COMMON DATATYPE type WGS KEYWORD keyword WGS KEYWORD keyword STANDARD_DRAFT DBLINK project biosample SUBMITTER ab_name ab_name ab_name contact email phone fax institute country city street zip REFERENCE title ab_name ab_name ab_name status Unpublished year COMMENT line Annotated by DFAST v.1.2.20 (https://dfast.nig.ac.jp) ST_COMMENT tagset_id Genome-Assembly-Data Assembly Method Genome Coverage Sequencing Technology sequence01 source 1..264172 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(162..1292) product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707330.1 transl_table 11 codon_start 1 locus_tag LOCUS_00010 CDS complement(1354..1947) product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707333.1 transl_table 11 codon_start 1 locus_tag LOCUS_00020 CDS 2087..3085 product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162498650.1 transl_table 11 codon_start 1 locus_tag LOCUS_00030 CDS 3082..3306 product YheU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704929.1 transl_table 11 codon_start 1 locus_tag LOCUS_00040 CDS 3365..4234 product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704920.1 transl_table 11 codon_start 1 locus_tag LOCUS_00050 CDS complement(4671..5075) product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349708.1 transl_table 11 codon_start 1 locus_tag LOCUS_00060 CDS 5257..5895 product cAMP-activated global transcriptional regulator CRP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005381432.1 transl_table 11 codon_start 1 locus_tag LOCUS_00070 gene crp CDS complement(6099..7202) product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462603.1 transl_table 11 codon_start 1 locus_tag LOCUS_00080 CDS complement(7303..7977) product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263211.1 transl_table 11 codon_start 1 locus_tag LOCUS_00090 CDS complement(8082..10184) product TonB-dependent siderophore vibrioferrin receptor PvuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460644.1 transl_table 11 codon_start 1 locus_tag LOCUS_00100 gene pvuA CDS 10421..11191 product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038164.1 transl_table 11 codon_start 1 locus_tag LOCUS_00110 CDS 11293..12450 product carboxylate--amine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076054234.1 transl_table 11 codon_start 1 locus_tag LOCUS_00120 CDS 12450..14147 product siderophore biosynthesis protein PsvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477461.1 transl_table 11 codon_start 1 locus_tag LOCUS_00130 CDS 14144..15316 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038168.1 transl_table 11 codon_start 1 locus_tag LOCUS_00140 CDS 15279..17060 product siderophore biosynthesis protein PvsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477449.1 transl_table 11 codon_start 1 locus_tag LOCUS_00150 CDS 17057..18247 product type III PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460650.1 transl_table 11 codon_start 1 locus_tag LOCUS_00160 CDS complement(18354..19244) product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022404.1 transl_table 11 codon_start 1 locus_tag LOCUS_00170 CDS complement(19241..20833) product alternate F1F0 ATPase, F1 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022405.1 transl_table 11 codon_start 1 locus_tag LOCUS_00180 CDS complement(20830..21639) product ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022406.1 transl_table 11 codon_start 1 locus_tag LOCUS_00190 CDS complement(21643..21924) product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328511.1 transl_table 11 codon_start 1 locus_tag LOCUS_00200 CDS complement(21955..22656) product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022408.1 transl_table 11 codon_start 1 locus_tag LOCUS_00210 CDS complement(22646..22975) product ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022409.1 transl_table 11 codon_start 1 locus_tag LOCUS_00220 CDS complement(22968..23291) product AtpZ/AtpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022410.1 transl_table 11 codon_start 1 locus_tag LOCUS_00230 CDS complement(23284..23688) product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022411.1 transl_table 11 codon_start 1 locus_tag LOCUS_00240 CDS complement(23663..25135) product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065404.1 transl_table 11 codon_start 1 locus_tag LOCUS_00250 gene atpD CDS complement(25370..26902) product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105400.1 transl_table 11 codon_start 1 locus_tag LOCUS_00260 gene hutH CDS complement(26907..28589) product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070507.1 transl_table 11 codon_start 1 locus_tag LOCUS_00270 CDS complement(28602..29543) product formimidoylglutamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704354.1 transl_table 11 codon_start 1 locus_tag LOCUS_00280 gene hutG CDS complement(29540..30772) product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927515.1 transl_table 11 codon_start 1 locus_tag LOCUS_00290 gene hutI CDS 30974..32284 product YjiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001289401.1 transl_table 11 codon_start 1 locus_tag LOCUS_00300 CDS 32383..32919 product YaeQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173162.1 transl_table 11 codon_start 1 locus_tag LOCUS_00310 CDS complement(33358..34068) product histidine utilization repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704352.1 transl_table 11 codon_start 1 locus_tag LOCUS_00320 gene hutC CDS 34224..34697 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707436.1 transl_table 11 codon_start 1 locus_tag LOCUS_00330 CDS complement(34859..35437) product YjaG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707437.1 transl_table 11 codon_start 1 locus_tag LOCUS_00340 CDS 35593..36537 product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707438.1 transl_table 11 codon_start 1 locus_tag LOCUS_00350 CDS 36537..37121 product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456472.1 transl_table 11 codon_start 1 locus_tag LOCUS_00360 CDS complement(37595..38383) product zinc ABC transporter permease subunit ZnuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707445.1 transl_table 11 codon_start 1 locus_tag LOCUS_00370 gene znuB CDS complement(38373..39110) product zinc ABC transporter ATP-binding protein ZnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707444.1 transl_table 11 codon_start 1 locus_tag LOCUS_00380 gene znuC CDS 39197..40237 product zinc ABC transporter substrate-binding protein ZnuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707443.1 transl_table 11 codon_start 1 locus_tag LOCUS_00390 gene znuA CDS 40463..41761 product murein DD-endopeptidase MepM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707439.1 transl_table 11 codon_start 1 locus_tag LOCUS_00400 gene mepM CDS complement(41833..42900) product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421300.1 transl_table 11 codon_start 1 locus_tag LOCUS_00410 gene hemE CDS 43102..43575 product Rsd/AlgQ family anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707403.1 transl_table 11 codon_start 1 locus_tag LOCUS_00420 CDS complement(43643..45010) product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707405.1 transl_table 11 codon_start 1 locus_tag LOCUS_00430 gene radA CDS complement(45108..46109) product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707408.1 transl_table 11 codon_start 1 locus_tag LOCUS_00440 gene serB CDS 46190..46759 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00450 CDS complement(46742..47458) product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166923.1 transl_table 11 codon_start 1 locus_tag LOCUS_00460 gene deoD CDS complement(47883..49013) product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417780.1 transl_table 11 codon_start 1 locus_tag LOCUS_00470 CDS complement(49023..50825) product sodium-extruding oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480900.1 transl_table 11 codon_start 1 locus_tag LOCUS_00480 gene oadA CDS complement(50899..51141) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00490 tRNA complement(51459..51535) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00010 tRNA complement(51542..51634) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00020 tRNA complement(51692..51768) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00030 tRNA complement(51794..51870) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00040 tRNA complement(51911..51987) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00050 tRNA complement(51994..52086) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00060 CDS complement(52222..52413) product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417777.1 transl_table 11 codon_start 1 locus_tag LOCUS_00500 gene csrA CDS complement(52604..55228) product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707429.1 transl_table 11 codon_start 1 locus_tag LOCUS_00510 gene alaS CDS complement(55333..55791) product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455548.1 transl_table 11 codon_start 1 locus_tag LOCUS_00520 gene recX CDS complement(55851..56183) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00530 CDS complement(56132..56788) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00540 CDS complement(56859..57353) product nicotinamide-nucleotide amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132231.1 transl_table 11 codon_start 1 locus_tag LOCUS_00550 gene pncC CDS complement(57453..58187) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000456110.1 transl_table 11 codon_start 1 locus_tag LOCUS_00560 CDS complement(58545..59294) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00570 CDS complement(59294..61015) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00580 CDS complement(61403..62293) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704355.1 transl_table 11 codon_start 1 locus_tag LOCUS_00590 CDS 62388..63830 product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976014.1 transl_table 11 codon_start 1 locus_tag LOCUS_00600 CDS 63844..64854 product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975258.1 transl_table 11 codon_start 1 locus_tag LOCUS_00610 CDS 64910..66478 product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479897.1 transl_table 11 codon_start 1 locus_tag LOCUS_00620 CDS 66570..66944 product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529414.1 transl_table 11 codon_start 1 locus_tag LOCUS_00630 CDS 67321..69927 product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707433.1 transl_table 11 codon_start 1 locus_tag LOCUS_00640 gene mutS CDS complement(70264..71235) product RNA polymerase sigma factor RpoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704778.1 transl_table 11 codon_start 1 locus_tag LOCUS_00650 gene rpoS CDS complement(71278..72273) product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819395.1 transl_table 11 codon_start 1 locus_tag LOCUS_00660 CDS complement(72281..72826) product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349540.1 transl_table 11 codon_start 1 locus_tag LOCUS_00670 CDS complement(72859..73485) product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704775.1 transl_table 11 codon_start 1 locus_tag LOCUS_00680 CDS complement(73489..74235) product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704774.1 transl_table 11 codon_start 1 locus_tag LOCUS_00690 gene surE CDS complement(74216..75256) product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704773.1 transl_table 11 codon_start 1 locus_tag LOCUS_00700 gene truD CDS complement(75253..75729) product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704772.1 transl_table 11 codon_start 1 locus_tag LOCUS_00710 gene ispF CDS complement(75726..76421) product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704771.1 transl_table 11 codon_start 1 locus_tag LOCUS_00720 gene ispD CDS complement(76418..76705) product cell division protein FtsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704770.1 transl_table 11 codon_start 1 locus_tag LOCUS_00730 gene ftsB CDS complement(77401..78702) product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648049.1 transl_table 11 codon_start 1 locus_tag LOCUS_00740 gene eno CDS complement(78807..80444) product CTP synthase (glutamine hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704768.1 transl_table 11 codon_start 1 locus_tag LOCUS_00750 gene pyrG CDS complement(80711..81658) product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390826.1 transl_table 11 codon_start 1 locus_tag LOCUS_00760 CDS complement(81658..82407) product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267372.1 transl_table 11 codon_start 1 locus_tag LOCUS_00770 CDS 82537..84186 product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406170.1 transl_table 11 codon_start 1 locus_tag LOCUS_00780 CDS complement(84276..85037) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104991.1 transl_table 11 codon_start 1 locus_tag LOCUS_00790 CDS complement(85487..86380) product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477273.1 transl_table 11 codon_start 1 locus_tag LOCUS_00800 gene mmsB CDS complement(86394..87521) product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114169.1 transl_table 11 codon_start 1 locus_tag LOCUS_00810 CDS complement(87755..88909) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483354.1 transl_table 11 codon_start 1 locus_tag LOCUS_00820 CDS complement(89456..90949) product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114170.1 transl_table 11 codon_start 1 locus_tag LOCUS_00830 CDS complement(91000..92181) product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071827.1 transl_table 11 codon_start 1 locus_tag LOCUS_00840 CDS complement(92429..92557) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00850 CDS 92556..93719 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705945.1 transl_table 11 codon_start 1 locus_tag LOCUS_00860 CDS 93903..95507 product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072003.1 transl_table 11 codon_start 1 locus_tag LOCUS_00870 CDS 95516..96313 product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477148.1 transl_table 11 codon_start 1 locus_tag LOCUS_00880 CDS 96306..98303 product methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113506.1 transl_table 11 codon_start 1 locus_tag LOCUS_00890 gene liuD CDS 98300..99190 product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104166.1 transl_table 11 codon_start 1 locus_tag LOCUS_00900 CDS complement(99478..100416) product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071073.1 transl_table 11 codon_start 1 locus_tag LOCUS_00910 gene mdh CDS complement(100539..101216) product arginine ABC transporter permease ArtM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704622.1 transl_table 11 codon_start 1 locus_tag LOCUS_00920 gene artM CDS complement(101209..101856) product arginine ABC transporter permease ArtQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704621.1 transl_table 11 codon_start 1 locus_tag LOCUS_00930 gene artQ CDS complement(101858..102592) product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704620.1 transl_table 11 codon_start 1 locus_tag LOCUS_00940 CDS complement(102612..103349) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308671.1 transl_table 11 codon_start 1 locus_tag LOCUS_00950 CDS 103483..103983 product transcriptional regulator ArgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308670.1 transl_table 11 codon_start 1 locus_tag LOCUS_00960 gene argR CDS complement(104324..105238) product Dyp-type peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704619.1 transl_table 11 codon_start 1 locus_tag LOCUS_00970 CDS complement(105343..106404) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704618.1 transl_table 11 codon_start 1 locus_tag LOCUS_00980 CDS complement(106404..108026) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704617.1 transl_table 11 codon_start 1 locus_tag LOCUS_00990 CDS complement(108061..109074) product Fe(3+) ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704616.1 transl_table 11 codon_start 1 locus_tag LOCUS_01000 CDS complement(109306..110532) product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490371.1 transl_table 11 codon_start 1 locus_tag LOCUS_01010 CDS complement(110548..110886) product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767166.1 transl_table 11 codon_start 1 locus_tag LOCUS_01020 gene glnK CDS 111061..111477 product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704614.1 transl_table 11 codon_start 1 locus_tag LOCUS_01030 gene arfB CDS complement(111591..111950) product YacL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704605.1 transl_table 11 codon_start 1 locus_tag LOCUS_01040 CDS complement(112013..113053) product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265511.1 transl_table 11 codon_start 1 locus_tag LOCUS_01050 CDS 113468..114862 product uracil-xanthine permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417021.1 transl_table 11 codon_start 1 locus_tag LOCUS_01060 CDS complement(115234..117831) product bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818886.1 transl_table 11 codon_start 1 locus_tag LOCUS_01070 gene acnB CDS complement(118059..120326) product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707557.1 transl_table 11 codon_start 1 locus_tag LOCUS_01080 CDS complement(120535..121965) product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000102485.1 transl_table 11 codon_start 1 locus_tag LOCUS_01090 gene lpdA CDS complement(122129..124021) product pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707562.1 transl_table 11 codon_start 1 locus_tag LOCUS_01100 gene aceF CDS complement(124032..126692) product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707563.1 transl_table 11 codon_start 1 locus_tag LOCUS_01110 gene aceE CDS complement(126754..127515) product pyruvate dehydrogenase complex transcriptional repressor PdhR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707564.1 transl_table 11 codon_start 1 locus_tag LOCUS_01120 gene pdhR CDS complement(127811..128665) product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707567.1 transl_table 11 codon_start 1 locus_tag LOCUS_01130 gene nadC CDS complement(129113..129616) product TIGR02281 family clan AA aspartic protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113919.1 transl_table 11 codon_start 1 locus_tag LOCUS_01140 CDS 129695..130249 product 1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046051592.1 transl_table 11 codon_start 1 locus_tag LOCUS_01150 gene ampD CDS 130560..130985 product type IVa pilus major pilin TapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707568.1 transl_table 11 codon_start 1 locus_tag LOCUS_01160 gene tapA CDS 130989..132701 product PilB family type IVa pilus assembly ATPase TapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707569.1 transl_table 11 codon_start 1 locus_tag LOCUS_01170 gene tapB CDS 132742..133968 product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707570.1 transl_table 11 codon_start 1 locus_tag LOCUS_01180 CDS 134015..134881 product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707571.1 transl_table 11 codon_start 1 locus_tag LOCUS_01190 CDS 134878..135483 product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707572.1 transl_table 11 codon_start 1 locus_tag LOCUS_01200 gene coaE CDS complement(135643..136368) product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927735.1 transl_table 11 codon_start 1 locus_tag LOCUS_01210 gene trmB CDS complement(136633..137811) product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707233.1 transl_table 11 codon_start 1 locus_tag LOCUS_01220 CDS 138034..139092 product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707498.1 transl_table 11 codon_start 1 locus_tag LOCUS_01230 gene mutY CDS 139089..139364 product oxidative damage protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005305420.1 transl_table 11 codon_start 1 locus_tag LOCUS_01240 tRNA 139459..139534 product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00070 tRNA 139596..139671 product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00080 tRNA 139701..139776 product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00090 tRNA 139797..139872 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00100 CDS complement(140002..140211) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01250 CDS 140265..140450 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01260 CDS 140461..140904 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01270 CDS 141056..141424 product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_217159161.1 transl_table 11 codon_start 1 locus_tag LOCUS_01280 CDS 141400..141807 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01290 note possible pseudo, frameshifted CDS complement(141932..142543) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01300 CDS 143146..144198 product IS4-like element IS1481A family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035386.1 transl_table 11 codon_start 1 locus_tag LOCUS_01310 tRNA 144439..144514 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00110 CDS 144743..145717 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01320 CDS complement(145730..146041) product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261433.1 transl_table 11 codon_start 1 locus_tag LOCUS_01330 CDS 146335..146544 product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005331438.1 transl_table 11 codon_start 1 locus_tag LOCUS_01340 CDS complement(146952..148067) product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458342.1 transl_table 11 codon_start 1 locus_tag LOCUS_01350 CDS 148317..148646 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01360 CDS complement(148758..149630) product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707511.1 transl_table 11 codon_start 1 locus_tag LOCUS_01370 gene dapA CDS 149922..150941 product 16S rRNA (guanine(1207)-N(2))-methyltransferase RsmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707512.1 transl_table 11 codon_start 1 locus_tag LOCUS_01380 gene rsmC tRNA 151067..151152 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00120 tRNA 151224..151309 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00130 tRNA 151384..151469 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00140 CDS complement(152144..153490) product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707417.1 transl_table 11 codon_start 1 locus_tag LOCUS_01390 gene rlmD tRNA complement(153722..153806) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00150 CDS 153942..154478 product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045788985.1 transl_table 11 codon_start 1 locus_tag LOCUS_01400 CDS complement(154524..155594) product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707420.1 transl_table 11 codon_start 1 locus_tag LOCUS_01410 gene lptG CDS complement(155594..156703) product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005305138.1 transl_table 11 codon_start 1 locus_tag LOCUS_01420 gene lptF CDS 156865..158376 product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707422.1 transl_table 11 codon_start 1 locus_tag LOCUS_01430 gene pepA CDS 158379..158825 product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008502815.1 transl_table 11 codon_start 1 locus_tag LOCUS_01440 gene holC CDS 158830..161694 product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478852.1 transl_table 11 codon_start 1 locus_tag LOCUS_01450 CDS 161902..162462 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01460 CDS complement(162666..162893) product osmotically-inducible lipoprotein OsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000498247.1 transl_table 11 codon_start 1 locus_tag LOCUS_01470 gene osmB CDS complement(163014..163421) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01480 CDS complement(163452..165689) product DUF6351 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225776.1 transl_table 11 codon_start 1 locus_tag LOCUS_01490 CDS 165818..166351 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01500 CDS complement(166377..166721) product ribonuclease E inhibitor RraB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076360509.1 transl_table 11 codon_start 1 locus_tag LOCUS_01510 gene rraB CDS complement(166953..167672) product 1-acylglycerol-3-phosphate O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707454.1 transl_table 11 codon_start 1 locus_tag LOCUS_01520 CDS complement(167862..170501) product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707576.1 transl_table 11 codon_start 1 locus_tag LOCUS_01530 gene secA CDS complement(170640..171491) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01540 CDS complement(171561..172484) product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707578.1 transl_table 11 codon_start 1 locus_tag LOCUS_01550 gene lpxC CDS complement(172582..173724) product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005305686.1 transl_table 11 codon_start 1 locus_tag LOCUS_01560 gene ftsZ CDS complement(173782..175038) product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005305690.1 transl_table 11 codon_start 1 locus_tag LOCUS_01570 gene ftsA CDS complement(174998..175765) product cell division protein FtsQ/DivIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707579.1 transl_table 11 codon_start 1 locus_tag LOCUS_01580 CDS complement(175767..176684) product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210432.1 transl_table 11 codon_start 1 locus_tag LOCUS_01590 CDS complement(176681..178144) product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010635950.1 transl_table 11 codon_start 1 locus_tag LOCUS_01600 gene murC CDS complement(178158..179231) product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707580.1 transl_table 11 codon_start 1 locus_tag LOCUS_01610 gene murG CDS complement(179228..180403) product cell division protein FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016352178.1 transl_table 11 codon_start 1 locus_tag LOCUS_01620 gene ftsW CDS complement(180400..181710) product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707582.1 transl_table 11 codon_start 1 locus_tag LOCUS_01630 gene murD CDS complement(181714..182796) product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707583.1 transl_table 11 codon_start 1 locus_tag LOCUS_01640 gene mraY CDS complement(182790..184130) product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707584.1 transl_table 11 codon_start 1 locus_tag LOCUS_01650 gene murF CDS complement(184127..185599) product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707585.1 transl_table 11 codon_start 1 locus_tag LOCUS_01660 gene murE CDS complement(185583..187328) product peptidoglycan glycosyltransferase FtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707586.1 transl_table 11 codon_start 1 locus_tag LOCUS_01670 CDS complement(187325..187639) product cell division protein FtsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005305726.1 transl_table 11 codon_start 1 locus_tag LOCUS_01680 gene ftsL CDS complement(187636..188580) product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707587.1 transl_table 11 codon_start 1 locus_tag LOCUS_01690 gene rsmH CDS complement(188582..189040) product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005305730.1 transl_table 11 codon_start 1 locus_tag LOCUS_01700 gene mraZ CDS complement(189793..190638) product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707588.1 transl_table 11 codon_start 1 locus_tag LOCUS_01710 gene rsmI CDS 190845..192527 product penicillin-binding protein activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818899.1 transl_table 11 codon_start 1 locus_tag LOCUS_01720 CDS 192499..192864 product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707590.1 transl_table 11 codon_start 1 locus_tag LOCUS_01730 CDS 192873..193466 product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707591.1 transl_table 11 codon_start 1 locus_tag LOCUS_01740 CDS 193463..194044 product division/outer membrane stress-associated lipid-binding lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818900.1 transl_table 11 codon_start 1 locus_tag LOCUS_01750 gene dolP CDS complement(194179..194622) product ClpXP protease specificity-enhancing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017409380.1 transl_table 11 codon_start 1 locus_tag LOCUS_01760 CDS complement(194625..195254) product stringent starvation protein SspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707594.1 transl_table 11 codon_start 1 locus_tag LOCUS_01770 gene sspA CDS complement(195343..196077) product cytochrome c1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707595.1 transl_table 11 codon_start 1 locus_tag LOCUS_01780 CDS complement(196074..197291) product cytochrome bc complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707596.1 transl_table 11 codon_start 1 locus_tag LOCUS_01790 CDS complement(197294..197701) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01800 CDS complement(198168..198560) product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005336286.1 transl_table 11 codon_start 1 locus_tag LOCUS_01810 gene rpsI CDS complement(198576..199004) product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005396465.1 transl_table 11 codon_start 1 locus_tag LOCUS_01820 gene rplM CDS complement(199256..200356) product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707598.1 transl_table 11 codon_start 1 locus_tag LOCUS_01830 gene zapE CDS 200565..201923 product Do family serine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707600.1 transl_table 11 codon_start 1 locus_tag LOCUS_01840 CDS 202083..203123 product outer membrane-stress sensor serine endopeptidase DegS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707601.1 transl_table 11 codon_start 1 locus_tag LOCUS_01850 gene degS CDS complement(203335..204591) product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707623.1 transl_table 11 codon_start 1 locus_tag LOCUS_01860 gene murA CDS complement(204604..204864) product BolA family iron metabolism protein IbaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417509.1 transl_table 11 codon_start 1 locus_tag LOCUS_01870 gene ibaG CDS complement(204851..205135) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01880 CDS complement(205132..205770) product phospholipid-binding protein MlaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707621.1 transl_table 11 codon_start 1 locus_tag LOCUS_01890 gene mlaC CDS complement(205799..206272) product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707620.1 transl_table 11 codon_start 1 locus_tag LOCUS_01900 gene mlaD CDS complement(206279..207058) product lipid asymmetry maintenance ABC transporter permease subunit MlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707619.1 transl_table 11 codon_start 1 locus_tag LOCUS_01910 gene mlaE CDS complement(207048..207905) product phospholipid ABC transporter ATP-binding protein MlaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707618.1 transl_table 11 codon_start 1 locus_tag LOCUS_01920 gene mlaF CDS 208070..209044 product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707617.1 transl_table 11 codon_start 1 locus_tag LOCUS_01930 CDS 209044..209595 product 3-deoxy-manno-octulosonate-8-phosphatase KdsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174251.1 transl_table 11 codon_start 1 locus_tag LOCUS_01940 gene kdsC CDS 209592..210143 product LPS export ABC transporter periplasmic protein LptC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707615.1 transl_table 11 codon_start 1 locus_tag LOCUS_01950 gene lptC CDS 210109..210642 product lipopolysaccharide transport periplasmic protein LptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016352198.1 transl_table 11 codon_start 1 locus_tag LOCUS_01960 gene lptA CDS 210645..211370 product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707613.1 transl_table 11 codon_start 1 locus_tag LOCUS_01970 gene lptB CDS 211421..212860 product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707612.1 transl_table 11 codon_start 1 locus_tag LOCUS_01980 CDS 212885..213172 product ribosome hibernation promoting factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005305957.1 transl_table 11 codon_start 1 locus_tag LOCUS_01990 gene hpf CDS 213175..213621 product PTS IIA-like nitrogen regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005305951.1 transl_table 11 codon_start 1 locus_tag LOCUS_02000 gene ptsN CDS 213632..214492 product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707611.1 transl_table 11 codon_start 1 locus_tag LOCUS_02010 gene rapZ CDS 214485..214760 product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073703.1 transl_table 11 codon_start 1 locus_tag LOCUS_02020 CDS 214800..216161 product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073704.1 transl_table 11 codon_start 1 locus_tag LOCUS_02030 gene mgtE CDS complement(216206..217555) product metalloprotease PmbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707624.1 transl_table 11 codon_start 1 locus_tag LOCUS_02040 gene pmbA CDS 217650..218186 product ribosome biogenesis factor YjgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707625.1 transl_table 11 codon_start 1 locus_tag LOCUS_02050 gene yjgA CDS complement(218291..218485) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02060 CDS complement(218616..220061) product metalloprotease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819195.1 transl_table 11 codon_start 1 locus_tag LOCUS_02070 gene tldD CDS complement(220051..220881) product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704381.1 transl_table 11 codon_start 1 locus_tag LOCUS_02080 CDS complement(221389..225207) product YhdP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819191.1 transl_table 11 codon_start 1 locus_tag LOCUS_02090 CDS complement(225207..226676) product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704378.1 transl_table 11 codon_start 1 locus_tag LOCUS_02100 gene rng CDS complement(226743..227261) product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703625.1 transl_table 11 codon_start 1 locus_tag LOCUS_02110 CDS complement(227327..227815) product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308115.1 transl_table 11 codon_start 1 locus_tag LOCUS_02120 gene mreD CDS complement(227812..228690) product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704376.1 transl_table 11 codon_start 1 locus_tag LOCUS_02130 gene mreC CDS complement(228727..229770) product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308111.1 transl_table 11 codon_start 1 locus_tag LOCUS_02140 CDS 229944..230864 product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819958.1 transl_table 11 codon_start 1 locus_tag LOCUS_02150 CDS complement(230859..232772) product RNase E specificity factor CsrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039212856.1 transl_table 11 codon_start 1 locus_tag LOCUS_02160 CDS complement(232991..233620) product single-stranded DNA-binding protein SSB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209100.1 transl_table 11 codon_start 1 locus_tag LOCUS_02170 gene ssb1 CDS complement(233635..235008) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073745.1 transl_table 11 codon_start 1 locus_tag LOCUS_02180 CDS 235154..237982 product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707637.1 transl_table 11 codon_start 1 locus_tag LOCUS_02190 gene uvrA CDS 238000..239751 product Wzy polymerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818252.1 transl_table 11 codon_start 1 locus_tag LOCUS_02200 CDS complement(239960..240712) product glutaminyl-peptide cyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858314.1 transl_table 11 codon_start 1 locus_tag LOCUS_02210 CDS complement(240822..241010) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02220 CDS 240979..241377 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02230 CDS 241377..242378 product PA2778 family cysteine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895637.1 transl_table 11 codon_start 1 locus_tag LOCUS_02240 CDS complement(242784..244493) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02250 CDS complement(244497..245129) product ABC-type transport auxiliary lipoprotein family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109195.1 transl_table 11 codon_start 1 locus_tag LOCUS_02260 CDS complement(245126..246064) product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114822.1 transl_table 11 codon_start 1 locus_tag LOCUS_02270 CDS complement(246068..246859) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114823.1 transl_table 11 codon_start 1 locus_tag LOCUS_02280 CDS complement(246856..247974) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114824.1 transl_table 11 codon_start 1 locus_tag LOCUS_02290 CDS 248060..248671 product alkylphosphonate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043122718.1 transl_table 11 codon_start 1 locus_tag LOCUS_02300 CDS 248698..249009 product YqfO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092679.1 transl_table 11 codon_start 1 locus_tag LOCUS_02310 CDS 249075..249542 product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464913.1 transl_table 11 codon_start 1 locus_tag LOCUS_02320 CDS complement(250052..251299) product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626309.1 transl_table 11 codon_start 1 locus_tag LOCUS_02330 CDS complement(251563..255243) product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704406.1 transl_table 11 codon_start 1 locus_tag LOCUS_02340 gene metH CDS 255487..256776 product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704405.1 transl_table 11 codon_start 1 locus_tag LOCUS_02350 assembly_gap 256835..256844 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(257299..258243) product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704462.1 transl_table 11 codon_start 1 locus_tag LOCUS_02360 gene metA CDS 258386..259564 product CinA family nicotinamide mononucleotide deamidase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704460.1 transl_table 11 codon_start 1 locus_tag LOCUS_02370 CDS complement(259597..260301) product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171423.1 transl_table 11 codon_start 1 locus_tag LOCUS_02380 CDS complement(260461..261807) product 8-oxoguanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112635.1 transl_table 11 codon_start 1 locus_tag LOCUS_02390 CDS complement(261940..263361) product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004408020.1 transl_table 11 codon_start 1 locus_tag LOCUS_02400 sequence02 source 1..251612 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(244..2160) product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706272.1 transl_table 11 codon_start 1 locus_tag LOCUS_02410 CDS complement(2459..2926) product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707750.1 transl_table 11 codon_start 1 locus_tag LOCUS_02420 gene pyrI CDS complement(2923..3846) product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016352301.1 transl_table 11 codon_start 1 locus_tag LOCUS_02430 gene pyrB tRNA 4167..4243 product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00160 CDS 4298..4675 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02440 CDS 4651..5139 product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000214241.1 transl_table 11 codon_start 1 locus_tag LOCUS_02450 gene rimI CDS 5192..6208 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02460 CDS 6458..7753 product divalent metal cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478826.1 transl_table 11 codon_start 1 locus_tag LOCUS_02470 CDS 8231..9757 product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295398.1 transl_table 11 codon_start 1 locus_tag LOCUS_02480 gene pntA CDS 9763..11142 product Re/Si-specific NAD(P)(+) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073523.1 transl_table 11 codon_start 1 locus_tag LOCUS_02490 gene pntB CDS 11715..12389 product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015619.1 transl_table 11 codon_start 1 locus_tag LOCUS_02500 CDS 12386..12715 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02510 CDS 12770..13657 product putative selenate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125171.1 transl_table 11 codon_start 1 locus_tag LOCUS_02520 CDS 13658..14329 product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113154.1 transl_table 11 codon_start 1 locus_tag LOCUS_02530 CDS 14331..15812 product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707871.1 transl_table 11 codon_start 1 locus_tag LOCUS_02540 gene phnE CDS 15931..16239 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02550 CDS complement(16333..17085) product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477266.1 transl_table 11 codon_start 1 locus_tag LOCUS_02560 CDS 17338..17505 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02570 CDS 17506..18399 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02580 note possible pseudo, internal stop codon CDS 18529..18816 product mercury resistance system periplasmic binding protein MerP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000732292.1 transl_table 11 codon_start 1 locus_tag LOCUS_02590 gene merP CDS 18820..19062 product mercury resistance system transport protein MerF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654684.1 transl_table 11 codon_start 1 locus_tag LOCUS_02600 gene merF CDS 19062..20468 product mercury(II) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281123.1 transl_table 11 codon_start 1 locus_tag LOCUS_02610 gene merA CDS complement(20731..22044) product urate hydroxylase PuuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550272.1 transl_table 11 codon_start 1 locus_tag LOCUS_02620 CDS complement(22523..23104) product tRNA-uridine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074160.1 transl_table 11 codon_start 1 locus_tag LOCUS_02630 CDS 23325..24914 product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456063.1 transl_table 11 codon_start 1 locus_tag LOCUS_02640 gene prfC CDS 25155..25922 product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172625948.1 transl_table 11 codon_start 1 locus_tag LOCUS_02650 CDS 26094..27374 product NupC/NupG family nucleoside CNT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707414.1 transl_table 11 codon_start 1 locus_tag LOCUS_02660 CDS 27424..28203 product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295412.1 transl_table 11 codon_start 1 locus_tag LOCUS_02670 gene deoC CDS 28285..29502 product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209216.1 transl_table 11 codon_start 1 locus_tag LOCUS_02680 gene deoB CDS complement(29953..30840) product Tim44-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704944.1 transl_table 11 codon_start 1 locus_tag LOCUS_02690 CDS 30887..31033 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02700 CDS 31106..32500 product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704946.1 transl_table 11 codon_start 1 locus_tag LOCUS_02710 gene dnaB CDS 32510..33598 product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209096.1 transl_table 11 codon_start 1 locus_tag LOCUS_02720 gene alr CDS complement(34249..34461) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167824836.1 transl_table 11 codon_start 1 locus_tag LOCUS_02730 CDS complement(34693..35145) product zinc uptake transcriptional repressor Zur inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707398.1 transl_table 11 codon_start 1 locus_tag LOCUS_02740 gene zur CDS complement(35468..36256) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02750 CDS 36503..36880 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02760 CDS 37125..39062 product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000367546.1 transl_table 11 codon_start 1 locus_tag LOCUS_02770 CDS 39062..41974 product type III restriction-modification system endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000033406.1 transl_table 11 codon_start 1 locus_tag LOCUS_02780 CDS complement(42216..42539) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02790 CDS complement(42691..43767) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02800 CDS complement(43853..44941) product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003693486.1 transl_table 11 codon_start 1 locus_tag LOCUS_02810 CDS complement(45244..46329) product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083692.1 transl_table 11 codon_start 1 locus_tag LOCUS_02820 CDS complement(46750..47013) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02830 CDS complement(47037..47360) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02840 CDS complement(47357..47527) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02850 CDS complement(47524..48021) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02860 CDS complement(48018..48221) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02870 CDS complement(48221..48415) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02880 CDS complement(48418..48660) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02890 CDS complement(48653..50911) product replication endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_150388894.1 transl_table 11 codon_start 1 locus_tag LOCUS_02900 CDS complement(50908..51159) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02910 CDS complement(51159..51446) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02920 CDS complement(51443..51685) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02930 CDS complement(51734..52210) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02940 CDS complement(52207..52461) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02950 CDS complement(52461..52769) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02960 CDS complement(52776..52955) product Cro/CI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262504.1 transl_table 11 codon_start 1 locus_tag LOCUS_02970 CDS 53029..53712 product LexA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000856967.1 transl_table 11 codon_start 1 locus_tag LOCUS_02980 CDS 53739..54866 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02990 CDS complement(54902..55087) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03000 CDS complement(55566..57293) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000977539.1 transl_table 11 codon_start 1 locus_tag LOCUS_03010 CDS complement(57265..57843) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767203.1 transl_table 11 codon_start 1 locus_tag LOCUS_03020 CDS complement(57840..58730) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03030 CDS complement(58743..59027) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03040 CDS complement(58996..60087) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03050 CDS complement(60084..60371) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03060 CDS complement(60368..60775) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03070 CDS complement(60790..62904) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03080 CDS complement(62909..63286) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03090 CDS complement(63283..63567) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939862.1 transl_table 11 codon_start 1 locus_tag LOCUS_03100 CDS complement(63577..65211) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03110 CDS complement(65208..66122) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03120 CDS complement(66115..67326) product baseplate J/gp47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097385.1 transl_table 11 codon_start 1 locus_tag LOCUS_03130 CDS complement(67323..67649) product DUF2590 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097386.1 transl_table 11 codon_start 1 locus_tag LOCUS_03140 CDS complement(67639..69594) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03150 CDS complement(69779..70042) product putative phage tail assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097388.1 transl_table 11 codon_start 1 locus_tag LOCUS_03160 CDS complement(70039..70293) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03170 CDS complement(70211..70831) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03180 CDS complement(70828..71346) product glycoside hydrolase family 108 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225286.1 transl_table 11 codon_start 1 locus_tag LOCUS_03190 CDS complement(71346..71549) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03200 CDS complement(71555..72010) product DUF2597 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097392.1 transl_table 11 codon_start 1 locus_tag LOCUS_03210 CDS complement(72010..73125) product DUF2586 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097393.1 transl_table 11 codon_start 1 locus_tag LOCUS_03220 CDS complement(73128..73790) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815670.1 transl_table 11 codon_start 1 locus_tag LOCUS_03230 CDS complement(73787..74284) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03240 CDS complement(74295..74753) product head completion/stabilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024143839.1 transl_table 11 codon_start 1 locus_tag LOCUS_03250 CDS complement(74861..75574) product phage terminase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001218531.1 transl_table 11 codon_start 1 locus_tag LOCUS_03260 gene gpM CDS complement(75585..76625) product phage major capsid protein, P2 family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003838043.1 transl_table 11 codon_start 1 locus_tag LOCUS_03270 CDS complement(76635..77519) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03280 CDS 77709..79538 product terminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004389558.1 transl_table 11 codon_start 1 locus_tag LOCUS_03290 CDS 79535..80536 product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097401.1 transl_table 11 codon_start 1 locus_tag LOCUS_03300 CDS 80621..80875 product ogr/Delta-like zinc finger family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705928.1 transl_table 11 codon_start 1 locus_tag LOCUS_03310 CDS complement(80885..81958) product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975769.1 transl_table 11 codon_start 1 locus_tag LOCUS_03320 CDS 82214..83101 product tRNA dihydrouridine(20/20a) synthase DusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001884460.1 transl_table 11 codon_start 1 locus_tag LOCUS_03330 gene dusA CDS complement(83157..83417) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03340 CDS 83650..84378 product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000495223.1 transl_table 11 codon_start 1 locus_tag LOCUS_03350 CDS 84530..85423 product DNA-binding transcriptional regulator OxyR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017409206.1 transl_table 11 codon_start 1 locus_tag LOCUS_03360 gene oxyR CDS complement(85802..88180) product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000668733.1 transl_table 11 codon_start 1 locus_tag LOCUS_03370 CDS 88381..89403 product PilM family type IVa pilus assembly protein TapM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706970.1 transl_table 11 codon_start 1 locus_tag LOCUS_03380 gene tapM CDS 89391..89951 product PilN family type IV pilus biogenesis protein TapN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706969.1 transl_table 11 codon_start 1 locus_tag LOCUS_03390 gene tapN CDS 89948..90532 product PilO family type IV pilus biogenesis protein TapO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706968.1 transl_table 11 codon_start 1 locus_tag LOCUS_03400 gene tapO CDS 90529..91044 product pilus assembly protein PilP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706967.1 transl_table 11 codon_start 1 locus_tag LOCUS_03410 CDS 91068..93092 product type IV pilus secretin PilQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706966.1 transl_table 11 codon_start 1 locus_tag LOCUS_03420 CDS 93383..93865 product shikimate kinase AroK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005298388.1 transl_table 11 codon_start 1 locus_tag LOCUS_03430 gene aroK CDS 93880..94959 product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706965.1 transl_table 11 codon_start 1 locus_tag LOCUS_03440 gene aroB CDS 94956..96290 product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706964.1 transl_table 11 codon_start 1 locus_tag LOCUS_03450 CDS 96352..97185 product Dam family site-specific DNA-(adenine-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706963.1 transl_table 11 codon_start 1 locus_tag LOCUS_03460 CDS complement(97187..97363) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03470 CDS 97469..98143 product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016351625.1 transl_table 11 codon_start 1 locus_tag LOCUS_03480 gene rpe CDS 98136..98831 product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706961.1 transl_table 11 codon_start 1 locus_tag LOCUS_03490 CDS 98824..99831 product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706960.1 transl_table 11 codon_start 1 locus_tag LOCUS_03500 gene trpS CDS 99991..100203 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706959.1 transl_table 11 codon_start 1 locus_tag LOCUS_03510 CDS 100391..100891 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03520 CDS complement(100910..102874) product acetoacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704166.1 transl_table 11 codon_start 1 locus_tag LOCUS_03530 CDS complement(102877..103545) product maleylacetoacetate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071821.1 transl_table 11 codon_start 1 locus_tag LOCUS_03540 gene maiA CDS complement(103532..104521) product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071820.1 transl_table 11 codon_start 1 locus_tag LOCUS_03550 CDS complement(104556..105686) product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480624.1 transl_table 11 codon_start 1 locus_tag LOCUS_03560 CDS complement(105836..106408) product DUF2939 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193499.1 transl_table 11 codon_start 1 locus_tag LOCUS_03570 CDS 106584..106976 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03580 CDS 107088..108356 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03590 CDS 108627..109091 product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071355.1 transl_table 11 codon_start 1 locus_tag LOCUS_03600 gene bfr CDS 109104..109571 product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071356.1 transl_table 11 codon_start 1 locus_tag LOCUS_03610 gene bfr CDS complement(109698..111080) product DUF853 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704217.1 transl_table 11 codon_start 1 locus_tag LOCUS_03620 CDS complement(111248..112741) product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263649.1 transl_table 11 codon_start 1 locus_tag LOCUS_03630 gene putP CDS complement(113004..113441) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03640 CDS 113352..113600 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03650 CDS complement(113993..114442) product flagellar export chaperone FlgN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211107.1 transl_table 11 codon_start 1 locus_tag LOCUS_03660 gene flgN CDS complement(114439..114726) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03670 CDS complement(114829..115566) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03680 CDS 115744..116160 product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000887042.1 transl_table 11 codon_start 1 locus_tag LOCUS_03690 gene flgB CDS 116192..116599 product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197251.1 transl_table 11 codon_start 1 locus_tag LOCUS_03700 gene flgC CDS 116602..117279 product flagellar hook assembly protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211112.1 transl_table 11 codon_start 1 locus_tag LOCUS_03710 gene flgD CDS 117328..118512 product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367327.1 transl_table 11 codon_start 1 locus_tag LOCUS_03720 gene flgE CDS 118526..119284 product flagellar basal body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009113335.1 transl_table 11 codon_start 1 locus_tag LOCUS_03730 CDS 119298..120080 product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625851.1 transl_table 11 codon_start 1 locus_tag LOCUS_03740 gene flgG CDS 120116..120778 product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367324.1 transl_table 11 codon_start 1 locus_tag LOCUS_03750 gene flgH CDS 120791..121963 product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550967.1 transl_table 11 codon_start 1 locus_tag LOCUS_03760 CDS 121963..122991 product flagellar assembly peptidoglycan hydrolase FlgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211118.1 transl_table 11 codon_start 1 locus_tag LOCUS_03770 gene flgJ CDS 123065..124675 product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704937.1 transl_table 11 codon_start 1 locus_tag LOCUS_03780 gene flgK CDS 124701..125891 product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946958.1 transl_table 11 codon_start 1 locus_tag LOCUS_03790 gene flgL CDS complement(126055..126843) product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930333.1 transl_table 11 codon_start 1 locus_tag LOCUS_03800 gene fliR CDS complement(126850..127119) product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005160414.1 transl_table 11 codon_start 1 locus_tag LOCUS_03810 gene fliQ CDS complement(127144..127893) product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001253411.1 transl_table 11 codon_start 1 locus_tag LOCUS_03820 gene fliP CDS complement(127896..128324) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03830 CDS complement(128321..128803) product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063737.1 transl_table 11 codon_start 1 locus_tag LOCUS_03840 gene fliN CDS complement(128796..129851) product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043526237.1 transl_table 11 codon_start 1 locus_tag LOCUS_03850 gene fliM CDS complement(129872..130354) product flagellar basal body-associated protein FliL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367297.1 transl_table 11 codon_start 1 locus_tag LOCUS_03860 gene fliL CDS complement(130483..131568) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03870 CDS complement(131568..132044) product flagellar export protein FliJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367295.1 transl_table 11 codon_start 1 locus_tag LOCUS_03880 gene fliJ CDS complement(132044..133435) product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000213259.1 transl_table 11 codon_start 1 locus_tag LOCUS_03890 gene fliI CDS complement(133432..134196) product flagellar assembly protein FliH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097731.1 transl_table 11 codon_start 1 locus_tag LOCUS_03900 gene fliH CDS complement(134189..135199) product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000067735.1 transl_table 11 codon_start 1 locus_tag LOCUS_03910 gene fliG CDS complement(135192..136892) product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523066.1 transl_table 11 codon_start 1 locus_tag LOCUS_03920 gene fliF CDS 137148..137486 product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367290.1 transl_table 11 codon_start 1 locus_tag LOCUS_03930 gene fliE CDS complement(137612..138850) product FliC/FljB family flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704962.1 transl_table 11 codon_start 1 locus_tag LOCUS_03940 CDS 139100..140806 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03950 CDS 140911..142260 product flagellar filament capping protein FliD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211150.1 transl_table 11 codon_start 1 locus_tag LOCUS_03960 gene fliD CDS 142325..142744 product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211149.1 transl_table 11 codon_start 1 locus_tag LOCUS_03970 gene fliS CDS 142746..143111 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03980 CDS 143146..144057 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03990 CDS 144050..144334 product EscU/YscU/HrcU family type III secretion system export apparatus switch protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811829.1 transl_table 11 codon_start 1 locus_tag LOCUS_04000 CDS 144710..145009 product flagellar transcriptional regulator FlhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005164498.1 transl_table 11 codon_start 1 locus_tag LOCUS_04010 gene flhD CDS 145023..145580 product flagellar transcriptional regulator FlhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198198.1 transl_table 11 codon_start 1 locus_tag LOCUS_04020 gene flhC CDS 145677..146546 product flagellar motor stator protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704927.1 transl_table 11 codon_start 1 locus_tag LOCUS_04030 gene motA CDS 146543..147409 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04040 CDS 147520..149643 product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704929.1 transl_table 11 codon_start 1 locus_tag LOCUS_04050 gene cheA CDS 149645..150034 product chemotaxis response regulator CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005164479.1 transl_table 11 codon_start 1 locus_tag LOCUS_04060 gene cheY CDS 150298..151461 product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009938913.1 transl_table 11 codon_start 1 locus_tag LOCUS_04070 gene flhB CDS 151458..153536 product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096067.1 transl_table 11 codon_start 1 locus_tag LOCUS_04080 gene flhA CDS 153572..153964 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04090 CDS 154110..154814 product RNA polymerase sigma factor FliA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005160341.1 transl_table 11 codon_start 1 locus_tag LOCUS_04100 CDS 154999..156123 product S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072127.1 transl_table 11 codon_start 1 locus_tag LOCUS_04110 CDS 156449..157288 product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027907389.1 transl_table 11 codon_start 1 locus_tag LOCUS_04120 gene fghA CDS 157415..158377 product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704457.1 transl_table 11 codon_start 1 locus_tag LOCUS_04130 CDS 158370..159299 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071850.1 transl_table 11 codon_start 1 locus_tag LOCUS_04140 CDS 159403..160500 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704459.1 transl_table 11 codon_start 1 locus_tag LOCUS_04150 CDS 160711..161850 product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771402.1 transl_table 11 codon_start 1 locus_tag LOCUS_04160 gene rfbB CDS 161850..162746 product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001023616.1 transl_table 11 codon_start 1 locus_tag LOCUS_04170 gene rfbD CDS 162743..163630 product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857508.1 transl_table 11 codon_start 1 locus_tag LOCUS_04180 gene rfbA CDS 163627..164169 product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096184.1 transl_table 11 codon_start 1 locus_tag LOCUS_04190 gene rfbC CDS 164252..165100 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289081.1 transl_table 11 codon_start 1 locus_tag LOCUS_04200 CDS 165100..166284 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356901.1 transl_table 11 codon_start 1 locus_tag LOCUS_04210 CDS 166284..167111 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04220 CDS 167108..168685 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04230 CDS 168705..170948 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387755.1 transl_table 11 codon_start 1 locus_tag LOCUS_04240 CDS 170983..172050 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04250 CDS 172058..173170 product DUF1972 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063172642.1 transl_table 11 codon_start 1 locus_tag LOCUS_04260 CDS 173198..174583 product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009934990.1 transl_table 11 codon_start 1 locus_tag LOCUS_04270 CDS 174573..175889 product O-antigen ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006995535.1 transl_table 11 codon_start 1 locus_tag LOCUS_04280 CDS complement(176163..177428) product L-methionine/branched-chain amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705120.1 transl_table 11 codon_start 1 locus_tag LOCUS_04290 gene yjeH CDS 177569..177994 product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477070.1 transl_table 11 codon_start 1 locus_tag LOCUS_04300 CDS 178004..180019 product DNA helicase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213061.1 transl_table 11 codon_start 1 locus_tag LOCUS_04310 gene helD CDS 180103..180798 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268494.1 transl_table 11 codon_start 1 locus_tag LOCUS_04320 CDS complement(181063..182529) product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974081.1 transl_table 11 codon_start 1 locus_tag LOCUS_04330 CDS complement(182569..183759) product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974080.1 transl_table 11 codon_start 1 locus_tag LOCUS_04340 CDS 184080..185687 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970606.1 transl_table 11 codon_start 1 locus_tag LOCUS_04350 CDS 185903..187492 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970606.1 transl_table 11 codon_start 1 locus_tag LOCUS_04360 CDS 187547..188512 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065034.1 transl_table 11 codon_start 1 locus_tag LOCUS_04370 CDS 188540..189523 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815883.1 transl_table 11 codon_start 1 locus_tag LOCUS_04380 CDS 189536..190534 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065036.1 transl_table 11 codon_start 1 locus_tag LOCUS_04390 CDS 190534..191541 product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065037.1 transl_table 11 codon_start 1 locus_tag LOCUS_04400 CDS 191704..192921 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037154163.1 transl_table 11 codon_start 1 locus_tag LOCUS_04410 CDS 192918..193133 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04420 CDS 193498..194577 product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454802.1 transl_table 11 codon_start 1 locus_tag LOCUS_04430 gene hppD CDS 194755..196122 product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007243715.1 transl_table 11 codon_start 1 locus_tag LOCUS_04440 CDS complement(196205..196816) product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929111.1 transl_table 11 codon_start 1 locus_tag LOCUS_04450 CDS complement(197244..198608) product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675346.1 transl_table 11 codon_start 1 locus_tag LOCUS_04460 CDS complement(198602..200470) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04470 CDS 200599..200772 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04480 CDS 200782..202188 product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169026.1 transl_table 11 codon_start 1 locus_tag LOCUS_04490 CDS 202190..203179 product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037938.1 transl_table 11 codon_start 1 locus_tag LOCUS_04500 gene cydB CDS 203479..203952 product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967062.1 transl_table 11 codon_start 1 locus_tag LOCUS_04510 CDS 204261..204974 product gamma-glutamyl-gamma-aminobutyrate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014831700.1 transl_table 11 codon_start 1 locus_tag LOCUS_04520 gene puuD CDS 205032..206516 product aldehyde dehydrogenase PuuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096836.1 transl_table 11 codon_start 1 locus_tag LOCUS_04530 gene puuC CDS 206527..207801 product gamma-glutamylputrescine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000134843.1 transl_table 11 codon_start 1 locus_tag LOCUS_04540 gene puuB CDS 208333..209085 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04550 CDS complement(209528..209866) product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071818.1 transl_table 11 codon_start 1 locus_tag LOCUS_04560 CDS complement(209877..210671) product phenylalanine 4-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705758.1 transl_table 11 codon_start 1 locus_tag LOCUS_04570 gene phhA CDS complement(210792..211982) product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023995174.1 transl_table 11 codon_start 1 locus_tag LOCUS_04580 gene pncB CDS complement(211975..212622) product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813004.1 transl_table 11 codon_start 1 locus_tag LOCUS_04590 CDS 212768..213109 product DUF2750 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010674427.1 transl_table 11 codon_start 1 locus_tag LOCUS_04600 CDS 213238..214353 product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765211.1 transl_table 11 codon_start 1 locus_tag LOCUS_04610 gene zapE CDS complement(214365..214865) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04620 CDS complement(214984..218310) product miniconductance mechanosensitive channel MscM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706981.1 transl_table 11 codon_start 1 locus_tag LOCUS_04630 gene mscM CDS complement(218375..219235) product archaetidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818735.1 transl_table 11 codon_start 1 locus_tag LOCUS_04640 gene asd CDS complement(219263..220168) product small ribosomal subunit biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039215125.1 transl_table 11 codon_start 1 locus_tag LOCUS_04650 gene rsgA CDS 220112..220348 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04660 CDS 220386..220931 product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707210.1 transl_table 11 codon_start 1 locus_tag LOCUS_04670 gene orn tRNA 221170..221245 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00170 tRNA 221385..221460 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00180 tRNA 221605..221680 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00190 tRNA 221732..221807 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00200 tRNA 221861..221936 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00210 CDS complement(222360..223493) product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819425.1 transl_table 11 codon_start 1 locus_tag LOCUS_04680 gene queG CDS 223492..225039 product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000968671.1 transl_table 11 codon_start 1 locus_tag LOCUS_04690 gene nnr CDS 225002..225469 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457080.1 transl_table 11 codon_start 1 locus_tag LOCUS_04700 gene tsaE CDS 225610..226779 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04710 CDS 226781..228643 product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704862.1 transl_table 11 codon_start 1 locus_tag LOCUS_04720 gene mutL CDS 228663..229577 product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001280339.1 transl_table 11 codon_start 1 locus_tag LOCUS_04730 gene miaA CDS 229613..229879 product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209151.1 transl_table 11 codon_start 1 locus_tag LOCUS_04740 gene hfq CDS 229955..231241 product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704865.1 transl_table 11 codon_start 1 locus_tag LOCUS_04750 gene hflX CDS 231288..232460 product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704866.1 transl_table 11 codon_start 1 locus_tag LOCUS_04760 gene hflK CDS 232464..233354 product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704867.1 transl_table 11 codon_start 1 locus_tag LOCUS_04770 gene hflC CDS 233486..234784 product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000527932.1 transl_table 11 codon_start 1 locus_tag LOCUS_04780 CDS complement(235031..236005) product octaprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704869.1 transl_table 11 codon_start 1 locus_tag LOCUS_04790 gene ispB CDS 236241..236552 product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000271393.1 transl_table 11 codon_start 1 locus_tag LOCUS_04800 gene rplU CDS 236570..236827 product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005383095.1 transl_table 11 codon_start 1 locus_tag LOCUS_04810 gene rpmA CDS 236945..238114 product Obg family GTPase CgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704870.1 transl_table 11 codon_start 1 locus_tag LOCUS_04820 gene cgtA CDS 238118..238600 product type 3 dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000973535.1 transl_table 11 codon_start 1 locus_tag LOCUS_04830 gene folA CDS complement(238659..239474) product symmetrical bis(5'-nucleosyl)-tetraphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704877.1 transl_table 11 codon_start 1 locus_tag LOCUS_04840 CDS complement(239474..239848) product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000383338.1 transl_table 11 codon_start 1 locus_tag LOCUS_04850 gene apaG CDS complement(239851..240657) product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349619.1 transl_table 11 codon_start 1 locus_tag LOCUS_04860 gene rsmA CDS complement(240650..241639) product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704880.1 transl_table 11 codon_start 1 locus_tag LOCUS_04870 gene pdxA CDS complement(241636..242952) product peptidylprolyl isomerase SurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704881.1 transl_table 11 codon_start 1 locus_tag LOCUS_04880 gene surA CDS complement(242977..245361) product LPS assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704882.1 transl_table 11 codon_start 1 locus_tag LOCUS_04890 gene lptD CDS 245614..246417 product co-chaperone DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704885.1 transl_table 11 codon_start 1 locus_tag LOCUS_04900 gene djlA CDS complement(246501..247451) product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707005.1 transl_table 11 codon_start 1 locus_tag LOCUS_04910 CDS complement(247536..248201) product bifunctional tRNA pseudouridine(32) synthase/23S rRNA pseudouridine(746) synthase RluA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704807.1 transl_table 11 codon_start 1 locus_tag LOCUS_04920 gene rluA CDS complement(248214..251087) product RNA polymerase-associated protein RapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704808.1 transl_table 11 codon_start 1 locus_tag LOCUS_04930 gene rapA sequence03 source 1..231581 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 475..1854 product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704812.1 transl_table 11 codon_start 1 locus_tag LOCUS_04940 CDS complement(1851..2579) product thiamine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704814.1 transl_table 11 codon_start 1 locus_tag LOCUS_04950 gene thiQ CDS complement(2563..4164) product thiamine/thiamine pyrophosphate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704815.1 transl_table 11 codon_start 1 locus_tag LOCUS_04960 gene thiP CDS complement(4164..5147) product thiamine ABC transporter substrate binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026017959.1 transl_table 11 codon_start 1 locus_tag LOCUS_04970 gene thiB CDS 5320..5610 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04980 CDS complement(5673..6272) product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704819.1 transl_table 11 codon_start 1 locus_tag LOCUS_04990 gene leuD CDS complement(6283..7680) product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704820.1 transl_table 11 codon_start 1 locus_tag LOCUS_05000 gene leuC CDS complement(7680..8780) product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704821.1 transl_table 11 codon_start 1 locus_tag LOCUS_05010 gene leuB CDS complement(8783..10348) product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704822.1 transl_table 11 codon_start 1 locus_tag LOCUS_05020 gene leuA CDS 11188..12906 product acetolactate synthase 3 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704827.1 transl_table 11 codon_start 1 locus_tag LOCUS_05030 CDS 12906..13400 product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704829.1 transl_table 11 codon_start 1 locus_tag LOCUS_05040 gene ilvN CDS 13521..13829 product DUF2845 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029303666.1 transl_table 11 codon_start 1 locus_tag LOCUS_05050 CDS 13954..14682 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005306294.1 transl_table 11 codon_start 1 locus_tag LOCUS_05060 CDS 14679..15062 product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707699.1 transl_table 11 codon_start 1 locus_tag LOCUS_05070 CDS 15112..15513 product sulfurtransferase complex subunit TusD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001209680.1 transl_table 11 codon_start 1 locus_tag LOCUS_05080 gene tusD CDS 15554..15910 product sulfurtransferase complex subunit TusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212321.1 transl_table 11 codon_start 1 locus_tag LOCUS_05090 gene tusC CDS 15918..16202 product sulfurtransferase complex subunit TusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024945207.1 transl_table 11 codon_start 1 locus_tag LOCUS_05100 gene tusB CDS 16518..16988 product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005306266.1 transl_table 11 codon_start 1 locus_tag LOCUS_05110 gene rpsG CDS 17065..19161 product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707695.1 transl_table 11 codon_start 1 locus_tag LOCUS_05120 gene fusA CDS 19225..20409 product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210669.1 transl_table 11 codon_start 1 locus_tag LOCUS_05130 gene tuf CDS 20577..21011 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05140 CDS 21226..21417 product bacterioferritin-associated ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016352142.1 transl_table 11 codon_start 1 locus_tag LOCUS_05150 CDS 21585..22049 product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818875.1 transl_table 11 codon_start 1 locus_tag LOCUS_05160 CDS complement(22050..22181) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05170 CDS 22481..22912 product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083199.1 transl_table 11 codon_start 1 locus_tag LOCUS_05180 CDS 23107..23727 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087183.1 transl_table 11 codon_start 1 locus_tag LOCUS_05190 CDS 24061..25506 product xanthine dehydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267258.1 transl_table 11 codon_start 1 locus_tag LOCUS_05200 gene xdhA CDS 25499..27895 product xanthine dehydrogenase molybdopterin binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114679.1 transl_table 11 codon_start 1 locus_tag LOCUS_05210 gene xdhB CDS 28235..29080 product xanthine dehydrogenase accessory protein XdhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463290.1 transl_table 11 codon_start 1 locus_tag LOCUS_05220 gene xdhC CDS 29111..30415 product guanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201419799.1 transl_table 11 codon_start 1 locus_tag LOCUS_05230 gene guaD CDS 30633..31373 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267254.1 transl_table 11 codon_start 1 locus_tag LOCUS_05240 CDS 31678..32073 product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061778.1 transl_table 11 codon_start 1 locus_tag LOCUS_05250 CDS 32115..33539 product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975813.1 transl_table 11 codon_start 1 locus_tag LOCUS_05260 CDS 33673..35139 product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527998.1 transl_table 11 codon_start 1 locus_tag LOCUS_05270 CDS complement(35315..35644) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05280 CDS 35544..37304 product sulfoacetaldehyde acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808155.1 transl_table 11 codon_start 1 locus_tag LOCUS_05290 gene xsc CDS 37523..38476 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05300 CDS 38514..38807 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05310 CDS 38986..40422 product NCS1 family nucleobase:cation symporter-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038716188.1 transl_table 11 codon_start 1 locus_tag LOCUS_05320 CDS 41036..42472 product NCS1 family nucleobase:cation symporter-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038716188.1 transl_table 11 codon_start 1 locus_tag LOCUS_05330 CDS complement(42564..43088) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207464.1 transl_table 11 codon_start 1 locus_tag LOCUS_05340 CDS complement(43163..44506) product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331270.1 transl_table 11 codon_start 1 locus_tag LOCUS_05350 CDS complement(44499..45089) product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724859.1 transl_table 11 codon_start 1 locus_tag LOCUS_05360 CDS complement(45151..46167) product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009565859.1 transl_table 11 codon_start 1 locus_tag LOCUS_05370 CDS complement(46466..48244) product cobaltochelatase subunit CobT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009566423.1 transl_table 11 codon_start 1 locus_tag LOCUS_05380 gene cobT CDS complement(48411..49391) product cobaltochelatase subunit CobS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387959.1 transl_table 11 codon_start 1 locus_tag LOCUS_05390 gene cobS CDS complement(49535..51331) product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033447544.1 transl_table 11 codon_start 1 locus_tag LOCUS_05400 CDS 51593..52927 product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037479.1 transl_table 11 codon_start 1 locus_tag LOCUS_05410 CDS 53127..53540 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05420 CDS complement(53592..53843) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05430 CDS 54069..54401 product DUF3461 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456756.1 transl_table 11 codon_start 1 locus_tag LOCUS_05440 CDS complement(54466..55800) product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038867.1 transl_table 11 codon_start 1 locus_tag LOCUS_05450 CDS complement(56117..57460) product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087209.1 transl_table 11 codon_start 1 locus_tag LOCUS_05460 CDS complement(57552..57905) product hydroxyisourate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087207.1 transl_table 11 codon_start 1 locus_tag LOCUS_05470 gene uraH CDS 58293..59213 product allantoinase PuuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765316.1 transl_table 11 codon_start 1 locus_tag LOCUS_05480 gene puuE CDS 59213..59728 product 2-oxo-4-hydroxy-4-carboxy-5-ureidoimidazoline decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083333.1 transl_table 11 codon_start 1 locus_tag LOCUS_05490 gene uraD CDS 59782..60291 product ureidoglycolate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083329.1 transl_table 11 codon_start 1 locus_tag LOCUS_05500 CDS complement(60392..61450) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113380.1 transl_table 11 codon_start 1 locus_tag LOCUS_05510 CDS complement(61545..61691) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05520 CDS 61666..63603 product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266678.1 transl_table 11 codon_start 1 locus_tag LOCUS_05530 CDS complement(63797..64213) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100368.1 transl_table 11 codon_start 1 locus_tag LOCUS_05540 CDS 64351..65169 product DUF2797 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483526.1 transl_table 11 codon_start 1 locus_tag LOCUS_05550 CDS complement(65231..66139) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312133.1 transl_table 11 codon_start 1 locus_tag LOCUS_05560 CDS 66299..67309 product D-cysteine desulfhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815232.1 transl_table 11 codon_start 1 locus_tag LOCUS_05570 CDS 67408..68721 product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728086.1 transl_table 11 codon_start 1 locus_tag LOCUS_05580 gene hisD CDS 68770..69978 product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125607.1 transl_table 11 codon_start 1 locus_tag LOCUS_05590 CDS 70059..71048 product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009565859.1 transl_table 11 codon_start 1 locus_tag LOCUS_05600 CDS 71148..71714 product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724859.1 transl_table 11 codon_start 1 locus_tag LOCUS_05610 CDS 71748..73028 product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331270.1 transl_table 11 codon_start 1 locus_tag LOCUS_05620 CDS 73117..73800 product aspartate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868491.1 transl_table 11 codon_start 1 locus_tag LOCUS_05630 CDS 73947..75209 product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071202.1 transl_table 11 codon_start 1 locus_tag LOCUS_05640 CDS 75372..76304 product hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250916.1 transl_table 11 codon_start 1 locus_tag LOCUS_05650 CDS 76760..78217 product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946820.1 transl_table 11 codon_start 1 locus_tag LOCUS_05660 CDS 78227..79054 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05670 CDS 79161..79406 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05680 CDS 79418..79876 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05690 CDS complement(79975..80151) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170387.1 transl_table 11 codon_start 1 locus_tag LOCUS_05700 CDS 80282..80458 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05710 CDS 80455..80772 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05720 CDS 80769..81194 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05730 CDS 81191..81799 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05740 CDS 81811..83199 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05750 CDS 84132..84584 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05760 CDS complement(84916..85236) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05770 tRNA complement(85423..85499) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00220 CDS complement(85652..87484) product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704782.1 transl_table 11 codon_start 1 locus_tag LOCUS_05780 gene rpoD CDS complement(87718..89496) product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704781.1 transl_table 11 codon_start 1 locus_tag LOCUS_05790 gene dnaG CDS complement(89575..90018) product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704780.1 transl_table 11 codon_start 1 locus_tag LOCUS_05800 CDS complement(90034..90249) product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001144069.1 transl_table 11 codon_start 1 locus_tag LOCUS_05810 gene rpsU CDS 90429..91445 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704779.1 transl_table 11 codon_start 1 locus_tag LOCUS_05820 gene tsaD CDS complement(91503..92111) product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016352149.1 transl_table 11 codon_start 1 locus_tag LOCUS_05830 gene plsY CDS 92231..92590 product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707547.1 transl_table 11 codon_start 1 locus_tag LOCUS_05840 gene folB CDS 92665..93468 product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262664.1 transl_table 11 codon_start 1 locus_tag LOCUS_05850 CDS complement(93465..94691) product multifunctional CCA addition/repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707495.1 transl_table 11 codon_start 1 locus_tag LOCUS_05860 CDS complement(94968..98135) product bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase PutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704727.1 transl_table 11 codon_start 1 locus_tag LOCUS_05870 gene putA CDS 98611..99567 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039214230.1 transl_table 11 codon_start 1 locus_tag LOCUS_05880 CDS complement(99653..100270) product TIGR04211 family SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455434.1 transl_table 11 codon_start 1 locus_tag LOCUS_05890 CDS complement(100381..101646) product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707483.1 transl_table 11 codon_start 1 locus_tag LOCUS_05900 CDS complement(101669..102349) product TIGR00153 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005305357.1 transl_table 11 codon_start 1 locus_tag LOCUS_05910 CDS 102518..104035 product inorganic triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000447090.1 transl_table 11 codon_start 1 locus_tag LOCUS_05920 CDS complement(104164..104496) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073543.1 transl_table 11 codon_start 1 locus_tag LOCUS_05930 CDS complement(104493..105122) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05940 CDS complement(105133..105546) product DUF2170 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007645549.1 transl_table 11 codon_start 1 locus_tag LOCUS_05950 CDS 105714..108593 product bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819368.1 transl_table 11 codon_start 1 locus_tag LOCUS_05960 gene glnE CDS 108617..108976 product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035765.1 transl_table 11 codon_start 1 locus_tag LOCUS_05970 CDS complement(109030..109953) product LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707479.1 transl_table 11 codon_start 1 locus_tag LOCUS_05980 gene lpxL CDS 110107..111534 product bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707478.1 transl_table 11 codon_start 1 locus_tag LOCUS_05990 gene hldE CDS complement(111615..112694) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038448.1 transl_table 11 codon_start 1 locus_tag LOCUS_06000 CDS complement(112691..114100) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038449.1 transl_table 11 codon_start 1 locus_tag LOCUS_06010 CDS complement(114097..114768) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038450.1 transl_table 11 codon_start 1 locus_tag LOCUS_06020 CDS 114893..115879 product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365605.1 transl_table 11 codon_start 1 locus_tag LOCUS_06030 CDS 115891..116325 product tripartite tricarboxylate transporter TctB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114175.1 transl_table 11 codon_start 1 locus_tag LOCUS_06040 CDS 116330..117853 product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098090.1 transl_table 11 codon_start 1 locus_tag LOCUS_06050 CDS 117850..118863 product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004192.1 transl_table 11 codon_start 1 locus_tag LOCUS_06060 CDS 119020..119235 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06070 CDS complement(119307..120608) product outer membrane channel protein TolC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024944694.1 transl_table 11 codon_start 1 locus_tag LOCUS_06080 gene tolC CDS 121089..121709 product ADP-ribose diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024943166.1 transl_table 11 codon_start 1 locus_tag LOCUS_06090 gene nudF CDS 121840..122283 product DUF1249 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005305333.1 transl_table 11 codon_start 1 locus_tag LOCUS_06100 CDS 122280..123152 product 3',5'-cyclic-AMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707475.1 transl_table 11 codon_start 1 locus_tag LOCUS_06110 gene cpdA CDS 123155..123724 product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707474.1 transl_table 11 codon_start 1 locus_tag LOCUS_06120 CDS 124367..126262 product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005305312.1 transl_table 11 codon_start 1 locus_tag LOCUS_06130 gene parE CDS 126276..128522 product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707468.1 transl_table 11 codon_start 1 locus_tag LOCUS_06140 gene parC CDS complement(128578..128994) product 8-oxo-dGTP diphosphatase MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016352173.1 transl_table 11 codon_start 1 locus_tag LOCUS_06150 gene mutT CDS complement(128984..129175) product DNA gyrase inhibitor YacG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005305661.1 transl_table 11 codon_start 1 locus_tag LOCUS_06160 gene yacG CDS complement(129172..129906) product cell division protein ZapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818895.1 transl_table 11 codon_start 1 locus_tag LOCUS_06170 gene zapD CDS complement(129958..131103) product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704790.1 transl_table 11 codon_start 1 locus_tag LOCUS_06180 gene hemW CDS complement(131103..131702) product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704791.1 transl_table 11 codon_start 1 locus_tag LOCUS_06190 CDS complement(131837..132250) product DUF4426 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707384.1 transl_table 11 codon_start 1 locus_tag LOCUS_06200 CDS complement(132373..132924) product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707386.1 transl_table 11 codon_start 1 locus_tag LOCUS_06210 CDS complement(132934..133755) product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707387.1 transl_table 11 codon_start 1 locus_tag LOCUS_06220 gene proC CDS complement(133766..134458) product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073222.1 transl_table 11 codon_start 1 locus_tag LOCUS_06230 CDS 134493..135527 product type IVa pilus ATPase TapT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707389.1 transl_table 11 codon_start 1 locus_tag LOCUS_06240 gene tapT CDS 135542..136654 product type IVa pilus ATPase TapU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707390.1 transl_table 11 codon_start 1 locus_tag LOCUS_06250 gene tapU CDS 136729..137502 product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005487639.1 transl_table 11 codon_start 1 locus_tag LOCUS_06260 gene yaaA CDS complement(138222..138380) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06270 CDS complement(138465..139829) product ATP-dependent RNA helicase SrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707392.1 transl_table 11 codon_start 1 locus_tag LOCUS_06280 gene srmB CDS 139900..140607 product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707393.1 transl_table 11 codon_start 1 locus_tag LOCUS_06290 CDS 140772..142076 product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707394.1 transl_table 11 codon_start 1 locus_tag LOCUS_06300 gene brnQ CDS 142332..143726 product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071311.1 transl_table 11 codon_start 1 locus_tag LOCUS_06310 CDS complement(143737..144252) product flavodoxin FldB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707047.1 transl_table 11 codon_start 1 locus_tag LOCUS_06320 gene fldB CDS 144328..145215 product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707046.1 transl_table 11 codon_start 1 locus_tag LOCUS_06330 gene xerD CDS 145589..147346 product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707042.1 transl_table 11 codon_start 1 locus_tag LOCUS_06340 gene recJ CDS 147703..148665 product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707133.1 transl_table 11 codon_start 1 locus_tag LOCUS_06350 gene prfB CDS 148928..150412 product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261233.1 transl_table 11 codon_start 1 locus_tag LOCUS_06360 gene lysS CDS complement(150689..150958) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06370 CDS complement(151304..152707) product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969340.1 transl_table 11 codon_start 1 locus_tag LOCUS_06380 CDS complement(152734..154245) product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969339.1 transl_table 11 codon_start 1 locus_tag LOCUS_06390 CDS complement(154887..155366) product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003525883.1 transl_table 11 codon_start 1 locus_tag LOCUS_06400 CDS complement(155403..156590) product ectoine hydrolase DoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252806.1 transl_table 11 codon_start 1 locus_tag LOCUS_06410 gene doeA CDS 157204..158490 product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482999.1 transl_table 11 codon_start 1 locus_tag LOCUS_06420 CDS complement(158521..158955) product PACE efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704738.1 transl_table 11 codon_start 1 locus_tag LOCUS_06430 CDS 159047..159937 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967943.1 transl_table 11 codon_start 1 locus_tag LOCUS_06440 CDS complement(159919..160830) product tRNA-modifying protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704740.1 transl_table 11 codon_start 1 locus_tag LOCUS_06450 gene ygfZ CDS 160957..161220 product succinate dehydrogenase assembly factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704741.1 transl_table 11 codon_start 1 locus_tag LOCUS_06460 CDS 161267..161572 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06470 CDS complement(162068..163699) product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704743.1 transl_table 11 codon_start 1 locus_tag LOCUS_06480 gene nadB CDS 163883..164461 product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005309371.1 transl_table 11 codon_start 1 locus_tag LOCUS_06490 gene rpoE CDS 164478..165041 product RseA family anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704744.1 transl_table 11 codon_start 1 locus_tag LOCUS_06500 CDS 165111..166028 product MucB/RseB C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349517.1 transl_table 11 codon_start 1 locus_tag LOCUS_06510 CDS 166025..166474 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06520 CDS 166554..168350 product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704747.1 transl_table 11 codon_start 1 locus_tag LOCUS_06530 gene lepA CDS 168353..169267 product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704748.1 transl_table 11 codon_start 1 locus_tag LOCUS_06540 gene lepB CDS 169267..169935 product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704749.1 transl_table 11 codon_start 1 locus_tag LOCUS_06550 gene rnc CDS 169932..170837 product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214829.1 transl_table 11 codon_start 1 locus_tag LOCUS_06560 gene era CDS 170846..171553 product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704751.1 transl_table 11 codon_start 1 locus_tag LOCUS_06570 gene recO CDS 171546..172283 product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704752.1 transl_table 11 codon_start 1 locus_tag LOCUS_06580 gene pdxJ CDS complement(172423..175119) product two-component sensor histidine kinase BarA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704764.1 transl_table 11 codon_start 1 locus_tag LOCUS_06590 gene barA CDS 175201..176517 product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704765.1 transl_table 11 codon_start 1 locus_tag LOCUS_06600 gene rlmD CDS 176527..178740 product GTP diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704766.1 transl_table 11 codon_start 1 locus_tag LOCUS_06610 gene relA CDS 178752..179552 product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704767.1 transl_table 11 codon_start 1 locus_tag LOCUS_06620 gene mazG CDS 179680..180135 product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704626.1 transl_table 11 codon_start 1 locus_tag LOCUS_06630 CDS complement(180152..181420) product CNNM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704627.1 transl_table 11 codon_start 1 locus_tag LOCUS_06640 CDS complement(181486..182274) product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704628.1 transl_table 11 codon_start 1 locus_tag LOCUS_06650 gene ccsA CDS 182419..183804 product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704629.1 transl_table 11 codon_start 1 locus_tag LOCUS_06660 gene ffh CDS 184024..184275 product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209458.1 transl_table 11 codon_start 1 locus_tag LOCUS_06670 gene rpsP CDS 184299..184820 product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704630.1 transl_table 11 codon_start 1 locus_tag LOCUS_06680 gene rimM CDS 184848..185597 product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704631.1 transl_table 11 codon_start 1 locus_tag LOCUS_06690 gene trmD CDS 185630..185992 product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006080791.1 transl_table 11 codon_start 1 locus_tag LOCUS_06700 gene rplS CDS complement(186428..187105) product DNA mismatch repair endonuclease MutH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704633.1 transl_table 11 codon_start 1 locus_tag LOCUS_06710 gene mutH CDS complement(187102..187401) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06720 CDS 187781..188293 product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704634.1 transl_table 11 codon_start 1 locus_tag LOCUS_06730 gene rppH CDS 188319..190577 product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704635.1 transl_table 11 codon_start 1 locus_tag LOCUS_06740 gene ptsP CDS 190828..191646 product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704636.1 transl_table 11 codon_start 1 locus_tag LOCUS_06750 gene lgt CDS 191643..192437 product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704637.1 transl_table 11 codon_start 1 locus_tag LOCUS_06760 gene thyA CDS 192625..193806 product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704638.1 transl_table 11 codon_start 1 locus_tag LOCUS_06770 gene nhaA CDS 193931..194875 product transcriptional activator NhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704639.1 transl_table 11 codon_start 1 locus_tag LOCUS_06780 gene nhaR CDS 194902..195219 product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349423.1 transl_table 11 codon_start 1 locus_tag LOCUS_06790 CDS complement(195301..195561) product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308808.1 transl_table 11 codon_start 1 locus_tag LOCUS_06800 gene rpsT CDS 195792..197315 product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261243.1 transl_table 11 codon_start 1 locus_tag LOCUS_06810 gene murJ CDS 197383..198330 product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704642.1 transl_table 11 codon_start 1 locus_tag LOCUS_06820 gene ribF CDS 198336..201161 product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704643.1 transl_table 11 codon_start 1 locus_tag LOCUS_06830 gene ileS CDS 201161..201649 product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704644.1 transl_table 11 codon_start 1 locus_tag LOCUS_06840 gene lspA CDS 201646..202098 product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704645.1 transl_table 11 codon_start 1 locus_tag LOCUS_06850 gene fkpB CDS 202109..203053 product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704646.1 transl_table 11 codon_start 1 locus_tag LOCUS_06860 gene ispH CDS complement(203416..203814) product type IV pilin protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704653.1 transl_table 11 codon_start 1 locus_tag LOCUS_06870 CDS 203907..204386 product GspH/FimT family pseudopilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704654.1 transl_table 11 codon_start 1 locus_tag LOCUS_06880 CDS 204380..205045 product type IV pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704655.1 transl_table 11 codon_start 1 locus_tag LOCUS_06890 CDS 205048..206202 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704656.1 transl_table 11 codon_start 1 locus_tag LOCUS_06900 CDS 206214..208307 product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704657.1 transl_table 11 codon_start 1 locus_tag LOCUS_06910 CDS 208387..210006 product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815768.1 transl_table 11 codon_start 1 locus_tag LOCUS_06920 CDS 210017..210355 product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308848.1 transl_table 11 codon_start 1 locus_tag LOCUS_06930 gene glnB CDS 210493..211002 product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704660.1 transl_table 11 codon_start 1 locus_tag LOCUS_06940 gene luxS CDS 211133..213481 product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704662.1 transl_table 11 codon_start 1 locus_tag LOCUS_06950 gene rnr CDS 213598..214335 product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704663.1 transl_table 11 codon_start 1 locus_tag LOCUS_06960 gene rlmB CDS 214424..215287 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819329.1 transl_table 11 codon_start 1 locus_tag LOCUS_06970 assembly_gap 215422..215441 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 215615..215983 product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308887.1 transl_table 11 codon_start 1 locus_tag LOCUS_06980 gene rpsF CDS 216011..216238 product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006083042.1 transl_table 11 codon_start 1 locus_tag LOCUS_06990 gene rpsR CDS 216278..216727 product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704669.1 transl_table 11 codon_start 1 locus_tag LOCUS_07000 gene rplI CDS 216823..217560 product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704670.1 transl_table 11 codon_start 1 locus_tag LOCUS_07010 CDS complement(217639..217857) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07020 CDS 217970..218902 product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051773499.1 transl_table 11 codon_start 1 locus_tag LOCUS_07030 CDS 218950..221757 product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704676.1 transl_table 11 codon_start 1 locus_tag LOCUS_07040 CDS 221831..223414 product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704677.1 transl_table 11 codon_start 1 locus_tag LOCUS_07050 gene gshA CDS 223972..224715 product helical backbone metal receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403682.1 transl_table 11 codon_start 1 locus_tag LOCUS_07060 CDS complement(224767..225513) product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017409782.1 transl_table 11 codon_start 1 locus_tag LOCUS_07070 CDS 225627..226607 product 23S rRNA pseudouridine(1911/1915/1917) synthase RluD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707736.1 transl_table 11 codon_start 1 locus_tag LOCUS_07080 gene rluD CDS 226598..227347 product purine nucleoside phosphorylase YfiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000040169.1 transl_table 11 codon_start 1 locus_tag LOCUS_07090 gene yfiH CDS 227457..230030 product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707734.1 transl_table 11 codon_start 1 locus_tag LOCUS_07100 gene clpB CDS complement(230076..231275) product NnrS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707628.1 transl_table 11 codon_start 1 locus_tag LOCUS_07110 sequence04 source 1..221735 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(10..86) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00230 tRNA complement(131..207) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00240 CDS 388..2490 product bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819954.1 transl_table 11 codon_start 1 locus_tag LOCUS_07120 gene rlmKL CDS 2490..2723 product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706136.1 transl_table 11 codon_start 1 locus_tag LOCUS_07130 CDS 2720..4621 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490212.1 transl_table 11 codon_start 1 locus_tag LOCUS_07140 CDS 5212..5388 product ribosome modulation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010674759.1 transl_table 11 codon_start 1 locus_tag LOCUS_07150 gene rmf CDS complement(5498..6028) product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706133.1 transl_table 11 codon_start 1 locus_tag LOCUS_07160 gene fabA CDS complement(6119..8074) product Lon protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706132.1 transl_table 11 codon_start 1 locus_tag LOCUS_07170 CDS complement(8217..8948) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07180 CDS 9148..9738 product biliverdin-producing heme oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162177622.1 transl_table 11 codon_start 1 locus_tag LOCUS_07190 CDS 9773..11860 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07200 CDS complement(12037..12984) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462366.1 transl_table 11 codon_start 1 locus_tag LOCUS_07210 CDS complement(13084..13887) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07220 CDS complement(13985..15154) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071370.1 transl_table 11 codon_start 1 locus_tag LOCUS_07230 CDS complement(15544..15786) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07240 CDS complement(16016..16321) product MTH1187 family thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942208.1 transl_table 11 codon_start 1 locus_tag LOCUS_07250 CDS 16901..18178 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07260 CDS 18461..18664 product transcription antiterminator/RNA stability regulator CspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004716300.1 transl_table 11 codon_start 1 locus_tag LOCUS_07270 gene cspE CDS complement(19043..19981) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07280 CDS complement(19984..20211) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07290 CDS 20771..20989 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07300 CDS complement(20884..22155) product NADH:flavin oxidoreductase/NADH oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244567.1 transl_table 11 codon_start 1 locus_tag LOCUS_07310 CDS complement(22235..22543) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104978.1 transl_table 11 codon_start 1 locus_tag LOCUS_07320 CDS complement(23019..23210) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07330 CDS 23243..23620 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07340 CDS 23649..24335 product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681373.1 transl_table 11 codon_start 1 locus_tag LOCUS_07350 CDS 24494..24904 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07360 CDS 25024..25242 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07370 CDS complement(25527..27062) product DUF4041 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000195116.1 transl_table 11 codon_start 1 locus_tag LOCUS_07380 CDS complement(28211..29506) product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706131.1 transl_table 11 codon_start 1 locus_tag LOCUS_07390 CDS complement(29682..30152) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07400 CDS 30458..31882 product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016350679.1 transl_table 11 codon_start 1 locus_tag LOCUS_07410 gene ccoN CDS 31895..32512 product cytochrome-c oxidase, cbb3-type subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005300783.1 transl_table 11 codon_start 1 locus_tag LOCUS_07420 gene ccoO CDS 32525..32743 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07430 CDS 32740..33714 product cytochrome-c oxidase, cbb3-type subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706147.1 transl_table 11 codon_start 1 locus_tag LOCUS_07440 gene ccoP CDS 33804..34289 product FixH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072347.1 transl_table 11 codon_start 1 locus_tag LOCUS_07450 CDS 34292..36661 product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706149.1 transl_table 11 codon_start 1 locus_tag LOCUS_07460 CDS 36658..36900 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07470 CDS 36884..37564 product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706150.1 transl_table 11 codon_start 1 locus_tag LOCUS_07480 CDS 37699..38445 product FNR family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477663.1 transl_table 11 codon_start 1 locus_tag LOCUS_07490 CDS 38479..39390 product universal stress protein UspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005300766.1 transl_table 11 codon_start 1 locus_tag LOCUS_07500 gene uspE CDS 39462..40415 product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706151.1 transl_table 11 codon_start 1 locus_tag LOCUS_07510 gene ttcA CDS complement(40723..41322) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07520 CDS complement(41319..42089) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029303065.1 transl_table 11 codon_start 1 locus_tag LOCUS_07530 CDS 42326..43492 product spermidine/putrescine ABC transporter ATP-binding protein PotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005495030.1 transl_table 11 codon_start 1 locus_tag LOCUS_07540 gene potA CDS 43479..44399 product spermidine/putrescine ABC transporter permease PotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261915.1 transl_table 11 codon_start 1 locus_tag LOCUS_07550 gene potB CDS 44392..45159 product spermidine/putrescine ABC transporter permease PotC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012968557.1 transl_table 11 codon_start 1 locus_tag LOCUS_07560 gene potC CDS 45161..46210 product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261916.1 transl_table 11 codon_start 1 locus_tag LOCUS_07570 CDS complement(46344..47060) product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706162.1 transl_table 11 codon_start 1 locus_tag LOCUS_07580 gene cobB CDS complement(47229..47534) product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005300715.1 transl_table 11 codon_start 1 locus_tag LOCUS_07590 gene ihfA CDS complement(47536..49923) product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706166.1 transl_table 11 codon_start 1 locus_tag LOCUS_07600 gene pheT CDS complement(50024..50791) product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706167.1 transl_table 11 codon_start 1 locus_tag LOCUS_07610 gene pheS note possible pseudo, frameshifted CDS complement(50946..51302) product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005300683.1 transl_table 11 codon_start 1 locus_tag LOCUS_07620 gene rplT CDS complement(51317..51511) product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072303.1 transl_table 11 codon_start 1 locus_tag LOCUS_07630 gene rpmI CDS complement(51587..52051) product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072302.1 transl_table 11 codon_start 1 locus_tag LOCUS_07640 gene infC CDS complement(52126..54060) product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706169.1 transl_table 11 codon_start 1 locus_tag LOCUS_07650 gene thrS CDS 54315..55304 product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455078.1 transl_table 11 codon_start 1 locus_tag LOCUS_07660 CDS 55313..56059 product pteridine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038530.1 transl_table 11 codon_start 1 locus_tag LOCUS_07670 CDS 56086..56289 product CPXCG motif-containing cysteine-rich protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005301298.1 transl_table 11 codon_start 1 locus_tag LOCUS_07680 CDS complement(56330..56935) product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210939.1 transl_table 11 codon_start 1 locus_tag LOCUS_07690 CDS 57098..58486 product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705975.1 transl_table 11 codon_start 1 locus_tag LOCUS_07700 CDS 58431..59465 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07710 tRNA 59557..59633 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00250 tRNA 59694..59770 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00260 tRNA 59830..59906 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00270 CDS complement(60126..61544) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040457.1 transl_table 11 codon_start 1 locus_tag LOCUS_07720 CDS complement(61531..61848) product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037402017.1 transl_table 11 codon_start 1 locus_tag LOCUS_07730 CDS complement(61852..62955) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808671.1 transl_table 11 codon_start 1 locus_tag LOCUS_07740 CDS complement(63001..63774) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705575.1 transl_table 11 codon_start 1 locus_tag LOCUS_07750 CDS complement(63880..64806) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089933.1 transl_table 11 codon_start 1 locus_tag LOCUS_07760 CDS 64996..66318 product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920685.1 transl_table 11 codon_start 1 locus_tag LOCUS_07770 CDS 67114..69036 product PrkA family serine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706273.1 transl_table 11 codon_start 1 locus_tag LOCUS_07780 CDS 69048..70328 product YeaH/YhbH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706274.1 transl_table 11 codon_start 1 locus_tag LOCUS_07790 CDS 70336..71856 product SpoVR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706275.1 transl_table 11 codon_start 1 locus_tag LOCUS_07800 CDS complement(71902..72615) product fatty acid metabolism transcriptional regulator FadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706276.1 transl_table 11 codon_start 1 locus_tag LOCUS_07810 gene fadR CDS 72739..73260 product disulfide bond formation protein DsbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706278.1 transl_table 11 codon_start 1 locus_tag LOCUS_07820 gene dsbB CDS complement(73425..73859) product YcgN family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005300228.1 transl_table 11 codon_start 1 locus_tag LOCUS_07830 CDS complement(73864..74526) product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096147.1 transl_table 11 codon_start 1 locus_tag LOCUS_07840 CDS complement(74567..74848) product YcgL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366056.1 transl_table 11 codon_start 1 locus_tag LOCUS_07850 CDS 74954..75637 product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705993.1 transl_table 11 codon_start 1 locus_tag LOCUS_07860 gene minC CDS 75661..76473 product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705992.1 transl_table 11 codon_start 1 locus_tag LOCUS_07870 gene minD CDS 76477..76785 product cell division topological specificity factor MinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705991.1 transl_table 11 codon_start 1 locus_tag LOCUS_07880 gene minE CDS complement(76827..77921) product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171280573.1 transl_table 11 codon_start 1 locus_tag LOCUS_07890 gene rnd CDS complement(77975..79684) product long-chain-fatty-acid--CoA ligase FadD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706061.1 transl_table 11 codon_start 1 locus_tag LOCUS_07900 gene fadD CDS complement(79984..80673) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816515.1 transl_table 11 codon_start 1 locus_tag LOCUS_07910 gene tsaB CDS complement(80681..82612) product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706056.1 transl_table 11 codon_start 1 locus_tag LOCUS_07920 CDS 82766..82921 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07930 CDS complement(83328..84050) product divalent cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922379.1 transl_table 11 codon_start 1 locus_tag LOCUS_07940 CDS complement(84092..84268) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07950 CDS 84185..84919 product tRNA (adenine(22)-N(1))-methyltransferase TrmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000765958.1 transl_table 11 codon_start 1 locus_tag LOCUS_07960 CDS 85075..86451 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038874.1 transl_table 11 codon_start 1 locus_tag LOCUS_07970 CDS complement(86675..86818) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07980 CDS complement(86827..88059) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07990 CDS 88588..89586 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08000 CDS 89656..91587 product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925163.1 transl_table 11 codon_start 1 locus_tag LOCUS_08010 CDS 91764..92645 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004407856.1 transl_table 11 codon_start 1 locus_tag LOCUS_08020 CDS 93073..93975 product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706053.1 transl_table 11 codon_start 1 locus_tag LOCUS_08030 gene hisG CDS 93979..95271 product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001261310.1 transl_table 11 codon_start 1 locus_tag LOCUS_08040 gene hisD CDS 95268..96326 product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706051.1 transl_table 11 codon_start 1 locus_tag LOCUS_08050 gene hisC CDS 96327..97412 product bifunctional histidinol-phosphatase/imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261648.1 transl_table 11 codon_start 1 locus_tag LOCUS_08060 gene hisB CDS 97409..98011 product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261649.1 transl_table 11 codon_start 1 locus_tag LOCUS_08070 gene hisH CDS 98012..98749 product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706048.1 transl_table 11 codon_start 1 locus_tag LOCUS_08080 gene hisA CDS 98731..99504 product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000880146.1 transl_table 11 codon_start 1 locus_tag LOCUS_08090 gene hisF CDS 99497..100120 product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706043.1 transl_table 11 codon_start 1 locus_tag LOCUS_08100 gene hisIE CDS complement(100450..101361) product M14 family metallocarboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037185.1 transl_table 11 codon_start 1 locus_tag LOCUS_08110 CDS complement(101525..102340) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08120 CDS 102434..102613 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08130 CDS complement(102755..103087) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08140 CDS complement(103256..103966) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08150 CDS complement(104160..104681) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08160 CDS 104765..104944 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08170 CDS 105639..106073 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08180 note possible pseudo, internal stop codon CDS complement(106143..106367) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08190 CDS complement(106543..108126) product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110915.1 transl_table 11 codon_start 1 locus_tag LOCUS_08200 CDS 108699..109604 product DNA replication terminus site-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706671.1 transl_table 11 codon_start 1 locus_tag LOCUS_08210 CDS 109899..111101 product Bcr/CflA family multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706371.1 transl_table 11 codon_start 1 locus_tag LOCUS_08220 CDS 111197..112387 product aspartate/tyrosine/aromatic aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000462147.1 transl_table 11 codon_start 1 locus_tag LOCUS_08230 CDS 112663..113949 product paraquat-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457979.1 transl_table 11 codon_start 1 locus_tag LOCUS_08240 CDS 113942..115579 product intermembrane transport protein PqiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457973.1 transl_table 11 codon_start 1 locus_tag LOCUS_08250 gene pqiB CDS 115576..116199 product membrane integrity-associated transporter subunit PqiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000805968.1 transl_table 11 codon_start 1 locus_tag LOCUS_08260 CDS complement(116302..117465) product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886857.1 transl_table 11 codon_start 1 locus_tag LOCUS_08270 CDS complement(117674..117961) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08280 CDS complement(118109..118663) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08290 CDS complement(118818..118985) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08300 CDS 118971..119132 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08310 CDS 119643..120200 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08320 CDS complement(120250..120441) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08330 CDS complement(120461..120826) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08340 CDS 121015..121515 product cyclin-dependent kinase inhibitor 3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262753.1 transl_table 11 codon_start 1 locus_tag LOCUS_08350 CDS complement(121704..123017) product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902956.1 transl_table 11 codon_start 1 locus_tag LOCUS_08360 CDS complement(123042..124154) product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388524.1 transl_table 11 codon_start 1 locus_tag LOCUS_08370 CDS complement(124256..125167) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262119.1 transl_table 11 codon_start 1 locus_tag LOCUS_08380 CDS 125334..126005 product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704391.1 transl_table 11 codon_start 1 locus_tag LOCUS_08390 CDS 126147..126584 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08400 CDS complement(126604..129309) product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207762468.1 transl_table 11 codon_start 1 locus_tag LOCUS_08410 CDS complement(129416..129823) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08420 CDS complement(129856..130464) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08430 CDS complement(130775..131677) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261970.1 transl_table 11 codon_start 1 locus_tag LOCUS_08440 CDS 131849..132658 product putative hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261969.1 transl_table 11 codon_start 1 locus_tag LOCUS_08450 CDS 132675..133454 product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261968.1 transl_table 11 codon_start 1 locus_tag LOCUS_08460 CDS 133451..134197 product 5-oxoprolinase subunit PxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065610322.1 transl_table 11 codon_start 1 locus_tag LOCUS_08470 gene pxpB CDS 134194..135168 product biotin-dependent carboxyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261966.1 transl_table 11 codon_start 1 locus_tag LOCUS_08480 CDS 135399..136553 product divalent metal cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261965.1 transl_table 11 codon_start 1 locus_tag LOCUS_08490 CDS complement(136714..137067) product DUF1622 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_199254442.1 transl_table 11 codon_start 1 locus_tag LOCUS_08500 CDS complement(137167..137718) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08510 CDS complement(137735..137971) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08520 CDS complement(138260..138973) product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819653.1 transl_table 11 codon_start 1 locus_tag LOCUS_08530 CDS complement(139057..140463) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071592.1 transl_table 11 codon_start 1 locus_tag LOCUS_08540 CDS complement(140673..141011) product zinc ribbon domain-containing protein YjdM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261944.1 transl_table 11 codon_start 1 locus_tag LOCUS_08550 CDS complement(141235..141885) product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070529.1 transl_table 11 codon_start 1 locus_tag LOCUS_08560 CDS complement(141959..142192) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08570 CDS complement(142202..143092) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011857652.1 transl_table 11 codon_start 1 locus_tag LOCUS_08580 CDS 143263..144285 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193566.1 transl_table 11 codon_start 1 locus_tag LOCUS_08590 CDS 144463..145245 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000759079.1 transl_table 11 codon_start 1 locus_tag LOCUS_08600 CDS complement(145408..146103) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08610 CDS complement(146217..148274) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08620 CDS complement(148271..148714) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08630 CDS complement(148711..149532) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08640 CDS 149624..150145 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08650 CDS 150106..150645 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08660 CDS 151987..153753 product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258461.1 transl_table 11 codon_start 1 locus_tag LOCUS_08670 CDS complement(154235..158686) product chromosome partition protein MukB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706219.1 transl_table 11 codon_start 1 locus_tag LOCUS_08680 gene mukB CDS complement(158683..159354) product chromosome partition protein MukE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706220.1 transl_table 11 codon_start 1 locus_tag LOCUS_08690 gene mukE CDS complement(159335..160660) product chromosome partition protein MukF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706221.1 transl_table 11 codon_start 1 locus_tag LOCUS_08700 gene mukF CDS complement(160949..161743) product tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706222.1 transl_table 11 codon_start 1 locus_tag LOCUS_08710 gene cmoM CDS 161815..162603 product envelope biogenesis factor ElyC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000462426.1 transl_table 11 codon_start 1 locus_tag LOCUS_08720 gene elyC CDS 162925..163677 product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706224.1 transl_table 11 codon_start 1 locus_tag LOCUS_08730 gene tpiA CDS 163886..164848 product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706225.1 transl_table 11 codon_start 1 locus_tag LOCUS_08740 gene pfkA CDS 165065..165799 product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454206.1 transl_table 11 codon_start 1 locus_tag LOCUS_08750 CDS 165915..166496 product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000141550.1 transl_table 11 codon_start 1 locus_tag LOCUS_08760 gene rsxA CDS 166498..167052 product electron transport complex subunit RsxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706450.1 transl_table 11 codon_start 1 locus_tag LOCUS_08770 gene rsxB CDS 167054..169405 product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706451.1 transl_table 11 codon_start 1 locus_tag LOCUS_08780 gene rsxC CDS 169405..170454 product electron transport complex subunit RsxD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706452.1 transl_table 11 codon_start 1 locus_tag LOCUS_08790 gene rsxD CDS 170454..171086 product electron transport complex subunit RsxG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706453.1 transl_table 11 codon_start 1 locus_tag LOCUS_08800 gene rsxG CDS 171083..171778 product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480817.1 transl_table 11 codon_start 1 locus_tag LOCUS_08810 CDS 171775..172416 product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706455.1 transl_table 11 codon_start 1 locus_tag LOCUS_08820 gene nth CDS 172474..172881 product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706456.1 transl_table 11 codon_start 1 locus_tag LOCUS_08830 gene gloA CDS complement(173139..174113) product HTH-type transcriptional regulator CysB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010634254.1 transl_table 11 codon_start 1 locus_tag LOCUS_08840 gene cysB CDS 174316..174861 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162517116.1 transl_table 11 codon_start 1 locus_tag LOCUS_08850 CDS complement(174946..176190) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705687.1 transl_table 11 codon_start 1 locus_tag LOCUS_08860 CDS 176280..177188 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705688.1 transl_table 11 codon_start 1 locus_tag LOCUS_08870 CDS 177210..177794 product DUF2796 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707298.1 transl_table 11 codon_start 1 locus_tag LOCUS_08880 CDS 177801..178487 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707299.1 transl_table 11 codon_start 1 locus_tag LOCUS_08890 CDS 178481..179728 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707300.1 transl_table 11 codon_start 1 locus_tag LOCUS_08900 CDS 179746..180228 product DUF3299 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707301.1 transl_table 11 codon_start 1 locus_tag LOCUS_08910 CDS complement(180458..181651) product S-methyl-5-thioribose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816942.1 transl_table 11 codon_start 1 locus_tag LOCUS_08920 gene mtnK CDS 181867..182457 product RNA polymerase factor sigma-70 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206317.1 transl_table 11 codon_start 1 locus_tag LOCUS_08930 CDS 182451..182669 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08940 CDS 182680..183681 product arsenosugar biosynthesis radical SAM protein ArsS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140889.1 transl_table 11 codon_start 1 locus_tag LOCUS_08950 gene arsS CDS 183687..184352 product TIGR04283 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403947.1 transl_table 11 codon_start 1 locus_tag LOCUS_08960 CDS 184349..185002 product TIGR04282 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113134.1 transl_table 11 codon_start 1 locus_tag LOCUS_08970 CDS 184986..185789 product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453865.1 transl_table 11 codon_start 1 locus_tag LOCUS_08980 CDS 186227..187168 product tRNA dihydrouridine(16) synthase DusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706065.1 transl_table 11 codon_start 1 locus_tag LOCUS_08990 gene dusC CDS 187395..187766 product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706064.1 transl_table 11 codon_start 1 locus_tag LOCUS_09000 CDS complement(188012..189121) product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706590.1 transl_table 11 codon_start 1 locus_tag LOCUS_09010 CDS 189350..191485 product ATP-dependent DNA helicase DinG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818171.1 transl_table 11 codon_start 1 locus_tag LOCUS_09020 gene dinG CDS 191698..192678 product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703864.1 transl_table 11 codon_start 1 locus_tag LOCUS_09030 CDS 192777..193409 product DUF2057 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706592.1 transl_table 11 codon_start 1 locus_tag LOCUS_09040 CDS complement(193486..194022) product DUF924 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460763.1 transl_table 11 codon_start 1 locus_tag LOCUS_09050 CDS complement(194341..195708) product YjiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704871.1 transl_table 11 codon_start 1 locus_tag LOCUS_09060 CDS complement(196048..196701) product thiopurine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705866.1 transl_table 11 codon_start 1 locus_tag LOCUS_09070 CDS complement(196770..196967) product DUF4250 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005300391.1 transl_table 11 codon_start 1 locus_tag LOCUS_09080 CDS 197273..197728 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09090 CDS complement(197813..198214) product phosphate-starvation-inducible PsiE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072739.1 transl_table 11 codon_start 1 locus_tag LOCUS_09100 CDS 198630..200114 product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263860.1 transl_table 11 codon_start 1 locus_tag LOCUS_09110 CDS 200127..200981 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813546.1 transl_table 11 codon_start 1 locus_tag LOCUS_09120 CDS complement(201091..202683) product ABC-F family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705884.1 transl_table 11 codon_start 1 locus_tag LOCUS_09130 CDS 203324..204127 product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143634.1 transl_table 11 codon_start 1 locus_tag LOCUS_09140 gene cysQ CDS complement(204298..205158) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093974.1 transl_table 11 codon_start 1 locus_tag LOCUS_09150 CDS 205425..205874 product YbjN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029301206.1 transl_table 11 codon_start 1 locus_tag LOCUS_09160 tRNA 206018..206105 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00280 CDS 206295..206933 product 2OG-Fe(II) oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819905.1 transl_table 11 codon_start 1 locus_tag LOCUS_09170 CDS 207124..208788 product asparagine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706472.1 transl_table 11 codon_start 1 locus_tag LOCUS_09180 gene asnB CDS complement(208840..210876) product exodeoxyribonuclease V subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103277.1 transl_table 11 codon_start 1 locus_tag LOCUS_09190 gene recD CDS complement(210863..214621) product exodeoxyribonuclease V subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266564.1 transl_table 11 codon_start 1 locus_tag LOCUS_09200 gene recB CDS complement(214618..218025) product exodeoxyribonuclease V subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266563.1 transl_table 11 codon_start 1 locus_tag LOCUS_09210 gene recC CDS complement(218356..219342) product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071191.1 transl_table 11 codon_start 1 locus_tag LOCUS_09220 CDS complement(219600..220427) product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922504.1 transl_table 11 codon_start 1 locus_tag LOCUS_09230 CDS complement(220439..221434) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09240 sequence05 source 1..189384 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1087 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005477133.1:choline dehydrogenase locus_tag LOCUS_09250 CDS 1333..2208 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975006.1 transl_table 11 codon_start 1 locus_tag LOCUS_09260 CDS complement(2226..3527) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967861.1 transl_table 11 codon_start 1 locus_tag LOCUS_09270 CDS complement(3546..4310) product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392379.1 transl_table 11 codon_start 1 locus_tag LOCUS_09280 gene proC CDS 4736..4948 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09290 CDS 5023..5556 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09300 CDS 7193..7402 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09310 CDS complement(7735..8304) product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114652.1 transl_table 11 codon_start 1 locus_tag LOCUS_09320 CDS complement(8289..8825) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09330 CDS complement(8880..9626) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09340 CDS complement(10103..10891) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114449.1 transl_table 11 codon_start 1 locus_tag LOCUS_09350 CDS complement(10881..12119) product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114448.1 transl_table 11 codon_start 1 locus_tag LOCUS_09360 CDS complement(12112..14073) product dimethylglycine demethylation protein DgcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463891.1 transl_table 11 codon_start 1 locus_tag LOCUS_09370 gene dgcB CDS complement(14120..16180) product dimethylglycine demethylation protein DgcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114446.1 transl_table 11 codon_start 1 locus_tag LOCUS_09380 gene dgcA CDS complement(16389..16919) product DUF5943 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107282.1 transl_table 11 codon_start 1 locus_tag LOCUS_09390 CDS complement(16951..17931) product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114445.1 transl_table 11 codon_start 1 locus_tag LOCUS_09400 CDS 17955..18113 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09410 CDS complement(18133..19185) product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763696.1 transl_table 11 codon_start 1 locus_tag LOCUS_09420 CDS complement(19282..19677) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09430 CDS complement(19725..21347) product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707434.1 transl_table 11 codon_start 1 locus_tag LOCUS_09440 CDS 21781..22959 product gamma-butyrobetaine dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531043.1 transl_table 11 codon_start 1 locus_tag LOCUS_09450 CDS complement(22983..24008) product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435534.1 transl_table 11 codon_start 1 locus_tag LOCUS_09460 CDS complement(24072..25748) product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707434.1 transl_table 11 codon_start 1 locus_tag LOCUS_09470 CDS complement(25867..26835) product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030804.1 transl_table 11 codon_start 1 locus_tag LOCUS_09480 CDS complement(26883..27773) product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030805.1 transl_table 11 codon_start 1 locus_tag LOCUS_09490 CDS complement(28016..29407) product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831122.1 transl_table 11 codon_start 1 locus_tag LOCUS_09500 CDS complement(29534..30352) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969812.1 transl_table 11 codon_start 1 locus_tag LOCUS_09510 CDS complement(30723..31679) product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402189.1 transl_table 11 codon_start 1 locus_tag LOCUS_09520 CDS 31865..32347 product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966456.1 transl_table 11 codon_start 1 locus_tag LOCUS_09530 CDS 32566..34518 product acetoacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113499.1 transl_table 11 codon_start 1 locus_tag LOCUS_09540 CDS complement(34602..35900) product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870182.1 transl_table 11 codon_start 1 locus_tag LOCUS_09550 CDS complement(35902..36426) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09560 CDS complement(36496..37503) product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395802.1 transl_table 11 codon_start 1 locus_tag LOCUS_09570 CDS 37875..38102 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09580 CDS complement(38139..39413) product glycine-betaine demethylase subunit GbcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269222.1 transl_table 11 codon_start 1 locus_tag LOCUS_09590 gene gbcA CDS 39708..40814 product glycine-betaine demethylase subunit GbcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096769.1 transl_table 11 codon_start 1 locus_tag LOCUS_09600 gene gbcB CDS complement(41439..41570) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09610 CDS complement(41679..42929) product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969412.1 transl_table 11 codon_start 1 locus_tag LOCUS_09620 CDS complement(43145..44431) product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071202.1 transl_table 11 codon_start 1 locus_tag LOCUS_09630 CDS complement(44745..46166) product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943381.1 transl_table 11 codon_start 1 locus_tag LOCUS_09640 CDS complement(46166..47854) product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943382.1 transl_table 11 codon_start 1 locus_tag LOCUS_09650 CDS complement(47851..48768) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768341.1 transl_table 11 codon_start 1 locus_tag LOCUS_09660 CDS 49040..49762 product amino acid racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262121.1 transl_table 11 codon_start 1 locus_tag LOCUS_09670 CDS complement(49948..51345) product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096822.1 transl_table 11 codon_start 1 locus_tag LOCUS_09680 gene aspA CDS 51536..52348 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113730.1 transl_table 11 codon_start 1 locus_tag LOCUS_09690 CDS 52428..52700 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000937852.1 transl_table 11 codon_start 1 locus_tag LOCUS_09700 CDS complement(52770..55625) product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527515.1 transl_table 11 codon_start 1 locus_tag LOCUS_09710 gene fdhF CDS complement(55629..57176) product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064348.1 transl_table 11 codon_start 1 locus_tag LOCUS_09720 CDS complement(57176..57685) product formate dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040335.1 transl_table 11 codon_start 1 locus_tag LOCUS_09730 CDS complement(57829..59028) product formaldehyde dehydrogenase, glutathione-independent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118811.1 transl_table 11 codon_start 1 locus_tag LOCUS_09740 gene fdhA CDS 59372..59530 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09750 CDS complement(59596..60348) product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058294.1 transl_table 11 codon_start 1 locus_tag LOCUS_09760 CDS complement(60345..61631) product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113810.1 transl_table 11 codon_start 1 locus_tag LOCUS_09770 CDS complement(61628..62101) product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113811.1 transl_table 11 codon_start 1 locus_tag LOCUS_09780 CDS complement(62146..63174) product TRAP transporter substrate-binding protein DctP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113812.1 transl_table 11 codon_start 1 locus_tag LOCUS_09790 gene dctP CDS complement(63304..64209) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092728.1 transl_table 11 codon_start 1 locus_tag LOCUS_09800 CDS 64465..65613 product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723610.1 transl_table 11 codon_start 1 locus_tag LOCUS_09810 CDS 65707..66426 product two-component system response regulator AruR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095718.1 transl_table 11 codon_start 1 locus_tag LOCUS_09820 gene aruR CDS 66417..67184 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09830 CDS 67185..69443 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019372340.1 transl_table 11 codon_start 1 locus_tag LOCUS_09840 CDS 69581..71056 product Na+/H+ antiporter NhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338014.1 transl_table 11 codon_start 1 locus_tag LOCUS_09850 gene nhaC CDS 71535..71801 product DksA/TraR family C4-type zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112314.1 transl_table 11 codon_start 1 locus_tag LOCUS_09860 CDS 71881..72351 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09870 CDS complement(72394..73164) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814657.1 transl_table 11 codon_start 1 locus_tag LOCUS_09880 CDS complement(73161..74234) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972996.1 transl_table 11 codon_start 1 locus_tag LOCUS_09890 CDS complement(74231..75346) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014527856.1 transl_table 11 codon_start 1 locus_tag LOCUS_09900 CDS 75567..76952 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072757.1 transl_table 11 codon_start 1 locus_tag LOCUS_09910 CDS complement(77041..77820) product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948022.1 transl_table 11 codon_start 1 locus_tag LOCUS_09920 CDS complement(77855..79045) product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258192.1 transl_table 11 codon_start 1 locus_tag LOCUS_09930 CDS complement(79070..79225) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09940 CDS complement(79237..79887) product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930386.1 transl_table 11 codon_start 1 locus_tag LOCUS_09950 CDS complement(79952..81034) product TRAP transporter substrate-binding protein DctP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810897.1 transl_table 11 codon_start 1 locus_tag LOCUS_09960 gene dctP CDS complement(81268..82491) product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529357.1 transl_table 11 codon_start 1 locus_tag LOCUS_09970 CDS complement(82461..82652) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09980 CDS 82796..83653 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921339.1 transl_table 11 codon_start 1 locus_tag LOCUS_09990 CDS complement(83671..84555) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065702830.1 transl_table 11 codon_start 1 locus_tag LOCUS_10000 CDS 84749..86161 product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100479.1 transl_table 11 codon_start 1 locus_tag LOCUS_10010 CDS 86472..87710 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532349.1 transl_table 11 codon_start 1 locus_tag LOCUS_10020 CDS complement(87796..89259) product sodium/pantothenate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005647973.1 transl_table 11 codon_start 1 locus_tag LOCUS_10030 gene panF CDS complement(89308..89472) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10040 CDS complement(89618..90829) product M24 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336960.1 transl_table 11 codon_start 1 locus_tag LOCUS_10050 CDS complement(90997..91371) product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261207.1 transl_table 11 codon_start 1 locus_tag LOCUS_10060 CDS 91576..93282 product phosphoethanolamine--lipid A transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705420.1 transl_table 11 codon_start 1 locus_tag LOCUS_10070 CDS complement(93264..94517) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094037.1 transl_table 11 codon_start 1 locus_tag LOCUS_10080 CDS complement(94519..95193) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094039.1 transl_table 11 codon_start 1 locus_tag LOCUS_10090 CDS complement(95203..95937) product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706567.1 transl_table 11 codon_start 1 locus_tag LOCUS_10100 gene lpxH CDS complement(96013..96510) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005302674.1 transl_table 11 codon_start 1 locus_tag LOCUS_10110 CDS 96664..98043 product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478905.1 transl_table 11 codon_start 1 locus_tag LOCUS_10120 gene cysS CDS 98169..98456 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10130 CDS 98772..99116 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10140 CDS complement(99339..100157) product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418550.1 transl_table 11 codon_start 1 locus_tag LOCUS_10150 CDS complement(100192..101049) product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705731.1 transl_table 11 codon_start 1 locus_tag LOCUS_10160 gene folD tRNA 101234..101310 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00290 tRNA 101317..101392 product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00300 CDS complement(101534..101929) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10170 CDS complement(102391..103404) product TIGR01620 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705757.1 transl_table 11 codon_start 1 locus_tag LOCUS_10180 CDS complement(103401..104756) product YcjX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819824.1 transl_table 11 codon_start 1 locus_tag LOCUS_10190 CDS complement(104831..105220) product envelope stress response membrane protein PspC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024941345.1 transl_table 11 codon_start 1 locus_tag LOCUS_10200 gene pspC CDS complement(105205..105438) product envelope stress response membrane protein PspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005300084.1 transl_table 11 codon_start 1 locus_tag LOCUS_10210 gene pspB CDS complement(105438..106103) product phage shock protein PspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705754.1 transl_table 11 codon_start 1 locus_tag LOCUS_10220 gene pspA CDS 106310..107311 product phage shock protein operon transcriptional activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705753.1 transl_table 11 codon_start 1 locus_tag LOCUS_10230 gene pspF CDS 107314..108915 product peptide ABC transporter substrate-binding protein SapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819989.1 transl_table 11 codon_start 1 locus_tag LOCUS_10240 gene sapA CDS 108918..109880 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705751.1 transl_table 11 codon_start 1 locus_tag LOCUS_10250 CDS 109864..110757 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705750.1 transl_table 11 codon_start 1 locus_tag LOCUS_10260 CDS 110757..111758 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705749.1 transl_table 11 codon_start 1 locus_tag LOCUS_10270 CDS 111755..112561 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705748.1 transl_table 11 codon_start 1 locus_tag LOCUS_10280 CDS complement(112795..113571) product tRNA isopentenyl-2-thiomethyl-A-37 hydroxylase MiaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705747.1 transl_table 11 codon_start 1 locus_tag LOCUS_10290 gene miaE CDS 113861..114280 product D-ribose pyranase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706155.1 transl_table 11 codon_start 1 locus_tag LOCUS_10300 gene rbsD CDS 114288..115790 product ribose ABC transporter ATP-binding protein RbsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180345411.1 transl_table 11 codon_start 1 locus_tag LOCUS_10310 gene rbsA CDS 115787..116752 product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001891150.1 transl_table 11 codon_start 1 locus_tag LOCUS_10320 gene rbsC CDS 116786..117667 product ribose ABC transporter substrate-binding protein RbsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463703.1 transl_table 11 codon_start 1 locus_tag LOCUS_10330 gene rbsB CDS 117749..118660 product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815255.1 transl_table 11 codon_start 1 locus_tag LOCUS_10340 gene rbsK CDS 118660..119661 product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262036.1 transl_table 11 codon_start 1 locus_tag LOCUS_10350 CDS 119775..120650 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10360 CDS 120734..121270 product septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707244.1 transl_table 11 codon_start 1 locus_tag LOCUS_10370 CDS 121352..121651 product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707245.1 transl_table 11 codon_start 1 locus_tag LOCUS_10380 CDS 121816..122106 product ComEA family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001166105.1 transl_table 11 codon_start 1 locus_tag LOCUS_10390 CDS 122208..123113 product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818749.1 transl_table 11 codon_start 1 locus_tag LOCUS_10400 gene galU CDS complement(123138..124187) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10410 CDS 124251..124931 product DnaT-like ssDNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707252.1 transl_table 11 codon_start 1 locus_tag LOCUS_10420 CDS 124915..125760 product DnaA/Hda family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707253.1 transl_table 11 codon_start 1 locus_tag LOCUS_10430 CDS 125862..128675 product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196173418.1 transl_table 11 codon_start 1 locus_tag LOCUS_10440 CDS complement(128762..129004) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10450 CDS complement(129009..129404) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10460 CDS complement(129536..129847) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10470 CDS complement(130041..130514) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10480 CDS complement(130635..131024) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10490 CDS complement(131242..134124) product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705609.1 transl_table 11 codon_start 1 locus_tag LOCUS_10500 gene gcvP CDS complement(134401..134889) product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010634317.1 transl_table 11 codon_start 1 locus_tag LOCUS_10510 gene gcvH CDS complement(134823..135926) product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705608.1 transl_table 11 codon_start 1 locus_tag LOCUS_10520 gene gcvT CDS complement(136247..137458) product FAD-dependent 2-octaprenylphenol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481236.1 transl_table 11 codon_start 1 locus_tag LOCUS_10530 CDS complement(137462..138652) product 2-octaprenyl-6-methoxyphenyl hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705606.1 transl_table 11 codon_start 1 locus_tag LOCUS_10540 gene ubiH CDS complement(138671..139237) product UPF0149 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705605.1 transl_table 11 codon_start 1 locus_tag LOCUS_10550 CDS 139389..139688 product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016350376.1 transl_table 11 codon_start 1 locus_tag LOCUS_10560 gene zapA CDS 140016..140246 product VF530 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417766.1 transl_table 11 codon_start 1 locus_tag LOCUS_10570 CDS 140537..141115 product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706539.1 transl_table 11 codon_start 1 locus_tag LOCUS_10580 CDS 141589..142248 product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706540.1 transl_table 11 codon_start 1 locus_tag LOCUS_10590 gene rpiA CDS complement(142286..143350) product molybdenum ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925958.1 transl_table 11 codon_start 1 locus_tag LOCUS_10600 gene modC CDS complement(143347..144030) product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064503.1 transl_table 11 codon_start 1 locus_tag LOCUS_10610 gene modB CDS complement(144055..144792) product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113613.1 transl_table 11 codon_start 1 locus_tag LOCUS_10620 gene modA CDS 144996..145787 product molybdenum-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168058.1 transl_table 11 codon_start 1 locus_tag LOCUS_10630 gene modE CDS complement(146324..149038) product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105996.1 transl_table 11 codon_start 1 locus_tag LOCUS_10640 gene acnA CDS complement(149142..149324) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10650 CDS 149323..150225 product 30S ribosomal protein S6--L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000689982.1 transl_table 11 codon_start 1 locus_tag LOCUS_10660 gene rimK CDS 150225..151244 product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455969.1 transl_table 11 codon_start 1 locus_tag LOCUS_10670 CDS complement(151288..152517) product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024946386.1 transl_table 11 codon_start 1 locus_tag LOCUS_10680 gene serA CDS complement(152680..153393) product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037741.1 transl_table 11 codon_start 1 locus_tag LOCUS_10690 CDS complement(153449..153943) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10700 CDS complement(153991..157650) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10710 CDS complement(157775..159685) product LapD/MoxY N-terminal periplasmic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706510.1 transl_table 11 codon_start 1 locus_tag LOCUS_10720 CDS complement(159688..160374) product transglutaminase-like cysteine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263954.1 transl_table 11 codon_start 1 locus_tag LOCUS_10730 CDS complement(160374..160973) product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000023794.1 transl_table 11 codon_start 1 locus_tag LOCUS_10740 CDS complement(161002..162315) product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706511.1 transl_table 11 codon_start 1 locus_tag LOCUS_10750 CDS complement(162337..163722) product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706512.1 transl_table 11 codon_start 1 locus_tag LOCUS_10760 CDS complement(163715..165859) product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706513.1 transl_table 11 codon_start 1 locus_tag LOCUS_10770 CDS complement(166062..167141) product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704732.1 transl_table 11 codon_start 1 locus_tag LOCUS_10780 gene fbaA CDS complement(167211..168374) product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209963.1 transl_table 11 codon_start 1 locus_tag LOCUS_10790 gene pgk CDS complement(168408..169427) product erythrose-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010635047.1 transl_table 11 codon_start 1 locus_tag LOCUS_10800 gene epd CDS complement(169606..169812) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10810 CDS complement(169868..171253) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387979.1 transl_table 11 codon_start 1 locus_tag LOCUS_10820 CDS complement(171463..173634) product malate synthase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113258.1 transl_table 11 codon_start 1 locus_tag LOCUS_10830 CDS complement(174019..174729) product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005334097.1 transl_table 11 codon_start 1 locus_tag LOCUS_10840 gene phoU CDS complement(174741..175559) product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706615.1 transl_table 11 codon_start 1 locus_tag LOCUS_10850 gene pstB CDS complement(175593..177203) product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706616.1 transl_table 11 codon_start 1 locus_tag LOCUS_10860 gene pstA CDS complement(177257..179500) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706617.1 transl_table 11 codon_start 1 locus_tag LOCUS_10870 CDS 179668..180168 product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016351315.1 transl_table 11 codon_start 1 locus_tag LOCUS_10880 CDS complement(180364..180852) product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050413802.1 transl_table 11 codon_start 1 locus_tag LOCUS_10890 gene tadA tRNA 181140..181216 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00310 CDS complement(181322..181783) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480622.1 transl_table 11 codon_start 1 locus_tag LOCUS_10900 CDS complement(181907..183133) product organoarsenical effux MFS transporter ArsJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070878.1 transl_table 11 codon_start 1 locus_tag LOCUS_10910 gene arsJ CDS complement(183133..184146) product ArsJ-associated glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070877.1 transl_table 11 codon_start 1 locus_tag LOCUS_10920 CDS complement(184493..185464) product phosphate ABC transporter substrate-binding protein PstS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705170.1 transl_table 11 codon_start 1 locus_tag LOCUS_10930 CDS complement(185603..186919) product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705169.1 transl_table 11 codon_start 1 locus_tag LOCUS_10940 gene phoR CDS complement(186927..187616) product phosphate regulon transcriptional regulator PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005298527.1 transl_table 11 codon_start 1 locus_tag LOCUS_10950 gene phoB CDS complement(187705..188163) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706840.1 transl_table 11 codon_start 1 locus_tag LOCUS_10960 CDS 188336..189244 product recombination-associated protein RdgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706841.1 transl_table 11 codon_start 1 locus_tag LOCUS_10970 gene rdgC sequence06 source 1..186149 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(456..944) product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462468.1 transl_table 11 codon_start 1 locus_tag LOCUS_10980 CDS complement(1407..2435) product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000735359.1 transl_table 11 codon_start 1 locus_tag LOCUS_10990 CDS complement(2479..3465) product DUF1852 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457949.1 transl_table 11 codon_start 1 locus_tag LOCUS_11000 CDS complement(3835..4719) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035570.1 transl_table 11 codon_start 1 locus_tag LOCUS_11010 CDS complement(5154..7088) product AsmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072519.1 transl_table 11 codon_start 1 locus_tag LOCUS_11020 CDS complement(7111..7692) product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706092.1 transl_table 11 codon_start 1 locus_tag LOCUS_11030 gene dcd CDS complement(7788..8861) product iron-sulfur cluster carrier protein ApbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706090.1 transl_table 11 codon_start 1 locus_tag LOCUS_11040 gene apbC CDS 9115..11160 product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706089.1 transl_table 11 codon_start 1 locus_tag LOCUS_11050 gene metG CDS complement(11560..12942) product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705997.1 transl_table 11 codon_start 1 locus_tag LOCUS_11060 CDS complement(13134..13697) product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706269.1 transl_table 11 codon_start 1 locus_tag LOCUS_11070 CDS complement(13694..15250) product aminodeoxychorismate synthase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819891.1 transl_table 11 codon_start 1 locus_tag LOCUS_11080 gene pabB CDS 15197..16717 product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024944465.1 transl_table 11 codon_start 1 locus_tag LOCUS_11090 CDS complement(16768..17040) product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868779.1 transl_table 11 codon_start 1 locus_tag LOCUS_11100 CDS 17116..18309 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927646.1 transl_table 11 codon_start 1 locus_tag LOCUS_11110 CDS complement(18363..18674) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11120 CDS 18588..19625 product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706081.1 transl_table 11 codon_start 1 locus_tag LOCUS_11130 gene selD CDS 19636..20724 product tRNA 2-selenouridine(34) synthase MnmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706080.1 transl_table 11 codon_start 1 locus_tag LOCUS_11140 gene mnmH CDS 20756..21388 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706079.1 transl_table 11 codon_start 1 locus_tag LOCUS_11150 CDS complement(21269..21529) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11160 CDS complement(21539..22153) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705673.1 transl_table 11 codon_start 1 locus_tag LOCUS_11170 CDS 22249..23019 product penicillin-insensitive murein endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819795.1 transl_table 11 codon_start 1 locus_tag LOCUS_11180 gene mepA CDS 23074..24573 product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705539.1 transl_table 11 codon_start 1 locus_tag LOCUS_11190 gene glpK CDS complement(24757..27897) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11200 CDS complement(27995..29203) product EAL domain-containing response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029301722.1 transl_table 11 codon_start 1 locus_tag LOCUS_11210 CDS complement(29239..33414) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11220 CDS 33945..35450 product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011913952.1 transl_table 11 codon_start 1 locus_tag LOCUS_11230 gene glpD CDS complement(35458..38103) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11240 CDS complement(38100..38474) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11250 CDS complement(38464..39351) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11260 CDS complement(39348..39884) product type II secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481015.1 transl_table 11 codon_start 1 locus_tag LOCUS_11270 CDS complement(39871..40401) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11280 CDS complement(40444..40935) product type IV pilin MshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106342.1 transl_table 11 codon_start 1 locus_tag LOCUS_11290 gene mshA CDS complement(41090..42310) product MSHA fimbrial biogenesis protein MshG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704369.1 transl_table 11 codon_start 1 locus_tag LOCUS_11300 gene mshG CDS complement(42310..44007) product MSHA fimbrial ATPase MshE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704368.1 transl_table 11 codon_start 1 locus_tag LOCUS_11310 gene mshE CDS complement(43985..44755) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11320 CDS complement(44752..46356) product pilus (MSHA type) biogenesis protein MshL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704365.1 transl_table 11 codon_start 1 locus_tag LOCUS_11330 gene mshL CDS complement(46353..46676) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11340 CDS complement(46669..47310) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11350 CDS complement(47307..47888) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11360 CDS complement(47888..48751) product MSHA fimbrial biogenesis protein MshI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704361.1 transl_table 11 codon_start 1 locus_tag LOCUS_11370 gene mshI CDS complement(48897..49778) product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706015.1 transl_table 11 codon_start 1 locus_tag LOCUS_11380 CDS complement(49875..51128) product D-amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032478594.1 transl_table 11 codon_start 1 locus_tag LOCUS_11390 CDS complement(51377..54157) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11400 CDS 54227..55594 product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462594.1 transl_table 11 codon_start 1 locus_tag LOCUS_11410 CDS complement(55651..55860) product DUF1127 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706670.1 transl_table 11 codon_start 1 locus_tag LOCUS_11420 CDS 56100..56324 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11430 CDS 56433..57911 product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420103.1 transl_table 11 codon_start 1 locus_tag LOCUS_11440 CDS 58382..59155 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11450 CDS 59210..60178 product lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705968.1 transl_table 11 codon_start 1 locus_tag LOCUS_11460 gene lpxM CDS complement(60529..61320) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110587.1 transl_table 11 codon_start 1 locus_tag LOCUS_11470 CDS complement(61699..62730) product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706468.1 transl_table 11 codon_start 1 locus_tag LOCUS_11480 CDS 62860..63534 product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387788.1 transl_table 11 codon_start 1 locus_tag LOCUS_11490 gene mtgA CDS 63671..64423 product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706469.1 transl_table 11 codon_start 1 locus_tag LOCUS_11500 CDS 64444..66033 product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706470.1 transl_table 11 codon_start 1 locus_tag LOCUS_11510 CDS complement(66347..67327) product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927663.1 transl_table 11 codon_start 1 locus_tag LOCUS_11520 gene hemH CDS complement(67403..68047) product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706319.1 transl_table 11 codon_start 1 locus_tag LOCUS_11530 gene adk CDS 68371..69531 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858304.1 transl_table 11 codon_start 1 locus_tag LOCUS_11540 CDS 69528..70934 product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002780438.1 transl_table 11 codon_start 1 locus_tag LOCUS_11550 CDS 70931..71278 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002780440.1 transl_table 11 codon_start 1 locus_tag LOCUS_11560 CDS complement(71536..71832) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11570 CDS 73553..75265 product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940398.1 transl_table 11 codon_start 1 locus_tag LOCUS_11580 CDS 75265..76062 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041170080.1 transl_table 11 codon_start 1 locus_tag LOCUS_11590 CDS 76059..76727 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000590258.1 transl_table 11 codon_start 1 locus_tag LOCUS_11600 CDS 76807..77889 product capsule polysaccharide export inner-membrane protein KpsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000905920.1 transl_table 11 codon_start 1 locus_tag LOCUS_11610 CDS 78009..79346 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11620 CDS 79370..81370 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11630 CDS 81387..83414 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11640 CDS 83474..84436 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11650 CDS 85016..86191 product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005467215.1 transl_table 11 codon_start 1 locus_tag LOCUS_11660 CDS 86252..89161 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11670 CDS 89177..90649 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11680 CDS 90651..92759 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11690 CDS 92753..93697 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11700 CDS 93863..94897 product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771402.1 transl_table 11 codon_start 1 locus_tag LOCUS_11710 gene rfbB CDS 95063..95968 product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001023636.1 transl_table 11 codon_start 1 locus_tag LOCUS_11720 gene rfbD CDS 95955..96842 product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706707.1 transl_table 11 codon_start 1 locus_tag LOCUS_11730 gene rfbA CDS 96839..97387 product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096184.1 transl_table 11 codon_start 1 locus_tag LOCUS_11740 gene rfbC CDS 97599..99689 product capsular polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224756.1 transl_table 11 codon_start 1 locus_tag LOCUS_11750 CDS complement(99850..100137) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948599.1 transl_table 11 codon_start 1 locus_tag LOCUS_11760 CDS complement(100130..100450) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099360.1 transl_table 11 codon_start 1 locus_tag LOCUS_11770 CDS 101182..101580 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11780 note possible pseudo, internal stop codon CDS 101632..101982 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11790 note possible pseudo, internal stop codon CDS complement(102366..104279) product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706320.1 transl_table 11 codon_start 1 locus_tag LOCUS_11800 gene htpG CDS complement(104866..107016) product fatty acid oxidation complex subunit alpha FadJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706013.1 transl_table 11 codon_start 1 locus_tag LOCUS_11810 gene fadJ CDS complement(107013..108326) product acetyl-CoA C-acyltransferase FadI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209704.1 transl_table 11 codon_start 1 locus_tag LOCUS_11820 gene fadI CDS 108610..109179 product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706006.1 transl_table 11 codon_start 1 locus_tag LOCUS_11830 CDS 109172..109900 product DUF3379 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706005.1 transl_table 11 codon_start 1 locus_tag LOCUS_11840 CDS 110154..111617 product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762940.1 transl_table 11 codon_start 1 locus_tag LOCUS_11850 gene putP CDS complement(112229..113797) product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705702.1 transl_table 11 codon_start 1 locus_tag LOCUS_11860 CDS 114425..114832 product DNA-binding transcriptional regulator H-NS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210661.1 transl_table 11 codon_start 1 locus_tag LOCUS_11870 gene hns CDS complement(114918..115139) product DUF3820 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073199.1 transl_table 11 codon_start 1 locus_tag LOCUS_11880 CDS complement(115309..116022) product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705694.1 transl_table 11 codon_start 1 locus_tag LOCUS_11890 gene pyrF CDS complement(116157..117326) product lipopolysaccharide assembly protein LapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705693.1 transl_table 11 codon_start 1 locus_tag LOCUS_11900 gene lapB CDS complement(117335..117622) product lipopolysaccharide assembly protein LapA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705692.1 transl_table 11 codon_start 1 locus_tag LOCUS_11910 CDS complement(117731..118012) product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705691.1 transl_table 11 codon_start 1 locus_tag LOCUS_11920 gene ihfB CDS complement(118082..119767) product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705690.1 transl_table 11 codon_start 1 locus_tag LOCUS_11930 gene rpsA CDS complement(119918..120595) product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705689.1 transl_table 11 codon_start 1 locus_tag LOCUS_11940 gene cmk CDS 120811..121404 product GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010634253.1 transl_table 11 codon_start 1 locus_tag LOCUS_11950 gene ribA CDS complement(121516..123240) product PTS fructose transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706188.1 transl_table 11 codon_start 1 locus_tag LOCUS_11960 gene fruA CDS complement(123240..124184) product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706189.1 transl_table 11 codon_start 1 locus_tag LOCUS_11970 gene pfkB CDS complement(124198..127047) product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119534.1 transl_table 11 codon_start 1 locus_tag LOCUS_11980 gene ptsP CDS complement(127213..127902) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073860.1 transl_table 11 codon_start 1 locus_tag LOCUS_11990 CDS complement(127949..128611) product TIGR01621 family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706480.1 transl_table 11 codon_start 1 locus_tag LOCUS_12000 tRNA complement(128685..128775) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00320 CDS 129023..129682 product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262111.1 transl_table 11 codon_start 1 locus_tag LOCUS_12010 CDS 129805..131985 product YccS family putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706489.1 transl_table 11 codon_start 1 locus_tag LOCUS_12020 gene yccS CDS 132022..132357 product sulfurtransferase TusE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019079836.1 transl_table 11 codon_start 1 locus_tag LOCUS_12030 gene tusE CDS complement(132726..133064) product Grx4 family monothiol glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010673955.1 transl_table 11 codon_start 1 locus_tag LOCUS_12040 CDS 133426..134007 product superoxide dismutase [Fe] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705306.1 transl_table 11 codon_start 1 locus_tag LOCUS_12050 gene sodB CDS 134450..135847 product copper resistance membrane spanning protein PcoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046494163.1 transl_table 11 codon_start 1 locus_tag LOCUS_12060 gene pcoS CDS complement(135852..136175) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12070 CDS complement(136332..136817) product cupredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029443756.1 transl_table 11 codon_start 1 locus_tag LOCUS_12080 CDS complement(136858..137817) product copper resistance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_090361384.1 transl_table 11 codon_start 1 locus_tag LOCUS_12090 CDS complement(137844..139664) product copper resistance system multicopper oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931403.1 transl_table 11 codon_start 1 locus_tag LOCUS_12100 CDS 139857..140540 product heavy metal response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186914724.1 transl_table 11 codon_start 1 locus_tag LOCUS_12110 CDS 140810..141358 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12120 CDS 141366..142478 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12130 CDS 142487..145588 product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944011.1 transl_table 11 codon_start 1 locus_tag LOCUS_12140 CDS 145614..145979 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12150 CDS complement(146443..146859) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12160 CDS 147634..148104 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12170 CDS complement(148243..148605) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12180 CDS 148924..149082 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12190 CDS 149228..149788 product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926361.1 transl_table 11 codon_start 1 locus_tag LOCUS_12200 CDS 149917..150150 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12210 CDS complement(150711..151442) product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072508.1 transl_table 11 codon_start 1 locus_tag LOCUS_12220 CDS 151744..152064 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12230 note possible pseudo, frameshifted CDS 152485..154533 product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528058.1 transl_table 11 codon_start 1 locus_tag LOCUS_12240 CDS complement(154657..155115) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070928.1 transl_table 11 codon_start 1 locus_tag LOCUS_12250 CDS 155852..157174 product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705268.1 transl_table 11 codon_start 1 locus_tag LOCUS_12260 gene rimO CDS 157507..158298 product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005298732.1 transl_table 11 codon_start 1 locus_tag LOCUS_12270 CDS complement(158345..158536) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12280 CDS 158587..160026 product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705256.1 transl_table 11 codon_start 1 locus_tag LOCUS_12290 gene pyk CDS complement(160104..162374) product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705253.1 transl_table 11 codon_start 1 locus_tag LOCUS_12300 CDS complement(162406..163047) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705252.1 transl_table 11 codon_start 1 locus_tag LOCUS_12310 CDS 163329..163490 product pleiotropic regulatory protein RsmS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005299504.1 transl_table 11 codon_start 1 locus_tag LOCUS_12320 gene rsmS CDS 163594..164679 product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070824.1 transl_table 11 codon_start 1 locus_tag LOCUS_12330 CDS complement(164810..168421) product bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase PutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531234.1 transl_table 11 codon_start 1 locus_tag LOCUS_12340 gene putA CDS 168672..168890 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12350 CDS 168966..169358 product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531233.1 transl_table 11 codon_start 1 locus_tag LOCUS_12360 CDS complement(169500..171404) product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705508.1 transl_table 11 codon_start 1 locus_tag LOCUS_12370 gene speA CDS complement(171632..172567) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12380 CDS complement(172731..173003) product SelT/SelW/SelH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705505.1 transl_table 11 codon_start 1 locus_tag LOCUS_12390 CDS complement(173127..173858) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12400 CDS complement(173873..174436) product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705502.1 transl_table 11 codon_start 1 locus_tag LOCUS_12410 CDS 174566..175510 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705501.1 transl_table 11 codon_start 1 locus_tag LOCUS_12420 CDS complement(175679..176335) product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705496.1 transl_table 11 codon_start 1 locus_tag LOCUS_12430 gene folE CDS 176507..177748 product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705495.1 transl_table 11 codon_start 1 locus_tag LOCUS_12440 gene moeA CDS 177748..178509 product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705494.1 transl_table 11 codon_start 1 locus_tag LOCUS_12450 gene moeB CDS complement(178819..179538) product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315202.1 transl_table 11 codon_start 1 locus_tag LOCUS_12460 gene queE CDS complement(179535..179891) product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533306.1 transl_table 11 codon_start 1 locus_tag LOCUS_12470 gene queD CDS complement(179879..180586) product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975901.1 transl_table 11 codon_start 1 locus_tag LOCUS_12480 gene queC CDS complement(180782..183160) product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818062.1 transl_table 11 codon_start 1 locus_tag LOCUS_12490 gene ppsA CDS 183347..184159 product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706506.1 transl_table 11 codon_start 1 locus_tag LOCUS_12500 CDS 184516..185937 product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893433.1 transl_table 11 codon_start 1 locus_tag LOCUS_12510 sequence07 source 1..167955 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 463..933 product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704113.1 transl_table 11 codon_start 1 locus_tag LOCUS_12520 CDS complement(960..1790) product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704112.1 transl_table 11 codon_start 1 locus_tag LOCUS_12530 gene murI CDS 1780..2103 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12540 CDS complement(2100..3980) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704111.1 transl_table 11 codon_start 1 locus_tag LOCUS_12550 CDS 4068..4277 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12560 CDS 4409..5749 product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463605.1 transl_table 11 codon_start 1 locus_tag LOCUS_12570 CDS 5759..6127 product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071030.1 transl_table 11 codon_start 1 locus_tag LOCUS_12580 CDS 6564..7457 product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245435.1 transl_table 11 codon_start 1 locus_tag LOCUS_12590 CDS complement(7549..8076) product ATP--cob(I)alamin adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707846.1 transl_table 11 codon_start 1 locus_tag LOCUS_12600 CDS 8219..9316 product tRNA (uridine(54)-C5)-methyltransferase TrmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480873.1 transl_table 11 codon_start 1 locus_tag LOCUS_12610 gene trmA CDS complement(9747..10991) product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465132.1 transl_table 11 codon_start 1 locus_tag LOCUS_12620 CDS complement(11109..11849) product thermonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103280.1 transl_table 11 codon_start 1 locus_tag LOCUS_12630 CDS complement(11963..12178) product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016352348.1 transl_table 11 codon_start 1 locus_tag LOCUS_12640 gene rpmE CDS 12321..14519 product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707854.1 transl_table 11 codon_start 1 locus_tag LOCUS_12650 gene priA CDS complement(14522..15112) product LON peptidase substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043164119.1 transl_table 11 codon_start 1 locus_tag LOCUS_12660 CDS 15280..17034 product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707774.1 transl_table 11 codon_start 1 locus_tag LOCUS_12670 gene argS CDS 17038..17616 product cell division protein FtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481405.1 transl_table 11 codon_start 1 locus_tag LOCUS_12680 gene ftsN CDS 17779..18228 product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005306539.1 transl_table 11 codon_start 1 locus_tag LOCUS_12690 gene hslV CDS 18277..19605 product HslU--HslV peptidase ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707776.1 transl_table 11 codon_start 1 locus_tag LOCUS_12700 gene hslU CDS 19704..20189 product ribonuclease E activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005306574.1 transl_table 11 codon_start 1 locus_tag LOCUS_12710 gene rraA CDS complement(20307..20516) product cell division protein ZapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349028.1 transl_table 11 codon_start 1 locus_tag LOCUS_12720 CDS complement(20658..21440) product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704210.1 transl_table 11 codon_start 1 locus_tag LOCUS_12730 gene cysE CDS complement(21444..22379) product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704209.1 transl_table 11 codon_start 1 locus_tag LOCUS_12740 CDS complement(22458..22922) product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074146.1 transl_table 11 codon_start 1 locus_tag LOCUS_12750 gene trmL CDS complement(22915..24288) product MATE family efflux transporter DinF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819117.1 transl_table 11 codon_start 1 locus_tag LOCUS_12760 gene dinF CDS complement(24407..25018) product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819116.1 transl_table 11 codon_start 1 locus_tag LOCUS_12770 CDS complement(25047..25943) product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074210.1 transl_table 11 codon_start 1 locus_tag LOCUS_12780 gene cyoE CDS complement(25968..26975) product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074209.1 transl_table 11 codon_start 1 locus_tag LOCUS_12790 CDS complement(26985..27434) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12800 CDS complement(27424..28104) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119510.1 transl_table 11 codon_start 1 locus_tag LOCUS_12810 CDS 28128..28334 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12820 CDS complement(28351..29220) product cytochrome c oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074205.1 transl_table 11 codon_start 1 locus_tag LOCUS_12830 CDS complement(29237..29767) product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074204.1 transl_table 11 codon_start 1 locus_tag LOCUS_12840 CDS complement(29754..31373) product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074203.1 transl_table 11 codon_start 1 locus_tag LOCUS_12850 gene ctaD CDS complement(31383..32510) product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106288.1 transl_table 11 codon_start 1 locus_tag LOCUS_12860 gene coxB CDS complement(32805..33416) product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704201.1 transl_table 11 codon_start 1 locus_tag LOCUS_12870 gene lexA CDS complement(33529..34395) product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704199.1 transl_table 11 codon_start 1 locus_tag LOCUS_12880 gene ubiA CDS complement(34404..34961) product chorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070536.1 transl_table 11 codon_start 1 locus_tag LOCUS_12890 CDS complement(35189..36022) product rhomboid family intramembrane serine protease GlpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704134.1 transl_table 11 codon_start 1 locus_tag LOCUS_12900 gene glpG CDS complement(36022..36339) product thiosulfate sulfurtransferase GlpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460380.1 transl_table 11 codon_start 1 locus_tag LOCUS_12910 gene glpE CDS complement(36395..37099) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704138.1 transl_table 11 codon_start 1 locus_tag LOCUS_12920 CDS complement(37102..37866) product high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704139.1 transl_table 11 codon_start 1 locus_tag LOCUS_12930 gene livG CDS complement(37863..39104) product high-affinity branched-chain amino acid ABC transporter permease LivM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017410832.1 transl_table 11 codon_start 1 locus_tag LOCUS_12940 CDS complement(39101..40024) product high-affinity branched-chain amino acid ABC transporter permease LivH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704141.1 transl_table 11 codon_start 1 locus_tag LOCUS_12950 gene livH CDS complement(40394..41509) product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704142.1 transl_table 11 codon_start 1 locus_tag LOCUS_12960 CDS complement(42295..43320) product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707888.1 transl_table 11 codon_start 1 locus_tag LOCUS_12970 gene tdh CDS complement(43334..44524) product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707887.1 transl_table 11 codon_start 1 locus_tag LOCUS_12980 CDS complement(44620..45282) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707886.1 transl_table 11 codon_start 1 locus_tag LOCUS_12990 CDS 45426..46379 product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707885.1 transl_table 11 codon_start 1 locus_tag LOCUS_13000 gene rfaD CDS 46405..48171 product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001023767.1 transl_table 11 codon_start 1 locus_tag LOCUS_13010 CDS 48149..49258 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13020 CDS 49307..50362 product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704188.1 transl_table 11 codon_start 1 locus_tag LOCUS_13030 gene waaF CDS 50367..51632 product lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704189.1 transl_table 11 codon_start 1 locus_tag LOCUS_13040 gene waaA CDS complement(51617..52324) product 3-deoxy-D-manno-octulosonic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704082.1 transl_table 11 codon_start 1 locus_tag LOCUS_13050 CDS 52410..53471 product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704081.1 transl_table 11 codon_start 1 locus_tag LOCUS_13060 CDS 53468..54247 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704187.1 transl_table 11 codon_start 1 locus_tag LOCUS_13070 CDS complement(54216..55241) product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704186.1 transl_table 11 codon_start 1 locus_tag LOCUS_13080 CDS 55321..55800 product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704185.1 transl_table 11 codon_start 1 locus_tag LOCUS_13090 gene coaD CDS complement(55989..56810) product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704183.1 transl_table 11 codon_start 1 locus_tag LOCUS_13100 gene mutM CDS complement(56904..57071) product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307500.1 transl_table 11 codon_start 1 locus_tag LOCUS_13110 gene rpmG CDS complement(57083..57319) product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417050.1 transl_table 11 codon_start 1 locus_tag LOCUS_13120 gene rpmB CDS complement(57452..58126) product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704181.1 transl_table 11 codon_start 1 locus_tag LOCUS_13130 gene radC CDS 58249..59457 product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704180.1 transl_table 11 codon_start 1 locus_tag LOCUS_13140 gene coaBC CDS 59444..59899 product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704179.1 transl_table 11 codon_start 1 locus_tag LOCUS_13150 gene dut CDS 59917..60519 product nucleoid occlusion factor SlmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704178.1 transl_table 11 codon_start 1 locus_tag LOCUS_13160 gene slmA CDS 60575..61429 product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704177.1 transl_table 11 codon_start 1 locus_tag LOCUS_13170 CDS complement(61476..62117) product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703811.1 transl_table 11 codon_start 1 locus_tag LOCUS_13180 gene pyrE CDS complement(62346..63068) product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001247078.1 transl_table 11 codon_start 1 locus_tag LOCUS_13190 gene rph CDS 63225..64088 product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707879.1 transl_table 11 codon_start 1 locus_tag LOCUS_13200 CDS 64245..67454 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071804.1 transl_table 11 codon_start 1 locus_tag LOCUS_13210 CDS complement(67461..69242) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13220 CDS 69361..70149 product glycosyltransferase family 32 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055064624.1 transl_table 11 codon_start 1 locus_tag LOCUS_13230 CDS 70455..71084 product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016348898.1 transl_table 11 codon_start 1 locus_tag LOCUS_13240 gene gmk CDS 71134..71409 product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307060.1 transl_table 11 codon_start 1 locus_tag LOCUS_13250 gene rpoZ CDS 71510..73627 product bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704079.1 transl_table 11 codon_start 1 locus_tag LOCUS_13260 gene spoT assembly_gap 73770..73779 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 73851..74891 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704076.1 transl_table 11 codon_start 1 locus_tag LOCUS_13270 CDS complement(74905..75351) product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106124.1 transl_table 11 codon_start 1 locus_tag LOCUS_13280 CDS 75562..75762 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13290 CDS 75765..76856 product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477894.1 transl_table 11 codon_start 1 locus_tag LOCUS_13300 CDS 76884..77813 product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477926.1 transl_table 11 codon_start 1 locus_tag LOCUS_13310 gene murQ CDS complement(77890..78213) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13320 CDS 78443..79318 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843742.1 transl_table 11 codon_start 1 locus_tag LOCUS_13330 CDS complement(79315..80502) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819957.1 transl_table 11 codon_start 1 locus_tag LOCUS_13340 CDS 80599..81771 product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706206.1 transl_table 11 codon_start 1 locus_tag LOCUS_13350 CDS 81828..82625 product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073544.1 transl_table 11 codon_start 1 locus_tag LOCUS_13360 CDS 82761..83201 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010635648.1 transl_table 11 codon_start 1 locus_tag LOCUS_13370 CDS complement(83205..84128) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704088.1 transl_table 11 codon_start 1 locus_tag LOCUS_13380 CDS 84592..85458 product carboxylate/amino acid/amine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704084.1 transl_table 11 codon_start 1 locus_tag LOCUS_13390 CDS 85825..86799 product MDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005416807.1 transl_table 11 codon_start 1 locus_tag LOCUS_13400 CDS 87318..88316 product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815993.1 transl_table 11 codon_start 1 locus_tag LOCUS_13410 CDS complement(88370..89245) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101427.1 transl_table 11 codon_start 1 locus_tag LOCUS_13420 CDS complement(89316..90074) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704126.1 transl_table 11 codon_start 1 locus_tag LOCUS_13430 CDS complement(90188..92230) product oligopeptidase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704124.1 transl_table 11 codon_start 1 locus_tag LOCUS_13440 gene prlC CDS 92449..93801 product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478739.1 transl_table 11 codon_start 1 locus_tag LOCUS_13450 gene gorA CDS complement(94272..94673) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13460 CDS 95634..96089 product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933541.1 transl_table 11 codon_start 1 locus_tag LOCUS_13470 CDS complement(96281..96595) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13480 CDS complement(96955..97437) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072083.1 transl_table 11 codon_start 1 locus_tag LOCUS_13490 CDS 97599..98159 product polyhydroxyalkanoate synthesis repressor PhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813585.1 transl_table 11 codon_start 1 locus_tag LOCUS_13500 gene phaR CDS complement(98211..98861) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13510 CDS 99698..101473 product glyoxylate carboligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527189.1 transl_table 11 codon_start 1 locus_tag LOCUS_13520 gene gcl CDS 101540..102322 product hydroxypyruvate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087181.1 transl_table 11 codon_start 1 locus_tag LOCUS_13530 gene hyi CDS 102388..103275 product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105826.1 transl_table 11 codon_start 1 locus_tag LOCUS_13540 CDS 103454..104722 product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114300.1 transl_table 11 codon_start 1 locus_tag LOCUS_13550 CDS complement(104874..105383) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13560 CDS 105435..105701 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13570 CDS 106007..107119 product carboxynorspermidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973611.1 transl_table 11 codon_start 1 locus_tag LOCUS_13580 gene nspC CDS 107172..108410 product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973612.1 transl_table 11 codon_start 1 locus_tag LOCUS_13590 CDS complement(108798..109610) product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531396.1 transl_table 11 codon_start 1 locus_tag LOCUS_13600 tRNA complement(109780..109856) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00330 tRNA complement(109921..110006) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00340 tRNA complement(110041..110116) product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00350 tRNA complement(110145..110221) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00360 CDS 110525..111016 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016348886.1 transl_table 11 codon_start 1 locus_tag LOCUS_13610 CDS 111046..112176 product multidrug efflux RND transporter periplasmic adaptor subunit VexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000759349.1 transl_table 11 codon_start 1 locus_tag LOCUS_13620 gene vexA CDS 112189..115266 product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704065.1 transl_table 11 codon_start 1 locus_tag LOCUS_13630 CDS 115621..115821 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13640 CDS 115921..116835 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704312.1 transl_table 11 codon_start 1 locus_tag LOCUS_13650 CDS 116916..117149 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13660 note possible pseudo, internal stop codon CDS 117250..119040 product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704534.1 transl_table 11 codon_start 1 locus_tag LOCUS_13670 CDS 119206..120555 product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275564.1 transl_table 11 codon_start 1 locus_tag LOCUS_13680 gene pssA CDS 120707..122779 product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819155.1 transl_table 11 codon_start 1 locus_tag LOCUS_13690 gene recG CDS 123055..125088 product AsmA-like C-terminal region-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704290.1 transl_table 11 codon_start 1 locus_tag LOCUS_13700 CDS complement(125106..125996) product bifunctional GNAT family N-acetyltransferase/hotdog fold thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704289.1 transl_table 11 codon_start 1 locus_tag LOCUS_13710 CDS complement(126082..126519) product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368967.1 transl_table 11 codon_start 1 locus_tag LOCUS_13720 gene dtd CDS complement(126516..127475) product prolyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414210.1 transl_table 11 codon_start 1 locus_tag LOCUS_13730 gene pip CDS complement(127475..128377) product virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704286.1 transl_table 11 codon_start 1 locus_tag LOCUS_13740 CDS complement(128544..130370) product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704285.1 transl_table 11 codon_start 1 locus_tag LOCUS_13750 gene typA CDS 130716..132125 product glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260968.1 transl_table 11 codon_start 1 locus_tag LOCUS_13760 gene glnA CDS complement(132326..133342) product DUF2955 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122410.1 transl_table 11 codon_start 1 locus_tag LOCUS_13770 CDS complement(133353..134402) product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119629.1 transl_table 11 codon_start 1 locus_tag LOCUS_13780 CDS complement(134421..134852) product transcriptional regulator SlyA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020078997.1 transl_table 11 codon_start 1 locus_tag LOCUS_13790 gene slyA CDS 135102..136172 product nitrogen regulation protein NR(II) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704282.1 transl_table 11 codon_start 1 locus_tag LOCUS_13800 gene glnL CDS 136182..137615 product nitrogen regulation protein NR(I) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010635441.1 transl_table 11 codon_start 1 locus_tag LOCUS_13810 gene glnG CDS 137636..138694 product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704281.1 transl_table 11 codon_start 1 locus_tag LOCUS_13820 gene add CDS complement(138777..140147) product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704280.1 transl_table 11 codon_start 1 locus_tag LOCUS_13830 gene hemN CDS complement(140161..140619) product DUF2489 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704279.1 transl_table 11 codon_start 1 locus_tag LOCUS_13840 CDS complement(140616..141200) product Der GTPase-activating protein YihI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001572146.1 transl_table 11 codon_start 1 locus_tag LOCUS_13850 gene yihI CDS complement(141197..141859) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260949.1 transl_table 11 codon_start 1 locus_tag LOCUS_13860 CDS complement(141909..142526) product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349084.1 transl_table 11 codon_start 1 locus_tag LOCUS_13870 CDS 142671..143303 product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703927.1 transl_table 11 codon_start 1 locus_tag LOCUS_13880 gene yihA CDS 143341..144000 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480641.1 transl_table 11 codon_start 1 locus_tag LOCUS_13890 CDS 144017..144703 product 16S rRNA pseudouridine(516) synthase RsuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073606.1 transl_table 11 codon_start 1 locus_tag LOCUS_13900 gene rsuA CDS complement(145151..146635) product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101377.1 transl_table 11 codon_start 1 locus_tag LOCUS_13910 CDS complement(146647..147522) product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401366.1 transl_table 11 codon_start 1 locus_tag LOCUS_13920 gene dapA CDS complement(147589..149052) product Na+/H+ antiporter NhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843974.1 transl_table 11 codon_start 1 locus_tag LOCUS_13930 gene nhaC CDS complement(149084..150394) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480719.1 transl_table 11 codon_start 1 locus_tag LOCUS_13940 CDS 150628..151533 product 4-hydroxyproline epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480619.1 transl_table 11 codon_start 1 locus_tag LOCUS_13950 CDS complement(151589..153382) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13960 CDS 153530..153901 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13970 CDS complement(153911..154291) product monovalent cation/H(+) antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958313.1 transl_table 11 codon_start 1 locus_tag LOCUS_13980 gene mnhG CDS complement(154281..154556) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13990 CDS complement(154561..155034) product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942976.1 transl_table 11 codon_start 1 locus_tag LOCUS_14000 CDS complement(155031..156533) product Na+/H+ antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942977.1 transl_table 11 codon_start 1 locus_tag LOCUS_14010 CDS complement(156530..156877) product Na+/H+ antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942978.1 transl_table 11 codon_start 1 locus_tag LOCUS_14020 CDS complement(156878..157309) product Na+/H+ antiporter subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942979.1 transl_table 11 codon_start 1 locus_tag LOCUS_14030 CDS complement(157306..159606) product putative monovalent cation/H+ antiporter subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942980.1 transl_table 11 codon_start 1 locus_tag LOCUS_14040 CDS complement(159841..160665) product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459962.1 transl_table 11 codon_start 1 locus_tag LOCUS_14050 gene thiD CDS complement(161390..164128) product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704214.1 transl_table 11 codon_start 1 locus_tag LOCUS_14060 gene polA CDS 164452..165099 product isoprenoid biosynthesis glyoxalase ElbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704213.1 transl_table 11 codon_start 1 locus_tag LOCUS_14070 gene elbB CDS 165361..165972 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14080 CDS complement(165969..166637) product 7-cyano-7-deazaguanine/7-aminomethyl-7-deazaguanine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707785.1 transl_table 11 codon_start 1 locus_tag LOCUS_14090 CDS complement(166762..167661) product O-acetylserine/cysteine exporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526255.1 transl_table 11 codon_start 1 locus_tag LOCUS_14100 sequence08 source 1..154908 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(723..1115) product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007644470.1 transl_table 11 codon_start 1 locus_tag LOCUS_14110 gene rplQ CDS complement(1160..2149) product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307997.1 transl_table 11 codon_start 1 locus_tag LOCUS_14120 gene rpoA CDS complement(2175..2795) product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704319.1 transl_table 11 codon_start 1 locus_tag LOCUS_14130 gene rpsD CDS complement(2826..3218) product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005319702.1 transl_table 11 codon_start 1 locus_tag LOCUS_14140 gene rpsK CDS complement(3233..3589) product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307991.1 transl_table 11 codon_start 1 locus_tag LOCUS_14150 gene rpsM CDS complement(3867..5198) product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010672567.1 transl_table 11 codon_start 1 locus_tag LOCUS_14160 gene secY CDS complement(5207..5641) product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417259.1 transl_table 11 codon_start 1 locus_tag LOCUS_14170 gene rplO CDS complement(5646..5828) product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307985.1 transl_table 11 codon_start 1 locus_tag LOCUS_14180 gene rpmD CDS complement(5836..6336) product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704318.1 transl_table 11 codon_start 1 locus_tag LOCUS_14190 gene rpsE CDS complement(6351..6704) product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000358092.1 transl_table 11 codon_start 1 locus_tag LOCUS_14200 gene rplR CDS complement(6714..7247) product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307981.1 transl_table 11 codon_start 1 locus_tag LOCUS_14210 gene rplF CDS complement(7257..7649) product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099025.1 transl_table 11 codon_start 1 locus_tag LOCUS_14220 gene rpsH CDS complement(7672..7977) product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704315.1 transl_table 11 codon_start 1 locus_tag LOCUS_14230 gene rpsN CDS complement(7989..8528) product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005331162.1 transl_table 11 codon_start 1 locus_tag LOCUS_14240 gene rplE CDS complement(8543..8860) product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307977.1 transl_table 11 codon_start 1 locus_tag LOCUS_14250 gene rplX CDS complement(8872..9240) product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307975.1 transl_table 11 codon_start 1 locus_tag LOCUS_14260 gene rplN CDS complement(9398..9658) product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130100.1 transl_table 11 codon_start 1 locus_tag LOCUS_14270 gene rpsQ CDS complement(9660..9851) product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307965.1 transl_table 11 codon_start 1 locus_tag LOCUS_14280 gene rpmC CDS complement(9851..10264) product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307963.1 transl_table 11 codon_start 1 locus_tag LOCUS_14290 gene rplP CDS complement(10277..10969) product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005331168.1 transl_table 11 codon_start 1 locus_tag LOCUS_14300 gene rpsC CDS complement(10988..11320) product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704314.1 transl_table 11 codon_start 1 locus_tag LOCUS_14310 gene rplV CDS complement(11331..11609) product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307960.1 transl_table 11 codon_start 1 locus_tag LOCUS_14320 gene rpsS CDS complement(11631..12455) product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417230.1 transl_table 11 codon_start 1 locus_tag LOCUS_14330 gene rplB CDS complement(12473..12775) product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307955.1 transl_table 11 codon_start 1 locus_tag LOCUS_14340 gene rplW CDS complement(12772..13377) product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005340616.1 transl_table 11 codon_start 1 locus_tag LOCUS_14350 gene rplD CDS complement(13395..14033) product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010672559.1 transl_table 11 codon_start 1 locus_tag LOCUS_14360 gene rplC CDS complement(14053..14364) product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307944.1 transl_table 11 codon_start 1 locus_tag LOCUS_14370 gene rpsJ CDS complement(14633..16513) product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262710.1 transl_table 11 codon_start 1 locus_tag LOCUS_14380 gene argH CDS complement(16806..18017) product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704563.1 transl_table 11 codon_start 1 locus_tag LOCUS_14390 CDS complement(18017..18934) product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819287.1 transl_table 11 codon_start 1 locus_tag LOCUS_14400 CDS complement(18945..19754) product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704561.1 transl_table 11 codon_start 1 locus_tag LOCUS_14410 gene argB CDS complement(19761..20774) product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704560.1 transl_table 11 codon_start 1 locus_tag LOCUS_14420 gene argC CDS 21023..22180 product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704559.1 transl_table 11 codon_start 1 locus_tag LOCUS_14430 gene argE CDS 22450..25071 product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308531.1 transl_table 11 codon_start 1 locus_tag LOCUS_14440 gene ppc CDS complement(25385..26332) product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074136.1 transl_table 11 codon_start 1 locus_tag LOCUS_14450 CDS 26502..26969 product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707484.1 transl_table 11 codon_start 1 locus_tag LOCUS_14460 gene ybaK CDS 27479..28741 product imelysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001101418.1 transl_table 11 codon_start 1 locus_tag LOCUS_14470 CDS 29053..30438 product di-heme oxidoredictase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457832.1 transl_table 11 codon_start 1 locus_tag LOCUS_14480 CDS 30435..31469 product imelysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261812.1 transl_table 11 codon_start 1 locus_tag LOCUS_14490 CDS 31469..32545 product DUF1513 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162796599.1 transl_table 11 codon_start 1 locus_tag LOCUS_14500 CDS 32632..32880 product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008500746.1 transl_table 11 codon_start 1 locus_tag LOCUS_14510 CDS complement(33020..33178) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14520 CDS 33232..33675 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528320.1 transl_table 11 codon_start 1 locus_tag LOCUS_14530 CDS complement(33727..36162) product bifunctional aspartate kinase/homoserine dehydrogenase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704558.1 transl_table 11 codon_start 1 locus_tag LOCUS_14540 CDS complement(36162..37322) product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704557.1 transl_table 11 codon_start 1 locus_tag LOCUS_14550 gene metB CDS 37503..37835 product met regulon transcriptional regulator MetJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308521.1 transl_table 11 codon_start 1 locus_tag LOCUS_14560 gene metJ CDS complement(38300..39118) product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704554.1 transl_table 11 codon_start 1 locus_tag LOCUS_14570 gene cysQ CDS complement(39121..39678) product ADP compounds hydrolase NudE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017765235.1 transl_table 11 codon_start 1 locus_tag LOCUS_14580 gene nudE CDS 39840..40232 product ribosome-associated heat shock protein Hsp15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819274.1 transl_table 11 codon_start 1 locus_tag LOCUS_14590 gene hslR CDS 40364..41224 product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024943636.1 transl_table 11 codon_start 1 locus_tag LOCUS_14600 gene hslO CDS 41395..43008 product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704536.1 transl_table 11 codon_start 1 locus_tag LOCUS_14610 gene pckA CDS complement(43594..46119) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14620 CDS complement(46280..47164) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816367.1 transl_table 11 codon_start 1 locus_tag LOCUS_14630 CDS 47316..48137 product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401939.1 transl_table 11 codon_start 1 locus_tag LOCUS_14640 gene fdhD CDS 48127..50430 product FdhF/YdeP family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816272.1 transl_table 11 codon_start 1 locus_tag LOCUS_14650 CDS 50570..51241 product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931455.1 transl_table 11 codon_start 1 locus_tag LOCUS_14660 CDS 51234..51563 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14670 CDS complement(52017..52949) product DNA-binding transcriptional regulator LysR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000741816.1 transl_table 11 codon_start 1 locus_tag LOCUS_14680 gene lysR CDS 53112..53669 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14690 CDS 53662..54960 product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870182.1 transl_table 11 codon_start 1 locus_tag LOCUS_14700 CDS 54978..55979 product TRAP transporter substrate-binding protein DctP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870184.1 transl_table 11 codon_start 1 locus_tag LOCUS_14710 gene dctP CDS 56033..57160 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808671.1 transl_table 11 codon_start 1 locus_tag LOCUS_14720 CDS 57138..57470 product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037402017.1 transl_table 11 codon_start 1 locus_tag LOCUS_14730 CDS 57457..58857 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040457.1 transl_table 11 codon_start 1 locus_tag LOCUS_14740 CDS 58910..59266 product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070702.1 transl_table 11 codon_start 1 locus_tag LOCUS_14750 CDS complement(59903..60253) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14760 CDS complement(60250..61566) product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112975.1 transl_table 11 codon_start 1 locus_tag LOCUS_14770 CDS complement(61577..62950) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269384.1 transl_table 11 codon_start 1 locus_tag LOCUS_14780 CDS complement(63143..64570) product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533461.1 transl_table 11 codon_start 1 locus_tag LOCUS_14790 CDS complement(64574..65761) product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258212.1 transl_table 11 codon_start 1 locus_tag LOCUS_14800 CDS 66083..67789 product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707434.1 transl_table 11 codon_start 1 locus_tag LOCUS_14810 CDS complement(67862..68800) product transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200344113.1 transl_table 11 codon_start 1 locus_tag LOCUS_14820 gene gcvA CDS complement(69022..70368) product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531195.1 transl_table 11 codon_start 1 locus_tag LOCUS_14830 CDS 70858..71343 product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005304871.1 transl_table 11 codon_start 1 locus_tag LOCUS_14840 CDS 71432..71677 product Rho-binding antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000253074.1 transl_table 11 codon_start 1 locus_tag LOCUS_14850 CDS 71769..72143 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14860 CDS 72291..72491 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14870 CDS 72708..73232 product DUF2199 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222121.1 transl_table 11 codon_start 1 locus_tag LOCUS_14880 CDS complement(73240..74043) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14890 CDS complement(74206..74832) product DUF1826 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114143.1 transl_table 11 codon_start 1 locus_tag LOCUS_14900 CDS 74954..76162 product zinc metallochaperone GTPase ZigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099674.1 transl_table 11 codon_start 1 locus_tag LOCUS_14910 gene zigA CDS 76750..76992 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14920 CDS 77372..77851 product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074226.1 transl_table 11 codon_start 1 locus_tag LOCUS_14930 gene greB CDS 78289..80649 product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819165.1 transl_table 11 codon_start 1 locus_tag LOCUS_14940 CDS 80791..81654 product DUF817 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265558.1 transl_table 11 codon_start 1 locus_tag LOCUS_14950 CDS 81963..83828 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14960 CDS 83825..84208 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14970 CDS 84212..86332 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14980 CDS 86339..88480 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14990 CDS 88493..89602 product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888498.1 transl_table 11 codon_start 1 locus_tag LOCUS_15000 CDS 89767..90306 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15010 CDS 90326..90880 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15020 CDS 90942..91373 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15030 CDS 91370..92413 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15040 CDS 92410..95277 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15050 CDS 95417..96544 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15060 CDS 96537..97193 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15070 CDS 97190..97753 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15080 CDS 97750..98085 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15090 CDS 98116..99360 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15100 CDS 99388..100020 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15110 CDS 100131..100553 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261614.1 transl_table 11 codon_start 1 locus_tag LOCUS_15120 CDS complement(100490..101287) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15130 CDS 101373..102800 product mannose-1-phosphate guanyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000605946.1 transl_table 11 codon_start 1 locus_tag LOCUS_15140 gene cpsB CDS 103304..104539 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201417625.1 transl_table 11 codon_start 1 locus_tag LOCUS_15150 CDS complement(104573..106582) product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208846059.1 transl_table 11 codon_start 1 locus_tag LOCUS_15160 CDS complement(106573..108915) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15170 CDS complement(109102..109836) product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022781.1 transl_table 11 codon_start 1 locus_tag LOCUS_15180 CDS 110119..111576 product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001242456.1 transl_table 11 codon_start 1 locus_tag LOCUS_15190 CDS 111731..113239 product thymidine phosphorylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169161074.1 transl_table 11 codon_start 1 locus_tag LOCUS_15200 CDS 113236..114129 product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946758.1 transl_table 11 codon_start 1 locus_tag LOCUS_15210 CDS 114279..114680 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15220 CDS 114677..115363 product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092609.1 transl_table 11 codon_start 1 locus_tag LOCUS_15230 CDS 115376..116023 product YjfK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019237428.1 transl_table 11 codon_start 1 locus_tag LOCUS_15240 CDS 116328..116744 product DUF350 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483612.1 transl_table 11 codon_start 1 locus_tag LOCUS_15250 CDS 116754..117368 product DUF1190 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098745.1 transl_table 11 codon_start 1 locus_tag LOCUS_15260 CDS 117368..118534 product glutathionylspermidine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483628.1 transl_table 11 codon_start 1 locus_tag LOCUS_15270 CDS complement(118550..119905) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004555126.1 transl_table 11 codon_start 1 locus_tag LOCUS_15280 CDS 120104..120484 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940847.1 transl_table 11 codon_start 1 locus_tag LOCUS_15290 CDS complement(120560..121447) product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082726.1 transl_table 11 codon_start 1 locus_tag LOCUS_15300 gene cyoE CDS complement(121775..122098) product cytochrome o ubiquinol oxidase subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003375849.1 transl_table 11 codon_start 1 locus_tag LOCUS_15310 gene cyoD CDS complement(122095..122736) product cytochrome o ubiquinol oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086858.1 transl_table 11 codon_start 1 locus_tag LOCUS_15320 gene cyoC CDS complement(122736..124721) product cytochrome o ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112371.1 transl_table 11 codon_start 1 locus_tag LOCUS_15330 gene cyoB CDS complement(124723..125586) product cytochrome o ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001239449.1 transl_table 11 codon_start 1 locus_tag LOCUS_15340 gene cyoA CDS complement(125826..126140) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15350 CDS complement(126454..127062) product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349742.1 transl_table 11 codon_start 1 locus_tag LOCUS_15360 CDS 127253..127945 product pyrimidine 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000872931.1 transl_table 11 codon_start 1 locus_tag LOCUS_15370 gene yjjG CDS complement(128037..128954) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815158.1 transl_table 11 codon_start 1 locus_tag LOCUS_15380 CDS 129024..129626 product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004549943.1 transl_table 11 codon_start 1 locus_tag LOCUS_15390 CDS 129644..130513 product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770654.1 transl_table 11 codon_start 1 locus_tag LOCUS_15400 CDS complement(130568..131419) product bifunctional allantoicase/(S)-ureidoglycine aminohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969931.1 transl_table 11 codon_start 1 locus_tag LOCUS_15410 CDS 131586..132455 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705524.1 transl_table 11 codon_start 1 locus_tag LOCUS_15420 CDS complement(132559..133260) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037387279.1 transl_table 11 codon_start 1 locus_tag LOCUS_15430 CDS complement(133453..134247) product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969683.1 transl_table 11 codon_start 1 locus_tag LOCUS_15440 CDS complement(134333..135721) product NCS1 family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272625.1 transl_table 11 codon_start 1 locus_tag LOCUS_15450 CDS complement(135854..136588) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15460 CDS complement(136964..137680) product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073261.1 transl_table 11 codon_start 1 locus_tag LOCUS_15470 CDS complement(137784..138506) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476584.1 transl_table 11 codon_start 1 locus_tag LOCUS_15480 CDS complement(138644..139420) product pimeloyl-ACP methyl ester esterase BioH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704304.1 transl_table 11 codon_start 1 locus_tag LOCUS_15490 gene bioH CDS 139449..140144 product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704303.1 transl_table 11 codon_start 1 locus_tag LOCUS_15500 CDS 140216..140794 product Fe-S biogenesis protein NfuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704302.1 transl_table 11 codon_start 1 locus_tag LOCUS_15510 gene nfuA CDS complement(141106..142110) product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704301.1 transl_table 11 codon_start 1 locus_tag LOCUS_15520 gene gpsA CDS complement(142110..142589) product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704300.1 transl_table 11 codon_start 1 locus_tag LOCUS_15530 gene secB CDS complement(142620..143048) product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307875.1 transl_table 11 codon_start 1 locus_tag LOCUS_15540 CDS 143264..144796 product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043126577.1 transl_table 11 codon_start 1 locus_tag LOCUS_15550 gene gpmM CDS 144807..146033 product murein hydrolase activator EnvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704298.1 transl_table 11 codon_start 1 locus_tag LOCUS_15560 gene envC CDS complement(146053..146304) product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769636.1 transl_table 11 codon_start 1 locus_tag LOCUS_15570 CDS complement(146389..146946) product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529391.1 transl_table 11 codon_start 1 locus_tag LOCUS_15580 CDS 147064..147450 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15590 CDS 147492..148868 product class II fumarate hydratase FumC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112741.1 transl_table 11 codon_start 1 locus_tag LOCUS_15600 gene fumC CDS complement(149277..150284) product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704437.1 transl_table 11 codon_start 1 locus_tag LOCUS_15610 gene glpX CDS complement(150313..150963) product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308055.1 transl_table 11 codon_start 1 locus_tag LOCUS_15620 gene can CDS complement(151052..151924) product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704351.1 transl_table 11 codon_start 1 locus_tag LOCUS_15630 gene rpoH CDS complement(152099..153046) product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704350.1 transl_table 11 codon_start 1 locus_tag LOCUS_15640 gene ftsX CDS complement(153043..153708) product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704349.1 transl_table 11 codon_start 1 locus_tag LOCUS_15650 gene ftsE misc_feature complement(153709..>154908) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011704348.1:signal recognition particle-docking protein FtsY locus_tag LOCUS_15660 sequence09 source 1..152407 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(181..711) product menaquinone-dependent protoporphyrinogen IX dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024945460.1 transl_table 11 codon_start 1 locus_tag LOCUS_15670 gene hemG CDS complement(721..2178) product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260910.1 transl_table 11 codon_start 1 locus_tag LOCUS_15680 CDS complement(2216..2845) product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704168.1 transl_table 11 codon_start 1 locus_tag LOCUS_15690 CDS 3120..5264 product fatty acid oxidation complex subunit alpha FadB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704165.1 transl_table 11 codon_start 1 locus_tag LOCUS_15700 gene fadB CDS 5286..6461 product acetyl-CoA C-acyltransferase FadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704164.1 transl_table 11 codon_start 1 locus_tag LOCUS_15710 gene fadA CDS 7093..7332 product sulfurtransferase TusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307416.1 transl_table 11 codon_start 1 locus_tag LOCUS_15720 gene tusA CDS 7409..8335 product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390930.1 transl_table 11 codon_start 1 locus_tag LOCUS_15730 CDS complement(8387..9037) product OmpA family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369222.1 transl_table 11 codon_start 1 locus_tag LOCUS_15740 CDS complement(9124..9693) product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704156.1 transl_table 11 codon_start 1 locus_tag LOCUS_15750 CDS 9828..10739 product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209624.1 transl_table 11 codon_start 1 locus_tag LOCUS_15760 gene glyQ CDS 10749..12818 product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704155.1 transl_table 11 codon_start 1 locus_tag LOCUS_15770 gene glyS CDS 12944..13285 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15780 CDS 13447..14709 product valine--pyruvate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704054.1 transl_table 11 codon_start 1 locus_tag LOCUS_15790 CDS complement(14806..15231) product Hsp20 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072287.1 transl_table 11 codon_start 1 locus_tag LOCUS_15800 CDS complement(15787..17475) product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000502719.1 transl_table 11 codon_start 1 locus_tag LOCUS_15810 gene ilvD CDS complement(17534..20998) product cellulose synthase complex outer membrane protein BcsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817392.1 transl_table 11 codon_start 1 locus_tag LOCUS_15820 gene bcsC CDS complement(20980..22086) product cellulose synthase complex periplasmic endoglucanase BcsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817393.1 transl_table 11 codon_start 1 locus_tag LOCUS_15830 gene bcsZ CDS complement(22092..24335) product cellulose biosynthesis cyclic di-GMP-binding regulatory protein BcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026018077.1 transl_table 11 codon_start 1 locus_tag LOCUS_15840 gene bcsB CDS complement(24346..26937) product UDP-forming cellulose synthase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817395.1 transl_table 11 codon_start 1 locus_tag LOCUS_15850 gene bcsA CDS complement(26934..27671) product cellulose biosynthesis protein BcsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174891.1 transl_table 11 codon_start 1 locus_tag LOCUS_15860 gene bcsQ CDS complement(27662..27868) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15870 CDS complement(27905..29455) product cellulose biosynthesis protein BcsG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174899.1 transl_table 11 codon_start 1 locus_tag LOCUS_15880 gene bcsG CDS complement(29550..29753) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15890 CDS complement(29756..31303) product cellulose biosynthesis protein BcsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817396.1 transl_table 11 codon_start 1 locus_tag LOCUS_15900 gene bcsE CDS complement(31547..33964) product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704050.1 transl_table 11 codon_start 1 locus_tag LOCUS_15910 gene gyrB CDS complement(33969..35060) product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704049.1 transl_table 11 codon_start 1 locus_tag LOCUS_15920 gene recF CDS complement(35063..36166) product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704048.1 transl_table 11 codon_start 1 locus_tag LOCUS_15930 gene dnaN CDS complement(36180..37574) product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307141.1 transl_table 11 codon_start 1 locus_tag LOCUS_15940 gene dnaA CDS 37962..39563 product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868946.1 transl_table 11 codon_start 1 locus_tag LOCUS_15950 CDS 39547..41556 product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041602000.1 transl_table 11 codon_start 1 locus_tag LOCUS_15960 CDS 41622..42551 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104205.1 transl_table 11 codon_start 1 locus_tag LOCUS_15970 CDS 42735..43493 product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307144.1 transl_table 11 codon_start 1 locus_tag LOCUS_15980 CDS 43497..44162 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707929.1 transl_table 11 codon_start 1 locus_tag LOCUS_15990 CDS 44170..44922 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707928.1 transl_table 11 codon_start 1 locus_tag LOCUS_16000 CDS 45333..45695 product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707927.1 transl_table 11 codon_start 1 locus_tag LOCUS_16010 gene rnpA CDS 45905..47566 product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707925.1 transl_table 11 codon_start 1 locus_tag LOCUS_16020 gene yidC CDS 47853..49214 product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707924.1 transl_table 11 codon_start 1 locus_tag LOCUS_16030 gene mnmE CDS 49528..51816 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_210266672.1 transl_table 11 codon_start 1 locus_tag LOCUS_16040 CDS 51957..52223 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16050 CDS 52223..53542 product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262056.1 transl_table 11 codon_start 1 locus_tag LOCUS_16060 CDS 53834..54958 product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815525.1 transl_table 11 codon_start 1 locus_tag LOCUS_16070 CDS 55087..55440 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16080 CDS 55471..56460 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731536.1 transl_table 11 codon_start 1 locus_tag LOCUS_16090 CDS complement(56517..57437) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073194.1 transl_table 11 codon_start 1 locus_tag LOCUS_16100 CDS 57564..58040 product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482937.1 transl_table 11 codon_start 1 locus_tag LOCUS_16110 CDS 58158..59153 product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038653.1 transl_table 11 codon_start 1 locus_tag LOCUS_16120 CDS 59212..60171 product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106575.1 transl_table 11 codon_start 1 locus_tag LOCUS_16130 CDS 60228..60926 product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086661.1 transl_table 11 codon_start 1 locus_tag LOCUS_16140 CDS 61143..61727 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478295.1 transl_table 11 codon_start 1 locus_tag LOCUS_16150 CDS 61818..62975 product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198074.1 transl_table 11 codon_start 1 locus_tag LOCUS_16160 CDS 63003..64046 product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113689.1 transl_table 11 codon_start 1 locus_tag LOCUS_16170 CDS 64096..64725 product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_215270200.1 transl_table 11 codon_start 1 locus_tag LOCUS_16180 CDS 64879..65571 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16190 CDS 65937..68081 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16200 CDS complement(68174..69139) product TDT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705967.1 transl_table 11 codon_start 1 locus_tag LOCUS_16210 CDS 69232..70104 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705966.1 transl_table 11 codon_start 1 locus_tag LOCUS_16220 CDS 70435..71364 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527033.1 transl_table 11 codon_start 1 locus_tag LOCUS_16230 CDS 71558..72667 product NAD/NADP-dependent octopine/nopaline dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966697.1 transl_table 11 codon_start 1 locus_tag LOCUS_16240 CDS 72734..74143 product YfcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095368.1 transl_table 11 codon_start 1 locus_tag LOCUS_16250 CDS complement(74222..75442) product serine/threonine transporter SstT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073018.1 transl_table 11 codon_start 1 locus_tag LOCUS_16260 gene sstT CDS 75828..79922 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16270 CDS 80162..81079 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390138.1 transl_table 11 codon_start 1 locus_tag LOCUS_16280 CDS complement(81188..81367) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16290 CDS 81589..82770 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532240.1 transl_table 11 codon_start 1 locus_tag LOCUS_16300 CDS 82736..83683 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390136.1 transl_table 11 codon_start 1 locus_tag LOCUS_16310 CDS 83680..84420 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193559.1 transl_table 11 codon_start 1 locus_tag LOCUS_16320 CDS complement(84438..85118) product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378111.1 transl_table 11 codon_start 1 locus_tag LOCUS_16330 CDS complement(85402..86706) product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013841.1 transl_table 11 codon_start 1 locus_tag LOCUS_16340 CDS complement(86706..87479) product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803832.1 transl_table 11 codon_start 1 locus_tag LOCUS_16350 CDS 88212..89279 product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000210005.1 transl_table 11 codon_start 1 locus_tag LOCUS_16360 gene pyrC CDS 89666..91105 product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729850.1 transl_table 11 codon_start 1 locus_tag LOCUS_16370 CDS complement(91238..91609) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403970.1 transl_table 11 codon_start 1 locus_tag LOCUS_16380 CDS complement(91593..91802) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16390 CDS 91864..92133 product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115113.1 transl_table 11 codon_start 1 locus_tag LOCUS_16400 CDS 92123..92596 product DUF1456 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037422212.1 transl_table 11 codon_start 1 locus_tag LOCUS_16410 CDS complement(92664..93557) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312133.1 transl_table 11 codon_start 1 locus_tag LOCUS_16420 CDS 93721..94761 product YeiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986861.1 transl_table 11 codon_start 1 locus_tag LOCUS_16430 CDS complement(94824..95855) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001134026.1 transl_table 11 codon_start 1 locus_tag LOCUS_16440 CDS complement(95881..96786) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706382.1 transl_table 11 codon_start 1 locus_tag LOCUS_16450 CDS 96945..98645 product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706381.1 transl_table 11 codon_start 1 locus_tag LOCUS_16460 CDS 98719..99492 product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706380.1 transl_table 11 codon_start 1 locus_tag LOCUS_16470 CDS 99482..100900 product LutB/LldF family L-lactate oxidation iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706379.1 transl_table 11 codon_start 1 locus_tag LOCUS_16480 CDS 100900..101553 product LUD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706378.1 transl_table 11 codon_start 1 locus_tag LOCUS_16490 CDS 101605..104406 product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000188699.1 transl_table 11 codon_start 1 locus_tag LOCUS_16500 CDS 104505..105590 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16510 CDS complement(105581..107386) product hybrid-cluster NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819666.1 transl_table 11 codon_start 1 locus_tag LOCUS_16520 CDS 107484..107840 product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262907.1 transl_table 11 codon_start 1 locus_tag LOCUS_16530 CDS complement(107897..109249) product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000289187.1 transl_table 11 codon_start 1 locus_tag LOCUS_16540 gene gdhA CDS 109476..111191 product type II secretion system ATPase GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070691812.1 transl_table 11 codon_start 1 locus_tag LOCUS_16550 gene gspE CDS 111193..112407 product type II secretion system inner membrane protein GspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767347.1 transl_table 11 codon_start 1 locus_tag LOCUS_16560 gene gspF CDS 112419..112847 product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088760.1 transl_table 11 codon_start 1 locus_tag LOCUS_16570 gene gspG CDS 112885..113274 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16580 CDS 113267..113683 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16590 CDS 113680..114345 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16600 CDS 114335..115237 product type II secretion system protein GspK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035906.1 transl_table 11 codon_start 1 locus_tag LOCUS_16610 CDS 115249..116328 product PilN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035907.1 transl_table 11 codon_start 1 locus_tag LOCUS_16620 CDS 116325..116933 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16630 CDS 116930..117541 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16640 CDS 117538..119631 product type II secretion system secretin GspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533584.1 transl_table 11 codon_start 1 locus_tag LOCUS_16650 gene gspD CDS 120450..122528 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16660 CDS complement(122584..124923) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16670 CDS complement(125678..126973) product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539908.1 transl_table 11 codon_start 1 locus_tag LOCUS_16680 CDS 127214..128935 product ExeA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071510.1 transl_table 11 codon_start 1 locus_tag LOCUS_16690 CDS 129066..129632 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16700 CDS 129770..130216 product FMN-binding protein MioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016352400.1 transl_table 11 codon_start 1 locus_tag LOCUS_16710 gene mioC CDS 130706..132595 product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707918.1 transl_table 11 codon_start 1 locus_tag LOCUS_16720 gene mnmG CDS 132619..133254 product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707917.1 transl_table 11 codon_start 1 locus_tag LOCUS_16730 gene rsmG CDS 133264..134067 product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707916.1 transl_table 11 codon_start 1 locus_tag LOCUS_16740 CDS 134064..134969 product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707915.1 transl_table 11 codon_start 1 locus_tag LOCUS_16750 CDS 135160..135552 product ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029302496.1 transl_table 11 codon_start 1 locus_tag LOCUS_16760 CDS 135696..136340 product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707913.1 transl_table 11 codon_start 1 locus_tag LOCUS_16770 gene atpB CDS 136404..136628 product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000429386.1 transl_table 11 codon_start 1 locus_tag LOCUS_16780 gene atpE CDS 136678..137148 product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707912.1 transl_table 11 codon_start 1 locus_tag LOCUS_16790 gene atpF CDS 137162..137692 product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707911.1 transl_table 11 codon_start 1 locus_tag LOCUS_16800 gene atpH CDS 137707..139248 product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862367.1 transl_table 11 codon_start 1 locus_tag LOCUS_16810 gene atpA CDS 139291..140151 product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707909.1 transl_table 11 codon_start 1 locus_tag LOCUS_16820 gene atpG CDS 140185..141573 product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307215.1 transl_table 11 codon_start 1 locus_tag LOCUS_16830 gene atpD CDS 141592..142008 product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307217.1 transl_table 11 codon_start 1 locus_tag LOCUS_16840 CDS 142321..143685 product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707907.1 transl_table 11 codon_start 1 locus_tag LOCUS_16850 gene glmU CDS 144115..144891 product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005339356.1 transl_table 11 codon_start 1 locus_tag LOCUS_16860 CDS 144895..146727 product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707902.1 transl_table 11 codon_start 1 locus_tag LOCUS_16870 gene glmS CDS complement(146833..149571) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16880 CDS complement(149549..150652) product autoinducer 2-binding periplasmic protein LuxP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463467.1 transl_table 11 codon_start 1 locus_tag LOCUS_16890 CDS 151011..152216 product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210164.1 transl_table 11 codon_start 1 locus_tag LOCUS_16900 sequence10 source 1..140556 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(156..1562) product tRNA 5-hydroxyuridine modification protein YegQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704950.1 transl_table 11 codon_start 1 locus_tag LOCUS_16910 gene yegQ CDS complement(1725..2714) product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153502.1 transl_table 11 codon_start 1 locus_tag LOCUS_16920 gene gapA CDS complement(3138..3296) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16930 CDS 3679..5109 product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_102988105.1 transl_table 11 codon_start 1 locus_tag LOCUS_16940 CDS 5239..5517 product DUF1315 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707127.1 transl_table 11 codon_start 1 locus_tag LOCUS_16950 CDS 5791..6744 product DUF523 and DUF1722 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705026.1 transl_table 11 codon_start 1 locus_tag LOCUS_16960 CDS 6734..7579 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705027.1 transl_table 11 codon_start 1 locus_tag LOCUS_16970 CDS 7551..8960 product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705028.1 transl_table 11 codon_start 1 locus_tag LOCUS_16980 gene phrB CDS 8957..9379 product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705029.1 transl_table 11 codon_start 1 locus_tag LOCUS_16990 CDS 9376..10104 product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705030.1 transl_table 11 codon_start 1 locus_tag LOCUS_17000 CDS 10101..11348 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073248.1 transl_table 11 codon_start 1 locus_tag LOCUS_17010 CDS 11345..12064 product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705032.1 transl_table 11 codon_start 1 locus_tag LOCUS_17020 CDS 12076..13329 product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705033.1 transl_table 11 codon_start 1 locus_tag LOCUS_17030 CDS 13299..13784 product DUF2878 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103433.1 transl_table 11 codon_start 1 locus_tag LOCUS_17040 CDS 13784..14272 product chalcone isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819977.1 transl_table 11 codon_start 1 locus_tag LOCUS_17050 CDS 14274..14855 product DUF3833 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705036.1 transl_table 11 codon_start 1 locus_tag LOCUS_17060 CDS complement(15281..15880) product 5'-deoxynucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705878.1 transl_table 11 codon_start 1 locus_tag LOCUS_17070 gene yfbR CDS 15944..16240 product DUF1244 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768750.1 transl_table 11 codon_start 1 locus_tag LOCUS_17080 CDS complement(16324..17160) product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705222.1 transl_table 11 codon_start 1 locus_tag LOCUS_17090 gene purU CDS complement(17197..17658) product YchJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819879.1 transl_table 11 codon_start 1 locus_tag LOCUS_17100 CDS complement(17769..18722) product porin OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705193.1 transl_table 11 codon_start 1 locus_tag LOCUS_17110 gene ompA CDS 19176..19439 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705196.1 transl_table 11 codon_start 1 locus_tag LOCUS_17120 CDS 19591..20511 product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705173.1 transl_table 11 codon_start 1 locus_tag LOCUS_17130 CDS 20563..21174 product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005298548.1 transl_table 11 codon_start 1 locus_tag LOCUS_17140 CDS 21353..22165 product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706537.1 transl_table 11 codon_start 1 locus_tag LOCUS_17150 gene dapB CDS 22579..23715 product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706536.1 transl_table 11 codon_start 1 locus_tag LOCUS_17160 gene carA CDS 23733..26960 product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706535.1 transl_table 11 codon_start 1 locus_tag LOCUS_17170 gene carB CDS 27218..27421 product transcription antiterminator/RNA stability regulator CspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009874442.1 transl_table 11 codon_start 1 locus_tag LOCUS_17180 gene cspE CDS complement(27537..27956) product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706917.1 transl_table 11 codon_start 1 locus_tag LOCUS_17190 gene ruvX CDS complement(27953..28507) product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016351591.1 transl_table 11 codon_start 1 locus_tag LOCUS_17200 CDS complement(28580..29527) product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706914.1 transl_table 11 codon_start 1 locus_tag LOCUS_17210 gene gshB CDS complement(29524..30255) product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706913.1 transl_table 11 codon_start 1 locus_tag LOCUS_17220 gene rsmE CDS complement(30233..30937) product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060390007.1 transl_table 11 codon_start 1 locus_tag LOCUS_17230 CDS complement(31097..31567) product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705182.1 transl_table 11 codon_start 1 locus_tag LOCUS_17240 CDS complement(31564..32076) product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706911.1 transl_table 11 codon_start 1 locus_tag LOCUS_17250 CDS complement(32480..33640) product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817040.1 transl_table 11 codon_start 1 locus_tag LOCUS_17260 gene metK CDS 33896..35896 product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706909.1 transl_table 11 codon_start 1 locus_tag LOCUS_17270 gene tkt CDS 36710..37384 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17280 CDS 37560..37757 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17290 CDS complement(37894..38364) product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071597.1 transl_table 11 codon_start 1 locus_tag LOCUS_17300 CDS 38462..38725 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17310 CDS complement(38667..39995) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17320 CDS complement(39976..40656) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023812818.1 transl_table 11 codon_start 1 locus_tag LOCUS_17330 CDS 40807..41277 product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096939.1 transl_table 11 codon_start 1 locus_tag LOCUS_17340 CDS 41565..41984 product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479368.1 transl_table 11 codon_start 1 locus_tag LOCUS_17350 CDS 41987..42406 product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818372.1 transl_table 11 codon_start 1 locus_tag LOCUS_17360 CDS complement(42745..43209) product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704834.1 transl_table 11 codon_start 1 locus_tag LOCUS_17370 gene bcp CDS complement(43227..43754) product glycine cleavage system transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349586.1 transl_table 11 codon_start 1 locus_tag LOCUS_17380 CDS 43885..44772 product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704836.1 transl_table 11 codon_start 1 locus_tag LOCUS_17390 gene dapA CDS 44765..45772 product outer membrane protein assembly factor BamC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704837.1 transl_table 11 codon_start 1 locus_tag LOCUS_17400 gene bamC CDS 46041..48389 product DNA polymerase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000687840.1 transl_table 11 codon_start 1 locus_tag LOCUS_17410 CDS complement(48472..48699) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17420 CDS complement(48703..49374) product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208550.1 transl_table 11 codon_start 1 locus_tag LOCUS_17430 CDS complement(49371..50504) product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705377.1 transl_table 11 codon_start 1 locus_tag LOCUS_17440 gene dapE CDS complement(50550..50900) product ArsC family reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043162216.1 transl_table 11 codon_start 1 locus_tag LOCUS_17450 CDS 51451..52536 product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705188.1 transl_table 11 codon_start 1 locus_tag LOCUS_17460 CDS 52666..54363 product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705191.1 transl_table 11 codon_start 1 locus_tag LOCUS_17470 CDS 54709..56019 product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705880.1 transl_table 11 codon_start 1 locus_tag LOCUS_17480 gene tig CDS 56162..56731 product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482529.1 transl_table 11 codon_start 1 locus_tag LOCUS_17490 gene clpP CDS 56815..58095 product ATP-dependent protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005301524.1 transl_table 11 codon_start 1 locus_tag LOCUS_17500 gene clpX CDS 58233..60584 product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705882.1 transl_table 11 codon_start 1 locus_tag LOCUS_17510 gene lon CDS 60792..61070 product DNA-binding protein HU-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005315375.1 transl_table 11 codon_start 1 locus_tag LOCUS_17520 gene hupB CDS 61189..63084 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206817666.1 transl_table 11 codon_start 1 locus_tag LOCUS_17530 gene ppiD CDS 63382..63945 product UvrY/SirA/GacA family response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005386783.1 transl_table 11 codon_start 1 locus_tag LOCUS_17540 gene uvrY CDS 63952..65781 product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706578.1 transl_table 11 codon_start 1 locus_tag LOCUS_17550 gene uvrC CDS 65829..66377 product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706577.1 transl_table 11 codon_start 1 locus_tag LOCUS_17560 gene pgsA tRNA 66506..66579 product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00370 tRNA 66604..66690 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00380 CDS complement(66935..67471) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17570 CDS 67751..68347 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444495.1 transl_table 11 codon_start 1 locus_tag LOCUS_17580 CDS 68949..70100 product L-threonine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369197.1 transl_table 11 codon_start 1 locus_tag LOCUS_17590 gene yiaY CDS 70255..70542 product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771921.1 transl_table 11 codon_start 1 locus_tag LOCUS_17600 CDS complement(70600..71352) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388756.1 transl_table 11 codon_start 1 locus_tag LOCUS_17610 CDS complement(71379..72479) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764114.1 transl_table 11 codon_start 1 locus_tag LOCUS_17620 CDS complement(72481..73665) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419738.1 transl_table 11 codon_start 1 locus_tag LOCUS_17630 CDS complement(73791..74810) product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201215949.1 transl_table 11 codon_start 1 locus_tag LOCUS_17640 CDS complement(75068..75721) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215448.1 transl_table 11 codon_start 1 locus_tag LOCUS_17650 CDS complement(75721..76737) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479814.1 transl_table 11 codon_start 1 locus_tag LOCUS_17660 CDS complement(76737..77528) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091589.1 transl_table 11 codon_start 1 locus_tag LOCUS_17670 CDS complement(77521..78300) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091588.1 transl_table 11 codon_start 1 locus_tag LOCUS_17680 CDS complement(78612..79415) product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267123.1 transl_table 11 codon_start 1 locus_tag LOCUS_17690 CDS complement(79418..80470) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818921.1 transl_table 11 codon_start 1 locus_tag LOCUS_17700 CDS complement(80681..81544) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17710 CDS 81694..82938 product benzoate/H(+) symporter BenE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206210.1 transl_table 11 codon_start 1 locus_tag LOCUS_17720 gene benE CDS 83214..84104 product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268385.1 transl_table 11 codon_start 1 locus_tag LOCUS_17730 gene rarD CDS complement(84114..84995) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073590.1 transl_table 11 codon_start 1 locus_tag LOCUS_17740 CDS complement(85091..86080) product rhodanese-related sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072295.1 transl_table 11 codon_start 1 locus_tag LOCUS_17750 CDS complement(86259..87647) product L-cystine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046050999.1 transl_table 11 codon_start 1 locus_tag LOCUS_17760 CDS complement(87846..89159) product lytic murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338735.1 transl_table 11 codon_start 1 locus_tag LOCUS_17770 CDS complement(89608..90252) product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258121.1 transl_table 11 codon_start 1 locus_tag LOCUS_17780 CDS 90468..90782 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17790 CDS 90818..91300 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17800 CDS 91387..92256 product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763680.1 transl_table 11 codon_start 1 locus_tag LOCUS_17810 gene purU CDS 92296..94239 product bifunctional metallophosphatase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706940.1 transl_table 11 codon_start 1 locus_tag LOCUS_17820 CDS 94564..95103 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349563.1 transl_table 11 codon_start 1 locus_tag LOCUS_17830 CDS 95106..97001 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17840 CDS complement(97230..97466) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17850 CDS 97508..98437 product methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464610.1 transl_table 11 codon_start 1 locus_tag LOCUS_17860 gene prpB CDS 98430..99542 product 2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001271319.1 transl_table 11 codon_start 1 locus_tag LOCUS_17870 gene prpC CDS 99912..101363 product bifunctional 2-methylcitrate dehydratase/aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706120.1 transl_table 11 codon_start 1 locus_tag LOCUS_17880 CDS 101823..103178 product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459893.1 transl_table 11 codon_start 1 locus_tag LOCUS_17890 CDS 103598..104890 product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456001.1 transl_table 11 codon_start 1 locus_tag LOCUS_17900 CDS complement(105428..106828) product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705384.1 transl_table 11 codon_start 1 locus_tag LOCUS_17910 gene asnS CDS 107115..108431 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17920 CDS 108521..108721 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17930 CDS 109183..109395 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17940 CDS 109475..109993 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17950 CDS 110082..111332 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456587.1 transl_table 11 codon_start 1 locus_tag LOCUS_17960 CDS 111448..112245 product Flp pilus assembly protein CpaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456561.1 transl_table 11 codon_start 1 locus_tag LOCUS_17970 gene cpaB CDS 112280..113686 product type II and III secretion system protein family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456668.1 transl_table 11 codon_start 1 locus_tag LOCUS_17980 CDS 113737..114006 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17990 CDS 114035..115360 product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021451008.1 transl_table 11 codon_start 1 locus_tag LOCUS_18000 CDS 115360..115809 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18010 CDS 115806..116300 product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456608.1 transl_table 11 codon_start 1 locus_tag LOCUS_18020 CDS 116304..117521 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18030 CDS 117598..118905 product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456652.1 transl_table 11 codon_start 1 locus_tag LOCUS_18040 CDS 118917..119891 product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456615.1 transl_table 11 codon_start 1 locus_tag LOCUS_18050 CDS 119893..120840 product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456630.1 transl_table 11 codon_start 1 locus_tag LOCUS_18060 CDS 120982..121932 product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021450998.1 transl_table 11 codon_start 1 locus_tag LOCUS_18070 CDS complement(122136..123416) product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819662.1 transl_table 11 codon_start 1 locus_tag LOCUS_18080 gene bioA CDS 123525..124556 product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705387.1 transl_table 11 codon_start 1 locus_tag LOCUS_18090 gene bioB CDS 124991..126142 product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705388.1 transl_table 11 codon_start 1 locus_tag LOCUS_18100 gene bioF CDS 126142..126942 product malonyl-ACP O-methyltransferase BioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000246763.1 transl_table 11 codon_start 1 locus_tag LOCUS_18110 gene bioC CDS 126935..127618 product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705390.1 transl_table 11 codon_start 1 locus_tag LOCUS_18120 gene bioD CDS 127692..128570 product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705391.1 transl_table 11 codon_start 1 locus_tag LOCUS_18130 gene htpX CDS 128957..129796 product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001277248.1 transl_table 11 codon_start 1 locus_tag LOCUS_18140 CDS 129905..130882 product type I-F CRISPR-associated endonuclease Cas1f inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210191.1 transl_table 11 codon_start 1 locus_tag LOCUS_18150 gene cas1f CDS 130879..134265 product type I-F CRISPR-associated helicase Cas3f inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221142.1 transl_table 11 codon_start 1 locus_tag LOCUS_18160 gene cas3f CDS 134512..135777 product type I-F CRISPR-associated protein Csy1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415806.1 transl_table 11 codon_start 1 locus_tag LOCUS_18170 gene csy1 CDS 135774..136718 product type I-F CRISPR-associated protein Csy2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000120898.1 transl_table 11 codon_start 1 locus_tag LOCUS_18180 gene csy2 CDS 136749..137771 product type I-F CRISPR-associated protein Csy3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957412.1 transl_table 11 codon_start 1 locus_tag LOCUS_18190 gene csy3 CDS 137781..138413 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18200 repeat_region 138542..140429 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttcaccgccacccaggcggcttagaaa sequence11 source 1..135870 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(17..92) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00390 tRNA complement(120..195) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00400 CDS 409..588 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18210 CDS 1299..1907 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705821.1 transl_table 11 codon_start 1 locus_tag LOCUS_18220 CDS 1977..3185 product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106441.1 transl_table 11 codon_start 1 locus_tag LOCUS_18230 CDS 3227..3562 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18240 CDS 3675..5459 product class I poly(R)-hydroxyalkanoic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000486234.1 transl_table 11 codon_start 1 locus_tag LOCUS_18250 CDS 5679..7340 product glutamine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705426.1 transl_table 11 codon_start 1 locus_tag LOCUS_18260 gene glnS CDS complement(7400..7855) product ferric iron uptake transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705427.1 transl_table 11 codon_start 1 locus_tag LOCUS_18270 gene fur CDS 8011..8466 product DUF4442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024943809.1 transl_table 11 codon_start 1 locus_tag LOCUS_18280 CDS 8610..8852 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18290 CDS complement(8922..9827) product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478383.1 transl_table 11 codon_start 1 locus_tag LOCUS_18300 CDS complement(9934..10461) product flavodoxin FldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705429.1 transl_table 11 codon_start 1 locus_tag LOCUS_18310 gene fldA CDS complement(10508..10792) product LexA regulated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705430.1 transl_table 11 codon_start 1 locus_tag LOCUS_18320 gene ybfE CDS complement(10796..11020) product DUF2788 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705431.1 transl_table 11 codon_start 1 locus_tag LOCUS_18330 CDS complement(11074..11841) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705432.1 transl_table 11 codon_start 1 locus_tag LOCUS_18340 CDS 11960..12478 product replication initiation negative regulator SeqA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927592.1 transl_table 11 codon_start 1 locus_tag LOCUS_18350 gene seqA CDS 12548..14191 product phosphoglucomutase (alpha-D-glucose-1,6-bisphosphate-dependent) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705434.1 transl_table 11 codon_start 1 locus_tag LOCUS_18360 gene pgm CDS 14628..15653 product succinylglutamate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706669.1 transl_table 11 codon_start 1 locus_tag LOCUS_18370 gene astE CDS 15895..16758 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112677.1 transl_table 11 codon_start 1 locus_tag LOCUS_18380 CDS complement(16837..17391) product HPP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071599.1 transl_table 11 codon_start 1 locus_tag LOCUS_18390 CDS 17533..17742 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18400 tRNA 17794..17884 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00410 CDS complement(17948..18937) product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464586.1 transl_table 11 codon_start 1 locus_tag LOCUS_18410 CDS complement(19097..20233) product PatB family C-S lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706898.1 transl_table 11 codon_start 1 locus_tag LOCUS_18420 CDS complement(20294..21250) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706897.1 transl_table 11 codon_start 1 locus_tag LOCUS_18430 CDS complement(21353..22120) product YciK family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706896.1 transl_table 11 codon_start 1 locus_tag LOCUS_18440 CDS 22309..23331 product protease SohB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706895.1 transl_table 11 codon_start 1 locus_tag LOCUS_18450 gene sohB CDS complement(23411..24748) product N-succinylarginine dihydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706894.1 transl_table 11 codon_start 1 locus_tag LOCUS_18460 gene astB CDS 25084..27711 product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706893.1 transl_table 11 codon_start 1 locus_tag LOCUS_18470 gene topA CDS 27841..28005 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005303277.1 transl_table 11 codon_start 1 locus_tag LOCUS_18480 CDS complement(28027..28362) product MGMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706891.1 transl_table 11 codon_start 1 locus_tag LOCUS_18490 CDS complement(28366..30132) product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262987.1 transl_table 11 codon_start 1 locus_tag LOCUS_18500 gene ggt tRNA 30455..30530 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00420 tRNA 30542..30615 product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00430 CDS complement(30640..31443) product DUF1853 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207554.1 transl_table 11 codon_start 1 locus_tag LOCUS_18510 CDS 31495..32253 product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706625.1 transl_table 11 codon_start 1 locus_tag LOCUS_18520 CDS 32583..33956 product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704939.1 transl_table 11 codon_start 1 locus_tag LOCUS_18530 CDS 33956..34330 product Hpt domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705471.1 transl_table 11 codon_start 1 locus_tag LOCUS_18540 CDS 34788..35801 product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168084.1 transl_table 11 codon_start 1 locus_tag LOCUS_18550 gene moaA CDS 35866..36381 product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091240.1 transl_table 11 codon_start 1 locus_tag LOCUS_18560 gene moaB CDS 36378..36851 product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000080921.1 transl_table 11 codon_start 1 locus_tag LOCUS_18570 gene moaC CDS 36848..37096 product molybdopterin synthase sulfur carrier subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705488.1 transl_table 11 codon_start 1 locus_tag LOCUS_18580 gene moaD CDS 37098..37544 product molybdopterin synthase catalytic subunit MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705489.1 transl_table 11 codon_start 1 locus_tag LOCUS_18590 gene moaE CDS complement(37948..38994) product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038157782.1 transl_table 11 codon_start 1 locus_tag LOCUS_18600 CDS 39250..40056 product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706499.1 transl_table 11 codon_start 1 locus_tag LOCUS_18610 CDS 40072..40914 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097867.1 transl_table 11 codon_start 1 locus_tag LOCUS_18620 CDS complement(40951..41262) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18630 CDS complement(41434..41691) product DUF1289 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073414.1 transl_table 11 codon_start 1 locus_tag LOCUS_18640 CDS complement(42175..43449) product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525489.1 transl_table 11 codon_start 1 locus_tag LOCUS_18650 CDS complement(43523..44881) product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112937.1 transl_table 11 codon_start 1 locus_tag LOCUS_18660 CDS 45117..46445 product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707799.1 transl_table 11 codon_start 1 locus_tag LOCUS_18670 CDS 46489..47850 product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707798.1 transl_table 11 codon_start 1 locus_tag LOCUS_18680 CDS 47870..48976 product spermidine/putrescine ABC transporter substrate-binding protein PotF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208762.1 transl_table 11 codon_start 1 locus_tag LOCUS_18690 gene potF CDS 49416..50537 product putrescine ABC transporter ATP-binding subunit PotG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000995999.1 transl_table 11 codon_start 1 locus_tag LOCUS_18700 gene potG CDS 50548..51441 product putrescine ABC transporter permease PotH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367525.1 transl_table 11 codon_start 1 locus_tag LOCUS_18710 gene potH CDS 51445..52296 product putrescine ABC transporter permease PotI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001061634.1 transl_table 11 codon_start 1 locus_tag LOCUS_18720 gene potI CDS 52307..52852 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972947.1 transl_table 11 codon_start 1 locus_tag LOCUS_18730 CDS 53004..54125 product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704256.1 transl_table 11 codon_start 1 locus_tag LOCUS_18740 gene ald CDS 54161..54571 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18750 CDS 54564..55841 product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482405.1 transl_table 11 codon_start 1 locus_tag LOCUS_18760 CDS complement(55893..57230) product lysine-sensitive aspartokinase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706390.1 transl_table 11 codon_start 1 locus_tag LOCUS_18770 gene lysC CDS complement(57544..58872) product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706389.1 transl_table 11 codon_start 1 locus_tag LOCUS_18780 gene argA CDS 59126..60571 product sodium:proton antiporter NhaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482814.1 transl_table 11 codon_start 1 locus_tag LOCUS_18790 gene nhaD CDS complement(61140..61532) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18800 CDS complement(61830..64397) product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704330.1 transl_table 11 codon_start 1 locus_tag LOCUS_18810 CDS complement(64543..65511) product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349123.1 transl_table 11 codon_start 1 locus_tag LOCUS_18820 CDS complement(65702..66943) product D-amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095928.1 transl_table 11 codon_start 1 locus_tag LOCUS_18830 CDS complement(66921..67220) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18840 CDS complement(67192..67977) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051633.1 transl_table 11 codon_start 1 locus_tag LOCUS_18850 CDS complement(67974..68975) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693803.1 transl_table 11 codon_start 1 locus_tag LOCUS_18860 CDS complement(68972..69655) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808030.1 transl_table 11 codon_start 1 locus_tag LOCUS_18870 CDS complement(69727..70476) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064578.1 transl_table 11 codon_start 1 locus_tag LOCUS_18880 CDS complement(70487..71938) product acyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012416341.1 transl_table 11 codon_start 1 locus_tag LOCUS_18890 CDS complement(71940..73016) product coenzyme F390 synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068525.1 transl_table 11 codon_start 1 locus_tag LOCUS_18900 CDS complement(73258..73428) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18910 CDS complement(73441..73998) product TMEM165/GDT1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010633534.1 transl_table 11 codon_start 1 locus_tag LOCUS_18920 CDS complement(74250..74570) product translation initiation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043123987.1 transl_table 11 codon_start 1 locus_tag LOCUS_18930 CDS complement(74599..75741) product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705422.1 transl_table 11 codon_start 1 locus_tag LOCUS_18940 gene nagA CDS complement(75750..76553) product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367707.1 transl_table 11 codon_start 1 locus_tag LOCUS_18950 gene nagB CDS 76673..78175 product N-acetylglucosamine-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001023164.1 transl_table 11 codon_start 1 locus_tag LOCUS_18960 gene nagE tRNA complement(78751..78826) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00440 CDS 78982..80982 product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706281.1 transl_table 11 codon_start 1 locus_tag LOCUS_18970 gene uvrB CDS complement(81069..81539) product CreA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000935051.1 transl_table 11 codon_start 1 locus_tag LOCUS_18980 CDS 81728..82198 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18990 CDS 82195..82626 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19000 CDS 82700..83158 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19010 CDS complement(83267..84214) product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705843.1 transl_table 11 codon_start 1 locus_tag LOCUS_19020 gene corA CDS 84407..84901 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19030 CDS complement(84906..86897) product bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000683799.1 transl_table 11 codon_start 1 locus_tag LOCUS_19040 gene mnmC CDS 87003..88217 product beta-ketoacyl-ACP synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705793.1 transl_table 11 codon_start 1 locus_tag LOCUS_19050 gene fabB CDS complement(88296..89027) product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706498.1 transl_table 11 codon_start 1 locus_tag LOCUS_19060 CDS 89173..90276 product 4-phosphoerythronate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706497.1 transl_table 11 codon_start 1 locus_tag LOCUS_19070 CDS 90510..91304 product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706494.1 transl_table 11 codon_start 1 locus_tag LOCUS_19080 gene truA CDS 91586..92449 product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706493.1 transl_table 11 codon_start 1 locus_tag LOCUS_19090 gene accD CDS 92449..93684 product bifunctional tetrahydrofolate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043123896.1 transl_table 11 codon_start 1 locus_tag LOCUS_19100 gene folC CDS 94208..94426 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19110 CDS complement(94725..95795) product agmatine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704695.1 transl_table 11 codon_start 1 locus_tag LOCUS_19120 gene aguA CDS complement(95795..96685) product N-carbamoylputrescine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209979.1 transl_table 11 codon_start 1 locus_tag LOCUS_19130 gene aguB CDS 96887..97789 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819969.1 transl_table 11 codon_start 1 locus_tag LOCUS_19140 CDS complement(98064..99386) product Na+/H+ antiporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706460.1 transl_table 11 codon_start 1 locus_tag LOCUS_19150 CDS 99624..100229 product peroxiredoxin C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420579.1 transl_table 11 codon_start 1 locus_tag LOCUS_19160 CDS complement(100329..100574) product TIGR02647 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003344490.1 transl_table 11 codon_start 1 locus_tag LOCUS_19170 CDS 100745..102223 product molybdate ABC transporter ATP-binding protein ModF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000096859.1 transl_table 11 codon_start 1 locus_tag LOCUS_19180 gene modF CDS 102437..103144 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478128.1 transl_table 11 codon_start 1 locus_tag LOCUS_19190 CDS complement(103202..103918) product ribonuclease T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029300258.1 transl_table 11 codon_start 1 locus_tag LOCUS_19200 gene rnt tRNA 104163..104250 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00450 CDS complement(104254..104553) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19210 CDS 104588..105103 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19220 note possible pseudo, internal stop codon, frameshifted CDS 105022..105222 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19230 note possible pseudo, internal stop codon, frameshifted CDS 105234..105452 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19240 note possible pseudo, internal stop codon, frameshifted CDS 105527..105868 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19250 CDS complement(105955..106653) product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261713.1 transl_table 11 codon_start 1 locus_tag LOCUS_19260 CDS 106777..107376 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043127834.1 transl_table 11 codon_start 1 locus_tag LOCUS_19270 CDS 107555..109225 product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705768.1 transl_table 11 codon_start 1 locus_tag LOCUS_19280 CDS complement(109382..110311) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705681.1 transl_table 11 codon_start 1 locus_tag LOCUS_19290 CDS complement(110385..111065) product DUF2982 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705682.1 transl_table 11 codon_start 1 locus_tag LOCUS_19300 CDS 111123..111848 product oxygen-insensitive NADPH nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705684.1 transl_table 11 codon_start 1 locus_tag LOCUS_19310 gene nfsA CDS complement(111915..112352) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010635648.1 transl_table 11 codon_start 1 locus_tag LOCUS_19320 CDS 112655..112855 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19330 CDS 113122..113256 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19340 CDS 113587..114099 product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705868.1 transl_table 11 codon_start 1 locus_tag LOCUS_19350 gene sixA CDS 114145..114357 product DUF1107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016350921.1 transl_table 11 codon_start 1 locus_tag LOCUS_19360 CDS complement(114651..115175) product endonuclease SmrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171938.1 transl_table 11 codon_start 1 locus_tag LOCUS_19370 gene smrB CDS 115225..116145 product 50S ribosomal protein L3 N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706198.1 transl_table 11 codon_start 1 locus_tag LOCUS_19380 gene prmB CDS 116168..117253 product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706197.1 transl_table 11 codon_start 1 locus_tag LOCUS_19390 gene aroC CDS 117333..117857 product elongation factor P hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365544.1 transl_table 11 codon_start 1 locus_tag LOCUS_19400 CDS 117873..119003 product ATP-NAD kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705766.1 transl_table 11 codon_start 1 locus_tag LOCUS_19410 CDS 119004..119300 product YfcL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705767.1 transl_table 11 codon_start 1 locus_tag LOCUS_19420 CDS complement(119550..121472) product sulfate adenylyltransferase subunit CysN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919356.1 transl_table 11 codon_start 1 locus_tag LOCUS_19430 gene cysN CDS complement(121472..122371) product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_175227789.1 transl_table 11 codon_start 1 locus_tag LOCUS_19440 gene cysD CDS 122493..124220 product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707307.1 transl_table 11 codon_start 1 locus_tag LOCUS_19450 CDS complement(124848..125606) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19460 CDS 126169..126504 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19470 CDS 126684..126908 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19480 CDS 127317..127694 product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972172.1 transl_table 11 codon_start 1 locus_tag LOCUS_19490 CDS 127947..128228 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19500 CDS complement(128421..129329) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19510 CDS complement(129319..130131) product sigma factor SigB/phosphatase RsbP regulator RsbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228292.1 transl_table 11 codon_start 1 locus_tag LOCUS_19520 gene rsbQ CDS 130936..131622 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103641.1 transl_table 11 codon_start 1 locus_tag LOCUS_19530 CDS 131613..134111 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268626.1 transl_table 11 codon_start 1 locus_tag LOCUS_19540 CDS 134111..135334 product lipocalin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974691.1 transl_table 11 codon_start 1 locus_tag LOCUS_19550 sequence12 source 1..123326 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(508..1971) product betaine-aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477313.1 transl_table 11 codon_start 1 locus_tag LOCUS_19560 gene betB CDS complement(1962..2570) product transcriptional regulator BetI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001335745.1 transl_table 11 codon_start 1 locus_tag LOCUS_19570 gene betI CDS complement(2799..3842) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764509.1 transl_table 11 codon_start 1 locus_tag LOCUS_19580 CDS 4187..5440 product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269187.1 transl_table 11 codon_start 1 locus_tag LOCUS_19590 CDS 5506..6759 product sarcosine oxidase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003148382.1 transl_table 11 codon_start 1 locus_tag LOCUS_19600 CDS 6770..7057 product sarcosine oxidase subunit delta family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096781.1 transl_table 11 codon_start 1 locus_tag LOCUS_19610 CDS 7054..10083 product sarcosine oxidase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003142077.1 transl_table 11 codon_start 1 locus_tag LOCUS_19620 CDS 10076..10705 product sarcosine oxidase subunit gamma family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103144.1 transl_table 11 codon_start 1 locus_tag LOCUS_19630 gene soxG CDS 10862..11728 product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763680.1 transl_table 11 codon_start 1 locus_tag LOCUS_19640 gene purU CDS 11848..12192 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090818.1 transl_table 11 codon_start 1 locus_tag LOCUS_19650 CDS complement(12620..12901) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19660 CDS 13690..15006 product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112975.1 transl_table 11 codon_start 1 locus_tag LOCUS_19670 CDS 15199..15828 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19680 CDS 15860..16339 product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027835.1 transl_table 11 codon_start 1 locus_tag LOCUS_19690 CDS complement(16347..17897) product transcriptional regulator TyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705761.1 transl_table 11 codon_start 1 locus_tag LOCUS_19700 gene tyrR CDS 18126..18686 product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964091.1 transl_table 11 codon_start 1 locus_tag LOCUS_19710 CDS 18699..20123 product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212033.1 transl_table 11 codon_start 1 locus_tag LOCUS_19720 CDS 20293..21681 product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707874.1 transl_table 11 codon_start 1 locus_tag LOCUS_19730 gene ccoG CDS 21822..22139 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19740 CDS 22161..22556 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19750 CDS complement(22504..23088) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19760 CDS complement(23475..24299) product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000718969.1 transl_table 11 codon_start 1 locus_tag LOCUS_19770 CDS complement(24302..25360) product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193123.1 transl_table 11 codon_start 1 locus_tag LOCUS_19780 gene cobT CDS complement(25588..28707) product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707626.1 transl_table 11 codon_start 1 locus_tag LOCUS_19790 CDS complement(28835..30664) product SmdB family multidrug efflux ABC transporter permease/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095870.1 transl_table 11 codon_start 1 locus_tag LOCUS_19800 CDS complement(30654..32387) product SmdA family multidrug ABC transporter permease/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208629.1 transl_table 11 codon_start 1 locus_tag LOCUS_19810 CDS complement(32409..33119) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19820 CDS 33193..33759 product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404323.1 transl_table 11 codon_start 1 locus_tag LOCUS_19830 gene msrA CDS complement(33710..34255) product molybdopterin-guanine dinucleotide biosynthesis protein MobB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217538.1 transl_table 11 codon_start 1 locus_tag LOCUS_19840 gene mobB CDS 34366..36057 product autotransporter assembly complex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819691.1 transl_table 11 codon_start 1 locus_tag LOCUS_19850 CDS 36054..39737 product translocation/assembly module TamB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705451.1 transl_table 11 codon_start 1 locus_tag LOCUS_19860 CDS 40347..42164 product Wzy polymerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818252.1 transl_table 11 codon_start 1 locus_tag LOCUS_19870 CDS complement(42453..42842) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19880 tRNA complement(43066..43142) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00460 CDS 43496..43846 product purine nucleoside phosphoramidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010633658.1 transl_table 11 codon_start 1 locus_tag LOCUS_19890 gene hinT CDS 43855..44469 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010635332.1 transl_table 11 codon_start 1 locus_tag LOCUS_19900 CDS 44459..45286 product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206817953.1 transl_table 11 codon_start 1 locus_tag LOCUS_19910 CDS 45365..46381 product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000529291.1 transl_table 11 codon_start 1 locus_tag LOCUS_19920 gene nagZ CDS 46550..47842 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706404.1 transl_table 11 codon_start 1 locus_tag LOCUS_19930 CDS 48179..48634 product ferredoxin-type protein NapF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477204.1 transl_table 11 codon_start 1 locus_tag LOCUS_19940 gene napF CDS 48621..48911 product chaperone NapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463501.1 transl_table 11 codon_start 1 locus_tag LOCUS_19950 CDS 48921..51413 product periplasmic nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000784576.1 transl_table 11 codon_start 1 locus_tag LOCUS_19960 gene napA CDS 51483..51965 product nitrate reductase cytochrome c-type subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262390.1 transl_table 11 codon_start 1 locus_tag LOCUS_19970 CDS 52064..52567 product NapC/NirT family cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420448.1 transl_table 11 codon_start 1 locus_tag LOCUS_19980 CDS 53009..53146 product TIGR02808 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420446.1 transl_table 11 codon_start 1 locus_tag LOCUS_19990 CDS complement(53910..54566) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20000 CDS complement(54929..55471) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20010 CDS complement(55590..55856) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20020 CDS 56846..58336 product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072221.1 transl_table 11 codon_start 1 locus_tag LOCUS_20030 gene yegD CDS complement(58359..59006) product DsbA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268731.1 transl_table 11 codon_start 1 locus_tag LOCUS_20040 CDS complement(59035..59316) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20050 CDS complement(59408..60652) product DUF3422 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391173.1 transl_table 11 codon_start 1 locus_tag LOCUS_20060 CDS complement(61035..62486) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028024693.1 transl_table 11 codon_start 1 locus_tag LOCUS_20070 CDS complement(62608..66042) product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705873.1 transl_table 11 codon_start 1 locus_tag LOCUS_20080 gene mfd CDS complement(66039..66311) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20090 CDS 66380..67591 product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705875.1 transl_table 11 codon_start 1 locus_tag LOCUS_20100 CDS 67584..68297 product lipoprotein-releasing ABC transporter ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206817672.1 transl_table 11 codon_start 1 locus_tag LOCUS_20110 gene lolD CDS 68297..69538 product lipoprotein-releasing ABC transporter permease subunit LolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705877.1 transl_table 11 codon_start 1 locus_tag LOCUS_20120 gene lolE CDS complement(69547..69738) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20130 CDS complement(69763..70269) product DUF2062 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091165.1 transl_table 11 codon_start 1 locus_tag LOCUS_20140 CDS complement(70269..70781) product DUF2062 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072737.1 transl_table 11 codon_start 1 locus_tag LOCUS_20150 CDS 70938..73043 product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818161.1 transl_table 11 codon_start 1 locus_tag LOCUS_20160 CDS 73071..74822 product lipid A ABC transporter ATP-binding protein/permease MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706583.1 transl_table 11 codon_start 1 locus_tag LOCUS_20170 gene msbA CDS 74822..75784 product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706582.1 transl_table 11 codon_start 1 locus_tag LOCUS_20180 gene lpxK CDS 75774..75962 product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706581.1 transl_table 11 codon_start 1 locus_tag LOCUS_20190 CDS 75959..76708 product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706580.1 transl_table 11 codon_start 1 locus_tag LOCUS_20200 gene kdsB CDS 76819..77838 product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705872.1 transl_table 11 codon_start 1 locus_tag LOCUS_20210 gene fbp CDS complement(78239..79525) product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005300205.1 transl_table 11 codon_start 1 locus_tag LOCUS_20220 CDS complement(79652..79858) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20230 CDS 79923..80321 product succinate dehydrogenase cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478785.1 transl_table 11 codon_start 1 locus_tag LOCUS_20240 gene sdhC CDS 80315..80659 product succinate dehydrogenase, hydrophobic membrane anchor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705796.1 transl_table 11 codon_start 1 locus_tag LOCUS_20250 gene sdhD CDS 80652..82427 product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705797.1 transl_table 11 codon_start 1 locus_tag LOCUS_20260 gene sdhA CDS 82443..83159 product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705798.1 transl_table 11 codon_start 1 locus_tag LOCUS_20270 CDS 83255..86068 product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043162312.1 transl_table 11 codon_start 1 locus_tag LOCUS_20280 gene sucA CDS 86087..87301 product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705800.1 transl_table 11 codon_start 1 locus_tag LOCUS_20290 gene odhB CDS 87420..88586 product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705801.1 transl_table 11 codon_start 1 locus_tag LOCUS_20300 gene sucC CDS 88591..89463 product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000025475.1 transl_table 11 codon_start 1 locus_tag LOCUS_20310 gene sucD CDS complement(89598..90098) product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172875.1 transl_table 11 codon_start 1 locus_tag LOCUS_20320 CDS complement(90207..91559) product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261371.1 transl_table 11 codon_start 1 locus_tag LOCUS_20330 gene xseA CDS 91664..93181 product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705859.1 transl_table 11 codon_start 1 locus_tag LOCUS_20340 gene guaB CDS 93275..94852 product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138293.1 transl_table 11 codon_start 1 locus_tag LOCUS_20350 gene guaA CDS 95146..96333 product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039727.1 transl_table 11 codon_start 1 locus_tag LOCUS_20360 CDS 96542..97726 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095387.1 transl_table 11 codon_start 1 locus_tag LOCUS_20370 CDS 97731..98237 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20380 CDS complement(98449..98931) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20390 CDS 99541..99771 product AlpA family phage regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388106.1 transl_table 11 codon_start 1 locus_tag LOCUS_20400 CDS 99773..100600 product helicase RepA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000880559.1 transl_table 11 codon_start 1 locus_tag LOCUS_20410 CDS 100587..101438 product replication protein C, IncQ-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000240536.1 transl_table 11 codon_start 1 locus_tag LOCUS_20420 gene repC CDS 102767..102949 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20430 CDS 103027..103317 product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001232701.1 transl_table 11 codon_start 1 locus_tag LOCUS_20440 CDS complement(103506..105128) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20450 CDS 105194..106486 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20460 CDS 107702..108154 product DUF302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053808215.1 transl_table 11 codon_start 1 locus_tag LOCUS_20470 CDS 109246..109554 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20480 CDS 109551..109745 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20490 CDS 110170..110427 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20500 note possible pseudo, frameshifted CDS 110440..111690 product glutamate dehydrogenase GdhA2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902870.1 transl_table 11 codon_start 1 locus_tag LOCUS_20510 gene gdhA2 CDS 111788..112063 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20520 CDS 112242..112400 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20530 CDS 112407..112631 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20540 CDS 113507..114727 product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640436.1 transl_table 11 codon_start 1 locus_tag LOCUS_20550 CDS 114923..115477 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20560 CDS complement(115904..116641) product PRC-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333519.1 transl_table 11 codon_start 1 locus_tag LOCUS_20570 CDS complement(116725..117042) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20580 CDS complement(117079..118242) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933801.1 transl_table 11 codon_start 1 locus_tag LOCUS_20590 CDS complement(118748..120076) product DUF2254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119919.1 transl_table 11 codon_start 1 locus_tag LOCUS_20600 CDS complement(120121..120792) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20610 CDS complement(120755..121003) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20620 CDS complement(121525..122889) product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119920.1 transl_table 11 codon_start 1 locus_tag LOCUS_20630 sequence13 source 1..107394 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 430..630 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20640 CDS 754..1140 product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819067.1 transl_table 11 codon_start 1 locus_tag LOCUS_20650 gene crcB CDS 1198..1953 product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704116.1 transl_table 11 codon_start 1 locus_tag LOCUS_20660 gene ubiE CDS 1953..2573 product SCP2 sterol-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704117.1 transl_table 11 codon_start 1 locus_tag LOCUS_20670 CDS 2570..4207 product ubiquinone biosynthesis regulatory protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704118.1 transl_table 11 codon_start 1 locus_tag LOCUS_20680 gene ubiB CDS 4291..4545 product Sec-independent protein translocase subunit TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456852.1 transl_table 11 codon_start 1 locus_tag LOCUS_20690 gene tatA CDS 4548..4919 product Sec-independent protein translocase protein TatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704120.1 transl_table 11 codon_start 1 locus_tag LOCUS_20700 gene tatB CDS 4920..5669 product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704121.1 transl_table 11 codon_start 1 locus_tag LOCUS_20710 gene tatC CDS 5666..6445 product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704122.1 transl_table 11 codon_start 1 locus_tag LOCUS_20720 CDS 6465..7478 product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704123.1 transl_table 11 codon_start 1 locus_tag LOCUS_20730 gene hemB CDS complement(7521..9011) product guanosine-5'-triphosphate,3'-diphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704128.1 transl_table 11 codon_start 1 locus_tag LOCUS_20740 gene gppA CDS complement(9017..10315) product ATP-dependent RNA helicase RhlB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704129.1 transl_table 11 codon_start 1 locus_tag LOCUS_20750 gene rhlB CDS 10432..10758 product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307306.1 transl_table 11 codon_start 1 locus_tag LOCUS_20760 gene trxA CDS 10944..12209 product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307308.1 transl_table 11 codon_start 1 locus_tag LOCUS_20770 gene rho CDS 12323..13804 product 4-hydroxy-3-polyprenylbenzoate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704131.1 transl_table 11 codon_start 1 locus_tag LOCUS_20780 gene ubiD CDS 13841..14536 product NAD(P)H-flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704132.1 transl_table 11 codon_start 1 locus_tag LOCUS_20790 gene fre CDS complement(14567..14746) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20800 CDS complement(14733..14999) product accessory factor UbiK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307315.1 transl_table 11 codon_start 1 locus_tag LOCUS_20810 CDS 15119..16165 product ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459829.1 transl_table 11 codon_start 1 locus_tag LOCUS_20820 CDS complement(16734..17618) product HTH-type transcriptional activator IlvY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704174.1 transl_table 11 codon_start 1 locus_tag LOCUS_20830 gene ilvY CDS 17772..19259 product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000024919.1 transl_table 11 codon_start 1 locus_tag LOCUS_20840 gene ilvC CDS 19788..20570 product tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707894.1 transl_table 11 codon_start 1 locus_tag LOCUS_20850 gene tcdA CDS complement(20567..20743) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20860 CDS complement(21016..21435) product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_182976181.1 transl_table 11 codon_start 1 locus_tag LOCUS_20870 CDS complement(21435..22655) product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707892.1 transl_table 11 codon_start 1 locus_tag LOCUS_20880 CDS 22867..24882 product DNA helicase Rep inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707891.1 transl_table 11 codon_start 1 locus_tag LOCUS_20890 gene rep CDS 25264..25491 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20900 CDS complement(25470..25904) product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024945508.1 transl_table 11 codon_start 1 locus_tag LOCUS_20910 CDS 26140..26676 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067697.1 transl_table 11 codon_start 1 locus_tag LOCUS_20920 CDS 26847..27467 product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039939.1 transl_table 11 codon_start 1 locus_tag LOCUS_20930 CDS complement(27499..28407) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012533894.1 transl_table 11 codon_start 1 locus_tag LOCUS_20940 CDS 28533..29744 product exonuclease subunit SbcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208687.1 transl_table 11 codon_start 1 locus_tag LOCUS_20950 gene sbcD CDS 29741..33163 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20960 CDS complement(33377..34840) product DUF3360 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457552.1 transl_table 11 codon_start 1 locus_tag LOCUS_20970 CDS 35090..35773 product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037430.1 transl_table 11 codon_start 1 locus_tag LOCUS_20980 CDS 35832..37133 product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210192.1 transl_table 11 codon_start 1 locus_tag LOCUS_20990 CDS 37676..38311 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21000 CDS 38476..38679 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21010 CDS 38792..39355 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21020 CDS 39367..39819 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21030 CDS 40096..41340 product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417604.1 transl_table 11 codon_start 1 locus_tag LOCUS_21040 CDS 41343..42323 product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088309.1 transl_table 11 codon_start 1 locus_tag LOCUS_21050 CDS complement(42420..43493) product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073761.1 transl_table 11 codon_start 1 locus_tag LOCUS_21060 CDS complement(43493..44104) product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073762.1 transl_table 11 codon_start 1 locus_tag LOCUS_21070 CDS complement(44234..44728) product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705787.1 transl_table 11 codon_start 1 locus_tag LOCUS_21080 CDS complement(44872..45228) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209409.1 transl_table 11 codon_start 1 locus_tag LOCUS_21090 CDS complement(45222..45665) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21100 CDS complement(45838..48114) product nitric-oxide reductase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980966.1 transl_table 11 codon_start 1 locus_tag LOCUS_21110 CDS complement(48107..48784) product iron-sulfur cluster repair protein YtfE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694400.1 transl_table 11 codon_start 1 locus_tag LOCUS_21120 gene ytfE CDS 48937..50496 product nitric oxide reductase transcriptional regulator NorR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113388.1 transl_table 11 codon_start 1 locus_tag LOCUS_21130 gene norR CDS 50585..51166 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21140 CDS complement(51580..52866) product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461221.1 transl_table 11 codon_start 1 locus_tag LOCUS_21150 CDS complement(52920..53567) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21160 CDS complement(53677..54687) product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969379.1 transl_table 11 codon_start 1 locus_tag LOCUS_21170 CDS complement(55111..55869) product MipA/OmpV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121650542.1 transl_table 11 codon_start 1 locus_tag LOCUS_21180 CDS complement(56228..58459) product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113369.1 transl_table 11 codon_start 1 locus_tag LOCUS_21190 CDS complement(58680..60143) product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925621.1 transl_table 11 codon_start 1 locus_tag LOCUS_21200 CDS complement(60361..61689) product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458380.1 transl_table 11 codon_start 1 locus_tag LOCUS_21210 CDS complement(61994..63202) product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119782.1 transl_table 11 codon_start 1 locus_tag LOCUS_21220 CDS complement(63409..64785) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261856.1 transl_table 11 codon_start 1 locus_tag LOCUS_21230 CDS 64951..65250 product DUF2960 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707214.1 transl_table 11 codon_start 1 locus_tag LOCUS_21240 CDS 65480..67309 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21250 CDS 67566..67907 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21260 CDS complement(68291..69634) product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704251.1 transl_table 11 codon_start 1 locus_tag LOCUS_21270 CDS 69633..70298 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21280 CDS 70446..70916 product copper chaperone PCu(A)C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105385.1 transl_table 11 codon_start 1 locus_tag LOCUS_21290 CDS complement(70983..71411) product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170853.1 transl_table 11 codon_start 1 locus_tag LOCUS_21300 CDS complement(71520..71954) product thioredoxin TrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036377.1 transl_table 11 codon_start 1 locus_tag LOCUS_21310 gene trxC CDS complement(71957..72364) product META domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016352339.1 transl_table 11 codon_start 1 locus_tag LOCUS_21320 CDS complement(72374..73378) product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707803.1 transl_table 11 codon_start 1 locus_tag LOCUS_21330 CDS complement(73423..74277) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707800.1 transl_table 11 codon_start 1 locus_tag LOCUS_21340 CDS 74398..75087 product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707792.1 transl_table 11 codon_start 1 locus_tag LOCUS_21350 tRNA 75150..75226 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00470 CDS complement(75554..76477) product transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972039.1 transl_table 11 codon_start 1 locus_tag LOCUS_21360 gene gcvA CDS 76691..77473 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816329.1 transl_table 11 codon_start 1 locus_tag LOCUS_21370 CDS 77681..79036 product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114813.1 transl_table 11 codon_start 1 locus_tag LOCUS_21380 CDS complement(79125..79340) product ribosome-associated protein YbcJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010674882.1 transl_table 11 codon_start 1 locus_tag LOCUS_21390 gene ybcJ CDS 79654..80787 product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889090.1 transl_table 11 codon_start 1 locus_tag LOCUS_21400 CDS 81487..82368 product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095113.1 transl_table 11 codon_start 1 locus_tag LOCUS_21410 gene phnC CDS 82365..83354 product phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095112.1 transl_table 11 codon_start 1 locus_tag LOCUS_21420 gene phnD CDS 83410..84195 product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001302225.1 transl_table 11 codon_start 1 locus_tag LOCUS_21430 gene phnE CDS 84282..84977 product phosphonate metabolism transcriptional regulator PhnF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209293.1 transl_table 11 codon_start 1 locus_tag LOCUS_21440 gene phnF CDS 84978..85421 product phosphonate C-P lyase system protein PhnG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175312.1 transl_table 11 codon_start 1 locus_tag LOCUS_21450 gene phnG CDS 85421..86017 product phosphonate C-P lyase system protein PhnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095108.1 transl_table 11 codon_start 1 locus_tag LOCUS_21460 gene phnH CDS 86020..87120 product carbon-phosphorus lyase complex subunit PhnI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704079.1 transl_table 11 codon_start 1 locus_tag LOCUS_21470 CDS 87117..88004 product alpha-D-ribose 1-methylphosphonate 5-phosphate C-P-lyase PhnJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000002284.1 transl_table 11 codon_start 1 locus_tag LOCUS_21480 gene phnJ CDS 88001..88858 product phosphonate C-P lyase system protein PhnK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209288.1 transl_table 11 codon_start 1 locus_tag LOCUS_21490 gene phnK CDS 88867..89595 product phosphonate C-P lyase system protein PhnL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000611411.1 transl_table 11 codon_start 1 locus_tag LOCUS_21500 gene phnL CDS 89592..90728 product alpha-D-ribose 1-methylphosphonate 5-triphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175326.1 transl_table 11 codon_start 1 locus_tag LOCUS_21510 gene phnM CDS 90746..91303 product ribose 1,5-bisphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209285.1 transl_table 11 codon_start 1 locus_tag LOCUS_21520 gene phnN CDS 91305..92087 product phosphonate metabolism protein PhnP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267547.1 transl_table 11 codon_start 1 locus_tag LOCUS_21530 gene phnP CDS 92163..92312 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21540 CDS 92394..92810 product DUF4399 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084345.1 transl_table 11 codon_start 1 locus_tag LOCUS_21550 CDS 92826..93665 product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704257.1 transl_table 11 codon_start 1 locus_tag LOCUS_21560 CDS 93784..93960 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349071.1 transl_table 11 codon_start 1 locus_tag LOCUS_21570 CDS 93960..95315 product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704261.1 transl_table 11 codon_start 1 locus_tag LOCUS_21580 gene rmuC CDS complement(95312..96688) product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704263.1 transl_table 11 codon_start 1 locus_tag LOCUS_21590 gene trkA CDS complement(96685..97980) product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704264.1 transl_table 11 codon_start 1 locus_tag LOCUS_21600 gene rsmB CDS complement(98006..98950) product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704265.1 transl_table 11 codon_start 1 locus_tag LOCUS_21610 gene fmt CDS complement(98973..99482) product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704266.1 transl_table 11 codon_start 1 locus_tag LOCUS_21620 gene def CDS 99608..100702 product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704267.1 transl_table 11 codon_start 1 locus_tag LOCUS_21630 CDS 100683..101780 product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704268.1 transl_table 11 codon_start 1 locus_tag LOCUS_21640 gene dprA CDS 101783..102256 product DUF494 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704269.1 transl_table 11 codon_start 1 locus_tag LOCUS_21650 CDS 102304..102852 product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704270.1 transl_table 11 codon_start 1 locus_tag LOCUS_21660 CDS 102881..103444 product Sua5/YciO/YrdC/YwlC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704272.1 transl_table 11 codon_start 1 locus_tag LOCUS_21670 CDS 103474..104382 product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704273.1 transl_table 11 codon_start 1 locus_tag LOCUS_21680 gene hemF CDS complement(104379..105245) product HTH-type transcriptional regulator HdfR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072234.1 transl_table 11 codon_start 1 locus_tag LOCUS_21690 gene hdfR CDS 105403..106227 product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704274.1 transl_table 11 codon_start 1 locus_tag LOCUS_21700 gene aroE CDS 106224..106484 product DUF1488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704275.1 transl_table 11 codon_start 1 locus_tag LOCUS_21710 CDS complement(106592..107128) product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070458.1 transl_table 11 codon_start 1 locus_tag LOCUS_21720 sequence14 source 1..104748 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1..444 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21730 CDS 549..905 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21740 CDS complement(832..1032) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21750 CDS 1262..1570 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21760 CDS complement(1668..2684) product murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170320148.1 transl_table 11 codon_start 1 locus_tag LOCUS_21770 gene oppF CDS complement(2674..3708) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706427.1 transl_table 11 codon_start 1 locus_tag LOCUS_21780 CDS complement(3718..4641) product oligopeptide ABC transporter permease OppC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706428.1 transl_table 11 codon_start 1 locus_tag LOCUS_21790 gene oppC CDS complement(4654..5574) product oligopeptide ABC transporter permease OppB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706429.1 transl_table 11 codon_start 1 locus_tag LOCUS_21800 gene oppB CDS complement(5788..7407) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706430.1 transl_table 11 codon_start 1 locus_tag LOCUS_21810 CDS 7788..8090 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21820 CDS complement(8129..8440) product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704428.1 transl_table 11 codon_start 1 locus_tag LOCUS_21830 CDS complement(8521..10779) product arginine/lysine/ornithine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191939.1 transl_table 11 codon_start 1 locus_tag LOCUS_21840 CDS 10806..11003 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21850 CDS 10987..11589 product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042064868.1 transl_table 11 codon_start 1 locus_tag LOCUS_21860 CDS complement(11566..12936) product D-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703886.1 transl_table 11 codon_start 1 locus_tag LOCUS_21870 gene dsdA CDS complement(13025..14356) product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113324.1 transl_table 11 codon_start 1 locus_tag LOCUS_21880 CDS complement(14444..16504) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707540.1 transl_table 11 codon_start 1 locus_tag LOCUS_21890 CDS complement(16482..16763) product HlyU family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707539.1 transl_table 11 codon_start 1 locus_tag LOCUS_21900 CDS complement(17205..17714) product PTS glucose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005303134.1 transl_table 11 codon_start 1 locus_tag LOCUS_21910 gene crr CDS 17844..18050 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21920 CDS complement(17993..18961) product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706833.1 transl_table 11 codon_start 1 locus_tag LOCUS_21930 gene cysK CDS 19143..20738 product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819550.1 transl_table 11 codon_start 1 locus_tag LOCUS_21940 CDS 20985..21551 product DUF882 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705140.1 transl_table 11 codon_start 1 locus_tag LOCUS_21950 CDS complement(21515..22276) product sulfate transporter CysZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705142.1 transl_table 11 codon_start 1 locus_tag LOCUS_21960 gene cysZ CDS 22631..23647 product cell division protein ZipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705144.1 transl_table 11 codon_start 1 locus_tag LOCUS_21970 gene zipA CDS 23729..25762 product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705145.1 transl_table 11 codon_start 1 locus_tag LOCUS_21980 gene ligA CDS complement(25888..26415) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21990 CDS 26667..28079 product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707206.1 transl_table 11 codon_start 1 locus_tag LOCUS_22000 gene gltX tRNA 28687..28762 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00480 tRNA 28799..28874 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00490 tRNA 28911..28986 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00500 assembly_gap 28987..29009 estimated_length known gap_type within scaffold linkage_evidence paired-ends tRNA 29030..29105 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00510 CDS 29057..29911 product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263026.1 transl_table 11 codon_start 1 locus_tag LOCUS_22010 CDS complement(29908..30510) product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707238.1 transl_table 11 codon_start 1 locus_tag LOCUS_22020 CDS 30509..31192 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707237.1 transl_table 11 codon_start 1 locus_tag LOCUS_22030 CDS 31185..33611 product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707236.1 transl_table 11 codon_start 1 locus_tag LOCUS_22040 CDS complement(33619..34527) product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707235.1 transl_table 11 codon_start 1 locus_tag LOCUS_22050 CDS complement(34797..35297) product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084387.1 transl_table 11 codon_start 1 locus_tag LOCUS_22060 gene tpx CDS complement(35462..37630) product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017410280.1 transl_table 11 codon_start 1 locus_tag LOCUS_22070 gene pta CDS complement(37641..38861) product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000041130.1 transl_table 11 codon_start 1 locus_tag LOCUS_22080 CDS 39139..39579 product terminus macrodomain insulation protein YfbV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704832.1 transl_table 11 codon_start 1 locus_tag LOCUS_22090 gene yfbV CDS 39668..40426 product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058294.1 transl_table 11 codon_start 1 locus_tag LOCUS_22100 CDS 40955..42448 product alanine/glycine:cation symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705934.1 transl_table 11 codon_start 1 locus_tag LOCUS_22110 CDS 42632..44080 product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174317.1 transl_table 11 codon_start 1 locus_tag LOCUS_22120 CDS complement(44149..44898) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22130 CDS 45210..45758 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22140 CDS 45910..47046 product formate-dependent phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406408.1 transl_table 11 codon_start 1 locus_tag LOCUS_22150 gene purT CDS complement(47153..49339) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22160 CDS complement(49418..49990) product chemotaxis protein CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001105137.1 transl_table 11 codon_start 1 locus_tag LOCUS_22170 CDS complement(49987..52179) product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762944.1 transl_table 11 codon_start 1 locus_tag LOCUS_22180 CDS complement(52179..54257) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22190 CDS complement(54247..55101) product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002079012.1 transl_table 11 codon_start 1 locus_tag LOCUS_22200 CDS complement(55098..58940) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22210 CDS complement(59586..60527) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22220 CDS complement(60717..61016) product DNA-binding transcriptional regulator Fis inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005309538.1 transl_table 11 codon_start 1 locus_tag LOCUS_22230 gene fis CDS complement(61043..61960) product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421284.1 transl_table 11 codon_start 1 locus_tag LOCUS_22240 gene dusB CDS complement(62372..63247) product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010675412.1 transl_table 11 codon_start 1 locus_tag LOCUS_22250 gene prmA CDS complement(63766..65220) product sodium/pantothenate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707115.1 transl_table 11 codon_start 1 locus_tag LOCUS_22260 gene panF CDS complement(65217..65492) product YhdT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016351749.1 transl_table 11 codon_start 1 locus_tag LOCUS_22270 CDS complement(65612..65977) product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000152368.1 transl_table 11 codon_start 1 locus_tag LOCUS_22280 CDS complement(66091..67431) product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707113.1 transl_table 11 codon_start 1 locus_tag LOCUS_22290 gene accC CDS complement(67441..67902) product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005163113.1 transl_table 11 codon_start 1 locus_tag LOCUS_22300 gene accB CDS complement(67939..68388) product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125573.1 transl_table 11 codon_start 1 locus_tag LOCUS_22310 gene aroQ CDS complement(68767..70716) product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707110.1 transl_table 11 codon_start 1 locus_tag LOCUS_22320 gene acs CDS complement(70895..71329) product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162304069.1 transl_table 11 codon_start 1 locus_tag LOCUS_22330 CDS complement(71334..72023) product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893951.1 transl_table 11 codon_start 1 locus_tag LOCUS_22340 CDS complement(72011..72979) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22350 CDS complement(73012..73365) product DUF2956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799584.1 transl_table 11 codon_start 1 locus_tag LOCUS_22360 CDS complement(73365..73985) product molecular chaperone TorD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707104.1 transl_table 11 codon_start 1 locus_tag LOCUS_22370 gene torD CDS 74259..75512 product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707102.1 transl_table 11 codon_start 1 locus_tag LOCUS_22380 CDS 75726..76175 product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010675395.1 transl_table 11 codon_start 1 locus_tag LOCUS_22390 gene nrdR CDS 76176..77291 product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707100.1 transl_table 11 codon_start 1 locus_tag LOCUS_22400 gene ribD CDS 77291..77944 product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707099.1 transl_table 11 codon_start 1 locus_tag LOCUS_22410 CDS 77975..79084 product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707098.1 transl_table 11 codon_start 1 locus_tag LOCUS_22420 gene ribBA CDS 79309..81312 product biofilm regulation protein phosphatase SiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112649.1 transl_table 11 codon_start 1 locus_tag LOCUS_22430 gene siaA CDS 81323..81865 product biofilm formation regulator kinase SiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083916.1 transl_table 11 codon_start 1 locus_tag LOCUS_22440 gene siaB CDS 81862..82263 product biofilm formation regulator SiaD modulator protein SiaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083913.1 transl_table 11 codon_start 1 locus_tag LOCUS_22450 gene siaC CDS 82256..83038 product biofilm regulation diguanylate cyclase SiaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118588.1 transl_table 11 codon_start 1 locus_tag LOCUS_22460 gene siaD CDS 83097..83654 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22470 CDS 83656..84324 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014509047.1 transl_table 11 codon_start 1 locus_tag LOCUS_22480 CDS 84379..84726 product HopJ type III effector protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263557.1 transl_table 11 codon_start 1 locus_tag LOCUS_22490 CDS 84771..85685 product DUF808 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035658.1 transl_table 11 codon_start 1 locus_tag LOCUS_22500 CDS complement(86261..87163) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483368.1 transl_table 11 codon_start 1 locus_tag LOCUS_22510 CDS complement(87351..90422) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22520 CDS 90830..91810 product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121934.1 transl_table 11 codon_start 1 locus_tag LOCUS_22530 CDS 91920..92387 product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016351731.1 transl_table 11 codon_start 1 locus_tag LOCUS_22540 gene ribE CDS 92401..92811 product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707095.1 transl_table 11 codon_start 1 locus_tag LOCUS_22550 gene nusB CDS 92859..93824 product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707094.1 transl_table 11 codon_start 1 locus_tag LOCUS_22560 gene thiL CDS 93825..94304 product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707093.1 transl_table 11 codon_start 1 locus_tag LOCUS_22570 CDS complement(94624..94797) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22580 CDS 95209..96948 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707092.1 transl_table 11 codon_start 1 locus_tag LOCUS_22590 CDS 96969..98522 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421494.1 transl_table 11 codon_start 1 locus_tag LOCUS_22600 CDS 98599..99573 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707090.1 transl_table 11 codon_start 1 locus_tag LOCUS_22610 CDS 99579..100514 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262868.1 transl_table 11 codon_start 1 locus_tag LOCUS_22620 CDS complement(100578..100811) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22630 CDS 100696..101961 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704211.1 transl_table 11 codon_start 1 locus_tag LOCUS_22640 CDS 102390..104483 product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071132.1 transl_table 11 codon_start 1 locus_tag LOCUS_22650 gene fusA sequence15 source 1..99166 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ repeat_region 123..3031 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttcaccgccacccaggcggcttagaaa CDS complement(3146..4195) product NADP(H)-dependent aldo-keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930118.1 transl_table 11 codon_start 1 locus_tag LOCUS_22660 CDS complement(4495..6408) product PhoX family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000265858.1 transl_table 11 codon_start 1 locus_tag LOCUS_22670 CDS complement(6760..7227) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707006.1 transl_table 11 codon_start 1 locus_tag LOCUS_22680 CDS complement(7426..8532) product GNAT family N-acetyltransferase/peptidase C39 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113487.1 transl_table 11 codon_start 1 locus_tag LOCUS_22690 CDS 8671..10134 product RimK family alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420659.1 transl_table 11 codon_start 1 locus_tag LOCUS_22700 CDS complement(10354..10824) product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038734.1 transl_table 11 codon_start 1 locus_tag LOCUS_22710 gene msrB CDS complement(10827..11444) product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257533.1 transl_table 11 codon_start 1 locus_tag LOCUS_22720 gene msrA CDS 11706..12485 product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706235.1 transl_table 11 codon_start 1 locus_tag LOCUS_22730 CDS 12514..13515 product vitamin B12 ABC transporter permease BtuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706548.1 transl_table 11 codon_start 1 locus_tag LOCUS_22740 gene btuC CDS 13508..14266 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226013954.1 transl_table 11 codon_start 1 locus_tag LOCUS_22750 CDS complement(14291..15370) product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818104.1 transl_table 11 codon_start 1 locus_tag LOCUS_22760 CDS complement(15470..15877) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098688.1 transl_table 11 codon_start 1 locus_tag LOCUS_22770 CDS 15952..16254 product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113114.1 transl_table 11 codon_start 1 locus_tag LOCUS_22780 CDS complement(16320..17315) product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113297.1 transl_table 11 codon_start 1 locus_tag LOCUS_22790 CDS 17432..17917 product prolyl-tRNA synthetase associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206817527.1 transl_table 11 codon_start 1 locus_tag LOCUS_22800 CDS 17977..19695 product tetrathionate respiration histidine kinase TtrS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816070.1 transl_table 11 codon_start 1 locus_tag LOCUS_22810 gene ttrS CDS 19695..20279 product tetrathionate respiration response regulator TtrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019083413.1 transl_table 11 codon_start 1 locus_tag LOCUS_22820 gene ttrR CDS complement(20527..21540) product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707130.1 transl_table 11 codon_start 1 locus_tag LOCUS_22830 gene ansA CDS complement(21540..23375) product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707123.1 transl_table 11 codon_start 1 locus_tag LOCUS_22840 gene sppA CDS 23553..25559 product NADPH-dependent 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707122.1 transl_table 11 codon_start 1 locus_tag LOCUS_22850 CDS 25782..26336 product NAD(P)H nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707121.1 transl_table 11 codon_start 1 locus_tag LOCUS_22860 CDS complement(26578..28617) product phenylacetic acid degradation bifunctional protein PaaZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206394.1 transl_table 11 codon_start 1 locus_tag LOCUS_22870 gene paaZ CDS 28887..29822 product 1,2-phenylacetyl-CoA epoxidase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206395.1 transl_table 11 codon_start 1 locus_tag LOCUS_22880 gene paaA CDS 29834..30121 product 1,2-phenylacetyl-CoA epoxidase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000073393.1 transl_table 11 codon_start 1 locus_tag LOCUS_22890 gene paaB CDS 30130..30894 product phenylacetate-CoA oxygenase subunit PaaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206396.1 transl_table 11 codon_start 1 locus_tag LOCUS_22900 gene paaC CDS 30906..31400 product phenylacetate-CoA oxygenase subunit PaaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001177939.1 transl_table 11 codon_start 1 locus_tag LOCUS_22910 gene paaJ CDS 31427..32488 product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206397.1 transl_table 11 codon_start 1 locus_tag LOCUS_22920 CDS 32498..33274 product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206399.1 transl_table 11 codon_start 1 locus_tag LOCUS_22930 CDS 33274..34065 product 2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase PaaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206400.1 transl_table 11 codon_start 1 locus_tag LOCUS_22940 gene paaG CDS 34067..35566 product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206401.1 transl_table 11 codon_start 1 locus_tag LOCUS_22950 CDS 35563..36009 product hydroxyphenylacetyl-CoA thioesterase PaaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813284.1 transl_table 11 codon_start 1 locus_tag LOCUS_22960 gene paaI CDS 36002..37210 product 3-oxoadipyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096753.1 transl_table 11 codon_start 1 locus_tag LOCUS_22970 gene pcaF CDS 37235..38524 product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000632280.1 transl_table 11 codon_start 1 locus_tag LOCUS_22980 gene paaF CDS 38611..39627 product phenylacetic acid degradation operon negative regulatory protein PaaX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062822.1 transl_table 11 codon_start 1 locus_tag LOCUS_22990 gene paaX CDS 39840..40436 product phenylacetic acid degradation protein PaaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001123464.1 transl_table 11 codon_start 1 locus_tag LOCUS_23000 gene paaY CDS complement(40512..42965) product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206901.1 transl_table 11 codon_start 1 locus_tag LOCUS_23010 CDS complement(43063..44364) product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812141.1 transl_table 11 codon_start 1 locus_tag LOCUS_23020 CDS complement(44361..44900) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23030 CDS complement(44906..45931) product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812137.1 transl_table 11 codon_start 1 locus_tag LOCUS_23040 CDS complement(46294..46884) product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706868.1 transl_table 11 codon_start 1 locus_tag LOCUS_23050 gene mobA CDS 47108..48316 product CynX/NimT family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886905.1 transl_table 11 codon_start 1 locus_tag LOCUS_23060 CDS 48680..49528 product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_110402348.1 transl_table 11 codon_start 1 locus_tag LOCUS_23070 CDS 49596..50348 product NRDE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112962.1 transl_table 11 codon_start 1 locus_tag LOCUS_23080 CDS complement(50382..51170) product RIO1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705970.1 transl_table 11 codon_start 1 locus_tag LOCUS_23090 CDS complement(51536..52495) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073534.1 transl_table 11 codon_start 1 locus_tag LOCUS_23100 CDS 52647..53585 product sodium-dependent bicarbonate transport family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073535.1 transl_table 11 codon_start 1 locus_tag LOCUS_23110 CDS complement(53715..55067) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531509.1 transl_table 11 codon_start 1 locus_tag LOCUS_23120 CDS 55338..57077 product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969299.1 transl_table 11 codon_start 1 locus_tag LOCUS_23130 CDS 57105..59186 product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393465.1 transl_table 11 codon_start 1 locus_tag LOCUS_23140 CDS 59290..60237 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533169.1 transl_table 11 codon_start 1 locus_tag LOCUS_23150 CDS 60276..60497 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23160 CDS complement(60784..60915) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23170 CDS complement(60918..62582) product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446850.1 transl_table 11 codon_start 1 locus_tag LOCUS_23180 CDS 63096..63590 product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073383.1 transl_table 11 codon_start 1 locus_tag LOCUS_23190 gene purE CDS 63587..64654 product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073384.1 transl_table 11 codon_start 1 locus_tag LOCUS_23200 gene purK CDS 64901..65815 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082969.1 transl_table 11 codon_start 1 locus_tag LOCUS_23210 CDS 66185..67153 product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055970141.1 transl_table 11 codon_start 1 locus_tag LOCUS_23220 gene speB CDS 67903..69033 product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000817269.1 transl_table 11 codon_start 1 locus_tag LOCUS_23230 CDS 69179..69988 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23240 CDS 69985..73041 product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262580.1 transl_table 11 codon_start 1 locus_tag LOCUS_23250 CDS complement(73280..74320) product PLP-dependent cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208631.1 transl_table 11 codon_start 1 locus_tag LOCUS_23260 CDS 74471..74926 product DNA-binding transcriptional regulator DecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884589.1 transl_table 11 codon_start 1 locus_tag LOCUS_23270 gene decR CDS complement(74943..75563) product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003081997.1 transl_table 11 codon_start 1 locus_tag LOCUS_23280 CDS 75838..76215 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23290 CDS complement(76180..77160) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967163.1 transl_table 11 codon_start 1 locus_tag LOCUS_23300 CDS 77488..78738 product sulfite dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088862.1 transl_table 11 codon_start 1 locus_tag LOCUS_23310 gene soxC CDS 78743..79453 product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162185828.1 transl_table 11 codon_start 1 locus_tag LOCUS_23320 CDS complement(79545..80708) product sodium:phosphate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706804.1 transl_table 11 codon_start 1 locus_tag LOCUS_23330 CDS 81098..81259 product DUF1328 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368384.1 transl_table 11 codon_start 1 locus_tag LOCUS_23340 CDS 81420..82229 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072480.1 transl_table 11 codon_start 1 locus_tag LOCUS_23350 CDS 82358..82981 product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071298.1 transl_table 11 codon_start 1 locus_tag LOCUS_23360 gene cobO CDS complement(83166..83558) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000491259.1 transl_table 11 codon_start 1 locus_tag LOCUS_23370 CDS 83788..84018 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23380 note possible pseudo, internal stop codon CDS complement(84114..84581) product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000128238.1 transl_table 11 codon_start 1 locus_tag LOCUS_23390 CDS complement(84684..85064) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23400 CDS complement(85454..86137) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23410 CDS complement(86279..86515) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23420 CDS complement(87160..87594) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23430 CDS complement(87739..88305) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457970.1 transl_table 11 codon_start 1 locus_tag LOCUS_23440 CDS 88562..89944 product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483346.1 transl_table 11 codon_start 1 locus_tag LOCUS_23450 CDS complement(90090..91595) product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263552.1 transl_table 11 codon_start 1 locus_tag LOCUS_23460 CDS 92014..93741 product potassium/proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114562.1 transl_table 11 codon_start 1 locus_tag LOCUS_23470 CDS complement(93911..94312) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23480 CDS complement(94447..94896) product YtoQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229263.1 transl_table 11 codon_start 1 locus_tag LOCUS_23490 CDS complement(95016..96098) product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926684.1 transl_table 11 codon_start 1 locus_tag LOCUS_23500 CDS complement(96190..96504) product pyrimidine/purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000077234.1 transl_table 11 codon_start 1 locus_tag LOCUS_23510 CDS 96737..98851 product 5-histidylcysteine sulfoxide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074094.1 transl_table 11 codon_start 1 locus_tag LOCUS_23520 gene ovoA sequence16 source 1..96920 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(171..380) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23530 CDS complement(416..625) product DUF3565 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922503.1 transl_table 11 codon_start 1 locus_tag LOCUS_23540 CDS complement(808..1149) product SEC-C metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261999.1 transl_table 11 codon_start 1 locus_tag LOCUS_23550 CDS complement(1284..1790) product DUF3087 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459966.1 transl_table 11 codon_start 1 locus_tag LOCUS_23560 CDS 1922..2419 product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480252.1 transl_table 11 codon_start 1 locus_tag LOCUS_23570 CDS complement(2475..2762) product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024945378.1 transl_table 11 codon_start 1 locus_tag LOCUS_23580 gene rplY CDS complement(2932..6819) product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000139614.1 transl_table 11 codon_start 1 locus_tag LOCUS_23590 gene hrpA CDS complement(7621..8094) product glycine zipper 2TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006996417.1 transl_table 11 codon_start 1 locus_tag LOCUS_23600 CDS complement(8357..9493) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097314.1 transl_table 11 codon_start 1 locus_tag LOCUS_23610 CDS complement(9587..10321) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706230.1 transl_table 11 codon_start 1 locus_tag LOCUS_23620 CDS complement(10354..11976) product ATP-dependent endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706231.1 transl_table 11 codon_start 1 locus_tag LOCUS_23630 CDS complement(12025..12306) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705448.1 transl_table 11 codon_start 1 locus_tag LOCUS_23640 CDS complement(12522..13958) product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000122732.1 transl_table 11 codon_start 1 locus_tag LOCUS_23650 CDS complement(14103..14504) product ectoine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000637098.1 transl_table 11 codon_start 1 locus_tag LOCUS_23660 CDS complement(14835..16106) product diaminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464458.1 transl_table 11 codon_start 1 locus_tag LOCUS_23670 gene ectB CDS complement(16181..16699) product diaminobutyrate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000640101.1 transl_table 11 codon_start 1 locus_tag LOCUS_23680 gene ectA CDS 16990..17199 product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000106983.1 transl_table 11 codon_start 1 locus_tag LOCUS_23690 CDS 17330..18241 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263914.1 transl_table 11 codon_start 1 locus_tag LOCUS_23700 CDS 18335..18679 product DUF413 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016350309.1 transl_table 11 codon_start 1 locus_tag LOCUS_23710 CDS 19097..20518 product exodeoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819831.1 transl_table 11 codon_start 1 locus_tag LOCUS_23720 gene sbcB CDS 20529..20867 product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705771.1 transl_table 11 codon_start 1 locus_tag LOCUS_23730 CDS 20864..21553 product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705770.1 transl_table 11 codon_start 1 locus_tag LOCUS_23740 CDS 21573..22430 product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705769.1 transl_table 11 codon_start 1 locus_tag LOCUS_23750 gene cdd CDS complement(22638..23243) product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010633741.1 transl_table 11 codon_start 1 locus_tag LOCUS_23760 gene recR CDS 23763..24002 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23770 CDS 24141..24407 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23780 assembly_gap 24513..24568 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(24634..24963) product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706069.1 transl_table 11 codon_start 1 locus_tag LOCUS_23790 CDS complement(25004..27592) product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706068.1 transl_table 11 codon_start 1 locus_tag LOCUS_23800 gene dnaX CDS complement(27599..28144) product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016350746.1 transl_table 11 codon_start 1 locus_tag LOCUS_23810 gene apt CDS complement(28215..28607) product YbaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706066.1 transl_table 11 codon_start 1 locus_tag LOCUS_23820 CDS complement(28719..30116) product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943755.1 transl_table 11 codon_start 1 locus_tag LOCUS_23830 CDS complement(30247..31029) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23840 CDS 31253..32218 product ornithine cyclodeaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037434787.1 transl_table 11 codon_start 1 locus_tag LOCUS_23850 CDS 32331..33773 product Na+/H+ antiporter NhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338014.1 transl_table 11 codon_start 1 locus_tag LOCUS_23860 gene nhaC CDS 33770..35065 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385698.1 transl_table 11 codon_start 1 locus_tag LOCUS_23870 CDS complement(35115..36029) product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005095780.1 transl_table 11 codon_start 1 locus_tag LOCUS_23880 CDS complement(36051..36791) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947406.1 transl_table 11 codon_start 1 locus_tag LOCUS_23890 CDS complement(36800..37789) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23900 CDS complement(37987..41082) product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943409.1 transl_table 11 codon_start 1 locus_tag LOCUS_23910 CDS complement(41085..42224) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943408.1 transl_table 11 codon_start 1 locus_tag LOCUS_23920 CDS 42403..44559 product bifunctional TVP38/TMEM64 family protein/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705444.1 transl_table 11 codon_start 1 locus_tag LOCUS_23930 CDS complement(44625..44816) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23940 CDS complement(45095..45994) product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719487.1 transl_table 11 codon_start 1 locus_tag LOCUS_23950 CDS 46220..47545 product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063972.1 transl_table 11 codon_start 1 locus_tag LOCUS_23960 CDS 47634..48191 product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198796.1 transl_table 11 codon_start 1 locus_tag LOCUS_23970 CDS 48408..49151 product glutamine ABC transporter substrate-binding protein GlnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210235.1 transl_table 11 codon_start 1 locus_tag LOCUS_23980 gene glnH CDS 49176..49832 product glutamine ABC transporter permease GlnP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168189.1 transl_table 11 codon_start 1 locus_tag LOCUS_23990 gene glnP CDS 49829..50557 product glutamine ABC transporter ATP-binding protein GlnQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569093.1 transl_table 11 codon_start 1 locus_tag LOCUS_24000 gene glnQ CDS 50567..51601 product C45 family autoproteolytic acyltransferase/hydolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190976.1 transl_table 11 codon_start 1 locus_tag LOCUS_24010 CDS complement(51684..52553) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074451.1 transl_table 11 codon_start 1 locus_tag LOCUS_24020 CDS 52820..53905 product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208292.1 transl_table 11 codon_start 1 locus_tag LOCUS_24030 CDS 54044..54259 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24040 CDS 54403..55530 product S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072127.1 transl_table 11 codon_start 1 locus_tag LOCUS_24050 CDS 55814..56653 product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074448.1 transl_table 11 codon_start 1 locus_tag LOCUS_24060 gene fghA CDS 56788..57714 product bestrophin family ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528797.1 transl_table 11 codon_start 1 locus_tag LOCUS_24070 CDS 57895..59436 product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109990.1 transl_table 11 codon_start 1 locus_tag LOCUS_24080 gene gshA CDS complement(59483..59746) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24090 CDS complement(59743..60156) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24100 note possible pseudo, frameshifted CDS complement(60164..60490) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24110 CDS complement(60403..60891) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24120 CDS complement(60888..61871) product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943073.1 transl_table 11 codon_start 1 locus_tag LOCUS_24130 CDS complement(61868..62866) product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000980946.1 transl_table 11 codon_start 1 locus_tag LOCUS_24140 gene pdhA CDS complement(62856..64628) product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000862095.1 transl_table 11 codon_start 1 locus_tag LOCUS_24150 gene acsA CDS complement(64904..66205) product Ni/Fe hydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948169.1 transl_table 11 codon_start 1 locus_tag LOCUS_24160 CDS complement(66202..67002) product sulfhydrogenase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948170.1 transl_table 11 codon_start 1 locus_tag LOCUS_24170 CDS complement(67121..67939) product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948171.1 transl_table 11 codon_start 1 locus_tag LOCUS_24180 CDS complement(67932..69044) product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027268647.1 transl_table 11 codon_start 1 locus_tag LOCUS_24190 CDS complement(69037..69777) product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728544.1 transl_table 11 codon_start 1 locus_tag LOCUS_24200 gene hypB CDS complement(69777..70103) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24210 CDS complement(70106..71140) product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720673.1 transl_table 11 codon_start 1 locus_tag LOCUS_24220 gene hypE CDS complement(71130..72287) product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338278.1 transl_table 11 codon_start 1 locus_tag LOCUS_24230 gene hypD CDS complement(72284..72553) product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816727.1 transl_table 11 codon_start 1 locus_tag LOCUS_24240 gene hypC CDS complement(72843..75215) product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940975.1 transl_table 11 codon_start 1 locus_tag LOCUS_24250 gene hypF CDS complement(75212..75736) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24260 CDS 76060..77508 product YfcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707752.1 transl_table 11 codon_start 1 locus_tag LOCUS_24270 CDS 77533..78762 product arginine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526983.1 transl_table 11 codon_start 1 locus_tag LOCUS_24280 gene arcA CDS 78780..79781 product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455105.1 transl_table 11 codon_start 1 locus_tag LOCUS_24290 CDS 79783..80709 product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970090.1 transl_table 11 codon_start 1 locus_tag LOCUS_24300 gene arcC CDS complement(80706..81347) product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207859.1 transl_table 11 codon_start 1 locus_tag LOCUS_24310 CDS 81565..83796 product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391529.1 transl_table 11 codon_start 1 locus_tag LOCUS_24320 gene katG CDS complement(83876..84871) product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207210.1 transl_table 11 codon_start 1 locus_tag LOCUS_24330 CDS complement(85048..85371) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261939.1 transl_table 11 codon_start 1 locus_tag LOCUS_24340 CDS complement(86018..86413) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24350 CDS complement(86693..87562) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000933929.1 transl_table 11 codon_start 1 locus_tag LOCUS_24360 CDS 87656..88156 product lactoylglutathione lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071263.1 transl_table 11 codon_start 1 locus_tag LOCUS_24370 CDS 88501..90816 product mechanosensitive channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704820.1 transl_table 11 codon_start 1 locus_tag LOCUS_24380 gene ybiO CDS complement(90875..92068) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086798.1 transl_table 11 codon_start 1 locus_tag LOCUS_24390 CDS 92185..93081 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314318.1 transl_table 11 codon_start 1 locus_tag LOCUS_24400 CDS 93078..93989 product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705015.1 transl_table 11 codon_start 1 locus_tag LOCUS_24410 CDS 94119..94694 product NAD(P)H-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082483.1 transl_table 11 codon_start 1 locus_tag LOCUS_24420 CDS complement(94799..95167) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24430 CDS 95631..95945 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24440 CDS complement(96053..96412) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001071541.1 transl_table 11 codon_start 1 locus_tag LOCUS_24450 CDS complement(96518..96820) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24460 sequence17 source 1..93296 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(521..1540) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24470 CDS complement(1580..2179) product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462478.1 transl_table 11 codon_start 1 locus_tag LOCUS_24480 CDS complement(2179..3306) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975598.1 transl_table 11 codon_start 1 locus_tag LOCUS_24490 CDS complement(3357..3686) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24500 CDS complement(3791..4867) product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476096.1 transl_table 11 codon_start 1 locus_tag LOCUS_24510 CDS complement(4886..5962) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24520 CDS complement(6046..6822) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24530 CDS 6914..7108 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24540 CDS complement(7379..8683) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24550 CDS complement(8686..9822) product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073076.1 transl_table 11 codon_start 1 locus_tag LOCUS_24560 CDS complement(9921..10262) product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123903.1 transl_table 11 codon_start 1 locus_tag LOCUS_24570 CDS complement(10313..11593) product Vi polysaccharide biosynthesis UDP-N-acetylglucosamine C-6 dehydrogenase TviB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073077.1 transl_table 11 codon_start 1 locus_tag LOCUS_24580 gene tviB CDS 12157..12336 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24590 CDS complement(12412..14619) product exopolysaccharide regulatory tyrosine autokinase VpsO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147064.1 transl_table 11 codon_start 1 locus_tag LOCUS_24600 gene vpsO CDS complement(14619..15158) product exopolysaccharide export protein VpsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000978825.1 transl_table 11 codon_start 1 locus_tag LOCUS_24610 gene vpsN CDS 15644..16240 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24620 CDS complement(16518..17771) product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705337.1 transl_table 11 codon_start 1 locus_tag LOCUS_24630 gene icd CDS 18053..18553 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24640 CDS 18550..19005 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705317.1 transl_table 11 codon_start 1 locus_tag LOCUS_24650 CDS 19334..20440 product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705316.1 transl_table 11 codon_start 1 locus_tag LOCUS_24660 gene mnmA CDS 20437..21060 product high frequency lysogenization protein HflD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005334622.1 transl_table 11 codon_start 1 locus_tag LOCUS_24670 gene hflD CDS 21104..22471 product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705315.1 transl_table 11 codon_start 1 locus_tag LOCUS_24680 gene purB CDS 22730..22921 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24690 CDS 22973..24115 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705314.1 transl_table 11 codon_start 1 locus_tag LOCUS_24700 CDS complement(24437..24934) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705313.1 transl_table 11 codon_start 1 locus_tag LOCUS_24710 CDS complement(24946..25581) product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705310.1 transl_table 11 codon_start 1 locus_tag LOCUS_24720 gene pdxH CDS 25748..25999 product YfhL family 4Fe-4S dicluster ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005334896.1 transl_table 11 codon_start 1 locus_tag LOCUS_24730 CDS 26112..26297 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24740 CDS complement(26373..27551) product multidrug efflux MFS transporter EmrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705603.1 transl_table 11 codon_start 1 locus_tag LOCUS_24750 gene emrD CDS 27909..28712 product inositol-1-monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016350372.1 transl_table 11 codon_start 1 locus_tag LOCUS_24760 gene suhB CDS complement(29196..30986) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926891.1 transl_table 11 codon_start 1 locus_tag LOCUS_24770 CDS complement(31612..31860) product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791529.1 transl_table 11 codon_start 1 locus_tag LOCUS_24780 CDS complement(31978..35034) product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206817986.1 transl_table 11 codon_start 1 locus_tag LOCUS_24790 CDS complement(35161..35976) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819278.1 transl_table 11 codon_start 1 locus_tag LOCUS_24800 CDS 36107..37456 product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479869.1 transl_table 11 codon_start 1 locus_tag LOCUS_24810 gene tyrS CDS complement(37708..38637) product 23S rRNA pseudouridine(2604) synthase RluF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419811.1 transl_table 11 codon_start 1 locus_tag LOCUS_24820 gene rluF CDS complement(38760..39230) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24830 CDS complement(39221..41107) product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705399.1 transl_table 11 codon_start 1 locus_tag LOCUS_24840 CDS complement(41327..41854) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24850 CDS complement(41985..43184) product trans-2-enoyl-CoA reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706445.1 transl_table 11 codon_start 1 locus_tag LOCUS_24860 CDS 43421..45166 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706440.1 transl_table 11 codon_start 1 locus_tag LOCUS_24870 CDS 45194..46687 product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706441.1 transl_table 11 codon_start 1 locus_tag LOCUS_24880 gene dacB CDS 46751..47014 product GrxA family glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006809455.1 transl_table 11 codon_start 1 locus_tag LOCUS_24890 CDS 47412..48626 product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706443.1 transl_table 11 codon_start 1 locus_tag LOCUS_24900 CDS complement(48700..50157) product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705220.1 transl_table 11 codon_start 1 locus_tag LOCUS_24910 gene cls CDS 50261..50806 product DUF1439 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026080151.1 transl_table 11 codon_start 1 locus_tag LOCUS_24920 CDS complement(50823..52565) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24930 CDS complement(52737..56627) product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819788.1 transl_table 11 codon_start 1 locus_tag LOCUS_24940 gene purL CDS 56757..58232 product membrane-bound lytic murein transglycosylase MltF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705651.1 transl_table 11 codon_start 1 locus_tag LOCUS_24950 gene mltF CDS 58353..58505 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24960 CDS complement(58589..59029) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227162.1 transl_table 11 codon_start 1 locus_tag LOCUS_24970 CDS complement(59228..60751) product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705649.1 transl_table 11 codon_start 1 locus_tag LOCUS_24980 gene der CDS complement(60824..61996) product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024944077.1 transl_table 11 codon_start 1 locus_tag LOCUS_24990 gene bamB CDS complement(61999..62643) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705647.1 transl_table 11 codon_start 1 locus_tag LOCUS_25000 CDS complement(62644..63888) product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705646.1 transl_table 11 codon_start 1 locus_tag LOCUS_25010 gene hisS CDS complement(64146..65267) product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705645.1 transl_table 11 codon_start 1 locus_tag LOCUS_25020 gene ispG CDS complement(65283..66221) product DUF4115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705644.1 transl_table 11 codon_start 1 locus_tag LOCUS_25030 CDS complement(66211..66990) product PilW family type IVa pilus biogenesis/stability lipoprotein TapF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705643.1 transl_table 11 codon_start 1 locus_tag LOCUS_25040 gene tapF CDS complement(67016..68134) product bifunctional tRNA (adenosine(37)-C2)-methyltransferase TrmG/ribosomal RNA large subunit methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705642.1 transl_table 11 codon_start 1 locus_tag LOCUS_25050 CDS complement(68315..68746) product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072285.1 transl_table 11 codon_start 1 locus_tag LOCUS_25060 gene ndk CDS complement(69397..70701) product aminopeptidase PepB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705639.1 transl_table 11 codon_start 1 locus_tag LOCUS_25070 gene pepB CDS complement(70941..71141) product Fe-S cluster assembly protein IscX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417922.1 transl_table 11 codon_start 1 locus_tag LOCUS_25080 gene iscX CDS complement(71154..71492) product ISC system 2Fe-2S type ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460237.1 transl_table 11 codon_start 1 locus_tag LOCUS_25090 gene fdx CDS complement(71495..73339) product Fe-S protein assembly chaperone HscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705638.1 transl_table 11 codon_start 1 locus_tag LOCUS_25100 gene hscA CDS complement(73345..73863) product co-chaperone HscB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001105747.1 transl_table 11 codon_start 1 locus_tag LOCUS_25110 gene hscB CDS complement(73874..74197) product iron-sulfur cluster assembly protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417916.1 transl_table 11 codon_start 1 locus_tag LOCUS_25120 gene iscA CDS complement(74210..74596) product Fe-S cluster assembly scaffold IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005299770.1 transl_table 11 codon_start 1 locus_tag LOCUS_25130 gene iscU CDS complement(74636..75850) product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705635.1 transl_table 11 codon_start 1 locus_tag LOCUS_25140 CDS complement(75940..76398) product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705634.1 transl_table 11 codon_start 1 locus_tag LOCUS_25150 gene iscR CDS complement(76496..77221) product tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705633.1 transl_table 11 codon_start 1 locus_tag LOCUS_25160 gene trmJ CDS complement(77580..78383) product lipoprotein NlpI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705628.1 transl_table 11 codon_start 1 locus_tag LOCUS_25170 gene nlpI CDS complement(78574..79518) product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460198.1 transl_table 11 codon_start 1 locus_tag LOCUS_25180 gene secF CDS complement(79530..81350) product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705625.1 transl_table 11 codon_start 1 locus_tag LOCUS_25190 gene secD CDS complement(81405..81731) product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705624.1 transl_table 11 codon_start 1 locus_tag LOCUS_25200 gene yajC CDS complement(81895..83040) product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010634306.1 transl_table 11 codon_start 1 locus_tag LOCUS_25210 gene tgt CDS complement(83214..84275) product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705623.1 transl_table 11 codon_start 1 locus_tag LOCUS_25220 gene queA CDS 84455..84961 product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000598452.1 transl_table 11 codon_start 1 locus_tag LOCUS_25230 CDS 84958..85551 product ACP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705571.1 transl_table 11 codon_start 1 locus_tag LOCUS_25240 CDS complement(85521..87344) product protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070916.1 transl_table 11 codon_start 1 locus_tag LOCUS_25250 CDS complement(87381..88730) product dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072332.1 transl_table 11 codon_start 1 locus_tag LOCUS_25260 CDS complement(88739..89716) product transketolase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072331.1 transl_table 11 codon_start 1 locus_tag LOCUS_25270 CDS complement(89716..90900) product thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072330.1 transl_table 11 codon_start 1 locus_tag LOCUS_25280 CDS complement(91146..92744) product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113373.1 transl_table 11 codon_start 1 locus_tag LOCUS_25290 sequence18 source 1..92628 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(234..1229) product nucleoid-associated protein YejK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016350315.1 transl_table 11 codon_start 1 locus_tag LOCUS_25300 gene yejK CDS 1307..1534 product YejL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001135667.1 transl_table 11 codon_start 1 locus_tag LOCUS_25310 CDS 1566..3422 product DUF3413 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705555.1 transl_table 11 codon_start 1 locus_tag LOCUS_25320 CDS complement(3478..3804) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25330 note possible pseudo, frameshifted CDS 4076..4831 product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705225.1 transl_table 11 codon_start 1 locus_tag LOCUS_25340 CDS 4846..5682 product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705224.1 transl_table 11 codon_start 1 locus_tag LOCUS_25350 CDS complement(5843..7180) product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456537.1 transl_table 11 codon_start 1 locus_tag LOCUS_25360 CDS complement(7222..8295) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705564.1 transl_table 11 codon_start 1 locus_tag LOCUS_25370 CDS complement(8308..8529) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25380 CDS 8648..10090 product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016350322.1 transl_table 11 codon_start 1 locus_tag LOCUS_25390 CDS complement(10256..10723) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25400 CDS 10820..11167 product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262403.1 transl_table 11 codon_start 1 locus_tag LOCUS_25410 gene arsC CDS 11167..11547 product DUF2069 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705569.1 transl_table 11 codon_start 1 locus_tag LOCUS_25420 CDS complement(12059..12751) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705577.1 transl_table 11 codon_start 1 locus_tag LOCUS_25430 CDS complement(12755..13495) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705576.1 transl_table 11 codon_start 1 locus_tag LOCUS_25440 CDS complement(13544..14320) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419848.1 transl_table 11 codon_start 1 locus_tag LOCUS_25450 CDS complement(14376..15143) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705574.1 transl_table 11 codon_start 1 locus_tag LOCUS_25460 CDS 15541..16449 product lysine exporter LysO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705573.1 transl_table 11 codon_start 1 locus_tag LOCUS_25470 CDS 16817..17923 product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705815.1 transl_table 11 codon_start 1 locus_tag LOCUS_25480 gene asd CDS 18506..20263 product 30S ribosomal protein S12 methylthiotransferase accessory protein YcaO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705813.1 transl_table 11 codon_start 1 locus_tag LOCUS_25490 CDS complement(20344..21078) product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390181.1 transl_table 11 codon_start 1 locus_tag LOCUS_25500 CDS complement(21146..21769) product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705578.1 transl_table 11 codon_start 1 locus_tag LOCUS_25510 CDS 22048..22995 product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114147.1 transl_table 11 codon_start 1 locus_tag LOCUS_25520 CDS 23136..25148 product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070809.1 transl_table 11 codon_start 1 locus_tag LOCUS_25530 CDS 25150..25524 product DUF1850 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528643.1 transl_table 11 codon_start 1 locus_tag LOCUS_25540 CDS 25533..27281 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000704410.1 transl_table 11 codon_start 1 locus_tag LOCUS_25550 CDS 27274..28596 product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972921.1 transl_table 11 codon_start 1 locus_tag LOCUS_25560 CDS 28758..30281 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25570 CDS complement(30284..31015) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25580 CDS 31288..31926 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705131.1 transl_table 11 codon_start 1 locus_tag LOCUS_25590 CDS complement(31977..35468) product PAS domain-containing hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704911.1 transl_table 11 codon_start 1 locus_tag LOCUS_25600 CDS complement(35468..36613) product 3-phenylpropionate MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704908.1 transl_table 11 codon_start 1 locus_tag LOCUS_25610 CDS 36709..37608 product ChaN family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181711605.1 transl_table 11 codon_start 1 locus_tag LOCUS_25620 CDS 37711..38043 product SMR family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003346798.1 transl_table 11 codon_start 1 locus_tag LOCUS_25630 CDS 38060..38791 product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957710.1 transl_table 11 codon_start 1 locus_tag LOCUS_25640 CDS 38933..40252 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197309.1 transl_table 11 codon_start 1 locus_tag LOCUS_25650 CDS complement(40286..41446) product benzoate/H(+) symporter BenE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707630.1 transl_table 11 codon_start 1 locus_tag LOCUS_25660 CDS 41572..42135 product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818910.1 transl_table 11 codon_start 1 locus_tag LOCUS_25670 CDS complement(42149..42586) product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071100.1 transl_table 11 codon_start 1 locus_tag LOCUS_25680 CDS complement(42853..43227) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25690 CDS 43283..43462 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25700 CDS 43466..44083 product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445085.1 transl_table 11 codon_start 1 locus_tag LOCUS_25710 CDS 44083..44508 product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261839.1 transl_table 11 codon_start 1 locus_tag LOCUS_25720 CDS 44716..44922 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25730 CDS 45175..46230 product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006309949.1 transl_table 11 codon_start 1 locus_tag LOCUS_25740 CDS 46373..46771 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25750 CDS 46791..48458 product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704886.1 transl_table 11 codon_start 1 locus_tag LOCUS_25760 gene ettA CDS 48608..49336 product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480275.1 transl_table 11 codon_start 1 locus_tag LOCUS_25770 CDS 49333..49650 product AzlD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460963.1 transl_table 11 codon_start 1 locus_tag LOCUS_25780 CDS complement(49901..50731) product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532814.1 transl_table 11 codon_start 1 locus_tag LOCUS_25790 CDS 50826..51731 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532815.1 transl_table 11 codon_start 1 locus_tag LOCUS_25800 CDS complement(52231..53589) product Na+/H+ antiporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001880817.1 transl_table 11 codon_start 1 locus_tag LOCUS_25810 CDS complement(53745..54368) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25820 CDS 54544..55740 product NO-inducible flavohemoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704625.1 transl_table 11 codon_start 1 locus_tag LOCUS_25830 gene hmpA CDS 55857..56699 product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085920.1 transl_table 11 codon_start 1 locus_tag LOCUS_25840 CDS 56793..57158 product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087752.1 transl_table 11 codon_start 1 locus_tag LOCUS_25850 CDS complement(57246..57395) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25860 CDS 57640..58770 product chromate efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000955540.1 transl_table 11 codon_start 1 locus_tag LOCUS_25870 gene chrA CDS 58952..60418 product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527998.1 transl_table 11 codon_start 1 locus_tag LOCUS_25880 CDS complement(60469..61236) product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024312277.1 transl_table 11 codon_start 1 locus_tag LOCUS_25890 CDS complement(61269..61676) product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272025.1 transl_table 11 codon_start 1 locus_tag LOCUS_25900 CDS complement(61752..63704) product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791648.1 transl_table 11 codon_start 1 locus_tag LOCUS_25910 CDS complement(63795..64808) product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940088.1 transl_table 11 codon_start 1 locus_tag LOCUS_25920 CDS 65155..66777 product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085184.1 transl_table 11 codon_start 1 locus_tag LOCUS_25930 CDS complement(66802..69303) product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151613683.1 transl_table 11 codon_start 1 locus_tag LOCUS_25940 CDS complement(69378..69800) product Cu(I)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383179.1 transl_table 11 codon_start 1 locus_tag LOCUS_25950 gene cueR CDS complement(69797..70138) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25960 CDS complement(70184..70429) product gold resistance metallochaperone GolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001159469.1 transl_table 11 codon_start 1 locus_tag LOCUS_25970 gene golB CDS complement(70535..71815) product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464684.1 transl_table 11 codon_start 1 locus_tag LOCUS_25980 gene gabT CDS complement(71840..73303) product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706799.1 transl_table 11 codon_start 1 locus_tag LOCUS_25990 CDS 73521..74453 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266560.1 transl_table 11 codon_start 1 locus_tag LOCUS_26000 CDS 74728..75735 product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483136.1 transl_table 11 codon_start 1 locus_tag LOCUS_26010 CDS 75804..76334 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26020 CDS 76334..77650 product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172863.1 transl_table 11 codon_start 1 locus_tag LOCUS_26030 CDS 77658..78080 product universal stress protein UspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001082296.1 transl_table 11 codon_start 1 locus_tag LOCUS_26040 gene uspF CDS complement(78077..79360) product purine/pyrimidine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_090635852.1 transl_table 11 codon_start 1 locus_tag LOCUS_26050 CDS complement(79474..79902) product Zn(2+)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005309469.1 transl_table 11 codon_start 1 locus_tag LOCUS_26060 gene zntR CDS 80120..81703 product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456445.1 transl_table 11 codon_start 1 locus_tag LOCUS_26070 gene purH CDS 81907..83193 product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704786.1 transl_table 11 codon_start 1 locus_tag LOCUS_26080 gene purD CDS 83639..84007 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317528.1 transl_table 11 codon_start 1 locus_tag LOCUS_26090 CDS complement(84064..84420) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26100 CDS complement(84417..84845) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707401.1 transl_table 11 codon_start 1 locus_tag LOCUS_26110 CDS complement(84972..85244) product DNA-binding protein HU-alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005305063.1 transl_table 11 codon_start 1 locus_tag LOCUS_26120 gene hupA CDS complement(85528..86391) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263071.1 transl_table 11 codon_start 1 locus_tag LOCUS_26130 CDS complement(86542..88011) product succinylglutamate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706955.1 transl_table 11 codon_start 1 locus_tag LOCUS_26140 gene astD CDS complement(88008..89030) product arginine N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706956.1 transl_table 11 codon_start 1 locus_tag LOCUS_26150 gene astA CDS complement(89109..90374) product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706957.1 transl_table 11 codon_start 1 locus_tag LOCUS_26160 CDS complement(90718..91299) product aminodeoxychorismate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174674.1 transl_table 11 codon_start 1 locus_tag LOCUS_26170 CDS complement(91411..92418) product elongation factor P--(R)-beta-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456968.1 transl_table 11 codon_start 1 locus_tag LOCUS_26180 gene epmA sequence19 source 1..86992 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1..429 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26190 CDS 713..1027 product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015575.1 transl_table 11 codon_start 1 locus_tag LOCUS_26200 CDS 1310..1462 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26210 CDS 1518..2375 product glutathione-dependent disulfide-bond oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295515.1 transl_table 11 codon_start 1 locus_tag LOCUS_26220 gene yghU CDS complement(2559..2993) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26230 CDS complement(3144..3806) product CoA transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088567.1 transl_table 11 codon_start 1 locus_tag LOCUS_26240 CDS complement(3853..4584) product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088566.1 transl_table 11 codon_start 1 locus_tag LOCUS_26250 CDS 4723..5613 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246985.1 transl_table 11 codon_start 1 locus_tag LOCUS_26260 CDS 5839..7476 product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477808.1 transl_table 11 codon_start 1 locus_tag LOCUS_26270 CDS 7568..9439 product DUF294 nucleotidyltransferase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421488.1 transl_table 11 codon_start 1 locus_tag LOCUS_26280 CDS 9449..10183 product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477841.1 transl_table 11 codon_start 1 locus_tag LOCUS_26290 CDS complement(10550..11176) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26300 CDS 11384..12295 product transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005303519.1 transl_table 11 codon_start 1 locus_tag LOCUS_26310 CDS 12292..12906 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705070.1 transl_table 11 codon_start 1 locus_tag LOCUS_26320 CDS 12896..13279 product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705071.1 transl_table 11 codon_start 1 locus_tag LOCUS_26330 CDS 13279..14370 product 23S rRNA (cytidine(2498)-2'-O)-methyltransferase RlmM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705072.1 transl_table 11 codon_start 1 locus_tag LOCUS_26340 gene rlmM CDS complement(14815..15273) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26350 CDS complement(15420..16427) product isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705074.1 transl_table 11 codon_start 1 locus_tag LOCUS_26360 CDS complement(16507..17289) product flap endonuclease Xni inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927567.1 transl_table 11 codon_start 1 locus_tag LOCUS_26370 gene xni CDS complement(17500..18855) product nucleotide 5'-monophosphate nucleosidase PpnN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705076.1 transl_table 11 codon_start 1 locus_tag LOCUS_26380 gene ppnN CDS complement(18883..20403) product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705077.1 transl_table 11 codon_start 1 locus_tag LOCUS_26390 CDS complement(20442..22694) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705078.1 transl_table 11 codon_start 1 locus_tag LOCUS_26400 CDS complement(22805..23656) product NADPH-dependent 7-cyano-7-deazaguanine reductase QueF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819527.1 transl_table 11 codon_start 1 locus_tag LOCUS_26410 gene queF CDS 23711..24244 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26420 CDS complement(24311..25084) product Zn-ribbon-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705081.1 transl_table 11 codon_start 1 locus_tag LOCUS_26430 CDS complement(25084..25386) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26440 CDS complement(25403..25630) product DUF2789 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771165.1 transl_table 11 codon_start 1 locus_tag LOCUS_26450 CDS complement(25742..26044) product DUF3301 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261354.1 transl_table 11 codon_start 1 locus_tag LOCUS_26460 CDS complement(26037..27104) product DUF3549 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705084.1 transl_table 11 codon_start 1 locus_tag LOCUS_26470 CDS 27191..27526 product YqcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705085.1 transl_table 11 codon_start 1 locus_tag LOCUS_26480 CDS 27523..28254 product tRNA pseudouridine(65) synthase TruC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705086.1 transl_table 11 codon_start 1 locus_tag LOCUS_26490 gene truC CDS 28337..28777 product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705087.1 transl_table 11 codon_start 1 locus_tag LOCUS_26500 CDS complement(29230..30057) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26510 CDS 30331..32220 product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975941.1 transl_table 11 codon_start 1 locus_tag LOCUS_26520 CDS 32253..32531 product DUF3081 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464900.1 transl_table 11 codon_start 1 locus_tag LOCUS_26530 CDS complement(32618..33997) product ATP-dependent RNA helicase DbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704511.1 transl_table 11 codon_start 1 locus_tag LOCUS_26540 gene dbpA CDS complement(34176..35207) product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456577.1 transl_table 11 codon_start 1 locus_tag LOCUS_26550 gene dapD CDS complement(35427..38057) product bifunctional uridylyltransferase/uridylyl-removing protein GlnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705092.1 transl_table 11 codon_start 1 locus_tag LOCUS_26560 gene glnD CDS complement(38229..38444) product cold shock-like protein CspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211350.1 transl_table 11 codon_start 1 locus_tag LOCUS_26570 gene cspD CDS 38824..39141 product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005300028.1 transl_table 11 codon_start 1 locus_tag LOCUS_26580 gene clpS CDS 39191..41446 product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705733.1 transl_table 11 codon_start 1 locus_tag LOCUS_26590 gene clpA CDS complement(41629..41847) product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211347.1 transl_table 11 codon_start 1 locus_tag LOCUS_26600 gene infA CDS complement(41924..42628) product arginyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705735.1 transl_table 11 codon_start 1 locus_tag LOCUS_26610 CDS complement(42625..43320) product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705736.1 transl_table 11 codon_start 1 locus_tag LOCUS_26620 gene aat CDS complement(43333..43506) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26630 CDS 43619..45361 product C4-dicarboxylic acid transporter DauA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925752.1 transl_table 11 codon_start 1 locus_tag LOCUS_26640 gene dauA CDS complement(45455..46408) product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000073137.1 transl_table 11 codon_start 1 locus_tag LOCUS_26650 gene trxB CDS 47043..47546 product leucine-responsive transcriptional regulator Lrp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228473.1 transl_table 11 codon_start 1 locus_tag LOCUS_26660 gene lrp CDS 47719..50289 product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705741.1 transl_table 11 codon_start 1 locus_tag LOCUS_26670 CDS 50292..50900 product outer membrane lipoprotein chaperone LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705742.1 transl_table 11 codon_start 1 locus_tag LOCUS_26680 gene lolA CDS 51210..52535 product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196299305.1 transl_table 11 codon_start 1 locus_tag LOCUS_26690 CDS 52633..53931 product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705744.1 transl_table 11 codon_start 1 locus_tag LOCUS_26700 gene serS CDS 54100..54591 product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072963.1 transl_table 11 codon_start 1 locus_tag LOCUS_26710 CDS 54612..56129 product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705746.1 transl_table 11 codon_start 1 locus_tag LOCUS_26720 gene purF CDS complement(56202..56807) product Yip1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071909.1 transl_table 11 codon_start 1 locus_tag LOCUS_26730 CDS complement(56978..57808) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072068.1 transl_table 11 codon_start 1 locus_tag LOCUS_26740 CDS complement(58192..59040) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26750 CDS complement(59154..60053) product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480548.1 transl_table 11 codon_start 1 locus_tag LOCUS_26760 tmRNA complement(60293..60652) product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_tm00010 CDS complement(60695..61180) product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705343.1 transl_table 11 codon_start 1 locus_tag LOCUS_26770 gene smpB CDS 61317..61766 product type II toxin-antitoxin system RatA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815744.1 transl_table 11 codon_start 1 locus_tag LOCUS_26780 CDS 61747..62088 product RnfH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705345.1 transl_table 11 codon_start 1 locus_tag LOCUS_26790 CDS complement(62127..62465) product outer membrane protein assembly factor BamE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705347.1 transl_table 11 codon_start 1 locus_tag LOCUS_26800 CDS 62666..63424 product uridine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705364.1 transl_table 11 codon_start 1 locus_tag LOCUS_26810 gene udp CDS complement(63555..65219) product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706784.1 transl_table 11 codon_start 1 locus_tag LOCUS_26820 gene recN CDS complement(65376..66260) product NAD(+) kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005303013.1 transl_table 11 codon_start 1 locus_tag LOCUS_26830 gene nadK CDS 66446..67048 product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706782.1 transl_table 11 codon_start 1 locus_tag LOCUS_26840 gene grpE CDS 67185..69116 product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706781.1 transl_table 11 codon_start 1 locus_tag LOCUS_26850 gene dnaK CDS 69209..70342 product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118464.1 transl_table 11 codon_start 1 locus_tag LOCUS_26860 gene dnaJ CDS 70474..70950 product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707083.1 transl_table 11 codon_start 1 locus_tag LOCUS_26870 gene greA CDS complement(71384..71680) product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005298134.1 transl_table 11 codon_start 1 locus_tag LOCUS_26880 gene yhbY CDS 71765..72394 product 23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707081.1 transl_table 11 codon_start 1 locus_tag LOCUS_26890 gene rlmE CDS 72460..74391 product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707080.1 transl_table 11 codon_start 1 locus_tag LOCUS_26900 gene ftsH CDS 74460..75293 product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815445.1 transl_table 11 codon_start 1 locus_tag LOCUS_26910 gene folP CDS 75298..76638 product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707078.1 transl_table 11 codon_start 1 locus_tag LOCUS_26920 gene glmM CDS 76829..77164 product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010633113.1 transl_table 11 codon_start 1 locus_tag LOCUS_26930 gene secG tRNA 77172..77258 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00520 tRNA 77316..77392 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00530 CDS 77583..78041 product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147148.1 transl_table 11 codon_start 1 locus_tag LOCUS_26940 gene rimP CDS 78056..79558 product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707075.1 transl_table 11 codon_start 1 locus_tag LOCUS_26950 gene nusA CDS 79578..82268 product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707074.1 transl_table 11 codon_start 1 locus_tag LOCUS_26960 gene infB CDS 82352..82780 product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707073.1 transl_table 11 codon_start 1 locus_tag LOCUS_26970 gene rbfA CDS 82783..83718 product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016351717.1 transl_table 11 codon_start 1 locus_tag LOCUS_26980 gene truB CDS 83881..84150 product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005298162.1 transl_table 11 codon_start 1 locus_tag LOCUS_26990 gene rpsO CDS 84441..86636 product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707071.1 transl_table 11 codon_start 1 locus_tag LOCUS_27000 gene pnp sequence20 source 1..79038 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(178..1044) product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037818.1 transl_table 11 codon_start 1 locus_tag LOCUS_27010 CDS complement(1041..1649) product GNAT family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338369.1 transl_table 11 codon_start 1 locus_tag LOCUS_27020 CDS complement(1649..2059) product ketosteroid isomerase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972626.1 transl_table 11 codon_start 1 locus_tag LOCUS_27030 CDS 2266..3300 product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707708.1 transl_table 11 codon_start 1 locus_tag LOCUS_27040 gene murB CDS 3288..4262 product bifunctional biotin--[acetyl-CoA-carboxylase] ligase/biotin operon repressor BirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707707.1 transl_table 11 codon_start 1 locus_tag LOCUS_27050 gene birA CDS complement(4674..5615) product type I pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707706.1 transl_table 11 codon_start 1 locus_tag LOCUS_27060 gene coaA tRNA 5875..5950 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00540 tRNA 5960..6044 product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00550 tRNA 6116..6190 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00560 tRNA 6194..6269 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00570 CDS 6376..7560 product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210669.1 transl_table 11 codon_start 1 locus_tag LOCUS_27070 gene tuf tRNA 7612..7688 product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00580 CDS 7755..8126 product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707705.1 transl_table 11 codon_start 1 locus_tag LOCUS_27080 gene secE CDS 8136..8684 product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005306318.1 transl_table 11 codon_start 1 locus_tag LOCUS_27090 gene nusG CDS 8813..9241 product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005318556.1 transl_table 11 codon_start 1 locus_tag LOCUS_27100 gene rplK CDS 9246..9941 product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707704.1 transl_table 11 codon_start 1 locus_tag LOCUS_27110 gene rplA CDS 10183..10686 product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070609.1 transl_table 11 codon_start 1 locus_tag LOCUS_27120 gene rplJ CDS 10741..11103 product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707702.1 transl_table 11 codon_start 1 locus_tag LOCUS_27130 gene rplL CDS 11327..15355 product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010635847.1 transl_table 11 codon_start 1 locus_tag LOCUS_27140 gene rpoB CDS 15441..19652 product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707700.1 transl_table 11 codon_start 1 locus_tag LOCUS_27150 gene rpoC CDS 20256..22052 product assimilatory sulfite reductase (NADPH) flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261116.1 transl_table 11 codon_start 1 locus_tag LOCUS_27160 CDS 22052..23755 product assimilatory sulfite reductase (NADPH) hemoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707137.1 transl_table 11 codon_start 1 locus_tag LOCUS_27170 gene cysI CDS 23745..24512 product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707138.1 transl_table 11 codon_start 1 locus_tag LOCUS_27180 CDS 24679..26076 product siroheme synthase CysG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707310.1 transl_table 11 codon_start 1 locus_tag LOCUS_27190 gene cysG CDS complement(26619..27149) product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707292.1 transl_table 11 codon_start 1 locus_tag LOCUS_27200 gene ppa CDS 27345..28718 product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707291.1 transl_table 11 codon_start 1 locus_tag LOCUS_27210 gene mpl CDS 28705..29343 product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707290.1 transl_table 11 codon_start 1 locus_tag LOCUS_27220 CDS 29425..29955 product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707288.1 transl_table 11 codon_start 1 locus_tag LOCUS_27230 gene hpt CDS 30052..30975 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707287.1 transl_table 11 codon_start 1 locus_tag LOCUS_27240 CDS 30972..31745 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005304632.1 transl_table 11 codon_start 1 locus_tag LOCUS_27250 CDS complement(31804..32190) product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113912.1 transl_table 11 codon_start 1 locus_tag LOCUS_27260 CDS complement(32294..33142) product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707282.1 transl_table 11 codon_start 1 locus_tag LOCUS_27270 gene panC CDS complement(33152..33946) product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707281.1 transl_table 11 codon_start 1 locus_tag LOCUS_27280 gene panB CDS complement(33958..34446) product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707280.1 transl_table 11 codon_start 1 locus_tag LOCUS_27290 gene folK CDS complement(34443..35771) product polynucleotide adenylyltransferase PcnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707279.1 transl_table 11 codon_start 1 locus_tag LOCUS_27300 gene pcnB CDS complement(35875..36798) product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818759.1 transl_table 11 codon_start 1 locus_tag LOCUS_27310 gene gluQRS CDS complement(36814..37266) product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005304459.1 transl_table 11 codon_start 1 locus_tag LOCUS_27320 gene dksA CDS 37562..38311 product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545814.1 transl_table 11 codon_start 1 locus_tag LOCUS_27330 gene sfsA CDS 38301..38453 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27340 CDS complement(38865..39386) product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206820023.1 transl_table 11 codon_start 1 locus_tag LOCUS_27350 gene thpR CDS 39457..41889 product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818758.1 transl_table 11 codon_start 1 locus_tag LOCUS_27360 gene hrpB CDS 41892..44222 product penicillin-binding protein 1B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707274.1 transl_table 11 codon_start 1 locus_tag LOCUS_27370 gene mrcB CDS 44359..44784 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009876549.1 transl_table 11 codon_start 1 locus_tag LOCUS_27380 CDS complement(44790..46076) product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707264.1 transl_table 11 codon_start 1 locus_tag LOCUS_27390 gene hemL CDS 46251..46886 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27400 CDS 46942..47286 product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005304404.1 transl_table 11 codon_start 1 locus_tag LOCUS_27410 gene erpA CDS 47305..47622 product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263648.1 transl_table 11 codon_start 1 locus_tag LOCUS_27420 CDS 47619..48044 product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704842.1 transl_table 11 codon_start 1 locus_tag LOCUS_27430 CDS complement(48070..49368) product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706904.1 transl_table 11 codon_start 1 locus_tag LOCUS_27440 CDS 49537..50733 product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010633247.1 transl_table 11 codon_start 1 locus_tag LOCUS_27450 gene tyrS CDS complement(50837..52507) product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990624.1 transl_table 11 codon_start 1 locus_tag LOCUS_27460 CDS complement(53329..53958) product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705587.1 transl_table 11 codon_start 1 locus_tag LOCUS_27470 CDS complement(54021..54851) product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705594.1 transl_table 11 codon_start 1 locus_tag LOCUS_27480 CDS complement(54859..55788) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27490 CDS complement(55794..56492) product 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705596.1 transl_table 11 codon_start 1 locus_tag LOCUS_27500 gene mtnN CDS complement(56944..58359) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706516.1 transl_table 11 codon_start 1 locus_tag LOCUS_27510 CDS complement(58372..62829) product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706515.1 transl_table 11 codon_start 1 locus_tag LOCUS_27520 gene gltB CDS 63432..65807 product aerobic respiration two-component sensor histidine kinase ArcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704845.1 transl_table 11 codon_start 1 locus_tag LOCUS_27530 gene arcB CDS 65804..67168 product dGTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704846.1 transl_table 11 codon_start 1 locus_tag LOCUS_27540 gene dgt CDS 67289..68521 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27550 CDS complement(68994..69491) product transcription/translation regulatory transformer protein RfaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000833004.1 transl_table 11 codon_start 1 locus_tag LOCUS_27560 gene rfaH CDS complement(69588..70415) product MetQ/NlpA family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459159.1 transl_table 11 codon_start 1 locus_tag LOCUS_27570 CDS complement(70434..71087) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704854.1 transl_table 11 codon_start 1 locus_tag LOCUS_27580 CDS complement(71068..72111) product methionine ABC transporter ATP-binding protein MetN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704855.1 transl_table 11 codon_start 1 locus_tag LOCUS_27590 gene metN CDS 72356..73375 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818730.1 transl_table 11 codon_start 1 locus_tag LOCUS_27600 CDS 73368..74429 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707196.1 transl_table 11 codon_start 1 locus_tag LOCUS_27610 CDS 74442..76244 product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707195.1 transl_table 11 codon_start 1 locus_tag LOCUS_27620 CDS 76244..77224 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707194.1 transl_table 11 codon_start 1 locus_tag LOCUS_27630 CDS 77221..78297 product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707193.1 transl_table 11 codon_start 1 locus_tag LOCUS_27640 CDS 78314..78871 product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044801009.1 transl_table 11 codon_start 1 locus_tag LOCUS_27650 gene gmhB sequence21 source 1..72606 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 321..1226 product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005303453.1 transl_table 11 codon_start 1 locus_tag LOCUS_27660 CDS 1453..2643 product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705098.1 transl_table 11 codon_start 1 locus_tag LOCUS_27670 gene ispC CDS 2643..3992 product sigma E protease regulator RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705099.1 transl_table 11 codon_start 1 locus_tag LOCUS_27680 gene rseP CDS 4115..6502 product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705100.1 transl_table 11 codon_start 1 locus_tag LOCUS_27690 gene bamA CDS 7553..8056 product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037416754.1 transl_table 11 codon_start 1 locus_tag LOCUS_27700 CDS 8084..9106 product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705102.1 transl_table 11 codon_start 1 locus_tag LOCUS_27710 gene lpxD CDS 9129..9602 product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010634777.1 transl_table 11 codon_start 1 locus_tag LOCUS_27720 gene fabZ CDS 9605..10396 product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705103.1 transl_table 11 codon_start 1 locus_tag LOCUS_27730 gene lpxA CDS 10389..11537 product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705104.1 transl_table 11 codon_start 1 locus_tag LOCUS_27740 gene lpxB CDS 11548..12183 product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480979.1 transl_table 11 codon_start 1 locus_tag LOCUS_27750 gene rnhB CDS 12180..15653 product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705106.1 transl_table 11 codon_start 1 locus_tag LOCUS_27760 gene dnaE CDS 15663..16616 product acetyl-CoA carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349878.1 transl_table 11 codon_start 1 locus_tag LOCUS_27770 gene accA CDS 16794..17549 product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000701830.1 transl_table 11 codon_start 1 locus_tag LOCUS_27780 CDS 17628..17816 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27790 CDS 18010..19317 product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705125.1 transl_table 11 codon_start 1 locus_tag LOCUS_27800 gene tilS CDS 19324..19689 product endonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942019.1 transl_table 11 codon_start 1 locus_tag LOCUS_27810 CDS complement(19933..21084) product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705128.1 transl_table 11 codon_start 1 locus_tag LOCUS_27820 CDS complement(21539..23257) product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368141.1 transl_table 11 codon_start 1 locus_tag LOCUS_27830 gene proS CDS complement(23454..24173) product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706829.1 transl_table 11 codon_start 1 locus_tag LOCUS_27840 gene tsaA CDS complement(24173..24541) product Rcs stress response system protein RcsF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010633326.1 transl_table 11 codon_start 1 locus_tag LOCUS_27850 gene rcsF tRNA 24867..24940 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00590 CDS complement(25038..25754) product two-component system response regulator ArcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856501.1 transl_table 11 codon_start 1 locus_tag LOCUS_27860 gene arcA CDS 26257..26748 product putative 4-hydroxy-4-methyl-2-oxoglutarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706822.1 transl_table 11 codon_start 1 locus_tag LOCUS_27870 CDS complement(26865..28007) product IS4-like element IS1481A family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035386.1 transl_table 11 codon_start 1 locus_tag LOCUS_27880 CDS complement(28135..29862) product bifunctional isocitrate dehydrogenase kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706819.1 transl_table 11 codon_start 1 locus_tag LOCUS_27890 gene aceK CDS complement(30278..31270) product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071843.1 transl_table 11 codon_start 1 locus_tag LOCUS_27900 CDS 31349..32128 product tRNA/rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706818.1 transl_table 11 codon_start 1 locus_tag LOCUS_27910 CDS 32364..34823 product bifunctional aspartate kinase/homoserine dehydrogenase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706816.1 transl_table 11 codon_start 1 locus_tag LOCUS_27920 gene thrA CDS 34824..35780 product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706815.1 transl_table 11 codon_start 1 locus_tag LOCUS_27930 gene thrB CDS 35777..37054 product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706814.1 transl_table 11 codon_start 1 locus_tag LOCUS_27940 gene thrC CDS 37258..37518 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27950 CDS 38287..39153 product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706717.1 transl_table 11 codon_start 1 locus_tag LOCUS_27960 gene tesB CDS 39418..40098 product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465920.1 transl_table 11 codon_start 1 locus_tag LOCUS_27970 gene ung CDS complement(40334..40525) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27980 CDS complement(40701..41654) product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016351598.1 transl_table 11 codon_start 1 locus_tag LOCUS_27990 gene tal CDS 42070..43491 product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706925.1 transl_table 11 codon_start 1 locus_tag LOCUS_28000 CDS complement(43581..44132) product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100571.1 transl_table 11 codon_start 1 locus_tag LOCUS_28010 CDS 44548..44883 product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705754.1 transl_table 11 codon_start 1 locus_tag LOCUS_28020 CDS 44952..45587 product DUF480 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706673.1 transl_table 11 codon_start 1 locus_tag LOCUS_28030 CDS complement(45800..46354) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28040 CDS complement(46296..47177) product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689183.1 transl_table 11 codon_start 1 locus_tag LOCUS_28050 CDS complement(47177..48598) product copper-containing nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200986.1 transl_table 11 codon_start 1 locus_tag LOCUS_28060 gene nirK CDS 48971..49981 product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042143812.1 transl_table 11 codon_start 1 locus_tag LOCUS_28070 CDS 49978..50544 product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529043.1 transl_table 11 codon_start 1 locus_tag LOCUS_28080 CDS 50541..51821 product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810021.1 transl_table 11 codon_start 1 locus_tag LOCUS_28090 CDS 51862..52593 product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086078.1 transl_table 11 codon_start 1 locus_tag LOCUS_28100 CDS 52763..53455 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_212344658.1 transl_table 11 codon_start 1 locus_tag LOCUS_28110 CDS 54086..55507 product dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086079.1 transl_table 11 codon_start 1 locus_tag LOCUS_28120 gene hydA CDS 55512..56207 product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810391.1 transl_table 11 codon_start 1 locus_tag LOCUS_28130 CDS 56290..57462 product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815469.1 transl_table 11 codon_start 1 locus_tag LOCUS_28140 CDS 57547..58584 product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926712.1 transl_table 11 codon_start 1 locus_tag LOCUS_28150 CDS 58645..59277 product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811059.1 transl_table 11 codon_start 1 locus_tag LOCUS_28160 CDS 59274..60566 product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808102.1 transl_table 11 codon_start 1 locus_tag LOCUS_28170 CDS 60566..61993 product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086065.1 transl_table 11 codon_start 1 locus_tag LOCUS_28180 CDS 62048..62827 product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229070.1 transl_table 11 codon_start 1 locus_tag LOCUS_28190 CDS 62890..63783 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28200 CDS complement(63780..64721) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626196.1 transl_table 11 codon_start 1 locus_tag LOCUS_28210 CDS 65128..66480 product beta-alanine--pyruvate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083801.1 transl_table 11 codon_start 1 locus_tag LOCUS_28220 gene bauA CDS 66669..68159 product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266562.1 transl_table 11 codon_start 1 locus_tag LOCUS_28230 CDS 68650..69627 product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705183.1 transl_table 11 codon_start 1 locus_tag LOCUS_28240 CDS 69775..71133 product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992247.1 transl_table 11 codon_start 1 locus_tag LOCUS_28250 CDS 71102..71878 product 7-alpha-hydroxysteroid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000483353.1 transl_table 11 codon_start 1 locus_tag LOCUS_28260 gene hdhA CDS complement(72143..72484) product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071041.1 transl_table 11 codon_start 1 locus_tag LOCUS_28270 sequence22 source 1..59543 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(3255..3995) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28280 CDS complement(3992..5590) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28290 CDS complement(5959..6444) product zinc ribbon-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005298255.1 transl_table 11 codon_start 1 locus_tag LOCUS_28300 CDS 6566..9145 product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077392314.1 transl_table 11 codon_start 1 locus_tag LOCUS_28310 gene leuS CDS 9393..9878 product LPS assembly lipoprotein LptE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707022.1 transl_table 11 codon_start 1 locus_tag LOCUS_28320 gene lptE CDS 9878..10900 product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707024.1 transl_table 11 codon_start 1 locus_tag LOCUS_28330 gene holA CDS 10897..11544 product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707025.1 transl_table 11 codon_start 1 locus_tag LOCUS_28340 gene nadD CDS 11579..11920 product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707026.1 transl_table 11 codon_start 1 locus_tag LOCUS_28350 gene rsfS CDS 11920..12390 product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776104.1 transl_table 11 codon_start 1 locus_tag LOCUS_28360 gene rlmH CDS 12393..14285 product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707027.1 transl_table 11 codon_start 1 locus_tag LOCUS_28370 gene mrdA CDS 14278..15384 product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818663.1 transl_table 11 codon_start 1 locus_tag LOCUS_28380 gene rodA CDS 15397..16368 product lytic murein transglycosylase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041216677.1 transl_table 11 codon_start 1 locus_tag LOCUS_28390 gene mltB CDS 16352..17179 product septal ring lytic transglycosylase RlpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071396.1 transl_table 11 codon_start 1 locus_tag LOCUS_28400 CDS 17247..18419 product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707032.1 transl_table 11 codon_start 1 locus_tag LOCUS_28410 CDS 18601..18864 product DUF493 family protein YbeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005298227.1 transl_table 11 codon_start 1 locus_tag LOCUS_28420 gene ybeD CDS 18874..19527 product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071393.1 transl_table 11 codon_start 1 locus_tag LOCUS_28430 gene lipB CDS 19524..20489 product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707035.1 transl_table 11 codon_start 1 locus_tag LOCUS_28440 gene lipA CDS complement(20589..21644) product 3-deoxy-7-phosphoheptulonate synthase AroG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705850.1 transl_table 11 codon_start 1 locus_tag LOCUS_28450 gene aroG CDS 22001..22402 product DUF2750 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706662.1 transl_table 11 codon_start 1 locus_tag LOCUS_28460 CDS 22402..22839 product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704544.1 transl_table 11 codon_start 1 locus_tag LOCUS_28470 CDS 22899..23444 product DUF1439 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026080151.1 transl_table 11 codon_start 1 locus_tag LOCUS_28480 CDS complement(23508..23714) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28490 CDS 23638..24240 product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106442.1 transl_table 11 codon_start 1 locus_tag LOCUS_28500 CDS 24222..24638 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28510 CDS 24691..26739 product protein-disulfide reductase DsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481629.1 transl_table 11 codon_start 1 locus_tag LOCUS_28520 CDS 26736..27254 product protein disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421462.1 transl_table 11 codon_start 1 locus_tag LOCUS_28530 CDS 27603..28970 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962682.1 transl_table 11 codon_start 1 locus_tag LOCUS_28540 CDS complement(29366..31573) product DUF2339 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085336.1 transl_table 11 codon_start 1 locus_tag LOCUS_28550 CDS complement(32136..32564) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28560 CDS complement(32630..33886) product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707185.1 transl_table 11 codon_start 1 locus_tag LOCUS_28570 CDS complement(33895..34998) product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707186.1 transl_table 11 codon_start 1 locus_tag LOCUS_28580 gene proB CDS complement(35113..35511) product sigma factor-binding protein Crl inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707187.1 transl_table 11 codon_start 1 locus_tag LOCUS_28590 gene crl CDS complement(35676..36146) product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002889733.1 transl_table 11 codon_start 1 locus_tag LOCUS_28600 gene gpt CDS 36483..37940 product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707191.1 transl_table 11 codon_start 1 locus_tag LOCUS_28610 CDS 38095..38436 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28620 CDS 38566..38733 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28630 CDS complement(38739..39794) product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226167.1 transl_table 11 codon_start 1 locus_tag LOCUS_28640 gene dinB CDS complement(39904..40128) product (Na+)-NQR maturation NqrM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705066.1 transl_table 11 codon_start 1 locus_tag LOCUS_28650 gene nqrM CDS complement(40130..41164) product FAD:protein FMN transferase ApbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705065.1 transl_table 11 codon_start 1 locus_tag LOCUS_28660 CDS complement(41171..42394) product NADH:ubiquinone reductase (Na(+)-transporting) subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705064.1 transl_table 11 codon_start 1 locus_tag LOCUS_28670 gene nqrF CDS complement(42421..43017) product NADH:ubiquinone reductase (Na(+)-transporting) subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005436652.1 transl_table 11 codon_start 1 locus_tag LOCUS_28680 gene nqrE CDS complement(43021..43653) product NADH:ubiquinone reductase (Na(+)-transporting) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005303545.1 transl_table 11 codon_start 1 locus_tag LOCUS_28690 CDS complement(43646..44416) product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705063.1 transl_table 11 codon_start 1 locus_tag LOCUS_28700 CDS complement(44409..45647) product NADH:ubiquinone reductase (Na(+)-transporting) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418132.1 transl_table 11 codon_start 1 locus_tag LOCUS_28710 CDS complement(45651..46994) product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705061.1 transl_table 11 codon_start 1 locus_tag LOCUS_28720 CDS complement(47347..47664) product BolA/IbaG family iron-sulfur metabolism protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705060.1 transl_table 11 codon_start 1 locus_tag LOCUS_28730 CDS complement(47726..48310) product alpha-ketoglutarate-dependent dioxygenase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479964.1 transl_table 11 codon_start 1 locus_tag LOCUS_28740 CDS 48368..49513 product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705059.1 transl_table 11 codon_start 1 locus_tag LOCUS_28750 CDS 49530..50108 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28760 CDS 50109..50678 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005303575.1 transl_table 11 codon_start 1 locus_tag LOCUS_28770 CDS 50656..52047 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705057.1 transl_table 11 codon_start 1 locus_tag LOCUS_28780 CDS complement(52245..52727) product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705055.1 transl_table 11 codon_start 1 locus_tag LOCUS_28790 CDS 52855..53745 product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705054.1 transl_table 11 codon_start 1 locus_tag LOCUS_28800 CDS complement(54019..55467) product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705585.1 transl_table 11 codon_start 1 locus_tag LOCUS_28810 gene thiI CDS 55809..56027 product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367987.1 transl_table 11 codon_start 1 locus_tag LOCUS_28820 gene xseB CDS 56029..56919 product (2E,6E)-farnesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707087.1 transl_table 11 codon_start 1 locus_tag LOCUS_28830 gene ispA CDS 56941..58806 product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707088.1 transl_table 11 codon_start 1 locus_tag LOCUS_28840 gene dxs sequence23 source 1..48580 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1260 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921441.1:cadherin domain-containing protein locus_tag LOCUS_28850 CDS 1270..2613 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28860 CDS 2618..4735 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28870 CDS complement(4841..6391) product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707020.1 transl_table 11 codon_start 1 locus_tag LOCUS_28880 gene lnt CDS complement(6394..7275) product CNNM family magnesium/cobalt transport protein CorC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707019.1 transl_table 11 codon_start 1 locus_tag LOCUS_28890 gene corC CDS complement(7285..7749) product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707018.1 transl_table 11 codon_start 1 locus_tag LOCUS_28900 gene ybeY CDS complement(7746..8777) product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707017.1 transl_table 11 codon_start 1 locus_tag LOCUS_28910 CDS complement(8865..10295) product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707016.1 transl_table 11 codon_start 1 locus_tag LOCUS_28920 gene miaB CDS 10479..11648 product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707015.1 transl_table 11 codon_start 1 locus_tag LOCUS_28930 tRNA complement(11860..11934) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00600 tRNA complement(11946..12030) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00610 tRNA complement(12037..12113) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00620 tRNA complement(12227..12301) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00630 tRNA complement(12348..12422) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00640 tRNA complement(12427..12503) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00650 CDS complement(12769..13860) product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000505850.1 transl_table 11 codon_start 1 locus_tag LOCUS_28940 gene ychF CDS complement(13890..14486) product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105710.1 transl_table 11 codon_start 1 locus_tag LOCUS_28950 gene pth CDS 14681..15409 product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836257.1 transl_table 11 codon_start 1 locus_tag LOCUS_28960 CDS complement(15967..16914) product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005298464.1 transl_table 11 codon_start 1 locus_tag LOCUS_28970 CDS complement(17154..18023) product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706938.1 transl_table 11 codon_start 1 locus_tag LOCUS_28980 gene ispE CDS complement(18020..18598) product lipoprotein insertase outer membrane protein LolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706937.1 transl_table 11 codon_start 1 locus_tag LOCUS_28990 gene lolB CDS 18721..19980 product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927715.1 transl_table 11 codon_start 1 locus_tag LOCUS_29000 gene hemA CDS 20004..21089 product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706935.1 transl_table 11 codon_start 1 locus_tag LOCUS_29010 gene prfA CDS 21089..21946 product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706934.1 transl_table 11 codon_start 1 locus_tag LOCUS_29020 gene prmC CDS 21924..22754 product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706932.1 transl_table 11 codon_start 1 locus_tag LOCUS_29030 CDS 22763..23611 product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706931.1 transl_table 11 codon_start 1 locus_tag LOCUS_29040 gene kdsA CDS complement(23756..24559) product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477264.1 transl_table 11 codon_start 1 locus_tag LOCUS_29050 CDS complement(24556..25905) product nodulation protein NfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477226.1 transl_table 11 codon_start 1 locus_tag LOCUS_29060 CDS 26173..26610 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704532.1 transl_table 11 codon_start 1 locus_tag LOCUS_29070 CDS complement(26619..28046) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29080 CDS complement(28050..29504) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064848.1 transl_table 11 codon_start 1 locus_tag LOCUS_29090 CDS complement(29581..32025) product acyl-CoA dehydrogenase FadE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705468.1 transl_table 11 codon_start 1 locus_tag LOCUS_29100 gene fadE CDS 32276..32857 product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000284054.1 transl_table 11 codon_start 1 locus_tag LOCUS_29110 gene lpcA CDS 32863..33642 product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705470.1 transl_table 11 codon_start 1 locus_tag LOCUS_29120 CDS complement(34225..34863) product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818195.1 transl_table 11 codon_start 1 locus_tag LOCUS_29130 gene purN CDS complement(34860..35897) product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706623.1 transl_table 11 codon_start 1 locus_tag LOCUS_29140 gene purM CDS 36357..36953 product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420493.1 transl_table 11 codon_start 1 locus_tag LOCUS_29150 gene upp CDS 37005..38273 product uracil-xanthine permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072791.1 transl_table 11 codon_start 1 locus_tag LOCUS_29160 CDS 38337..39338 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29170 CDS 39331..40053 product DnaA inactivator Hda inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205596950.1 transl_table 11 codon_start 1 locus_tag LOCUS_29180 gene hda CDS complement(40330..41136) product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706756.1 transl_table 11 codon_start 1 locus_tag LOCUS_29190 gene xthA CDS complement(41185..41946) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103539.1 transl_table 11 codon_start 1 locus_tag LOCUS_29200 CDS 42146..43180 product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073326.1 transl_table 11 codon_start 1 locus_tag LOCUS_29210 CDS 43167..46262 product multidrug efflux RND transporter permease subunit VmeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481813.1 transl_table 11 codon_start 1 locus_tag LOCUS_29220 gene vmeF tRNA complement(46758..46842) product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00660 tRNA complement(46960..47044) product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00670 CDS complement(47279..48361) product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704969.1 transl_table 11 codon_start 1 locus_tag LOCUS_29230 sequence24 source 1..47263 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 369..1001 product cytochrome c biogenesis heme-transporting ATPase CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705297.1 transl_table 11 codon_start 1 locus_tag LOCUS_29240 gene ccmA CDS 998..1666 product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705298.1 transl_table 11 codon_start 1 locus_tag LOCUS_29250 gene ccmB CDS 1802..2548 product heme ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705299.1 transl_table 11 codon_start 1 locus_tag LOCUS_29260 CDS 2538..2744 product heme exporter protein CcmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705300.1 transl_table 11 codon_start 1 locus_tag LOCUS_29270 gene ccmD CDS 2741..3235 product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705301.1 transl_table 11 codon_start 1 locus_tag LOCUS_29280 gene ccmE CDS 3232..5187 product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705302.1 transl_table 11 codon_start 1 locus_tag LOCUS_29290 CDS 5184..5717 product DsbE family thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005298853.1 transl_table 11 codon_start 1 locus_tag LOCUS_29300 CDS 5722..6198 product cytochrome c-type biogenesis protein CcmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705303.1 transl_table 11 codon_start 1 locus_tag LOCUS_29310 CDS 6200..7411 product c-type cytochrome biogenesis protein CcmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705304.1 transl_table 11 codon_start 1 locus_tag LOCUS_29320 gene ccmI CDS 7485..8273 product VacJ family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029301472.1 transl_table 11 codon_start 1 locus_tag LOCUS_29330 CDS complement(8516..9109) product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392134.1 transl_table 11 codon_start 1 locus_tag LOCUS_29340 CDS complement(9212..9505) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29350 CDS 9750..10820 product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705545.1 transl_table 11 codon_start 1 locus_tag LOCUS_29360 CDS 10962..12092 product bifunctional chorismate mutase/prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257629.1 transl_table 11 codon_start 1 locus_tag LOCUS_29370 gene tyrA CDS complement(12311..14191) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29380 CDS complement(14592..14819) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29390 CDS complement(14767..15195) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29400 CDS 15542..17449 product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705455.1 transl_table 11 codon_start 1 locus_tag LOCUS_29410 CDS 17484..18263 product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705457.1 transl_table 11 codon_start 1 locus_tag LOCUS_29420 CDS complement(18187..18768) product inosine/xanthosine triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226224.1 transl_table 11 codon_start 1 locus_tag LOCUS_29430 gene yjjX CDS 18857..19255 product acyl-CoA thioester hydrolase YciA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419162.1 transl_table 11 codon_start 1 locus_tag LOCUS_29440 gene yciA CDS 19233..20072 product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705460.1 transl_table 11 codon_start 1 locus_tag LOCUS_29450 CDS complement(20200..21567) product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705461.1 transl_table 11 codon_start 1 locus_tag LOCUS_29460 CDS complement(21685..22482) product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705462.1 transl_table 11 codon_start 1 locus_tag LOCUS_29470 gene gloB CDS 22530..23243 product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016350242.1 transl_table 11 codon_start 1 locus_tag LOCUS_29480 CDS complement(23231..23692) product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705464.1 transl_table 11 codon_start 1 locus_tag LOCUS_29490 gene rnhA CDS 23858..24589 product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705465.1 transl_table 11 codon_start 1 locus_tag LOCUS_29500 gene dnaQ tRNA 24830..24906 product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00680 CDS 24978..26645 product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_150912620.1 transl_table 11 codon_start 1 locus_tag LOCUS_29510 CDS complement(26798..28063) product benzoate/H(+) symporter BenE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206210.1 transl_table 11 codon_start 1 locus_tag LOCUS_29520 gene benE CDS complement(28142..29491) product aromatic acid/H+ symport family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206209.1 transl_table 11 codon_start 1 locus_tag LOCUS_29530 CDS complement(29596..30375) product 1,6-dihydroxycyclohexa-2,4-diene-1-carboxylate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525022.1 transl_table 11 codon_start 1 locus_tag LOCUS_29540 CDS complement(30372..31400) product benzoate 1,2-dioxygenase electron transfer component BenC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705526.1 transl_table 11 codon_start 1 locus_tag LOCUS_29550 gene benC CDS complement(31420..31905) product benzoate 1,2-dioxygenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015095.1 transl_table 11 codon_start 1 locus_tag LOCUS_29560 gene benB CDS complement(31902..33278) product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705527.1 transl_table 11 codon_start 1 locus_tag LOCUS_29570 CDS complement(33386..34315) product catechol 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705528.1 transl_table 11 codon_start 1 locus_tag LOCUS_29580 gene catA CDS complement(34375..34665) product muconolactone Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366454.1 transl_table 11 codon_start 1 locus_tag LOCUS_29590 gene catC CDS complement(34701..35819) product muconate cycloisomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162708822.1 transl_table 11 codon_start 1 locus_tag LOCUS_29600 CDS 35927..36829 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089870.1 transl_table 11 codon_start 1 locus_tag LOCUS_29610 CDS 36942..37211 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29620 note possible pseudo, internal stop codon, frameshifted CDS 37204..37386 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29630 CDS complement(37706..39022) product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038867.1 transl_table 11 codon_start 1 locus_tag LOCUS_29640 CDS complement(39038..39208) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29650 CDS complement(39930..40712) product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807682.1 transl_table 11 codon_start 1 locus_tag LOCUS_29660 CDS 40990..41808 product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084060.1 transl_table 11 codon_start 1 locus_tag LOCUS_29670 CDS 41808..42602 product CoA-transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037402699.1 transl_table 11 codon_start 1 locus_tag LOCUS_29680 CDS 42599..43804 product 3-oxoadipyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037402686.1 transl_table 11 codon_start 1 locus_tag LOCUS_29690 gene pcaF CDS 44197..44997 product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035624.1 transl_table 11 codon_start 1 locus_tag LOCUS_29700 gene pcaD CDS complement(45100..46029) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705501.1 transl_table 11 codon_start 1 locus_tag LOCUS_29710 CDS 46193..46672 product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073195.1 transl_table 11 codon_start 1 locus_tag LOCUS_29720 sequence25 source 1..45822 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(87..302) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29730 CDS 301..1449 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072048.1 transl_table 11 codon_start 1 locus_tag LOCUS_29740 CDS complement(2091..2687) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035344.1 transl_table 11 codon_start 1 locus_tag LOCUS_29750 CDS complement(2719..4464) product Wzy polymerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818252.1 transl_table 11 codon_start 1 locus_tag LOCUS_29760 CDS complement(4723..5997) product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000289498.1 transl_table 11 codon_start 1 locus_tag LOCUS_29770 CDS complement(6068..6346) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29780 CDS complement(6543..7316) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001031644.1 transl_table 11 codon_start 1 locus_tag LOCUS_29790 CDS complement(7313..8587) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208594.1 transl_table 11 codon_start 1 locus_tag LOCUS_29800 CDS complement(8584..9378) product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083199050.1 transl_table 11 codon_start 1 locus_tag LOCUS_29810 CDS complement(9378..9866) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29820 CDS complement(10692..11318) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29830 CDS complement(11413..12768) product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001306804.1 transl_table 11 codon_start 1 locus_tag LOCUS_29840 gene ltrA CDS complement(13227..13712) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29850 CDS complement(13968..15017) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29860 CDS complement(15014..15697) product acylneuraminate cytidylyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392279.1 transl_table 11 codon_start 1 locus_tag LOCUS_29870 CDS complement(15694..16692) product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261005.1 transl_table 11 codon_start 1 locus_tag LOCUS_29880 CDS complement(16845..17759) product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861609.1 transl_table 11 codon_start 1 locus_tag LOCUS_29890 gene fmt CDS complement(17871..18938) product N-acetylneuraminate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459663.1 transl_table 11 codon_start 1 locus_tag LOCUS_29900 gene neuB CDS complement(18941..20089) product UDP-N-acetylglucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261002.1 transl_table 11 codon_start 1 locus_tag LOCUS_29910 gene neuC CDS complement(20091..21236) product LegC family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459668.1 transl_table 11 codon_start 1 locus_tag LOCUS_29920 CDS complement(21244..22434) product UDP-N-acetylglucosamine 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261000.1 transl_table 11 codon_start 1 locus_tag LOCUS_29930 CDS complement(22450..23721) product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085030.1 transl_table 11 codon_start 1 locus_tag LOCUS_29940 CDS complement(24775..25425) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29950 CDS complement(25415..26275) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29960 CDS complement(26279..28489) product exopolysaccharide regulatory tyrosine autokinase VpsO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147064.1 transl_table 11 codon_start 1 locus_tag LOCUS_29970 gene vpsO CDS complement(28492..29031) product exopolysaccharide export protein VpsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000978825.1 transl_table 11 codon_start 1 locus_tag LOCUS_29980 gene vpsN CDS complement(29115..30329) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29990 CDS 31077..31664 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30000 CDS 31933..33282 product O-antigen ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000947937.1 transl_table 11 codon_start 1 locus_tag LOCUS_30010 CDS 33321..33575 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30020 CDS complement(34086..35729) product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212085.1 transl_table 11 codon_start 1 locus_tag LOCUS_30030 gene pgi CDS complement(36163..37179) product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705040.1 transl_table 11 codon_start 1 locus_tag LOCUS_30040 gene galE CDS complement(37597..38991) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942487.1 transl_table 11 codon_start 1 locus_tag LOCUS_30050 CDS 39316..39459 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30060 CDS complement(39547..40413) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30070 CDS complement(40508..42130) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30080 CDS complement(42667..43854) product DegT/DnrJ/EryC1/StrS aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462475.1 transl_table 11 codon_start 1 locus_tag LOCUS_30090 CDS complement(44098..44259) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30100 CDS complement(44249..45220) product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462477.1 transl_table 11 codon_start 1 locus_tag LOCUS_30110 sequence26 source 1..42869 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(32..107) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00690 tRNA complement(140..215) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00700 tRNA complement(258..333) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00710 tRNA complement(396..471) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00720 tRNA complement(502..577) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00730 tRNA complement(614..689) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00740 tRNA complement(745..820) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00750 tRNA complement(840..915) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00760 CDS complement(1061..1753) product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072685.1 transl_table 11 codon_start 1 locus_tag LOCUS_30120 gene ybgF CDS complement(1842..2363) product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005304908.1 transl_table 11 codon_start 1 locus_tag LOCUS_30130 gene pal CDS complement(2390..3688) product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707363.1 transl_table 11 codon_start 1 locus_tag LOCUS_30140 gene tolB CDS complement(3692..4885) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30150 CDS complement(4893..5318) product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072689.1 transl_table 11 codon_start 1 locus_tag LOCUS_30160 gene tolR CDS complement(5318..5998) product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707366.1 transl_table 11 codon_start 1 locus_tag LOCUS_30170 gene tolQ CDS complement(5988..6413) product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707367.1 transl_table 11 codon_start 1 locus_tag LOCUS_30180 gene ybgC CDS complement(6572..7591) product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707371.1 transl_table 11 codon_start 1 locus_tag LOCUS_30190 gene ruvB CDS complement(7595..8203) product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005486097.1 transl_table 11 codon_start 1 locus_tag LOCUS_30200 gene ruvA CDS complement(8554..9075) product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418602.1 transl_table 11 codon_start 1 locus_tag LOCUS_30210 gene ruvC CDS complement(9444..10184) product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096082.1 transl_table 11 codon_start 1 locus_tag LOCUS_30220 CDS complement(10171..10656) product dihydroneopterin triphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023620451.1 transl_table 11 codon_start 1 locus_tag LOCUS_30230 gene nudB CDS complement(10660..12465) product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169176.1 transl_table 11 codon_start 1 locus_tag LOCUS_30240 gene aspS CDS 12736..13578 product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705417.1 transl_table 11 codon_start 1 locus_tag LOCUS_30250 CDS complement(13619..13783) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30260 CDS 13964..14692 product carboxy-S-adenosyl-L-methionine synthase CmoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705416.1 transl_table 11 codon_start 1 locus_tag LOCUS_30270 gene cmoA CDS 14689..15699 product tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041216623.1 transl_table 11 codon_start 1 locus_tag LOCUS_30280 gene cmoB CDS 15692..16459 product ATP-dependent zinc protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016350202.1 transl_table 11 codon_start 1 locus_tag LOCUS_30290 CDS 16465..18033 product inactive transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705413.1 transl_table 11 codon_start 1 locus_tag LOCUS_30300 CDS 18026..19000 product alpha-L-glutamate ligase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705412.1 transl_table 11 codon_start 1 locus_tag LOCUS_30310 CDS complement(19288..20217) product 23S rRNA pseudouridine(2605) synthase RluB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706718.1 transl_table 11 codon_start 1 locus_tag LOCUS_30320 gene rluB CDS complement(20227..20847) product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295575.1 transl_table 11 codon_start 1 locus_tag LOCUS_30330 CDS complement(20866..21690) product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706722.1 transl_table 11 codon_start 1 locus_tag LOCUS_30340 CDS 22082..23632 product anthranilate synthase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706723.1 transl_table 11 codon_start 1 locus_tag LOCUS_30350 CDS 23625..25238 product bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366209.1 transl_table 11 codon_start 1 locus_tag LOCUS_30360 gene trpD CDS 25232..26620 product bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818276.1 transl_table 11 codon_start 1 locus_tag LOCUS_30370 gene trpCF CDS complement(26623..26958) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30380 CDS 26903..27772 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30390 note possible pseudo, frameshifted CDS 27769..28578 product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706728.1 transl_table 11 codon_start 1 locus_tag LOCUS_30400 gene trpA CDS complement(28951..29448) product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081117.1 transl_table 11 codon_start 1 locus_tag LOCUS_30410 CDS 29611..30195 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071613.1 transl_table 11 codon_start 1 locus_tag LOCUS_30420 CDS 30192..33086 product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071612.1 transl_table 11 codon_start 1 locus_tag LOCUS_30430 CDS 33149..34996 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30440 CDS 35015..37444 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30450 CDS 37718..38482 product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791492.1 transl_table 11 codon_start 1 locus_tag LOCUS_30460 gene fabG CDS 38658..39791 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30470 CDS complement(39876..40964) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014119.1 transl_table 11 codon_start 1 locus_tag LOCUS_30480 CDS complement(41286..42335) product DUF2235 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226213.1 transl_table 11 codon_start 1 locus_tag LOCUS_30490 sequence27 source 1..42433 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 68..143 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00770 CDS 944..2368 product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707874.1 transl_table 11 codon_start 1 locus_tag LOCUS_30500 gene ccoG CDS 2414..3382 product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707873.1 transl_table 11 codon_start 1 locus_tag LOCUS_30510 CDS 3423..4025 product thiol:disulfide interchange protein DsbA/DsbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707872.1 transl_table 11 codon_start 1 locus_tag LOCUS_30520 CDS complement(4070..4378) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071883.1 transl_table 11 codon_start 1 locus_tag LOCUS_30530 CDS complement(4434..5945) product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707862.1 transl_table 11 codon_start 1 locus_tag LOCUS_30540 CDS 6313..8007 product acetolactate synthase 2 catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707860.1 transl_table 11 codon_start 1 locus_tag LOCUS_30550 gene ilvG CDS 8004..8264 product acetolactate synthase 2 small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212016.1 transl_table 11 codon_start 1 locus_tag LOCUS_30560 gene ilvM CDS 8276..9199 product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707859.1 transl_table 11 codon_start 1 locus_tag LOCUS_30570 CDS 9268..11118 product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001127399.1 transl_table 11 codon_start 1 locus_tag LOCUS_30580 gene ilvD CDS 11121..12674 product threonine ammonia-lyase, biosynthetic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707857.1 transl_table 11 codon_start 1 locus_tag LOCUS_30590 gene ilvA CDS complement(12860..14125) product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706908.1 transl_table 11 codon_start 1 locus_tag LOCUS_30600 CDS complement(14313..14897) product HupE/UreJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112304.1 transl_table 11 codon_start 1 locus_tag LOCUS_30610 CDS complement(14966..15604) product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095530.1 transl_table 11 codon_start 1 locus_tag LOCUS_30620 gene ureG CDS complement(15636..16445) product urease accessory protein UreF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057205.1 transl_table 11 codon_start 1 locus_tag LOCUS_30630 CDS complement(16333..16857) product urease accessory protein UreE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431764.1 transl_table 11 codon_start 1 locus_tag LOCUS_30640 gene ureE CDS complement(16879..18582) product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269033.1 transl_table 11 codon_start 1 locus_tag LOCUS_30650 gene ureC CDS complement(18579..18914) product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084271.1 transl_table 11 codon_start 1 locus_tag LOCUS_30660 CDS complement(18926..19228) product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862556.1 transl_table 11 codon_start 1 locus_tag LOCUS_30670 CDS complement(19329..20195) product urease accessory protein UreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185533.1 transl_table 11 codon_start 1 locus_tag LOCUS_30680 CDS 20834..21700 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113156.1 transl_table 11 codon_start 1 locus_tag LOCUS_30690 CDS complement(22254..23429) product heme biosynthesis HemY N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704439.1 transl_table 11 codon_start 1 locus_tag LOCUS_30700 CDS complement(23440..24570) product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704440.1 transl_table 11 codon_start 1 locus_tag LOCUS_30710 CDS complement(24554..25312) product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704441.1 transl_table 11 codon_start 1 locus_tag LOCUS_30720 CDS complement(25309..26238) product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349245.1 transl_table 11 codon_start 1 locus_tag LOCUS_30730 gene hemC CDS 26512..28950 product class I adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704443.1 transl_table 11 codon_start 1 locus_tag LOCUS_30740 CDS complement(28947..29258) product iron donor protein CyaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704445.1 transl_table 11 codon_start 1 locus_tag LOCUS_30750 gene cyaY CDS 29331..29453 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30760 CDS 29465..30721 product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704446.1 transl_table 11 codon_start 1 locus_tag LOCUS_30770 gene lysA CDS 30725..31558 product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704447.1 transl_table 11 codon_start 1 locus_tag LOCUS_30780 gene dapF CDS 31555..32265 product DUF484 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349251.1 transl_table 11 codon_start 1 locus_tag LOCUS_30790 CDS 32252..33169 product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704449.1 transl_table 11 codon_start 1 locus_tag LOCUS_30800 gene xerC CDS 33669..34376 product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704450.1 transl_table 11 codon_start 1 locus_tag LOCUS_30810 CDS 34412..36580 product DNA helicase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704228.1 transl_table 11 codon_start 1 locus_tag LOCUS_30820 gene uvrD CDS complement(37002..37901) product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704249.1 transl_table 11 codon_start 1 locus_tag LOCUS_30830 gene rarD CDS 38118..39944 product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707789.1 transl_table 11 codon_start 1 locus_tag LOCUS_30840 gene recQ CDS complement(39994..40293) product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707788.1 transl_table 11 codon_start 1 locus_tag LOCUS_30850 CDS 40515..41948 product YdiU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707787.1 transl_table 11 codon_start 1 locus_tag LOCUS_30860 CDS 41963..42211 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30870 sequence28 source 1..36297 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(305..712) product nucleoside diphosphate kinase regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706600.1 transl_table 11 codon_start 1 locus_tag LOCUS_30880 gene rnk CDS 850..1026 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30890 CDS 956..1546 product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707635.1 transl_table 11 codon_start 1 locus_tag LOCUS_30900 CDS complement(1636..2847) product L-2-hydroxyglutarate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000271942.1 transl_table 11 codon_start 1 locus_tag LOCUS_30910 gene lhgO CDS complement(2955..3923) product glutarate dioxygenase GlaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704498.1 transl_table 11 codon_start 1 locus_tag LOCUS_30920 gene glaH CDS 4088..4777 product DNA-binding transcriptional regulator CsiR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000156811.1 transl_table 11 codon_start 1 locus_tag LOCUS_30930 gene csiR CDS 5159..5329 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30940 note possible pseudo, frameshifted CDS 5366..6268 product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005306036.1 transl_table 11 codon_start 1 locus_tag LOCUS_30950 gene metF CDS 6953..7960 product DctP family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812403.1 transl_table 11 codon_start 1 locus_tag LOCUS_30960 CDS 8036..8530 product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389893.1 transl_table 11 codon_start 1 locus_tag LOCUS_30970 CDS 8520..9824 product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389892.1 transl_table 11 codon_start 1 locus_tag LOCUS_30980 CDS 10004..10288 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30990 CDS complement(10340..12598) product zinc/cadmium/mercury/lead-transporting ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819304.1 transl_table 11 codon_start 1 locus_tag LOCUS_31000 CDS complement(12651..13556) product LysR family transcriptional regulator ArgP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704527.1 transl_table 11 codon_start 1 locus_tag LOCUS_31010 CDS 13670..14293 product LysE/ArgO family amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482474.1 transl_table 11 codon_start 1 locus_tag LOCUS_31020 CDS complement(14288..16045) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31030 CDS 16274..17215 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065074.1 transl_table 11 codon_start 1 locus_tag LOCUS_31040 CDS complement(17216..18727) product p-aminobenzoyl-glutamate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096863.1 transl_table 11 codon_start 1 locus_tag LOCUS_31050 gene abgT CDS complement(18790..19965) product M20 aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814551.1 transl_table 11 codon_start 1 locus_tag LOCUS_31060 CDS complement(20175..21443) product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482970.1 transl_table 11 codon_start 1 locus_tag LOCUS_31070 CDS complement(21512..22879) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707647.1 transl_table 11 codon_start 1 locus_tag LOCUS_31080 CDS complement(22869..23597) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707648.1 transl_table 11 codon_start 1 locus_tag LOCUS_31090 CDS 23776..24297 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31100 CDS complement(24509..24979) product transcriptional regulator AsnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707730.1 transl_table 11 codon_start 1 locus_tag LOCUS_31110 gene asnC CDS 25122..26114 product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016352287.1 transl_table 11 codon_start 1 locus_tag LOCUS_31120 gene asnA CDS complement(26180..26587) product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707727.1 transl_table 11 codon_start 1 locus_tag LOCUS_31130 CDS 27092..28531 product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707724.1 transl_table 11 codon_start 1 locus_tag LOCUS_31140 CDS 28524..29027 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31150 CDS 29033..30376 product two-component system response regulator GlrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625590.1 transl_table 11 codon_start 1 locus_tag LOCUS_31160 gene glrR CDS 30450..31475 product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707720.1 transl_table 11 codon_start 1 locus_tag LOCUS_31170 gene msrP CDS 31475..32095 product protein-methionine-sulfoxide reductase heme-binding subunit MsrQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707719.1 transl_table 11 codon_start 1 locus_tag LOCUS_31180 gene msrQ CDS 32405..32866 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31190 CDS 32935..34878 product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707714.1 transl_table 11 codon_start 1 locus_tag LOCUS_31200 CDS 34952..36025 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31210 sequence29 source 1..35989 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1087 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005477133.1:choline dehydrogenase locus_tag LOCUS_31220 CDS 1289..2506 product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969412.1 transl_table 11 codon_start 1 locus_tag LOCUS_31230 CDS complement(2574..3164) product DUF1415 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071856.1 transl_table 11 codon_start 1 locus_tag LOCUS_31240 CDS complement(3235..3666) product DUF3465 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000870871.1 transl_table 11 codon_start 1 locus_tag LOCUS_31250 CDS complement(3713..4375) product DUF3047 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941830.1 transl_table 11 codon_start 1 locus_tag LOCUS_31260 CDS 4404..5033 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31270 CDS 5119..5865 product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113623.1 transl_table 11 codon_start 1 locus_tag LOCUS_31280 CDS 5862..6590 product allophanate hydrolase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113622.1 transl_table 11 codon_start 1 locus_tag LOCUS_31290 CDS 6587..7531 product biotin-dependent carboxyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147543.1 transl_table 11 codon_start 1 locus_tag LOCUS_31300 CDS complement(7571..7855) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31310 CDS complement(7852..9651) product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071060.1 transl_table 11 codon_start 1 locus_tag LOCUS_31320 CDS 9779..10744 product zinc transporter ZntB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029301878.1 transl_table 11 codon_start 1 locus_tag LOCUS_31330 gene zntB CDS complement(10829..12361) product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706466.1 transl_table 11 codon_start 1 locus_tag LOCUS_31340 CDS complement(12622..12837) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31350 CDS complement(13121..14503) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532501.1 transl_table 11 codon_start 1 locus_tag LOCUS_31360 CDS complement(14668..15282) product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482839.1 transl_table 11 codon_start 1 locus_tag LOCUS_31370 gene thiE CDS complement(15279..16082) product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263206.1 transl_table 11 codon_start 1 locus_tag LOCUS_31380 gene thiM CDS complement(16121..16567) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31390 CDS complement(16689..17090) product TM2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404557.1 transl_table 11 codon_start 1 locus_tag LOCUS_31400 CDS complement(17528..18649) product 2-iminoacetate synthase ThiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260917.1 transl_table 11 codon_start 1 locus_tag LOCUS_31410 gene thiH CDS complement(18646..19416) product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480959.1 transl_table 11 codon_start 1 locus_tag LOCUS_31420 CDS complement(19418..19618) product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704010.1 transl_table 11 codon_start 1 locus_tag LOCUS_31430 gene thiS CDS complement(19624..20376) product HesA/MoeB/ThiF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704415.1 transl_table 11 codon_start 1 locus_tag LOCUS_31440 CDS complement(20378..21886) product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704414.1 transl_table 11 codon_start 1 locus_tag LOCUS_31450 gene thiE CDS complement(21892..23850) product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704413.1 transl_table 11 codon_start 1 locus_tag LOCUS_31460 gene thiC CDS 24417..25340 product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704501.1 transl_table 11 codon_start 1 locus_tag LOCUS_31470 gene menC CDS 25412..27379 product exoribonuclease II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704526.1 transl_table 11 codon_start 1 locus_tag LOCUS_31480 CDS 27571..28575 product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365488.1 transl_table 11 codon_start 1 locus_tag LOCUS_31490 CDS 28579..29418 product sulfate/thiosulfate ABC transporter permease CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098204.1 transl_table 11 codon_start 1 locus_tag LOCUS_31500 gene cysT CDS 29418..30257 product sulfate/thiosulfate ABC transporter permease CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098203.1 transl_table 11 codon_start 1 locus_tag LOCUS_31510 gene cysW CDS 30264..31355 product sulfate/thiosulfate ABC transporter ATP-binding protein CysA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172252.1 transl_table 11 codon_start 1 locus_tag LOCUS_31520 gene cysA CDS complement(31437..32327) product cysteine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102419.1 transl_table 11 codon_start 1 locus_tag LOCUS_31530 gene cysM CDS complement(32435..33052) product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365424.1 transl_table 11 codon_start 1 locus_tag LOCUS_31540 CDS 33161..35830 product bifunctional acetate--CoA ligase family protein/GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208750.1 transl_table 11 codon_start 1 locus_tag LOCUS_31550 sequence30 source 1..35235 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2963..3913 product 23S rRNA pseudouridine(955/2504/2580) synthase RluC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201356046.1 transl_table 11 codon_start 1 locus_tag LOCUS_31560 gene rluC CDS 3910..4551 product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706097.1 transl_table 11 codon_start 1 locus_tag LOCUS_31570 CDS complement(4817..5395) product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206817289.1 transl_table 11 codon_start 1 locus_tag LOCUS_31580 CDS 5561..6082 product 23S rRNA accumulation protein YceD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706102.1 transl_table 11 codon_start 1 locus_tag LOCUS_31590 gene yceD CDS 6104..6274 product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005300935.1 transl_table 11 codon_start 1 locus_tag LOCUS_31600 gene rpmF CDS 6285..7295 product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706103.1 transl_table 11 codon_start 1 locus_tag LOCUS_31610 gene plsX CDS 7301..8260 product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706104.1 transl_table 11 codon_start 1 locus_tag LOCUS_31620 CDS 8310..9245 product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706105.1 transl_table 11 codon_start 1 locus_tag LOCUS_31630 gene fabD CDS 9482..10216 product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210935.1 transl_table 11 codon_start 1 locus_tag LOCUS_31640 gene fabG CDS 10375..10611 product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005300909.1 transl_table 11 codon_start 1 locus_tag LOCUS_31650 gene acpP CDS 10684..11925 product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706107.1 transl_table 11 codon_start 1 locus_tag LOCUS_31660 gene fabF CDS 11984..12808 product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706108.1 transl_table 11 codon_start 1 locus_tag LOCUS_31670 gene pabC CDS 12792..13796 product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016350715.1 transl_table 11 codon_start 1 locus_tag LOCUS_31680 gene mltG CDS 13800..14423 product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706110.1 transl_table 11 codon_start 1 locus_tag LOCUS_31690 gene tmk CDS 14408..15382 product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163136678.1 transl_table 11 codon_start 1 locus_tag LOCUS_31700 gene holB CDS 15458..16246 product YchF/TatD family DNA exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706112.1 transl_table 11 codon_start 1 locus_tag LOCUS_31710 CDS 16541..16954 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31720 CDS 16968..17921 product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250267.1 transl_table 11 codon_start 1 locus_tag LOCUS_31730 CDS complement(18283..19461) product Bcr/CflA family multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001276805.1 transl_table 11 codon_start 1 locus_tag LOCUS_31740 CDS 19857..20165 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31750 CDS complement(20244..22031) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261885.1 transl_table 11 codon_start 1 locus_tag LOCUS_31760 CDS 22107..22565 product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706144.1 transl_table 11 codon_start 1 locus_tag LOCUS_31770 CDS 22654..23199 product RNA chaperone ProQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706143.1 transl_table 11 codon_start 1 locus_tag LOCUS_31780 gene proQ CDS 23210..25216 product carboxy terminal-processing peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706142.1 transl_table 11 codon_start 1 locus_tag LOCUS_31790 gene prc CDS 25298..27904 product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706141.1 transl_table 11 codon_start 1 locus_tag LOCUS_31800 gene pepN CDS 27956..28078 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31810 CDS 28467..33302 product NAD-glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706140.1 transl_table 11 codon_start 1 locus_tag LOCUS_31820 CDS 33366..34373 product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097269.1 transl_table 11 codon_start 1 locus_tag LOCUS_31830 gene pyrD CDS 34533..35012 product cell division protein ZapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706138.1 transl_table 11 codon_start 1 locus_tag LOCUS_31840 tRNA complement(35134..35210) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00780 sequence31 source 1..30567 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(154..552) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810412.1 transl_table 11 codon_start 1 locus_tag LOCUS_31850 CDS 800..1843 product GMP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707000.1 transl_table 11 codon_start 1 locus_tag LOCUS_31860 CDS complement(1891..2457) product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000246893.1 transl_table 11 codon_start 1 locus_tag LOCUS_31870 gene efp CDS 2500..3525 product EF-P beta-lysylation protein EpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482201.1 transl_table 11 codon_start 1 locus_tag LOCUS_31880 gene epmB CDS 3806..4114 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31890 CDS complement(4142..6076) product bifunctional diguanylate cyclase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704806.1 transl_table 11 codon_start 1 locus_tag LOCUS_31900 CDS complement(6073..6573) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349563.1 transl_table 11 codon_start 1 locus_tag LOCUS_31910 CDS complement(6800..8437) product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704804.1 transl_table 11 codon_start 1 locus_tag LOCUS_31920 gene groL CDS complement(8473..8763) product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005309514.1 transl_table 11 codon_start 1 locus_tag LOCUS_31930 CDS 8962..10314 product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704803.1 transl_table 11 codon_start 1 locus_tag LOCUS_31940 CDS complement(10709..11209) product membrane protein FxsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460455.1 transl_table 11 codon_start 1 locus_tag LOCUS_31950 gene fxsA CDS 11427..11876 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31960 CDS 11955..12296 product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005156248.1 transl_table 11 codon_start 1 locus_tag LOCUS_31970 CDS complement(12313..13098) product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704938.1 transl_table 11 codon_start 1 locus_tag LOCUS_31980 gene fkpA CDS 13456..13671 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31990 CDS complement(14152..14778) product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477517.1 transl_table 11 codon_start 1 locus_tag LOCUS_32000 CDS complement(14780..15730) product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477410.1 transl_table 11 codon_start 1 locus_tag LOCUS_32010 CDS complement(15727..17148) product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477444.1 transl_table 11 codon_start 1 locus_tag LOCUS_32020 gene uxaC CDS complement(17173..18648) product fructuronate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477431.1 transl_table 11 codon_start 1 locus_tag LOCUS_32030 CDS complement(18737..19921) product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000438591.1 transl_table 11 codon_start 1 locus_tag LOCUS_32040 gene uxuA CDS complement(20019..20774) product FCD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477441.1 transl_table 11 codon_start 1 locus_tag LOCUS_32050 CDS complement(20887..21858) product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005449968.1 transl_table 11 codon_start 1 locus_tag LOCUS_32060 CDS 22163..22651 product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461368.1 transl_table 11 codon_start 1 locus_tag LOCUS_32070 CDS 22681..23982 product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461370.1 transl_table 11 codon_start 1 locus_tag LOCUS_32080 CDS 24117..25055 product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207577.1 transl_table 11 codon_start 1 locus_tag LOCUS_32090 CDS complement(25098..25625) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32100 CDS complement(25766..25966) product YheV family putative zinc ribbon protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704934.1 transl_table 11 codon_start 1 locus_tag LOCUS_32110 CDS 26029..26718 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819462.1 transl_table 11 codon_start 1 locus_tag LOCUS_32120 CDS 26749..28647 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707314.1 transl_table 11 codon_start 1 locus_tag LOCUS_32130 CDS 28644..29075 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32140 CDS 29090..29938 product 23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707316.1 transl_table 11 codon_start 1 locus_tag LOCUS_32150 gene rlmJ sequence32 source 1..29219 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(508..1971) product betaine-aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477313.1 transl_table 11 codon_start 1 locus_tag LOCUS_32160 gene betB CDS complement(1962..2570) product transcriptional regulator BetI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001335745.1 transl_table 11 codon_start 1 locus_tag LOCUS_32170 gene betI CDS 2897..3406 product lipocalin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071839.1 transl_table 11 codon_start 1 locus_tag LOCUS_32180 CDS 3523..3981 product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073278.1 transl_table 11 codon_start 1 locus_tag LOCUS_32190 CDS complement(4594..5274) product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073279.1 transl_table 11 codon_start 1 locus_tag LOCUS_32200 CDS complement(5460..6125) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32210 CDS complement(6284..6577) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32220 CDS 6651..7772 product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929866.1 transl_table 11 codon_start 1 locus_tag LOCUS_32230 CDS 8255..8977 product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113437.1 transl_table 11 codon_start 1 locus_tag LOCUS_32240 CDS 8999..9949 product formimidoylglutamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113438.1 transl_table 11 codon_start 1 locus_tag LOCUS_32250 gene hutG CDS 10012..11220 product sodium/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105930.1 transl_table 11 codon_start 1 locus_tag LOCUS_32260 gene gltS CDS complement(11303..12382) product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000462798.1 transl_table 11 codon_start 1 locus_tag LOCUS_32270 gene ftsZ CDS complement(12456..13415) product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308002.1 transl_table 11 codon_start 1 locus_tag LOCUS_32280 CDS 13627..15147 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32290 CDS complement(15877..16266) product SirB2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704321.1 transl_table 11 codon_start 1 locus_tag LOCUS_32300 CDS 16412..16837 product DUF411 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704327.1 transl_table 11 codon_start 1 locus_tag LOCUS_32310 CDS complement(16818..17174) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32320 CDS 17293..19056 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32330 CDS 19057..19251 product YnbE family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000784063.1 transl_table 11 codon_start 1 locus_tag LOCUS_32340 CDS 19261..19575 product YdbL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098276.1 transl_table 11 codon_start 1 locus_tag LOCUS_32350 CDS 19727..21898 product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819168.1 transl_table 11 codon_start 1 locus_tag LOCUS_32360 CDS complement(22249..23598) product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014164074.1 transl_table 11 codon_start 1 locus_tag LOCUS_32370 CDS complement(23810..24928) product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704344.1 transl_table 11 codon_start 1 locus_tag LOCUS_32380 CDS 25073..25684 product HTH-type transcriptional repressor FabR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308043.1 transl_table 11 codon_start 1 locus_tag LOCUS_32390 gene fabR CDS 25702..26070 product YijD family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_113995426.1 transl_table 11 codon_start 1 locus_tag LOCUS_32400 CDS complement(26130..26987) product 3-mercaptopyruvate sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000203698.1 transl_table 11 codon_start 1 locus_tag LOCUS_32410 gene sseA CDS 27565..27885 product DUF2007 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704337.1 transl_table 11 codon_start 1 locus_tag LOCUS_32420 CDS complement(27895..28176) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32430 CDS complement(28173..28769) product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704347.1 transl_table 11 codon_start 1 locus_tag LOCUS_32440 gene rsmD sequence33 source 1..17720 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 32..107 product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00790 CDS 217..2031 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32450 CDS complement(2012..2536) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706315.1 transl_table 11 codon_start 1 locus_tag LOCUS_32460 CDS 2653..3045 product MerR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705940.1 transl_table 11 codon_start 1 locus_tag LOCUS_32470 CDS complement(3084..4370) product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010633771.1 transl_table 11 codon_start 1 locus_tag LOCUS_32480 gene aroA CDS complement(4620..5720) product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694274.1 transl_table 11 codon_start 1 locus_tag LOCUS_32490 gene hisC CDS complement(6140..7216) product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705848.1 transl_table 11 codon_start 1 locus_tag LOCUS_32500 gene serC CDS complement(7410..10193) product DNA topoisomerase (ATP-hydrolyzing) subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706172.1 transl_table 11 codon_start 1 locus_tag LOCUS_32510 gene gyrA CDS 10353..11051 product bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016350657.1 transl_table 11 codon_start 1 locus_tag LOCUS_32520 gene ubiG CDS 11055..11732 product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706174.1 transl_table 11 codon_start 1 locus_tag LOCUS_32530 CDS 12077..14353 product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819935.1 transl_table 11 codon_start 1 locus_tag LOCUS_32540 gene nrdA CDS 14721..15854 product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706176.1 transl_table 11 codon_start 1 locus_tag LOCUS_32550 gene nrdB CDS 15851..16123 product class I ribonucleotide reductase maintenance protein YfaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688918.1 transl_table 11 codon_start 1 locus_tag LOCUS_32560 gene yfaE CDS complement(16236..16601) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32570 CDS complement(16633..16791) product YqaE/Pmp3 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390272.1 transl_table 11 codon_start 1 locus_tag LOCUS_32580 CDS complement(16869..17129) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32590 sequence34 source 1..6073 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(597..1388) product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958195.1 transl_table 11 codon_start 1 locus_tag LOCUS_32600 gene map CDS 1755..2480 product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005303470.1 transl_table 11 codon_start 1 locus_tag LOCUS_32610 gene rpsB CDS 2588..3466 product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705094.1 transl_table 11 codon_start 1 locus_tag LOCUS_32620 gene tsf CDS 3539..4267 product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262433.1 transl_table 11 codon_start 1 locus_tag LOCUS_32630 gene pyrH CDS 4376..4933 product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705096.1 transl_table 11 codon_start 1 locus_tag LOCUS_32640 gene frr CDS 5009..5788 product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705097.1 transl_table 11 codon_start 1 locus_tag LOCUS_32650 gene uppS sequence35 source 1..5908 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 693..767 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00800 CDS 1016..1846 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704980.1 transl_table 11 codon_start 1 locus_tag LOCUS_32660 CDS 2020..2211 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32670 CDS complement(2116..2451) product DUF1904 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483015.1 transl_table 11 codon_start 1 locus_tag LOCUS_32680 CDS 2528..3373 product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704979.1 transl_table 11 codon_start 1 locus_tag LOCUS_32690 CDS 3517..3657 product DUF3149 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064773827.1 transl_table 11 codon_start 1 locus_tag LOCUS_32700 CDS 3876..5351 product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819484.1 transl_table 11 codon_start 1 locus_tag LOCUS_32710 CDS 5414..5791 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32720 sequence36 source 1..2412 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(254..1177) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388796.1 transl_table 11 codon_start 1 locus_tag LOCUS_32730 CDS 1342..1818 product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073195.1 transl_table 11 codon_start 1 locus_tag LOCUS_32740 sequence37 source 1..1986 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 135..995 product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707531.1 transl_table 11 codon_start 1 locus_tag LOCUS_32750 CDS complement(1000..1698) product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171423.1 transl_table 11 codon_start 1 locus_tag LOCUS_32760 sequence38 source 1..1849 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 29..104 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00810 tRNA 147..222 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00820 tRNA 255..330 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00830 tRNA 368..443 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00840 CDS 584..1645 product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818805.1 transl_table 11 codon_start 1 locus_tag LOCUS_32770 gene nadA sequence39 source 1..1811 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence40 source 1..1539 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(10..1119) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32780 sequence41 source 1..1419 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(305..1318) product IS110-like element IS1111A family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041952483.1 transl_table 11 codon_start 1 locus_tag LOCUS_32790 sequence42 source 1..1073 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence43 source 1..999 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence44 source 1..934 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence45 source 1..622 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence46 source 1..551 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence47 source 1..551 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@