon_start 1 locus_tag LOCUS_16820 CDS complement(127691..128404) product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103372.1 transl_table 11 codon_start 1 locus_tag LOCUS_16830 gene sfsA CDS complement(128475..131954) product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946697.1 transl_table 11 codon_start 1 locus_tag LOCUS_16840 gene dnaE CDS 132491..133810 product capsule biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002223278.1 transl_table 11 codon_start 1 locus_tag LOCUS_16850 CDS 134022..135011 product capsule polysaccharide export inner-membrane protein KpsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000905920.1 transl_table 11 codon_start 1 locus_tag LOCUS_16860 CDS 135322..136401 product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816414.1 transl_table 11 codon_start 1 locus_tag LOCUS_16870 CDS 136464..137258 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124279.1 transl_table 11 codon_start 1 locus_tag LOCUS_16880 CDS 137255..137914 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851179.1 transl_table 11 codon_start 1 locus_tag LOCUS_16890 CDS 137944..139062 product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_067557116.1 transl_table 11 codon_start 1 locus_tag LOCUS_16900 gene wecB CDS 139105..140361 product UDP-N-acetyl-D-mannosamine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099275.1 transl_table 11 codon_start 1 locus_tag LOCUS_16910 gene wecC CDS 140368..142572 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16920 CDS 142573..144105 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16930 CDS 144133..146598 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16940 CDS 146603..147106 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16950 note possible pseudo, internal stop codon CDS 147212..147574 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16960 CDS 147578..147820 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16970 CDS 147900..148220 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16980 CDS 148413..149378 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16990 CDS 149531..150406 product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208056.1 transl_table 11 codon_start 1 locus_tag LOCUS_17000 gene galU CDS 150494..151768 product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208057.1 transl_table 11 codon_start 1 locus_tag LOCUS_17010 CDS 151765..153480 product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208058.1 transl_table 11 codon_start 1 locus_tag LOCUS_17020 gene pgi CDS 153477..154103 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17030 note possible pseudo, frameshifted CDS 154051..154458 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17040 note possible pseudo, frameshifted CDS 154559..156625 product capsular polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224756.1 transl_table 11 codon_start 1 locus_tag LOCUS_17050 CDS 156686..157423 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000497656.1 transl_table 11 codon_start 1 locus_tag LOCUS_17060 CDS 157420..158979 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000600936.1 transl_table 11 codon_start 1 locus_tag LOCUS_17070 CDS 159085..159552 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17080 CDS 159616..160407 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17090 CDS complement(160781..162151) product phosphomannomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208062.1 transl_table 11 codon_start 1 locus_tag LOCUS_17100 CDS 162869..164209 product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113742.1 transl_table 11 codon_start 1 locus_tag LOCUS_17110 CDS 164223..165188 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17120 CDS complement(165572..168403) product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707637.1 transl_table 11 codon_start 1 locus_tag LOCUS_17130 gene uvrA CDS complement(168699..170228) product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114478.1 transl_table 11 codon_start 1 locus_tag LOCUS_17140 gene gpmI CDS 170967..171224 product Sec-independent protein translocase subunit TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260926.1 transl_table 11 codon_start 1 locus_tag LOCUS_17150 gene tatA CDS 171466..172320 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17160 CDS 172579..173358 product carboxy-S-adenosyl-L-methionine synthase CmoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123029.1 transl_table 11 codon_start 1 locus_tag LOCUS_17170 gene cmoA CDS 173434..174435 product tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114185.1 transl_table 11 codon_start 1 locus_tag LOCUS_17180 gene cmoB CDS complement(174675..176456) product Na+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368729.1 transl_table 11 codon_start 1 locus_tag LOCUS_17190 CDS complement(176873..177133) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17200 CDS 177442..177888 product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986743.1 transl_table 11 codon_start 1 locus_tag LOCUS_17210 gene msrB CDS 178150..178458 product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298602.1 transl_table 11 codon_start 1 locus_tag LOCUS_17220 CDS 178468..178887 product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038731.1 transl_table 11 codon_start 1 locus_tag LOCUS_17230 CDS 178889..179299 product YeeE/YedE thiosulfate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817041.1 transl_table 11 codon_start 1 locus_tag LOCUS_17240 CDS complement(179695..180240) product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093248.1 transl_table 11 codon_start 1 locus_tag LOCUS_17250 gene ppa CDS 180414..182000 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17260 CDS 182018..182785 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17270 CDS 182980..183351 product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123113.1 transl_table 11 codon_start 1 locus_tag LOCUS_17280 gene arsC CDS 183662..184078 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17290 CDS 184092..185462 product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036678.1 transl_table 11 codon_start 1 locus_tag LOCUS_17300 gene purB CDS 185682..186308 product LysE/ArgO family amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937896.1 transl_table 11 codon_start 1 locus_tag LOCUS_17310 CDS complement(186563..186904) product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000539674.1 transl_table 11 codon_start 1 locus_tag LOCUS_17320 CDS complement(186906..187298) product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000790630.1 transl_table 11 codon_start 1 locus_tag LOCUS_17330 CDS complement(188014..188217) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17340 CDS complement(188255..189133) product threonine/homoserine exporter RhtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213809.1 transl_table 11 codon_start 1 locus_tag LOCUS_17350 gene rhtA CDS complement(189383..190174) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939625.1 transl_table 11 codon_start 1 locus_tag LOCUS_17360 CDS 190626..191129 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17370 CDS 191567..197686 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17380 CDS 198005..198547 product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016060.1 transl_table 11 codon_start 1 locus_tag LOCUS_17390 CDS 198956..201199 product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815972.1 transl_table 11 codon_start 1 locus_tag LOCUS_17400 gene nrdA CDS 201372..202469 product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011011111.1 transl_table 11 codon_start 1 locus_tag LOCUS_17410 gene nrdB CDS 202811..203104 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17420 CDS 203258..204286 product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210762.1 transl_table 11 codon_start 1 locus_tag LOCUS_17430 gene bioB CDS complement(204401..205096) product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263885.1 transl_table 11 codon_start 1 locus_tag LOCUS_17440 CDS complement(205111..205647) product ClpXP protease specificity-enhancing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458208.1 transl_table 11 codon_start 1 locus_tag LOCUS_17450 gene sspB CDS complement(205823..206431) product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037464.1 transl_table 11 codon_start 1 locus_tag LOCUS_17460 CDS complement(206526..207314) product cytochrome c1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000758871.1 transl_table 11 codon_start 1 locus_tag LOCUS_17470 CDS complement(207350..208633) product cytochrome bc complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215003.1 transl_table 11 codon_start 1 locus_tag LOCUS_17480 CDS complement(208633..209232) product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215005.1 transl_table 11 codon_start 1 locus_tag LOCUS_17490 gene petA CDS complement(209266..209787) product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262737.1 transl_table 11 codon_start 1 locus_tag LOCUS_17500 gene efp CDS complement(209910..211013) product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227769.1 transl_table 11 codon_start 1 locus_tag LOCUS_17510 CDS complement(211333..212427) product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227769.1 transl_table 11 codon_start 1 locus_tag LOCUS_17520 CDS complement(212740..214146) product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173616429.1 transl_table 11 codon_start 1 locus_tag LOCUS_17530 CDS complement(214140..214616) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17540 CDS complement(215090..216142) product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003341445.1 transl_table 11 codon_start 1 locus_tag LOCUS_17550 CDS 216391..216834 product ferric iron uptake transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958136.1 transl_table 11 codon_start 1 locus_tag LOCUS_17560 gene fur CDS 216819..218453 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17570 CDS 218828..220741 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17580 CDS 220892..221902 product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267145.1 transl_table 11 codon_start 1 locus_tag LOCUS_17590 gene murB CDS 222115..222726 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946580.1 transl_table 11 codon_start 1 locus_tag LOCUS_17600 CDS 222948..223235 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17610 tRNA 223395..223470 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00370 tRNA 223479..223552 product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00380 CDS 223712..225895 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17620 CDS 225980..226309 product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809572.1 transl_table 11 codon_start 1 locus_tag LOCUS_17630 CDS 226322..226915 product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087237.1 transl_table 11 codon_start 1 locus_tag LOCUS_17640 gene recR CDS 226925..227266 product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546430.1 transl_table 11 codon_start 1 locus_tag LOCUS_17650 CDS 227573..228607 product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869721.1 transl_table 11 codon_start 1 locus_tag LOCUS_17660 CDS complement(228870..229892) product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404319.1 transl_table 11 codon_start 1 locus_tag LOCUS_17670 CDS complement(230056..230583) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387373.1 transl_table 11 codon_start 1 locus_tag LOCUS_17680 CDS 231042..232406 product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399952.1 transl_table 11 codon_start 1 locus_tag LOCUS_17690 CDS 232406..233410 product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477299.1 transl_table 11 codon_start 1 locus_tag LOCUS_17700 gene cydB CDS 233582..233740 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17710 tRNA 233888..233964 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00390 CDS 234127..234771 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17720 CDS 234774..236018 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17730 CDS 236174..237601 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17740 CDS 237774..238328 product shikimate kinase AroK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245596.1 transl_table 11 codon_start 1 locus_tag LOCUS_17750 gene aroK CDS 238325..239401 product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545319.1 transl_table 11 codon_start 1 locus_tag LOCUS_17760 gene aroB CDS 239402..240391 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17770 CDS 240652..242631 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113976.1 transl_table 11 codon_start 1 locus_tag LOCUS_17780 CDS 242688..243059 product outer membrane protein assembly factor BamE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262460.1 transl_table 11 codon_start 1 locus_tag LOCUS_17790 gene bamE CDS 243260..243805 product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268868.1 transl_table 11 codon_start 1 locus_tag LOCUS_17800 CDS 243938..245383 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17810 CDS complement(245712..247373) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17820 tRNA 247595..247671 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00400 tRNA 247678..247754 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00410 CDS 248021..249322 product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989861.1 transl_table 11 codon_start 1 locus_tag LOCUS_17830 CDS 249500..250219 product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707410.1 transl_table 11 codon_start 1 locus_tag LOCUS_17840 gene deoD CDS 250224..251525 product xanthosine/proton symporter XapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020402.1 transl_table 11 codon_start 1 locus_tag LOCUS_17850 gene xapB CDS 251525..251932 product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721969.1 transl_table 11 codon_start 1 locus_tag LOCUS_17860 CDS complement(252071..254344) product LPS-assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189876.1 transl_table 11 codon_start 1 locus_tag LOCUS_17870 CDS 254615..255304 product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813772.1 transl_table 11 codon_start 1 locus_tag LOCUS_17880 CDS 255514..256260 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17890 CDS complement(256220..257458) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17900 CDS 257667..258128 product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036912.1 transl_table 11 codon_start 1 locus_tag LOCUS_17910 CDS complement(258236..258895) product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688991.1 transl_table 11 codon_start 1 locus_tag LOCUS_17920 CDS 259174..259899 product VIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230540.1 transl_table 11 codon_start 1 locus_tag LOCUS_17930 CDS 260159..260581 product D-ribose pyranase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212252.1 transl_table 11 codon_start 1 locus_tag LOCUS_17940 gene rbsD CDS 260596..261924 product ribose ABC transporter ATP-binding protein RbsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000339360.1 transl_table 11 codon_start 1 locus_tag LOCUS_17950 gene rbsA CDS 261947..262105 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17960 note possible pseudo, frameshifted CDS 262105..263070 product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368991.1 transl_table 11 codon_start 1 locus_tag LOCUS_17970 gene rbsC CDS 263088..263972 product ribose ABC transporter substrate-binding protein RbsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175185.1 transl_table 11 codon_start 1 locus_tag LOCUS_17980 gene rbsB CDS complement(264349..265242) product formate dehydrogenase accessory protein FdhE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005161934.1 transl_table 11 codon_start 1 locus_tag LOCUS_17990 gene fdhE CDS complement(265457..266173) product formate dehydrogenase cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209610.1 transl_table 11 codon_start 1 locus_tag LOCUS_18000 gene fdoI CDS complement(266177..267082) product formate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528944.1 transl_table 11 codon_start 1 locus_tag LOCUS_18010 gene fdxH CDS complement(267095..270145) product formate dehydrogenase-N subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904702.1 transl_table 11 codon_start 1 locus_tag LOCUS_18020 gene fdnG sequence06 source 1..83942 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(757..2286) product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288629.1 transl_table 11 codon_start 1 locus_tag LOCUS_18030 gene guaA CDS 2921..3160 product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722680.1 transl_table 11 codon_start 1 locus_tag LOCUS_18040 CDS 3164..5512 product Fe(2+) transporter permease subunit FeoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390223.1 transl_table 11 codon_start 1 locus_tag LOCUS_18050 gene feoB CDS 5509..5772 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18060 CDS complement(5985..8267) product acid resistance putative oxidoreductase YdeP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000726709.1 transl_table 11 codon_start 1 locus_tag LOCUS_18070 gene ydeP CDS complement(8844..9269) product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225588.1 transl_table 11 codon_start 1 locus_tag LOCUS_18080 CDS complement(9349..10632) product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704180.1 transl_table 11 codon_start 1 locus_tag LOCUS_18090 gene coaBC CDS complement(10848..12377) product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461826.1 transl_table 11 codon_start 1 locus_tag LOCUS_18100 gene rng CDS complement(12377..13552) product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071212.1 transl_table 11 codon_start 1 locus_tag LOCUS_18110 CDS complement(13542..14525) product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000073137.1 transl_table 11 codon_start 1 locus_tag LOCUS_18120 gene trxB CDS complement(14858..15946) product polyamine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530248.1 transl_table 11 codon_start 1 locus_tag LOCUS_18130 CDS complement(16107..16541) product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263284.1 transl_table 11 codon_start 1 locus_tag LOCUS_18140 CDS complement(16698..18329) product ubiquinone biosynthesis regulatory protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948590.1 transl_table 11 codon_start 1 locus_tag LOCUS_18150 gene ubiB CDS complement(18459..19205) product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000227959.1 transl_table 11 codon_start 1 locus_tag LOCUS_18160 gene ubiE CDS complement(19341..20168) product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266136.1 transl_table 11 codon_start 1 locus_tag LOCUS_18170 gene aroE CDS complement(20168..22114) product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266495.1 transl_table 11 codon_start 1 locus_tag LOCUS_18180 gene mutL CDS complement(22278..23315) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18190 CDS complement(23459..24331) product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086270.1 transl_table 11 codon_start 1 locus_tag LOCUS_18200 gene dapA CDS complement(24623..25387) product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004546769.1 transl_table 11 codon_start 1 locus_tag LOCUS_18210 gene xth CDS 25642..27054 product glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099376.1 transl_table 11 codon_start 1 locus_tag LOCUS_18220 gene glnA CDS complement(27530..27715) product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957970.1 transl_table 11 codon_start 1 locus_tag LOCUS_18230 gene csrA CDS complement(27858..28556) product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552523.1 transl_table 11 codon_start 1 locus_tag LOCUS_18240 gene trmD CDS complement(28560..29063) product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261312.1 transl_table 11 codon_start 1 locus_tag LOCUS_18250 gene rimM CDS complement(29141..29410) product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092643.1 transl_table 11 codon_start 1 locus_tag LOCUS_18260 gene rpsP CDS complement(29544..30458) product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522022.1 transl_table 11 codon_start 1 locus_tag LOCUS_18270 gene lpxC CDS complement(30488..31609) product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948309.1 transl_table 11 codon_start 1 locus_tag LOCUS_18280 gene ftsZ CDS complement(31666..32916) product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003364017.1 transl_table 11 codon_start 1 locus_tag LOCUS_18290 gene ftsA CDS complement(32996..33949) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18300 CDS complement(33916..34875) product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005066802.1 transl_table 11 codon_start 1 locus_tag LOCUS_18310 CDS complement(34888..36306) product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094121.1 transl_table 11 codon_start 1 locus_tag LOCUS_18320 gene murC CDS complement(36303..37409) product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693451.1 transl_table 11 codon_start 1 locus_tag LOCUS_18330 gene murG CDS complement(37406..38527) product cell division protein FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262633.1 transl_table 11 codon_start 1 locus_tag LOCUS_18340 gene ftsW CDS complement(39082..40488) product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268846.1 transl_table 11 codon_start 1 locus_tag LOCUS_18350 gene murD CDS complement(40645..40980) product ribosome hibernation promoting factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005305957.1 transl_table 11 codon_start 1 locus_tag LOCUS_18360 gene hpf CDS complement(41281..42096) product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094894.1 transl_table 11 codon_start 1 locus_tag LOCUS_18370 gene mutM CDS 42212..42565 product DUF2069 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001918774.1 transl_table 11 codon_start 1 locus_tag LOCUS_18380 CDS complement(42650..44293) product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001089648.1 transl_table 11 codon_start 1 locus_tag LOCUS_18390 gene lnt CDS complement(44323..45510) product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234970.1 transl_table 11 codon_start 1 locus_tag LOCUS_18400 gene amiE tRNA 45648..45723 product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00420 tRNA 46130..46205 product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00430 CDS 46501..46644 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18410 CDS complement(46971..47570) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18420 CDS complement(47755..48990) product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071152.1 transl_table 11 codon_start 1 locus_tag LOCUS_18430 gene serA CDS complement(49006..50409) product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813072.1 transl_table 11 codon_start 1 locus_tag LOCUS_18440 gene thrC CDS 50831..52642 product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244167.1 transl_table 11 codon_start 1 locus_tag LOCUS_18450 CDS complement(52787..53302) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18460 CDS complement(53580..54431) product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688911.1 transl_table 11 codon_start 1 locus_tag LOCUS_18470 gene kdsA CDS 54784..55707 product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000535539.1 transl_table 11 codon_start 1 locus_tag LOCUS_18480 gene rarD CDS complement(55759..57318) product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948335.1 transl_table 11 codon_start 1 locus_tag LOCUS_18490 gene murJ CDS complement(57818..58123) product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000126166.1 transl_table 11 codon_start 1 locus_tag LOCUS_18500 CDS complement(58167..60551) product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267471.1 transl_table 11 codon_start 1 locus_tag LOCUS_18510 gene pheT CDS complement(60570..61583) product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382398.1 transl_table 11 codon_start 1 locus_tag LOCUS_18520 gene pheS CDS complement(61689..62045) product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211833.1 transl_table 11 codon_start 1 locus_tag LOCUS_18530 gene rplT CDS complement(62070..62267) product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003016672.1 transl_table 11 codon_start 1 locus_tag LOCUS_18540 gene rpmI CDS complement(62307..62780) product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170846037.1 transl_table 11 codon_start 1 locus_tag LOCUS_18550 gene infC CDS complement(63044..64963) product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191232.1 transl_table 11 codon_start 1 locus_tag LOCUS_18560 gene thrS CDS complement(65284..69177) product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000970165.1 transl_table 11 codon_start 1 locus_tag LOCUS_18570 gene purL CDS 69685..70326 product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478649.1 transl_table 11 codon_start 1 locus_tag LOCUS_18580 CDS 70523..71245 product thiol:disulfide interchange protein DsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096976.1 transl_table 11 codon_start 1 locus_tag LOCUS_18590 gene dsbA CDS 71488..72309 product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126322954.1 transl_table 11 codon_start 1 locus_tag LOCUS_18600 gene lgt CDS 72306..73100 product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948554.1 transl_table 11 codon_start 1 locus_tag LOCUS_18610 gene thyA CDS 73176..73667 product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957501.1 transl_table 11 codon_start 1 locus_tag LOCUS_18620 gene rnhA CDS 73704..74393 product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563276.1 transl_table 11 codon_start 1 locus_tag LOCUS_18630 gene dnaQ CDS 74575..75894 product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704839.1 transl_table 11 codon_start 1 locus_tag LOCUS_18640 gene rimO CDS complement(76020..77570) product phospholipase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010358244.1 transl_table 11 codon_start 1 locus_tag LOCUS_18650 CDS complement(77796..78383) product glutathione transferase GstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000765713.1 transl_table 11 codon_start 1 locus_tag LOCUS_18660 gene gstA CDS 78662..79309 product oxygen-insensitive NAD(P)H nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000355874.1 transl_table 11 codon_start 1 locus_tag LOCUS_18670 gene nfsB CDS 79692..80831 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037378875.1 transl_table 11 codon_start 1 locus_tag LOCUS_18680 CDS 80862..81881 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388771.1 transl_table 11 codon_start 1 locus_tag LOCUS_18690 CDS 81891..82715 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974521.1 transl_table 11 codon_start 1 locus_tag LOCUS_18700 CDS complement(82904..83545) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18710 sequence07 source 1..43019 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(2670..3098) product multidrug/biocide efflux PACE transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000597495.1 transl_table 11 codon_start 1 locus_tag LOCUS_18720 CDS complement(3376..5769) product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006995225.1 transl_table 11 codon_start 1 locus_tag LOCUS_18730 gene gyrB CDS complement(6017..7108) product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693333.1 transl_table 11 codon_start 1 locus_tag LOCUS_18740 gene recF CDS complement(7173..8276) product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768226.1 transl_table 11 codon_start 1 locus_tag LOCUS_18750 gene dnaN CDS complement(8846..9448) product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035602.1 transl_table 11 codon_start 1 locus_tag LOCUS_18760 CDS 10023..11105 product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002049199.1 transl_table 11 codon_start 1 locus_tag LOCUS_18770 gene pheA CDS 11442..11702 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18780 CDS 11879..12271 product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103181.1 transl_table 11 codon_start 1 locus_tag LOCUS_18790 gene folB CDS complement(12411..13670) product D-amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098274.1 transl_table 11 codon_start 1 locus_tag LOCUS_18800 gene dadA CDS 14206..15654 product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047962.1 transl_table 11 codon_start 1 locus_tag LOCUS_18810 CDS 16125..16547 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18820 CDS 16702..18756 product oligopeptide transporter, OPT family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951366.1 transl_table 11 codon_start 1 locus_tag LOCUS_18830 CDS complement(18979..19608) product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035729.1 transl_table 11 codon_start 1 locus_tag LOCUS_18840 CDS 19988..20320 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18850 note possible pseudo, frameshifted CDS 20358..20744 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18860 note possible pseudo, frameshifted CDS complement(20871..21347) product NIF family HAD-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816113.1 transl_table 11 codon_start 1 locus_tag LOCUS_18870 CDS complement(21727..22305) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18880 CDS complement(22421..23557) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529322.1 transl_table 11 codon_start 1 locus_tag LOCUS_18890 CDS complement(23550..24608) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180938249.1 transl_table 11 codon_start 1 locus_tag LOCUS_18900 CDS complement(24596..26296) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971998.1 transl_table 11 codon_start 1 locus_tag LOCUS_18910 CDS complement(26303..27304) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969670.1 transl_table 11 codon_start 1 locus_tag LOCUS_18920 CDS complement(27527..28717) product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021373411.1 transl_table 11 codon_start 1 locus_tag LOCUS_18930 CDS complement(28717..29166) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417884.1 transl_table 11 codon_start 1 locus_tag LOCUS_18940 CDS complement(29177..30145) product DUF3100 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439094.1 transl_table 11 codon_start 1 locus_tag LOCUS_18950 CDS complement(30431..31705) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815535.1 transl_table 11 codon_start 1 locus_tag LOCUS_18960 CDS complement(31784..32818) product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073010.1 transl_table 11 codon_start 1 locus_tag LOCUS_18970 gene queA CDS complement(33181..34416) product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114343.1 transl_table 11 codon_start 1 locus_tag LOCUS_18980 gene lysA CDS complement(34428..34700) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18990 CDS 35067..37718 product DNA topoisomerase (ATP-hydrolyzing) subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706144.1 transl_table 11 codon_start 1 locus_tag LOCUS_19000 gene gyrA CDS complement(38176..38520) product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211186.1 transl_table 11 codon_start 1 locus_tag LOCUS_19010 CDS complement(38796..39557) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19020 CDS complement(39561..41288) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705903.1 transl_table 11 codon_start 1 locus_tag LOCUS_19030 CDS complement(41688..42701) product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001035169.1 transl_table 11 codon_start 1 locus_tag LOCUS_19040 sequence08 source 1..20918 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(121..1056) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19050 CDS complement(1299..2243) product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815364.1 transl_table 11 codon_start 1 locus_tag LOCUS_19060 CDS 2411..3559 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208869.1 transl_table 11 codon_start 1 locus_tag LOCUS_19070 CDS complement(3646..3969) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19080 CDS 4393..4752 product NirD/YgiW/YdeI family stress tolerance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385036.1 transl_table 11 codon_start 1 locus_tag LOCUS_19090 CDS complement(4880..5701) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19100 CDS 6041..6589 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19110 CDS complement(6929..8239) product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026262905.1 transl_table 11 codon_start 1 locus_tag LOCUS_19120 gene tilS CDS complement(8528..10309) product autotransporter assembly complex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019238119.1 transl_table 11 codon_start 1 locus_tag LOCUS_19130 CDS complement(10621..11841) product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115333.1 transl_table 11 codon_start 1 locus_tag LOCUS_19140 CDS complement(12019..13440) product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222877.1 transl_table 11 codon_start 1 locus_tag LOCUS_19150 CDS 13964..14836 product NAD(+) kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948510.1 transl_table 11 codon_start 1 locus_tag LOCUS_19160 CDS 15267..16307 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19170 sequence09 source 1..10629 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(537..1349) product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242645.1 transl_table 11 codon_start 1 locus_tag LOCUS_19180 CDS complement(1668..3077) product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764764.1 transl_table 11 codon_start 1 locus_tag LOCUS_19190 CDS complement(3195..4325) product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038356.1 transl_table 11 codon_start 1 locus_tag LOCUS_19200 gene hemW CDS complement(4496..6529) product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098740.1 transl_table 11 codon_start 1 locus_tag LOCUS_19210 gene parE CDS complement(6607..7494) product recombination-associated protein RdgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095820.1 transl_table 11 codon_start 1 locus_tag LOCUS_19220 gene rdgC CDS complement(7646..8995) product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036471.1 transl_table 11 codon_start 1 locus_tag LOCUS_19230 gene rlmD CDS 9222..9581 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19240 CDS 9733..10383 product glutaredoxin 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780921.1 transl_table 11 codon_start 1 locus_tag LOCUS_19250 gene grxB sequence10 source 1..9444 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(7458..>9444) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_052728129.1:YadA-like family protein locus_tag LOCUS_19260 sequence11 source 1..3528 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 228..392 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19270 CDS 392..1336 product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963224.1 transl_table 11 codon_start 1 locus_tag LOCUS_19280 CDS complement(1339..1728) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19290 note possible pseudo, frameshifted CDS complement(1745..1936) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19300 note possible pseudo, frameshifted CDS 2028..3230 product tetracycline efflux MFS transporter Tet(B) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001089068.1 transl_table 11 codon_start 1 locus_tag LOCUS_19310 gene tet(B) sequence12 source 1..2965 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 845..878 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence13 source 1..1253 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence14 source 1..906 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence15 source 1..606 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence16 source 1..603 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence17 source 1..534 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence18 source 1..529 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@