COMMON DATATYPE type WGS KEYWORD keyword WGS KEYWORD keyword STANDARD_DRAFT DBLINK project biosample SUBMITTER ab_name ab_name ab_name contact email phone fax institute country city street zip REFERENCE title ab_name ab_name ab_name status Unpublished year COMMENT line Annotated by DFAST v.1.2.20 (https://dfast.nig.ac.jp) ST_COMMENT tagset_id Genome-Assembly-Data Assembly Method Genome Coverage Sequencing Technology sequence01 source 1..497304 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 613..933 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00010 CDS complement(946..1908) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531974.1 transl_table 11 codon_start 1 locus_tag LOCUS_00020 CDS 2098..2631 product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531973.1 transl_table 11 codon_start 1 locus_tag LOCUS_00030 CDS 2634..3239 product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531972.1 transl_table 11 codon_start 1 locus_tag LOCUS_00040 CDS complement(3215..4096) product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531969.1 transl_table 11 codon_start 1 locus_tag LOCUS_00050 CDS complement(4096..4548) product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531968.1 transl_table 11 codon_start 1 locus_tag LOCUS_00060 CDS 4848..5618 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00070 CDS 5699..6865 product DUF2336 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531967.1 transl_table 11 codon_start 1 locus_tag LOCUS_00080 CDS 6921..7982 product ornithine cyclodeaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533363.1 transl_table 11 codon_start 1 locus_tag LOCUS_00090 CDS 7987..8406 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094613.1 transl_table 11 codon_start 1 locus_tag LOCUS_00100 CDS complement(8409..9095) product RES family NAD+ phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530548.1 transl_table 11 codon_start 1 locus_tag LOCUS_00110 CDS complement(9089..9502) product MbcA/ParS/Xre antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530547.1 transl_table 11 codon_start 1 locus_tag LOCUS_00120 CDS 9970..10227 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00130 note possible pseudo, frameshifted CDS complement(10354..12414) product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531965.1 transl_table 11 codon_start 1 locus_tag LOCUS_00140 gene parE CDS complement(12648..13577) product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971872.1 transl_table 11 codon_start 1 locus_tag LOCUS_00150 CDS complement(13747..16545) product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531954.1 transl_table 11 codon_start 1 locus_tag LOCUS_00160 gene gcvP CDS complement(16558..16926) product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531953.1 transl_table 11 codon_start 1 locus_tag LOCUS_00170 gene gcvH CDS complement(16932..18035) product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531952.1 transl_table 11 codon_start 1 locus_tag LOCUS_00180 gene gcvT CDS 18480..18638 product YqaE/Pmp3 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310667.1 transl_table 11 codon_start 1 locus_tag LOCUS_00190 CDS complement(18660..19124) product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920506.1 transl_table 11 codon_start 1 locus_tag LOCUS_00200 gene queF tRNA complement(19249..19325) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00010 tRNA complement(19559..19635) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00020 tRNA 19867..19942 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00030 CDS 20078..20659 product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396078.1 transl_table 11 codon_start 1 locus_tag LOCUS_00210 CDS 20824..21186 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00220 CDS 21280..21813 product copper chaperone PCu(A)C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087647.1 transl_table 11 codon_start 1 locus_tag LOCUS_00230 CDS 21806..23239 product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105743634.1 transl_table 11 codon_start 1 locus_tag LOCUS_00240 CDS complement(23292..23939) product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530973.1 transl_table 11 codon_start 1 locus_tag LOCUS_00250 CDS 24106..25203 product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140099.1 transl_table 11 codon_start 1 locus_tag LOCUS_00260 CDS complement(25188..25814) product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397340.1 transl_table 11 codon_start 1 locus_tag LOCUS_00270 CDS 26235..26600 product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312714.1 transl_table 11 codon_start 1 locus_tag LOCUS_00280 CDS 26591..27172 product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531090.1 transl_table 11 codon_start 1 locus_tag LOCUS_00290 CDS 27183..27785 product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531091.1 transl_table 11 codon_start 1 locus_tag LOCUS_00300 CDS 27782..28213 product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971509.1 transl_table 11 codon_start 1 locus_tag LOCUS_00310 CDS 28210..29400 product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531092.1 transl_table 11 codon_start 1 locus_tag LOCUS_00320 CDS 29400..30641 product NADH-quinone oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531093.1 transl_table 11 codon_start 1 locus_tag LOCUS_00330 CDS 30652..31956 product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312708.1 transl_table 11 codon_start 1 locus_tag LOCUS_00340 gene nuoF CDS 32006..34087 product NADH-quinone oxidoreductase subunit NuoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531096.1 transl_table 11 codon_start 1 locus_tag LOCUS_00350 gene nuoG CDS 34084..35133 product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531097.1 transl_table 11 codon_start 1 locus_tag LOCUS_00360 gene nuoH CDS 35135..35626 product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707628.1 transl_table 11 codon_start 1 locus_tag LOCUS_00370 gene nuoI CDS 35777..36397 product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531099.1 transl_table 11 codon_start 1 locus_tag LOCUS_00380 CDS 36404..36712 product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003502389.1 transl_table 11 codon_start 1 locus_tag LOCUS_00390 gene nuoK CDS 36720..38705 product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531100.1 transl_table 11 codon_start 1 locus_tag LOCUS_00400 gene nuoL CDS 38705..40219 product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531101.1 transl_table 11 codon_start 1 locus_tag LOCUS_00410 CDS 40237..41676 product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531102.1 transl_table 11 codon_start 1 locus_tag LOCUS_00420 gene nuoN CDS 41682..42506 product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531103.1 transl_table 11 codon_start 1 locus_tag LOCUS_00430 CDS 42732..44405 product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531104.1 transl_table 11 codon_start 1 locus_tag LOCUS_00440 CDS 44485..44889 product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531105.1 transl_table 11 codon_start 1 locus_tag LOCUS_00450 gene mce CDS 44893..45165 product DUF1467 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971518.1 transl_table 11 codon_start 1 locus_tag LOCUS_00460 CDS 45688..47025 product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531107.1 transl_table 11 codon_start 1 locus_tag LOCUS_00470 CDS 47025..48299 product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531108.1 transl_table 11 codon_start 1 locus_tag LOCUS_00480 CDS 48299..49003 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027160544.1 transl_table 11 codon_start 1 locus_tag LOCUS_00490 CDS complement(49744..54414) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00500 CDS 54715..55050 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00510 CDS 55144..55464 product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312579.1 transl_table 11 codon_start 1 locus_tag LOCUS_00520 CDS complement(55469..56080) product DUF922 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920055.1 transl_table 11 codon_start 1 locus_tag LOCUS_00530 CDS 56217..57104 product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531874.1 transl_table 11 codon_start 1 locus_tag LOCUS_00540 gene folP CDS 57108..57467 product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531873.1 transl_table 11 codon_start 1 locus_tag LOCUS_00550 gene folB CDS 57451..57975 product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992279.1 transl_table 11 codon_start 1 locus_tag LOCUS_00560 gene folK CDS complement(57972..58511) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532990.1 transl_table 11 codon_start 1 locus_tag LOCUS_00570 CDS complement(58573..59664) product YcjF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531865.1 transl_table 11 codon_start 1 locus_tag LOCUS_00580 CDS complement(59661..61118) product YcjX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531864.1 transl_table 11 codon_start 1 locus_tag LOCUS_00590 CDS complement(61243..61764) product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531863.1 transl_table 11 codon_start 1 locus_tag LOCUS_00600 CDS 61968..62393 product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531862.1 transl_table 11 codon_start 1 locus_tag LOCUS_00610 gene dksA CDS complement(62469..63242) product flagellar biosynthetic protein FliO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396540.1 transl_table 11 codon_start 1 locus_tag LOCUS_00620 CDS 63527..66097 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531860.1 transl_table 11 codon_start 1 locus_tag LOCUS_00630 CDS 66230..66889 product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310900.1 transl_table 11 codon_start 1 locus_tag LOCUS_00640 CDS complement(66974..67900) product pseudouridine-5'-phosphate glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532153.1 transl_table 11 codon_start 1 locus_tag LOCUS_00650 CDS complement(67914..68876) product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532152.1 transl_table 11 codon_start 1 locus_tag LOCUS_00660 CDS 69136..70218 product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532151.1 transl_table 11 codon_start 1 locus_tag LOCUS_00670 gene recA CDS 70625..73276 product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969477.1 transl_table 11 codon_start 1 locus_tag LOCUS_00680 gene alaS CDS 73419..74054 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00690 CDS complement(74136..74513) product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014332651.1 transl_table 11 codon_start 1 locus_tag LOCUS_00700 CDS complement(74648..75859) product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969471.1 transl_table 11 codon_start 1 locus_tag LOCUS_00710 CDS 76084..76857 product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532146.1 transl_table 11 codon_start 1 locus_tag LOCUS_00720 CDS 76861..77646 product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396527.1 transl_table 11 codon_start 1 locus_tag LOCUS_00730 gene murI CDS complement(77668..78438) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00740 CDS 78760..79377 product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532142.1 transl_table 11 codon_start 1 locus_tag LOCUS_00750 gene rpsD CDS 79482..80345 product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532141.1 transl_table 11 codon_start 1 locus_tag LOCUS_00760 gene ttcA CDS complement(80420..81679) product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532138.1 transl_table 11 codon_start 1 locus_tag LOCUS_00770 CDS complement(81772..82101) product Grx4 family monothiol glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532137.1 transl_table 11 codon_start 1 locus_tag LOCUS_00780 gene grxD CDS complement(82151..82384) product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010909092.1 transl_table 11 codon_start 1 locus_tag LOCUS_00790 CDS complement(82396..84606) product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975659.1 transl_table 11 codon_start 1 locus_tag LOCUS_00800 gene purL CDS complement(84735..86144) product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396508.1 transl_table 11 codon_start 1 locus_tag LOCUS_00810 CDS complement(86478..87098) product Pr6Pr family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532132.1 transl_table 11 codon_start 1 locus_tag LOCUS_00820 CDS complement(87100..87390) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00830 CDS complement(87537..88205) product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532129.1 transl_table 11 codon_start 1 locus_tag LOCUS_00840 gene purQ CDS complement(88256..88618) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00850 CDS complement(88545..89336) product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532127.1 transl_table 11 codon_start 1 locus_tag LOCUS_00860 CDS 89581..89898 product DUF1476 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530104.1 transl_table 11 codon_start 1 locus_tag LOCUS_00870 CDS complement(89956..90591) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971907.1 transl_table 11 codon_start 1 locus_tag LOCUS_00880 CDS 90697..91500 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532122.1 transl_table 11 codon_start 1 locus_tag LOCUS_00890 CDS complement(91569..92876) product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971906.1 transl_table 11 codon_start 1 locus_tag LOCUS_00900 gene purB CDS complement(92990..94000) product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532117.1 transl_table 11 codon_start 1 locus_tag LOCUS_00910 CDS complement(93997..95094) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532116.1 transl_table 11 codon_start 1 locus_tag LOCUS_00920 CDS 95201..95704 product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532115.1 transl_table 11 codon_start 1 locus_tag LOCUS_00930 CDS 96057..96971 product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532109.1 transl_table 11 codon_start 1 locus_tag LOCUS_00940 CDS complement(97188..97967) product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531213.1 transl_table 11 codon_start 1 locus_tag LOCUS_00950 CDS complement(98060..99691) product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531215.1 transl_table 11 codon_start 1 locus_tag LOCUS_00960 CDS complement(99688..100548) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531216.1 transl_table 11 codon_start 1 locus_tag LOCUS_00970 CDS complement(100545..101492) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531217.1 transl_table 11 codon_start 1 locus_tag LOCUS_00980 CDS complement(101542..103026) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531218.1 transl_table 11 codon_start 1 locus_tag LOCUS_00990 CDS complement(103102..104364) product acetylornithine deacetylase/succinyl-diaminopimelate desuccinylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531219.1 transl_table 11 codon_start 1 locus_tag LOCUS_01000 CDS complement(104488..105426) product lipid A biosynthesis lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531221.1 transl_table 11 codon_start 1 locus_tag LOCUS_01010 CDS complement(105433..106461) product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531222.1 transl_table 11 codon_start 1 locus_tag LOCUS_01020 CDS complement(106513..107778) product beta-ketoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531223.1 transl_table 11 codon_start 1 locus_tag LOCUS_01030 CDS complement(107792..108973) product beta-ketoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531224.1 transl_table 11 codon_start 1 locus_tag LOCUS_01040 CDS complement(108978..109286) product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010909964.1 transl_table 11 codon_start 1 locus_tag LOCUS_01050 CDS complement(109404..110033) product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531226.1 transl_table 11 codon_start 1 locus_tag LOCUS_01060 CDS complement(110113..110322) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01070 CDS complement(110382..111443) product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921622.1 transl_table 11 codon_start 1 locus_tag LOCUS_01080 CDS 111571..111747 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01090 CDS complement(111748..112092) product DMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535339.1 transl_table 11 codon_start 1 locus_tag LOCUS_01100 CDS complement(112200..112949) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01110 tRNA complement(112920..113003) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00040 CDS complement(113080..114261) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531324.1 transl_table 11 codon_start 1 locus_tag LOCUS_01120 CDS complement(114290..115747) product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992274.1 transl_table 11 codon_start 1 locus_tag LOCUS_01130 CDS 115966..117216 product threonine ammonia-lyase IlvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531325.1 transl_table 11 codon_start 1 locus_tag LOCUS_01140 gene ilvA CDS complement(117313..118602) product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531749.1 transl_table 11 codon_start 1 locus_tag LOCUS_01150 gene gltA CDS complement(118971..120392) product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531748.1 transl_table 11 codon_start 1 locus_tag LOCUS_01160 gene gltX CDS 120640..122934 product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531747.1 transl_table 11 codon_start 1 locus_tag LOCUS_01170 CDS complement(123001..123696) product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531746.1 transl_table 11 codon_start 1 locus_tag LOCUS_01180 gene lexA CDS complement(123824..125032) product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971802.1 transl_table 11 codon_start 1 locus_tag LOCUS_01190 CDS complement(125032..125526) product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531740.1 transl_table 11 codon_start 1 locus_tag LOCUS_01200 gene moaC CDS complement(125528..126322) product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314425.1 transl_table 11 codon_start 1 locus_tag LOCUS_01210 gene trpC CDS complement(126324..127346) product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531738.1 transl_table 11 codon_start 1 locus_tag LOCUS_01220 gene trpD CDS complement(127349..129232) product SurA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531737.1 transl_table 11 codon_start 1 locus_tag LOCUS_01230 CDS 129360..130112 product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531736.1 transl_table 11 codon_start 1 locus_tag LOCUS_01240 gene tpiA CDS 130276..130755 product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971746.1 transl_table 11 codon_start 1 locus_tag LOCUS_01250 gene secG CDS 130958..131953 product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531734.1 transl_table 11 codon_start 1 locus_tag LOCUS_01260 CDS 132151..132894 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01270 CDS 132987..134615 product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531733.1 transl_table 11 codon_start 1 locus_tag LOCUS_01280 CDS complement(134665..134811) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529552.1 transl_table 11 codon_start 1 locus_tag LOCUS_01290 CDS 135212..136486 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976101.1 transl_table 11 codon_start 1 locus_tag LOCUS_01300 CDS complement(136515..136826) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531395.1 transl_table 11 codon_start 1 locus_tag LOCUS_01310 CDS complement(136954..137121) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01320 CDS 137193..137456 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01330 tRNA complement(137601..137690) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00050 CDS complement(137820..138113) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01340 CDS 138226..138693 product SRPBCC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529111.1 transl_table 11 codon_start 1 locus_tag LOCUS_01350 CDS 138867..140159 product septal ring lytic transglycosylase RlpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531579.1 transl_table 11 codon_start 1 locus_tag LOCUS_01360 CDS 140233..141429 product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173681.1 transl_table 11 codon_start 1 locus_tag LOCUS_01370 CDS 141500..142165 product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173682.1 transl_table 11 codon_start 1 locus_tag LOCUS_01380 gene tmk CDS 142162..143214 product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531576.1 transl_table 11 codon_start 1 locus_tag LOCUS_01390 CDS 143310..144866 product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396456.1 transl_table 11 codon_start 1 locus_tag LOCUS_01400 gene metG CDS 144868..145662 product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003528321.1 transl_table 11 codon_start 1 locus_tag LOCUS_01410 CDS 145666..146478 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531573.1 transl_table 11 codon_start 1 locus_tag LOCUS_01420 CDS 146630..148645 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01430 CDS complement(148734..149351) product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531356.1 transl_table 11 codon_start 1 locus_tag LOCUS_01440 gene aat CDS complement(149352..150704) product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531357.1 transl_table 11 codon_start 1 locus_tag LOCUS_01450 gene accC CDS complement(150716..151192) product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531358.1 transl_table 11 codon_start 1 locus_tag LOCUS_01460 gene accB CDS complement(151220..151657) product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531359.1 transl_table 11 codon_start 1 locus_tag LOCUS_01470 gene aroQ CDS complement(151827..152582) product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531360.1 transl_table 11 codon_start 1 locus_tag LOCUS_01480 CDS complement(152614..153936) product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531361.1 transl_table 11 codon_start 1 locus_tag LOCUS_01490 CDS 154205..155353 product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531362.1 transl_table 11 codon_start 1 locus_tag LOCUS_01500 CDS complement(155471..156880) product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328343.1 transl_table 11 codon_start 1 locus_tag LOCUS_01510 gene glnA CDS complement(156928..157266) product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003508042.1 transl_table 11 codon_start 1 locus_tag LOCUS_01520 CDS complement(157253..157504) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01530 CDS complement(158075..159304) product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114146.1 transl_table 11 codon_start 1 locus_tag LOCUS_01540 CDS complement(160262..161074) product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531842.1 transl_table 11 codon_start 1 locus_tag LOCUS_01550 CDS complement(161219..164140) product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531840.1 transl_table 11 codon_start 1 locus_tag LOCUS_01560 gene uvrA CDS 164450..164968 product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531834.1 transl_table 11 codon_start 1 locus_tag LOCUS_01570 CDS complement(165774..166403) product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531832.1 transl_table 11 codon_start 1 locus_tag LOCUS_01580 CDS 166724..169513 product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531829.1 transl_table 11 codon_start 1 locus_tag LOCUS_01590 gene gyrA CDS complement(169589..169786) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01600 CDS 169891..170388 product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531827.1 transl_table 11 codon_start 1 locus_tag LOCUS_01610 gene coaD CDS 170407..170982 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027161524.1 transl_table 11 codon_start 1 locus_tag LOCUS_01620 CDS 171011..171526 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531825.1 transl_table 11 codon_start 1 locus_tag LOCUS_01630 CDS 171595..172044 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531824.1 transl_table 11 codon_start 1 locus_tag LOCUS_01640 CDS 172046..173125 product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531823.1 transl_table 11 codon_start 1 locus_tag LOCUS_01650 gene queA CDS 173122..174252 product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531821.1 transl_table 11 codon_start 1 locus_tag LOCUS_01660 gene tgt CDS 174330..175832 product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531813.1 transl_table 11 codon_start 1 locus_tag LOCUS_01670 gene glpD CDS 175832..176227 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01680 note possible pseudo, frameshifted CDS 176184..177323 product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531806.1 transl_table 11 codon_start 1 locus_tag LOCUS_01690 gene glpK note possible pseudo, frameshifted tRNA 177464..177539 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00060 CDS complement(177670..178728) product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069331975.1 transl_table 11 codon_start 1 locus_tag LOCUS_01700 CDS complement(178673..178969) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975461.1 transl_table 11 codon_start 1 locus_tag LOCUS_01710 CDS complement(179134..179451) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01720 CDS complement(179451..179966) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01730 CDS complement(180049..180192) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01740 CDS complement(180192..180425) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01750 CDS complement(180456..181637) product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887075.1 transl_table 11 codon_start 1 locus_tag LOCUS_01760 CDS complement(181731..182063) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01770 CDS complement(182167..182928) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01780 CDS 183389..183562 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01790 CDS 183732..184001 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01800 CDS 184001..184741 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01810 CDS 184794..185561 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01820 CDS 185561..185761 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01830 CDS 185731..185910 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01840 CDS 185925..186485 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01850 CDS 186485..186691 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01860 CDS 186753..187505 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01870 CDS 187561..188622 product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527877.1 transl_table 11 codon_start 1 locus_tag LOCUS_01880 gene dnaN CDS 188624..189598 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01890 CDS 189598..190062 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01900 CDS 190059..191804 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706440.1 transl_table 11 codon_start 1 locus_tag LOCUS_01910 CDS 191816..192067 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01920 CDS 192101..192808 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01930 CDS complement(192879..193070) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01940 CDS 193150..193719 product MT-A70 family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103677717.1 transl_table 11 codon_start 1 locus_tag LOCUS_01950 CDS 193719..194537 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01960 CDS complement(194553..195104) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01970 CDS 195508..195729 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01980 CDS complement(195726..195959) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01990 CDS 196012..198195 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02000 CDS 198348..198515 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02010 CDS 198515..198823 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02020 CDS 198894..199277 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02030 CDS 199377..199592 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02040 CDS 199708..200007 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02050 CDS complement(200004..200183) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976037.1 transl_table 11 codon_start 1 locus_tag LOCUS_02060 CDS complement(200180..200818) product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057903075.1 transl_table 11 codon_start 1 locus_tag LOCUS_02070 CDS complement(200830..201090) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02080 CDS complement(201090..202355) product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942261.1 transl_table 11 codon_start 1 locus_tag LOCUS_02090 gene dinB CDS 202812..203018 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02100 CDS 203015..203500 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02110 CDS 203512..203742 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02120 CDS 203739..204632 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02130 tRNA 205280..205356 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00070 CDS 205384..205905 product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951187.1 transl_table 11 codon_start 1 locus_tag LOCUS_02140 CDS 205877..206200 product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_183394652.1 transl_table 11 codon_start 1 locus_tag LOCUS_02150 CDS 206314..206784 product phage terminase small subunit P27 family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975498.1 transl_table 11 codon_start 1 locus_tag LOCUS_02160 CDS 206988..208370 product terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165899772.1 transl_table 11 codon_start 1 locus_tag LOCUS_02170 CDS 208379..209617 product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337209.1 transl_table 11 codon_start 1 locus_tag LOCUS_02180 CDS 209628..209846 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02190 CDS 209856..210974 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02200 CDS 210987..212201 product phage major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072867.1 transl_table 11 codon_start 1 locus_tag LOCUS_02210 CDS 212244..212489 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02220 CDS 212510..212839 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02230 CDS 212843..213037 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02240 CDS 213004..213345 product head-tail adaptor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975487.1 transl_table 11 codon_start 1 locus_tag LOCUS_02250 CDS 213342..213764 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02260 CDS 213757..214149 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02270 CDS 214167..214604 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02280 CDS 214604..215083 product gene transfer agent family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975483.1 transl_table 11 codon_start 1 locus_tag LOCUS_02290 CDS 215116..215268 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02300 CDS complement(215269..215853) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02310 CDS 215894..218650 product tape measure protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384764.1 transl_table 11 codon_start 1 locus_tag LOCUS_02320 CDS 218654..219289 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976011.1 transl_table 11 codon_start 1 locus_tag LOCUS_02330 CDS 219291..219971 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003640.1 transl_table 11 codon_start 1 locus_tag LOCUS_02340 CDS 219968..220411 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02350 CDS 220438..223500 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02360 CDS 223525..223734 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02370 CDS 223724..224677 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02380 CDS 224677..225276 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02390 CDS complement(225280..225528) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02400 CDS 226618..227469 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02410 CDS 227462..227692 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02420 CDS 227622..227813 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02430 CDS 227869..228201 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975470.1 transl_table 11 codon_start 1 locus_tag LOCUS_02440 CDS 228295..229575 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02450 CDS 229572..229844 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02460 CDS 229911..230135 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02470 CDS 230132..231046 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02480 CDS 231043..231468 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02490 CDS 231465..231821 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02500 CDS 231818..232051 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02510 CDS 232041..232208 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02520 CDS 232208..232738 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02530 CDS complement(233075..233296) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02540 CDS 234801..235850 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02550 CDS 236099..237673 product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173615749.1 transl_table 11 codon_start 1 locus_tag LOCUS_02560 CDS 237822..238565 product cytochrome c biogenesis CcdA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531914.1 transl_table 11 codon_start 1 locus_tag LOCUS_02570 CDS 238680..240035 product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531912.1 transl_table 11 codon_start 1 locus_tag LOCUS_02580 gene glmU CDS 240089..241912 product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531911.1 transl_table 11 codon_start 1 locus_tag LOCUS_02590 gene glmS CDS 242029..242739 product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531909.1 transl_table 11 codon_start 1 locus_tag LOCUS_02600 CDS complement(242683..244821) product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531908.1 transl_table 11 codon_start 1 locus_tag LOCUS_02610 gene recG CDS 244945..245232 product succinate dehydrogenase assembly factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531907.1 transl_table 11 codon_start 1 locus_tag LOCUS_02620 CDS 245255..248749 product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531906.1 transl_table 11 codon_start 1 locus_tag LOCUS_02630 gene mfd CDS complement(248773..249444) product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531660.1 transl_table 11 codon_start 1 locus_tag LOCUS_02640 CDS complement(249460..251298) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531659.1 transl_table 11 codon_start 1 locus_tag LOCUS_02650 CDS 251578..252192 product invasion associated locus B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531658.1 transl_table 11 codon_start 1 locus_tag LOCUS_02660 CDS complement(252269..252556) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02670 CDS 252555..255005 product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531366.1 transl_table 11 codon_start 1 locus_tag LOCUS_02680 CDS 255342..256310 product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_113519808.1 transl_table 11 codon_start 1 locus_tag LOCUS_02690 gene prfB CDS complement(256382..257485) product DUF1176 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532108.1 transl_table 11 codon_start 1 locus_tag LOCUS_02700 CDS 257663..258121 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532105.1 transl_table 11 codon_start 1 locus_tag LOCUS_02710 CDS 258096..258968 product phosphatidylcholine/phosphatidylserine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024503276.1 transl_table 11 codon_start 1 locus_tag LOCUS_02720 CDS complement(258980..259708) product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971969.1 transl_table 11 codon_start 1 locus_tag LOCUS_02730 CDS complement(259892..260752) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531253.1 transl_table 11 codon_start 1 locus_tag LOCUS_02740 CDS 260975..262225 product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531252.1 transl_table 11 codon_start 1 locus_tag LOCUS_02750 CDS 262305..263486 product alpha-hydroxy acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013843875.1 transl_table 11 codon_start 1 locus_tag LOCUS_02760 CDS complement(263479..263919) product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972826.1 transl_table 11 codon_start 1 locus_tag LOCUS_02770 CDS complement(264062..265225) product OpgC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973266.1 transl_table 11 codon_start 1 locus_tag LOCUS_02780 gene opgC CDS 265436..266287 product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531500.1 transl_table 11 codon_start 1 locus_tag LOCUS_02790 gene mazG CDS complement(266277..266840) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531462.1 transl_table 11 codon_start 1 locus_tag LOCUS_02800 CDS complement(266861..267712) product 3-mercaptopyruvate sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531461.1 transl_table 11 codon_start 1 locus_tag LOCUS_02810 gene sseA CDS complement(267763..268494) product alanyl-tRNA editing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531460.1 transl_table 11 codon_start 1 locus_tag LOCUS_02820 CDS complement(268554..269594) product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531459.1 transl_table 11 codon_start 1 locus_tag LOCUS_02830 CDS complement(269772..270788) product tRNA dihydrouridine(20/20a) synthase DusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063172127.1 transl_table 11 codon_start 1 locus_tag LOCUS_02840 gene dusA CDS complement(270914..271189) product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006201846.1 transl_table 11 codon_start 1 locus_tag LOCUS_02850 CDS complement(271466..273877) product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532189.1 transl_table 11 codon_start 1 locus_tag LOCUS_02860 gene lon CDS complement(274125..275396) product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532190.1 transl_table 11 codon_start 1 locus_tag LOCUS_02870 gene clpX CDS complement(275825..276445) product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532191.1 transl_table 11 codon_start 1 locus_tag LOCUS_02880 gene clpP CDS 276523..276699 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02890 CDS 276937..277569 product transglutaminase-like cysteine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531340.1 transl_table 11 codon_start 1 locus_tag LOCUS_02900 CDS complement(277676..278209) product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531337.1 transl_table 11 codon_start 1 locus_tag LOCUS_02910 CDS 278514..279044 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02920 CDS complement(279046..279255) product DUF3126 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531334.1 transl_table 11 codon_start 1 locus_tag LOCUS_02930 CDS complement(279437..280282) product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531333.1 transl_table 11 codon_start 1 locus_tag LOCUS_02940 gene cysE CDS complement(280457..281218) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063172307.1 transl_table 11 codon_start 1 locus_tag LOCUS_02950 CDS complement(281237..281764) product DUF192 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531330.1 transl_table 11 codon_start 1 locus_tag LOCUS_02960 CDS complement(281930..282517) product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531329.1 transl_table 11 codon_start 1 locus_tag LOCUS_02970 CDS 282817..283257 product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531328.1 transl_table 11 codon_start 1 locus_tag LOCUS_02980 gene gloA CDS complement(283286..284452) product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531750.1 transl_table 11 codon_start 1 locus_tag LOCUS_02990 gene lpxB CDS complement(284449..285336) product LpxI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531751.1 transl_table 11 codon_start 1 locus_tag LOCUS_03000 CDS complement(285323..286147) product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531752.1 transl_table 11 codon_start 1 locus_tag LOCUS_03010 gene lpxA CDS complement(286164..286631) product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531753.1 transl_table 11 codon_start 1 locus_tag LOCUS_03020 gene fabZ CDS complement(286624..287676) product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531754.1 transl_table 11 codon_start 1 locus_tag LOCUS_03030 gene lpxD CDS complement(287742..290099) product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531755.1 transl_table 11 codon_start 1 locus_tag LOCUS_03040 gene bamA CDS complement(290294..291514) product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531756.1 transl_table 11 codon_start 1 locus_tag LOCUS_03050 gene rseP CDS complement(291671..292456) product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531757.1 transl_table 11 codon_start 1 locus_tag LOCUS_03060 CDS complement(292480..293199) product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531758.1 transl_table 11 codon_start 1 locus_tag LOCUS_03070 CDS complement(293388..293948) product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531759.1 transl_table 11 codon_start 1 locus_tag LOCUS_03080 gene frr CDS complement(294029..294754) product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531760.1 transl_table 11 codon_start 1 locus_tag LOCUS_03090 gene pyrH CDS complement(294920..295819) product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975302.1 transl_table 11 codon_start 1 locus_tag LOCUS_03100 gene tsf CDS complement(295940..296722) product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531765.1 transl_table 11 codon_start 1 locus_tag LOCUS_03110 gene rpsB CDS complement(296889..298712) product monovalent cation:proton antiporter-2 (CPA2) family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971803.1 transl_table 11 codon_start 1 locus_tag LOCUS_03120 CDS complement(298782..299624) product cell envelope integrity EipB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531768.1 transl_table 11 codon_start 1 locus_tag LOCUS_03130 CDS 299847..300566 product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531770.1 transl_table 11 codon_start 1 locus_tag LOCUS_03140 CDS 300575..301768 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969253.1 transl_table 11 codon_start 1 locus_tag LOCUS_03150 CDS 301765..302187 product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535003.1 transl_table 11 codon_start 1 locus_tag LOCUS_03160 CDS complement(302194..303150) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03170 CDS complement(303218..303568) product AzlD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312555.1 transl_table 11 codon_start 1 locus_tag LOCUS_03180 CDS complement(303565..304350) product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393451.1 transl_table 11 codon_start 1 locus_tag LOCUS_03190 CDS complement(304429..306831) product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531774.1 transl_table 11 codon_start 1 locus_tag LOCUS_03200 gene clpA CDS complement(306839..307207) product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023812950.1 transl_table 11 codon_start 1 locus_tag LOCUS_03210 gene clpS CDS 307556..309019 product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531777.1 transl_table 11 codon_start 1 locus_tag LOCUS_03220 CDS 309070..309315 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03230 CDS complement(309360..309794) product DUF1489 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531780.1 transl_table 11 codon_start 1 locus_tag LOCUS_03240 CDS 310294..311061 product DUF599 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531782.1 transl_table 11 codon_start 1 locus_tag LOCUS_03250 CDS complement(311016..311813) product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531783.1 transl_table 11 codon_start 1 locus_tag LOCUS_03260 CDS complement(311832..313313) product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240741.1 transl_table 11 codon_start 1 locus_tag LOCUS_03270 gene gatA CDS complement(313325..313798) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531786.1 transl_table 11 codon_start 1 locus_tag LOCUS_03280 CDS complement(313800..314087) product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533050.1 transl_table 11 codon_start 1 locus_tag LOCUS_03290 gene gatC CDS complement(314182..314895) product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531789.1 transl_table 11 codon_start 1 locus_tag LOCUS_03300 CDS 315016..315495 product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531790.1 transl_table 11 codon_start 1 locus_tag LOCUS_03310 gene ruvX CDS 315617..316555 product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969168.1 transl_table 11 codon_start 1 locus_tag LOCUS_03320 CDS complement(316537..318165) product DNA alkylation response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531793.1 transl_table 11 codon_start 1 locus_tag LOCUS_03330 CDS 318396..319361 product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531794.1 transl_table 11 codon_start 1 locus_tag LOCUS_03340 CDS 319358..320641 product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531795.1 transl_table 11 codon_start 1 locus_tag LOCUS_03350 CDS 320772..321377 product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531796.1 transl_table 11 codon_start 1 locus_tag LOCUS_03360 gene plsY CDS 321379..322506 product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531797.1 transl_table 11 codon_start 1 locus_tag LOCUS_03370 gene dprA CDS complement(322494..322739) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03380 CDS 323073..325718 product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531916.1 transl_table 11 codon_start 1 locus_tag LOCUS_03390 gene topA CDS 325724..328036 product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531917.1 transl_table 11 codon_start 1 locus_tag LOCUS_03400 gene rnr CDS 328042..328476 product DUF983 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024503574.1 transl_table 11 codon_start 1 locus_tag LOCUS_03410 CDS 328504..329244 product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531919.1 transl_table 11 codon_start 1 locus_tag LOCUS_03420 CDS 329283..330458 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531920.1 transl_table 11 codon_start 1 locus_tag LOCUS_03430 CDS 330587..330754 product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006201775.1 transl_table 11 codon_start 1 locus_tag LOCUS_03440 gene rpmG CDS 330832..331356 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383691.1 transl_table 11 codon_start 1 locus_tag LOCUS_03450 CDS complement(331744..335943) product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531415.1 transl_table 11 codon_start 1 locus_tag LOCUS_03460 gene rpoC CDS complement(336115..340251) product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531414.1 transl_table 11 codon_start 1 locus_tag LOCUS_03470 gene rpoB CDS complement(340427..340804) product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531413.1 transl_table 11 codon_start 1 locus_tag LOCUS_03480 gene rplL CDS complement(340862..341380) product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531412.1 transl_table 11 codon_start 1 locus_tag LOCUS_03490 gene rplJ CDS complement(341745..342446) product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531411.1 transl_table 11 codon_start 1 locus_tag LOCUS_03500 gene rplA CDS complement(342451..342879) product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531410.1 transl_table 11 codon_start 1 locus_tag LOCUS_03510 gene rplK CDS complement(343044..343610) product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006316434.1 transl_table 11 codon_start 1 locus_tag LOCUS_03520 gene nusG CDS complement(343600..343803) product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531408.1 transl_table 11 codon_start 1 locus_tag LOCUS_03530 gene secE tRNA complement(344105..344180) product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00080 CDS complement(344298..344960) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975158.1 transl_table 11 codon_start 1 locus_tag LOCUS_03540 CDS 345485..345880 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03550 tRNA 345962..346037 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00090 CDS complement(346053..346979) product glyoxylate/hydroxypyruvate reductase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970456.1 transl_table 11 codon_start 1 locus_tag LOCUS_03560 CDS complement(346993..347871) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972711.1 transl_table 11 codon_start 1 locus_tag LOCUS_03570 CDS complement(347907..348857) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014332683.1 transl_table 11 codon_start 1 locus_tag LOCUS_03580 CDS complement(348931..350598) product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240985.1 transl_table 11 codon_start 1 locus_tag LOCUS_03590 CDS complement(350651..352288) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399966.1 transl_table 11 codon_start 1 locus_tag LOCUS_03600 CDS 352549..353142 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808172.1 transl_table 11 codon_start 1 locus_tag LOCUS_03610 CDS 353177..354490 product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109982178.1 transl_table 11 codon_start 1 locus_tag LOCUS_03620 CDS 354504..355670 product DSD1 family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448968.1 transl_table 11 codon_start 1 locus_tag LOCUS_03630 CDS complement(355737..358979) product error-prone DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004680467.1 transl_table 11 codon_start 1 locus_tag LOCUS_03640 CDS complement(358976..360487) product DNA polymerase Y family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068950842.1 transl_table 11 codon_start 1 locus_tag LOCUS_03650 CDS complement(360408..361160) product ImuA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974873.1 transl_table 11 codon_start 1 locus_tag LOCUS_03660 CDS 361478..362233 product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531374.1 transl_table 11 codon_start 1 locus_tag LOCUS_03670 CDS 362408..363964 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063172295.1 transl_table 11 codon_start 1 locus_tag LOCUS_03680 CDS complement(364025..364399) product Fe-S cluster assembly scaffold SufA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532156.1 transl_table 11 codon_start 1 locus_tag LOCUS_03690 gene sufA CDS complement(364481..364894) product SUF system Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018239791.1 transl_table 11 codon_start 1 locus_tag LOCUS_03700 CDS complement(364954..366192) product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532158.1 transl_table 11 codon_start 1 locus_tag LOCUS_03710 CDS complement(366258..367520) product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532159.1 transl_table 11 codon_start 1 locus_tag LOCUS_03720 gene sufD CDS complement(367532..368287) product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532160.1 transl_table 11 codon_start 1 locus_tag LOCUS_03730 gene sufC CDS complement(368324..369832) product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532161.1 transl_table 11 codon_start 1 locus_tag LOCUS_03740 gene sufB CDS complement(369973..371136) product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532162.1 transl_table 11 codon_start 1 locus_tag LOCUS_03750 CDS 371342..372016 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532163.1 transl_table 11 codon_start 1 locus_tag LOCUS_03760 CDS complement(372077..372523) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03770 CDS complement(372611..373006) product NADH:ubiquinone oxidoreductase subunit NDUFA12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328036.1 transl_table 11 codon_start 1 locus_tag LOCUS_03780 CDS complement(373088..373552) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312626.1 transl_table 11 codon_start 1 locus_tag LOCUS_03790 CDS complement(373555..374052) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531348.1 transl_table 11 codon_start 1 locus_tag LOCUS_03800 CDS complement(374049..375551) product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531347.1 transl_table 11 codon_start 1 locus_tag LOCUS_03810 gene gatB CDS complement(375657..376088) product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531344.1 transl_table 11 codon_start 1 locus_tag LOCUS_03820 CDS complement(376164..376868) product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531343.1 transl_table 11 codon_start 1 locus_tag LOCUS_03830 CDS 377199..377792 product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531342.1 transl_table 11 codon_start 1 locus_tag LOCUS_03840 CDS 377988..378593 product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531341.1 transl_table 11 codon_start 1 locus_tag LOCUS_03850 CDS complement(378638..381964) product DUF3971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532168.1 transl_table 11 codon_start 1 locus_tag LOCUS_03860 CDS 382178..382645 product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971896.1 transl_table 11 codon_start 1 locus_tag LOCUS_03870 gene bcp CDS 382743..384032 product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532170.1 transl_table 11 codon_start 1 locus_tag LOCUS_03880 CDS complement(384044..384682) product ABC-type transport auxiliary lipoprotein family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531882.1 transl_table 11 codon_start 1 locus_tag LOCUS_03890 CDS complement(384682..385647) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03900 CDS complement(385649..386476) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531884.1 transl_table 11 codon_start 1 locus_tag LOCUS_03910 CDS complement(386490..387635) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531885.1 transl_table 11 codon_start 1 locus_tag LOCUS_03920 CDS 387837..388814 product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531886.1 transl_table 11 codon_start 1 locus_tag LOCUS_03930 CDS complement(388817..389101) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03940 CDS complement(389109..389930) product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531888.1 transl_table 11 codon_start 1 locus_tag LOCUS_03950 CDS 390207..392522 product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531890.1 transl_table 11 codon_start 1 locus_tag LOCUS_03960 CDS complement(392779..393039) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03970 CDS 393140..393412 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03980 CDS complement(393453..393659) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03990 CDS complement(393701..395080) product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531892.1 transl_table 11 codon_start 1 locus_tag LOCUS_04000 gene gltX CDS complement(395108..396790) product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531895.1 transl_table 11 codon_start 1 locus_tag LOCUS_04010 CDS complement(396834..397682) product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063172317.1 transl_table 11 codon_start 1 locus_tag LOCUS_04020 CDS complement(397689..398090) product Mth938-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531307.1 transl_table 11 codon_start 1 locus_tag LOCUS_04030 CDS complement(398090..400648) product protein translocase subunit SecDF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531306.1 transl_table 11 codon_start 1 locus_tag LOCUS_04040 gene secDF CDS complement(400697..401041) product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531305.1 transl_table 11 codon_start 1 locus_tag LOCUS_04050 gene yajC CDS 401344..402222 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531304.1 transl_table 11 codon_start 1 locus_tag LOCUS_04060 CDS complement(402288..403511) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04070 CDS complement(403643..404296) product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531300.1 transl_table 11 codon_start 1 locus_tag LOCUS_04080 CDS complement(404289..405047) product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393414.1 transl_table 11 codon_start 1 locus_tag LOCUS_04090 gene surE CDS complement(405051..406343) product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531298.1 transl_table 11 codon_start 1 locus_tag LOCUS_04100 gene serS CDS complement(406443..407273) product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531297.1 transl_table 11 codon_start 1 locus_tag LOCUS_04110 gene tatC CDS complement(407270..407911) product Sec-independent protein translocase protein TatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969282.1 transl_table 11 codon_start 1 locus_tag LOCUS_04120 gene tatB CDS complement(407945..408181) product twin-arginine translocase TatA/TatE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531295.1 transl_table 11 codon_start 1 locus_tag LOCUS_04130 CDS complement(408408..409145) product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531294.1 transl_table 11 codon_start 1 locus_tag LOCUS_04140 gene scpB CDS complement(409142..409993) product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162129796.1 transl_table 11 codon_start 1 locus_tag LOCUS_04150 CDS complement(410014..411033) product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531292.1 transl_table 11 codon_start 1 locus_tag LOCUS_04160 gene nagZ CDS complement(411120..413972) product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969276.1 transl_table 11 codon_start 1 locus_tag LOCUS_04170 CDS complement(414074..415831) product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531290.1 transl_table 11 codon_start 1 locus_tag LOCUS_04180 gene argS CDS complement(415895..417112) product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531289.1 transl_table 11 codon_start 1 locus_tag LOCUS_04190 CDS 417221..417559 product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531288.1 transl_table 11 codon_start 1 locus_tag LOCUS_04200 gene erpA CDS 417645..418430 product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531286.1 transl_table 11 codon_start 1 locus_tag LOCUS_04210 gene xth CDS complement(418443..418736) product Dabb family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531473.1 transl_table 11 codon_start 1 locus_tag LOCUS_04220 CDS 418965..420224 product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531472.1 transl_table 11 codon_start 1 locus_tag LOCUS_04230 CDS complement(420279..422060) product bifunctional 2',3'-cyclic-nucleotide 2'-phosphodiesterase/3'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328355.1 transl_table 11 codon_start 1 locus_tag LOCUS_04240 CDS complement(422033..422197) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04250 note possible pseudo, frameshifted CDS complement(422382..423770) product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531499.1 transl_table 11 codon_start 1 locus_tag LOCUS_04260 gene hflX CDS complement(423771..424019) product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535434.1 transl_table 11 codon_start 1 locus_tag LOCUS_04270 gene hfq CDS complement(424345..425721) product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535437.1 transl_table 11 codon_start 1 locus_tag LOCUS_04280 gene trkA CDS complement(425736..427097) product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531496.1 transl_table 11 codon_start 1 locus_tag LOCUS_04290 CDS complement(427178..429472) product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024505196.1 transl_table 11 codon_start 1 locus_tag LOCUS_04300 CDS complement(429570..431027) product nitrogen regulation protein NR(I) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531494.1 transl_table 11 codon_start 1 locus_tag LOCUS_04310 gene ntrC CDS complement(431024..432151) product nitrogen regulation protein NR(II) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531493.1 transl_table 11 codon_start 1 locus_tag LOCUS_04320 CDS complement(432148..433179) product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531492.1 transl_table 11 codon_start 1 locus_tag LOCUS_04330 gene dusB CDS 433319..434554 product bifunctional 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase/2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531491.1 transl_table 11 codon_start 1 locus_tag LOCUS_04340 CDS 434551..435042 product CinA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531490.1 transl_table 11 codon_start 1 locus_tag LOCUS_04350 CDS 435131..435907 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04360 CDS complement(435896..436615) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04370 CDS complement(436768..437223) product type II toxin-antitoxin system RatA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531488.1 transl_table 11 codon_start 1 locus_tag LOCUS_04380 CDS complement(437232..438197) product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531487.1 transl_table 11 codon_start 1 locus_tag LOCUS_04390 gene lipA CDS complement(438334..439779) product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969230.1 transl_table 11 codon_start 1 locus_tag LOCUS_04400 gene lpdA CDS complement(439791..440432) product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531484.1 transl_table 11 codon_start 1 locus_tag LOCUS_04410 CDS complement(440448..441818) product pyruvate dehydrogenase complex dihydrolipoamide acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082184199.1 transl_table 11 codon_start 1 locus_tag LOCUS_04420 CDS complement(441829..443244) product pyruvate dehydrogenase complex E1 component subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531482.1 transl_table 11 codon_start 1 locus_tag LOCUS_04430 CDS complement(443257..444300) product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975252.1 transl_table 11 codon_start 1 locus_tag LOCUS_04440 gene pdhA CDS complement(444486..444812) product septum formation initiator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531480.1 transl_table 11 codon_start 1 locus_tag LOCUS_04450 CDS complement(445076..446356) product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531479.1 transl_table 11 codon_start 1 locus_tag LOCUS_04460 gene eno CDS complement(446515..447348) product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034854711.1 transl_table 11 codon_start 1 locus_tag LOCUS_04470 gene kdsA CDS complement(447480..448244) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531284.1 transl_table 11 codon_start 1 locus_tag LOCUS_04480 CDS complement(449001..449309) product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121650427.1 transl_table 11 codon_start 1 locus_tag LOCUS_04490 CDS complement(449408..450553) product OmpP1/FadL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975322.1 transl_table 11 codon_start 1 locus_tag LOCUS_04500 CDS complement(450903..453827) product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975321.1 transl_table 11 codon_start 1 locus_tag LOCUS_04510 CDS complement(454135..455007) product cell division protein PopZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971821.1 transl_table 11 codon_start 1 locus_tag LOCUS_04520 gene popZ CDS complement(455339..456742) product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174299062.1 transl_table 11 codon_start 1 locus_tag LOCUS_04530 CDS complement(456872..457573) product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971822.1 transl_table 11 codon_start 1 locus_tag LOCUS_04540 tRNA complement(457680..457753) product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00100 CDS complement(457927..458205) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024503836.1 transl_table 11 codon_start 1 locus_tag LOCUS_04550 tRNA 458494..458568 product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00110 CDS complement(459034..459381) product RcnB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003525025.1 transl_table 11 codon_start 1 locus_tag LOCUS_04560 CDS complement(459531..460202) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968214.1 transl_table 11 codon_start 1 locus_tag LOCUS_04570 CDS 460400..460792 product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037400603.1 transl_table 11 codon_start 1 locus_tag LOCUS_04580 CDS complement(460886..461362) product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532927.1 transl_table 11 codon_start 1 locus_tag LOCUS_04590 CDS 461743..462084 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531989.1 transl_table 11 codon_start 1 locus_tag LOCUS_04600 CDS complement(462214..463752) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04610 CDS complement(464196..464549) product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312612.1 transl_table 11 codon_start 1 locus_tag LOCUS_04620 CDS complement(464546..464869) product NIPSNAP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392608.1 transl_table 11 codon_start 1 locus_tag LOCUS_04630 CDS 464946..465626 product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388139.1 transl_table 11 codon_start 1 locus_tag LOCUS_04640 CDS 465745..466995 product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531473.1 transl_table 11 codon_start 1 locus_tag LOCUS_04650 gene tyrS CDS 467073..468272 product UbiH/UbiF family hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531655.1 transl_table 11 codon_start 1 locus_tag LOCUS_04660 CDS 468455..468787 product heat shock protein HspQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027161605.1 transl_table 11 codon_start 1 locus_tag LOCUS_04670 gene hspQ CDS complement(468833..470035) product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531365.1 transl_table 11 codon_start 1 locus_tag LOCUS_04680 CDS 470678..473626 product ribonuclease E/G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531364.1 transl_table 11 codon_start 1 locus_tag LOCUS_04690 CDS 473984..474367 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04700 CDS 474514..474738 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04710 CDS complement(474824..475642) product ATP12 family chaperone protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531447.1 transl_table 11 codon_start 1 locus_tag LOCUS_04720 CDS complement(475639..476625) product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531445.1 transl_table 11 codon_start 1 locus_tag LOCUS_04730 CDS complement(476644..477021) product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531444.1 transl_table 11 codon_start 1 locus_tag LOCUS_04740 gene crcB CDS complement(477041..478354) product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401745.1 transl_table 11 codon_start 1 locus_tag LOCUS_04750 CDS complement(478358..479845) product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531440.1 transl_table 11 codon_start 1 locus_tag LOCUS_04760 CDS 480015..480965 product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975190.1 transl_table 11 codon_start 1 locus_tag LOCUS_04770 gene msrP CDS 480968..481597 product protein-methionine-sulfoxide reductase heme-binding subunit MsrQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969198.1 transl_table 11 codon_start 1 locus_tag LOCUS_04780 gene msrQ CDS complement(482176..482604) product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531439.1 transl_table 11 codon_start 1 locus_tag LOCUS_04790 gene rplQ CDS complement(482688..483698) product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531438.1 transl_table 11 codon_start 1 locus_tag LOCUS_04800 CDS complement(483804..484193) product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006205444.1 transl_table 11 codon_start 1 locus_tag LOCUS_04810 gene rpsK CDS complement(484312..484680) product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531437.1 transl_table 11 codon_start 1 locus_tag LOCUS_04820 gene rpsM CDS complement(484932..485525) product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328075.1 transl_table 11 codon_start 1 locus_tag LOCUS_04830 CDS complement(485522..486862) product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531435.1 transl_table 11 codon_start 1 locus_tag LOCUS_04840 gene secY CDS complement(486992..487465) product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531434.1 transl_table 11 codon_start 1 locus_tag LOCUS_04850 gene rplO CDS complement(487489..487680) product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006205449.1 transl_table 11 codon_start 1 locus_tag LOCUS_04860 gene rpmD CDS complement(487706..488257) product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707768.1 transl_table 11 codon_start 1 locus_tag LOCUS_04870 gene rpsE CDS complement(488348..488707) product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531433.1 transl_table 11 codon_start 1 locus_tag LOCUS_04880 gene rplR CDS complement(488898..489431) product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531432.1 transl_table 11 codon_start 1 locus_tag LOCUS_04890 gene rplF CDS complement(489459..489857) product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531431.1 transl_table 11 codon_start 1 locus_tag LOCUS_04900 gene rpsH CDS complement(489869..490174) product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531430.1 transl_table 11 codon_start 1 locus_tag LOCUS_04910 gene rpsN CDS complement(490200..490757) product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531429.1 transl_table 11 codon_start 1 locus_tag LOCUS_04920 gene rplE CDS complement(490750..491058) product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313975.1 transl_table 11 codon_start 1 locus_tag LOCUS_04930 gene rplX CDS complement(491071..491439) product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003495199.1 transl_table 11 codon_start 1 locus_tag LOCUS_04940 gene rplN CDS complement(491512..491751) product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010909280.1 transl_table 11 codon_start 1 locus_tag LOCUS_04950 gene rpsQ CDS complement(491763..491963) product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006205459.1 transl_table 11 codon_start 1 locus_tag LOCUS_04960 gene rpmC CDS complement(491979..492392) product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531427.1 transl_table 11 codon_start 1 locus_tag LOCUS_04970 gene rplP CDS complement(492420..493142) product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531426.1 transl_table 11 codon_start 1 locus_tag LOCUS_04980 gene rpsC CDS complement(493142..493525) product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006205462.1 transl_table 11 codon_start 1 locus_tag LOCUS_04990 gene rplV CDS complement(493528..493806) product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003507772.1 transl_table 11 codon_start 1 locus_tag LOCUS_05000 gene rpsS CDS complement(493823..494656) product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531425.1 transl_table 11 codon_start 1 locus_tag LOCUS_05010 gene rplB CDS complement(494678..494971) product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531424.1 transl_table 11 codon_start 1 locus_tag LOCUS_05020 CDS complement(494968..495588) product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531423.1 transl_table 11 codon_start 1 locus_tag LOCUS_05030 gene rplD CDS complement(495588..496304) product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531422.1 transl_table 11 codon_start 1 locus_tag LOCUS_05040 gene rplC CDS complement(496325..496633) product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010909272.1 transl_table 11 codon_start 1 locus_tag LOCUS_05050 gene rpsJ sequence02 source 1..413070 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 145..324 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05060 CDS 502..936 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05070 CDS complement(969..1184) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05080 CDS 1754..2521 product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_183806692.1 transl_table 11 codon_start 1 locus_tag LOCUS_05090 note possible pseudo, frameshifted CDS 2543..2809 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05100 CDS 2993..3271 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05110 note possible pseudo, frameshifted CDS complement(3555..4598) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339376.1 transl_table 11 codon_start 1 locus_tag LOCUS_05120 CDS 4739..5620 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162491172.1 transl_table 11 codon_start 1 locus_tag LOCUS_05130 CDS 5780..7135 product acyclic terpene utilization AtuA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124259.1 transl_table 11 codon_start 1 locus_tag LOCUS_05140 CDS 7132..7452 product DUF4387 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000813947.1 transl_table 11 codon_start 1 locus_tag LOCUS_05150 CDS 7467..8531 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037378875.1 transl_table 11 codon_start 1 locus_tag LOCUS_05160 CDS 8528..9382 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339378.1 transl_table 11 codon_start 1 locus_tag LOCUS_05170 CDS 9379..10185 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724379.1 transl_table 11 codon_start 1 locus_tag LOCUS_05180 CDS 10195..11412 product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258129.1 transl_table 11 codon_start 1 locus_tag LOCUS_05190 CDS 11420..12574 product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086213.1 transl_table 11 codon_start 1 locus_tag LOCUS_05200 CDS 12571..12987 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05210 CDS complement(13218..14186) product TIGR03885 family FMN-dependent LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969667.1 transl_table 11 codon_start 1 locus_tag LOCUS_05220 CDS complement(14190..14564) product sensory rhodopsin transducer inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969671.1 transl_table 11 codon_start 1 locus_tag LOCUS_05230 CDS 14652..16277 product alpha-amylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975019.1 transl_table 11 codon_start 1 locus_tag LOCUS_05240 CDS 16405..17691 product L-fucose:H+ symporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036694.1 transl_table 11 codon_start 1 locus_tag LOCUS_05250 gene fucP CDS complement(17788..18663) product zinc ABC transporter permease AztB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532308.1 transl_table 11 codon_start 1 locus_tag LOCUS_05260 gene aztB CDS complement(18664..19476) product zinc ABC transporter ATP-binding protein AztA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532307.1 transl_table 11 codon_start 1 locus_tag LOCUS_05270 gene aztA CDS complement(19547..20299) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339313.1 transl_table 11 codon_start 1 locus_tag LOCUS_05280 CDS 20427..20588 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05290 CDS complement(20585..21301) product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975003.1 transl_table 11 codon_start 1 locus_tag LOCUS_05300 CDS complement(21305..22138) product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531518.1 transl_table 11 codon_start 1 locus_tag LOCUS_05310 CDS 22284..23315 product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061873.1 transl_table 11 codon_start 1 locus_tag LOCUS_05320 CDS 23509..24177 product thiaminase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263205.1 transl_table 11 codon_start 1 locus_tag LOCUS_05330 gene tenA CDS complement(24239..25474) product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973612.1 transl_table 11 codon_start 1 locus_tag LOCUS_05340 CDS complement(25524..26621) product carboxynorspermidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973611.1 transl_table 11 codon_start 1 locus_tag LOCUS_05350 gene nspC CDS complement(26900..27421) product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973282.1 transl_table 11 codon_start 1 locus_tag LOCUS_05360 CDS complement(27442..28002) product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313905.1 transl_table 11 codon_start 1 locus_tag LOCUS_05370 CDS complement(28178..29218) product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972373.1 transl_table 11 codon_start 1 locus_tag LOCUS_05380 CDS complement(29269..30135) product D-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312132.1 transl_table 11 codon_start 1 locus_tag LOCUS_05390 CDS 30598..30912 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05400 CDS 31023..34796 product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530215.1 transl_table 11 codon_start 1 locus_tag LOCUS_05410 gene metH CDS 34947..35645 product DUF1428 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384906.1 transl_table 11 codon_start 1 locus_tag LOCUS_05420 CDS 35788..36762 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173509960.1 transl_table 11 codon_start 1 locus_tag LOCUS_05430 CDS 36870..38615 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529320.1 transl_table 11 codon_start 1 locus_tag LOCUS_05440 CDS 38769..39149 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05450 note possible pseudo, frameshifted CDS complement(39121..40161) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390949.1 transl_table 11 codon_start 1 locus_tag LOCUS_05460 CDS complement(40264..41037) product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528282.1 transl_table 11 codon_start 1 locus_tag LOCUS_05470 CDS complement(41232..43796) product autotransporter domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974616.1 transl_table 11 codon_start 1 locus_tag LOCUS_05480 CDS 44104..45405 product guanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528234.1 transl_table 11 codon_start 1 locus_tag LOCUS_05490 gene guaD CDS complement(45444..46418) product WD40 repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528226.1 transl_table 11 codon_start 1 locus_tag LOCUS_05500 CDS complement(46425..47543) product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528225.1 transl_table 11 codon_start 1 locus_tag LOCUS_05510 CDS 47762..48274 product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528223.1 transl_table 11 codon_start 1 locus_tag LOCUS_05520 CDS 48522..49436 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081714208.1 transl_table 11 codon_start 1 locus_tag LOCUS_05530 CDS 49478..50455 product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528218.1 transl_table 11 codon_start 1 locus_tag LOCUS_05540 CDS complement(50757..51533) product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528216.1 transl_table 11 codon_start 1 locus_tag LOCUS_05550 CDS 51954..53096 product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969563.1 transl_table 11 codon_start 1 locus_tag LOCUS_05560 CDS complement(53173..54384) product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537551.1 transl_table 11 codon_start 1 locus_tag LOCUS_05570 gene nhaA CDS complement(54572..56323) product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975851.1 transl_table 11 codon_start 1 locus_tag LOCUS_05580 CDS complement(56320..56892) product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528212.1 transl_table 11 codon_start 1 locus_tag LOCUS_05590 CDS 57146..59458 product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528207.1 transl_table 11 codon_start 1 locus_tag LOCUS_05600 CDS 59577..60311 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528206.1 transl_table 11 codon_start 1 locus_tag LOCUS_05610 CDS 60471..60698 product aa3-type cytochrome c oxidase subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035216233.1 transl_table 11 codon_start 1 locus_tag LOCUS_05620 CDS 60841..62076 product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528203.1 transl_table 11 codon_start 1 locus_tag LOCUS_05630 CDS 62076..62492 product proton-translocating transhydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709410.1 transl_table 11 codon_start 1 locus_tag LOCUS_05640 CDS 62499..63899 product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528201.1 transl_table 11 codon_start 1 locus_tag LOCUS_05650 CDS 64425..65582 product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529678.1 transl_table 11 codon_start 1 locus_tag LOCUS_05660 CDS 65579..68710 product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529677.1 transl_table 11 codon_start 1 locus_tag LOCUS_05670 CDS 68779..69282 product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529668.1 transl_table 11 codon_start 1 locus_tag LOCUS_05680 CDS 69287..70075 product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206876.1 transl_table 11 codon_start 1 locus_tag LOCUS_05690 CDS complement(70076..70246) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05700 CDS 70491..70727 product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529653.1 transl_table 11 codon_start 1 locus_tag LOCUS_05710 gene rpsU CDS 70955..71797 product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529652.1 transl_table 11 codon_start 1 locus_tag LOCUS_05720 CDS complement(72526..74898) product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061562.1 transl_table 11 codon_start 1 locus_tag LOCUS_05730 CDS complement(74903..75919) product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391592.1 transl_table 11 codon_start 1 locus_tag LOCUS_05740 gene deoC CDS 76023..77006 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267240.1 transl_table 11 codon_start 1 locus_tag LOCUS_05750 CDS complement(77003..77758) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972351.1 transl_table 11 codon_start 1 locus_tag LOCUS_05760 CDS complement(77755..78726) product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972350.1 transl_table 11 codon_start 1 locus_tag LOCUS_05770 CDS complement(78716..79678) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992347.1 transl_table 11 codon_start 1 locus_tag LOCUS_05780 CDS complement(79750..80682) product siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972348.1 transl_table 11 codon_start 1 locus_tag LOCUS_05790 CDS complement(80798..81556) product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184222143.1 transl_table 11 codon_start 1 locus_tag LOCUS_05800 CDS complement(81678..82907) product lytic murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529721.1 transl_table 11 codon_start 1 locus_tag LOCUS_05810 CDS complement(83200..83667) product Hsp20 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529716.1 transl_table 11 codon_start 1 locus_tag LOCUS_05820 CDS 83912..84979 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529715.1 transl_table 11 codon_start 1 locus_tag LOCUS_05830 CDS complement(85115..85888) product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529714.1 transl_table 11 codon_start 1 locus_tag LOCUS_05840 gene hisN CDS complement(86149..86754) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05850 CDS 86647..86955 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05860 CDS 87272..87634 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006199474.1 transl_table 11 codon_start 1 locus_tag LOCUS_05870 tRNA 87828..87902 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00120 CDS complement(87972..89651) product alpha/beta-hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976330.1 transl_table 11 codon_start 1 locus_tag LOCUS_05880 CDS 89780..91240 product YdiU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525148.1 transl_table 11 codon_start 1 locus_tag LOCUS_05890 CDS 91335..92813 product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003668.1 transl_table 11 codon_start 1 locus_tag LOCUS_05900 CDS 92852..93175 product YnfA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974861.1 transl_table 11 codon_start 1 locus_tag LOCUS_05910 CDS 93357..95591 product TonB-dependent siderophore receptor PirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112590.1 transl_table 11 codon_start 1 locus_tag LOCUS_05920 gene pirA CDS 95709..96914 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05930 CDS 97108..99072 product 5'-nucleotidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970201.1 transl_table 11 codon_start 1 locus_tag LOCUS_05940 CDS 99238..100293 product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529728.1 transl_table 11 codon_start 1 locus_tag LOCUS_05950 gene hemH CDS 100391..101359 product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529726.1 transl_table 11 codon_start 1 locus_tag LOCUS_05960 CDS 101368..101841 product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529725.1 transl_table 11 codon_start 1 locus_tag LOCUS_05970 CDS complement(101838..102548) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205180329.1 transl_table 11 codon_start 1 locus_tag LOCUS_05980 CDS complement(102541..103053) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05990 CDS complement(103190..103567) product DUF930 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974429.1 transl_table 11 codon_start 1 locus_tag LOCUS_06000 CDS complement(103714..104121) product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383469.1 transl_table 11 codon_start 1 locus_tag LOCUS_06010 CDS 104214..105146 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06020 CDS complement(105163..106146) product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529724.1 transl_table 11 codon_start 1 locus_tag LOCUS_06030 CDS 106505..108010 product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173044.1 transl_table 11 codon_start 1 locus_tag LOCUS_06040 CDS complement(107994..109064) product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393512.1 transl_table 11 codon_start 1 locus_tag LOCUS_06050 CDS 109477..114189 product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529718.1 transl_table 11 codon_start 1 locus_tag LOCUS_06060 gene gltB CDS 114275..114892 product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090139.1 transl_table 11 codon_start 1 locus_tag LOCUS_06070 CDS 114885..116339 product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529719.1 transl_table 11 codon_start 1 locus_tag LOCUS_06080 CDS 116553..118007 product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113731.1 transl_table 11 codon_start 1 locus_tag LOCUS_06090 CDS 118114..119373 product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268659.1 transl_table 11 codon_start 1 locus_tag LOCUS_06100 CDS complement(119336..119749) product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162688107.1 transl_table 11 codon_start 1 locus_tag LOCUS_06110 CDS complement(119739..120374) product DUF296 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162688125.1 transl_table 11 codon_start 1 locus_tag LOCUS_06120 CDS 120562..121032 product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974190.1 transl_table 11 codon_start 1 locus_tag LOCUS_06130 CDS 121154..121858 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180942960.1 transl_table 11 codon_start 1 locus_tag LOCUS_06140 CDS complement(121912..122292) product outer membrane lipoprotein Omp10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313453.1 transl_table 11 codon_start 1 locus_tag LOCUS_06150 gene omp10 CDS 122808..124220 product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530221.1 transl_table 11 codon_start 1 locus_tag LOCUS_06160 CDS 124283..124747 product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530220.1 transl_table 11 codon_start 1 locus_tag LOCUS_06170 CDS 124840..125127 product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530219.1 transl_table 11 codon_start 1 locus_tag LOCUS_06180 CDS complement(125194..126642) product homospermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529731.1 transl_table 11 codon_start 1 locus_tag LOCUS_06190 CDS complement(126727..127896) product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529734.1 transl_table 11 codon_start 1 locus_tag LOCUS_06200 CDS complement(127889..129760) product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173037.1 transl_table 11 codon_start 1 locus_tag LOCUS_06210 CDS 130161..131918 product DUF882 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531050.1 transl_table 11 codon_start 1 locus_tag LOCUS_06220 CDS complement(132053..132853) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06230 CDS complement(132918..133550) product 2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529740.1 transl_table 11 codon_start 1 locus_tag LOCUS_06240 CDS complement(133617..134222) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06250 CDS 134383..135309 product rhodanese-related sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529741.1 transl_table 11 codon_start 1 locus_tag LOCUS_06260 CDS 135470..136186 product tellurite resistance TerB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529742.1 transl_table 11 codon_start 1 locus_tag LOCUS_06270 CDS 136451..137134 product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529746.1 transl_table 11 codon_start 1 locus_tag LOCUS_06280 CDS 137173..137361 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06290 CDS complement(137365..138447) product nickel/cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973904.1 transl_table 11 codon_start 1 locus_tag LOCUS_06300 CDS complement(138448..139098) product DUF1007 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529751.1 transl_table 11 codon_start 1 locus_tag LOCUS_06310 CDS complement(139170..140087) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529752.1 transl_table 11 codon_start 1 locus_tag LOCUS_06320 CDS 140783..141916 product ornithine/lysine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529754.1 transl_table 11 codon_start 1 locus_tag LOCUS_06330 gene odc2 CDS 142056..142649 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529755.1 transl_table 11 codon_start 1 locus_tag LOCUS_06340 CDS complement(142731..143012) product SCP2 sterol-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529756.1 transl_table 11 codon_start 1 locus_tag LOCUS_06350 CDS complement(143147..143668) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529757.1 transl_table 11 codon_start 1 locus_tag LOCUS_06360 CDS complement(143665..144081) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529758.1 transl_table 11 codon_start 1 locus_tag LOCUS_06370 CDS complement(144078..144623) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06380 CDS complement(144663..145067) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06390 CDS complement(145067..145819) product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529768.1 transl_table 11 codon_start 1 locus_tag LOCUS_06400 gene fliR CDS complement(145816..147903) product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529769.1 transl_table 11 codon_start 1 locus_tag LOCUS_06410 gene flhA CDS 148099..148806 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06420 CDS complement(148856..149122) product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529773.1 transl_table 11 codon_start 1 locus_tag LOCUS_06430 gene fliQ CDS complement(149135..149557) product flagellar hook assembly protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974491.1 transl_table 11 codon_start 1 locus_tag LOCUS_06440 gene flgD CDS complement(149559..149990) product flagellar biosynthesis repressor FlbT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313043.1 transl_table 11 codon_start 1 locus_tag LOCUS_06450 gene flbT CDS complement(149987..150373) product flagellar biosynthesis regulator FlaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529776.1 transl_table 11 codon_start 1 locus_tag LOCUS_06460 gene flaF CDS complement(150373..151422) product flagellar hook-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529777.1 transl_table 11 codon_start 1 locus_tag LOCUS_06470 CDS complement(151427..152875) product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529778.1 transl_table 11 codon_start 1 locus_tag LOCUS_06480 gene flgK CDS complement(152912..154081) product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529779.1 transl_table 11 codon_start 1 locus_tag LOCUS_06490 CDS complement(154180..154857) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529780.1 transl_table 11 codon_start 1 locus_tag LOCUS_06500 CDS complement(155055..155615) product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050596211.1 transl_table 11 codon_start 1 locus_tag LOCUS_06510 CDS complement(155569..156945) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06520 CDS complement(156947..158131) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06530 CDS complement(158128..159399) product MotB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529784.1 transl_table 11 codon_start 1 locus_tag LOCUS_06540 CDS complement(159396..160043) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06550 CDS complement(160040..161692) product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529786.1 transl_table 11 codon_start 1 locus_tag LOCUS_06560 gene fliF CDS complement(162015..162770) product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529789.1 transl_table 11 codon_start 1 locus_tag LOCUS_06570 gene fliP CDS complement(162767..163252) product flagellar basal body-associated FliL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529790.1 transl_table 11 codon_start 1 locus_tag LOCUS_06580 CDS complement(163267..163971) product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529791.1 transl_table 11 codon_start 1 locus_tag LOCUS_06590 gene flgH CDS complement(163968..164474) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06600 CDS complement(164490..165617) product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529793.1 transl_table 11 codon_start 1 locus_tag LOCUS_06610 CDS complement(165614..166069) product flagellar basal body P-ring formation chaperone FlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529794.1 transl_table 11 codon_start 1 locus_tag LOCUS_06620 gene flgA CDS complement(166074..166859) product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529795.1 transl_table 11 codon_start 1 locus_tag LOCUS_06630 gene flgG CDS complement(166872..167186) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06640 CDS complement(167189..167602) product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974466.1 transl_table 11 codon_start 1 locus_tag LOCUS_06650 gene flgC CDS complement(167606..167989) product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529798.1 transl_table 11 codon_start 1 locus_tag LOCUS_06660 gene flgB CDS complement(168084..168671) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529906.1 transl_table 11 codon_start 1 locus_tag LOCUS_06670 CDS complement(168658..170052) product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529800.1 transl_table 11 codon_start 1 locus_tag LOCUS_06680 gene fliI CDS complement(170063..170782) product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529801.1 transl_table 11 codon_start 1 locus_tag LOCUS_06690 gene flgF CDS complement(170792..171568) product DUF1217 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327332.1 transl_table 11 codon_start 1 locus_tag LOCUS_06700 CDS 171716..172600 product flagellar motor stator protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529803.1 transl_table 11 codon_start 1 locus_tag LOCUS_06710 gene motA CDS 172597..173556 product FliM/FliN family flagellar motor switch protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529804.1 transl_table 11 codon_start 1 locus_tag LOCUS_06720 CDS 173637..174035 product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529805.1 transl_table 11 codon_start 1 locus_tag LOCUS_06730 gene fliN CDS 174058..175068 product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529806.1 transl_table 11 codon_start 1 locus_tag LOCUS_06740 CDS 175147..176226 product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529807.1 transl_table 11 codon_start 1 locus_tag LOCUS_06750 gene flhB CDS 176236..176694 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968724.1 transl_table 11 codon_start 1 locus_tag LOCUS_06760 CDS complement(177107..177814) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529809.1 transl_table 11 codon_start 1 locus_tag LOCUS_06770 CDS complement(177826..178365) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529810.1 transl_table 11 codon_start 1 locus_tag LOCUS_06780 CDS 178318..178590 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06790 CDS 178901..179908 product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971319.1 transl_table 11 codon_start 1 locus_tag LOCUS_06800 CDS complement(180033..180599) product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528197.1 transl_table 11 codon_start 1 locus_tag LOCUS_06810 CDS 180693..181079 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087865.1 transl_table 11 codon_start 1 locus_tag LOCUS_06820 CDS 181190..182422 product putative DNA modification/repair radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972122.1 transl_table 11 codon_start 1 locus_tag LOCUS_06830 CDS 182737..183897 product UdgX family uracil-DNA binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972121.1 transl_table 11 codon_start 1 locus_tag LOCUS_06840 CDS complement(183925..184089) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06850 CDS 184021..185196 product M20 aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085805.1 transl_table 11 codon_start 1 locus_tag LOCUS_06860 CDS 185196..186233 product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103966.1 transl_table 11 codon_start 1 locus_tag LOCUS_06870 CDS complement(186278..186706) product DUF3597 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973558.1 transl_table 11 codon_start 1 locus_tag LOCUS_06880 CDS 187145..187342 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06890 CDS 187356..188102 product Urease operon accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132073684.1 transl_table 11 codon_start 1 locus_tag LOCUS_06900 CDS complement(188060..188221) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06910 CDS complement(188838..190226) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06920 CDS complement(190231..191244) product CBASS cGAMP-activated phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001133548.1 transl_table 11 codon_start 1 locus_tag LOCUS_06930 CDS complement(191274..191516) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06940 CDS 191618..192496 product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044008000.1 transl_table 11 codon_start 1 locus_tag LOCUS_06950 CDS 192552..194090 product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201778938.1 transl_table 11 codon_start 1 locus_tag LOCUS_06960 CDS 194087..195268 product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083500625.1 transl_table 11 codon_start 1 locus_tag LOCUS_06970 CDS 195271..196077 product TIGR02391 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483178.1 transl_table 11 codon_start 1 locus_tag LOCUS_06980 CDS 196074..196904 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022387.1 transl_table 11 codon_start 1 locus_tag LOCUS_06990 CDS 196916..199015 product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022388.1 transl_table 11 codon_start 1 locus_tag LOCUS_07000 CDS 199012..202404 product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022389.1 transl_table 11 codon_start 1 locus_tag LOCUS_07010 CDS 202506..202673 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07020 CDS complement(202629..203717) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07030 CDS 204352..204882 product antirestriction protein ArdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021204.1 transl_table 11 codon_start 1 locus_tag LOCUS_07040 CDS 205076..205291 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07050 CDS 205338..205859 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07060 CDS complement(205878..206171) product DUF2285 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538229.1 transl_table 11 codon_start 1 locus_tag LOCUS_07070 CDS 206631..206900 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036743091.1 transl_table 11 codon_start 1 locus_tag LOCUS_07080 CDS 206900..207976 product replication initiator protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368640.1 transl_table 11 codon_start 1 locus_tag LOCUS_07090 CDS 208035..208553 product DUF2840 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368643.1 transl_table 11 codon_start 1 locus_tag LOCUS_07100 CDS 208550..209095 product S26 family signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368397.1 transl_table 11 codon_start 1 locus_tag LOCUS_07110 CDS 209130..209465 product DUF736 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368398.1 transl_table 11 codon_start 1 locus_tag LOCUS_07120 CDS 209705..210394 product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368399.1 transl_table 11 codon_start 1 locus_tag LOCUS_07130 CDS 210708..212762 product DUF3363 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538232.1 transl_table 11 codon_start 1 locus_tag LOCUS_07140 CDS complement(212875..213105) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07150 CDS complement(213429..214139) product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783729.1 transl_table 11 codon_start 1 locus_tag LOCUS_07160 CDS complement(214191..215054) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07170 CDS 215132..215308 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07180 note possible pseudo, frameshifted CDS 215359..215514 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07190 note possible pseudo, frameshifted CDS 215511..215696 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07200 note possible pseudo, frameshifted CDS 215811..216758 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230820.1 transl_table 11 codon_start 1 locus_tag LOCUS_07210 CDS 216809..217435 product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038740.1 transl_table 11 codon_start 1 locus_tag LOCUS_07220 CDS 217499..217825 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07230 CDS 218024..219820 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485997.1 transl_table 11 codon_start 1 locus_tag LOCUS_07240 CDS 219817..221568 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390092.1 transl_table 11 codon_start 1 locus_tag LOCUS_07250 CDS 221565..221753 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07260 CDS 221750..222883 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390970.1 transl_table 11 codon_start 1 locus_tag LOCUS_07270 CDS 222883..223614 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705137.1 transl_table 11 codon_start 1 locus_tag LOCUS_07280 CDS 223632..224744 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021243.1 transl_table 11 codon_start 1 locus_tag LOCUS_07290 CDS complement(224808..225488) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082696.1 transl_table 11 codon_start 1 locus_tag LOCUS_07300 CDS 225640..226632 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368405.1 transl_table 11 codon_start 1 locus_tag LOCUS_07310 CDS 226763..228751 product conjugal transfer protein TraG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368406.1 transl_table 11 codon_start 1 locus_tag LOCUS_07320 CDS 228762..229235 product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538234.1 transl_table 11 codon_start 1 locus_tag LOCUS_07330 CDS complement(229298..229900) product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530052.1 transl_table 11 codon_start 1 locus_tag LOCUS_07340 CDS complement(229929..231125) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226921.1 transl_table 11 codon_start 1 locus_tag LOCUS_07350 CDS 231235..232149 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969857.1 transl_table 11 codon_start 1 locus_tag LOCUS_07360 CDS complement(232266..232610) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976140.1 transl_table 11 codon_start 1 locus_tag LOCUS_07370 CDS complement(232702..233007) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07380 CDS 233226..234161 product RNA polymerase sigma factor SigJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029962.1 transl_table 11 codon_start 1 locus_tag LOCUS_07390 gene sigJ CDS complement(234209..234505) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07400 CDS 234576..235559 product P-type conjugative transfer ATPase TrbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368408.1 transl_table 11 codon_start 1 locus_tag LOCUS_07410 gene trbB CDS 235556..235888 product TrbC/VirB2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388565.1 transl_table 11 codon_start 1 locus_tag LOCUS_07420 CDS 235888..236169 product VirB3 family type IV secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368410.1 transl_table 11 codon_start 1 locus_tag LOCUS_07430 CDS 236180..238672 product conjugal transfer protein TrbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368411.1 transl_table 11 codon_start 1 locus_tag LOCUS_07440 gene trbE CDS 238669..239445 product P-type conjugative transfer protein TrbJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538236.1 transl_table 11 codon_start 1 locus_tag LOCUS_07450 gene trbJ CDS 239460..239726 product putative entry exclusion protein TrbK-alt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368413.1 transl_table 11 codon_start 1 locus_tag LOCUS_07460 gene trbK-alt CDS 239729..241087 product P-type conjugative transfer protein TrbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368414.1 transl_table 11 codon_start 1 locus_tag LOCUS_07470 gene trbL CDS 241084..241773 product conjugal transfer protein TrbF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368415.1 transl_table 11 codon_start 1 locus_tag LOCUS_07480 gene trbF CDS 241770..242771 product P-type conjugative transfer protein TrbG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368416.1 transl_table 11 codon_start 1 locus_tag LOCUS_07490 gene trbG CDS 242768..243904 product TrbI/VirB10 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368417.1 transl_table 11 codon_start 1 locus_tag LOCUS_07500 CDS 243907..244134 product DUF2274 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368418.1 transl_table 11 codon_start 1 locus_tag LOCUS_07510 CDS complement(244391..244720) product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087106.1 transl_table 11 codon_start 1 locus_tag LOCUS_07520 CDS complement(244772..245398) product glutathione S-transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920810.1 transl_table 11 codon_start 1 locus_tag LOCUS_07530 CDS 245534..246499 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086730.1 transl_table 11 codon_start 1 locus_tag LOCUS_07540 CDS complement(246590..247033) product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095485158.1 transl_table 11 codon_start 1 locus_tag LOCUS_07550 CDS 247115..247426 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532546.1 transl_table 11 codon_start 1 locus_tag LOCUS_07560 CDS 247545..248621 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07570 CDS complement(248790..249158) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087865.1 transl_table 11 codon_start 1 locus_tag LOCUS_07580 CDS 249247..249963 product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103613.1 transl_table 11 codon_start 1 locus_tag LOCUS_07590 CDS complement(250206..250961) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974415.1 transl_table 11 codon_start 1 locus_tag LOCUS_07600 CDS 251059..252006 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035566.1 transl_table 11 codon_start 1 locus_tag LOCUS_07610 CDS 252227..252544 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07620 CDS 252541..252894 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07630 CDS 252891..253289 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051076796.1 transl_table 11 codon_start 1 locus_tag LOCUS_07640 CDS 253286..254944 product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286106.1 transl_table 11 codon_start 1 locus_tag LOCUS_07650 tRNA complement(254915..254991) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00130 CDS complement(255200..255337) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07660 CDS 255457..255882 product organic hydroperoxide resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947687.1 transl_table 11 codon_start 1 locus_tag LOCUS_07670 CDS 255932..256423 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970621.1 transl_table 11 codon_start 1 locus_tag LOCUS_07680 CDS 256452..257168 product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731326.1 transl_table 11 codon_start 1 locus_tag LOCUS_07690 CDS 257293..258039 product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970619.1 transl_table 11 codon_start 1 locus_tag LOCUS_07700 CDS complement(258139..259416) product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067368.1 transl_table 11 codon_start 1 locus_tag LOCUS_07710 CDS complement(259540..260124) product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972386.1 transl_table 11 codon_start 1 locus_tag LOCUS_07720 CDS complement(260254..261183) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330312.1 transl_table 11 codon_start 1 locus_tag LOCUS_07730 CDS 261504..262826 product sn-glycerol-3-phosphate ABC transporter substrate-binding protein UgpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930288.1 transl_table 11 codon_start 1 locus_tag LOCUS_07740 gene ugpB CDS 262900..263781 product sn-glycerol-3-phosphate ABC transporter permease UgpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811262.1 transl_table 11 codon_start 1 locus_tag LOCUS_07750 gene ugpA CDS 263781..264626 product sn-glycerol-3-phosphate ABC transporter permease UgpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811259.1 transl_table 11 codon_start 1 locus_tag LOCUS_07760 gene ugpE CDS 264637..265734 product sn-glycerol-3-phosphate import ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339184.1 transl_table 11 codon_start 1 locus_tag LOCUS_07770 CDS 265807..266607 product OXA-42 family oxacillin-hydrolyzing class D beta-lactamase OXA-59 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524931.1 transl_table 11 codon_start 1 locus_tag LOCUS_07780 gene blaOXA CDS complement(266650..267624) product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529722.1 transl_table 11 codon_start 1 locus_tag LOCUS_07790 gene galU CDS 267723..268982 product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971031.1 transl_table 11 codon_start 1 locus_tag LOCUS_07800 gene aroA CDS complement(269301..269555) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531549.1 transl_table 11 codon_start 1 locus_tag LOCUS_07810 CDS 269809..270528 product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525063.1 transl_table 11 codon_start 1 locus_tag LOCUS_07820 CDS complement(270561..271331) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972995.1 transl_table 11 codon_start 1 locus_tag LOCUS_07830 CDS complement(271325..272392) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972996.1 transl_table 11 codon_start 1 locus_tag LOCUS_07840 CDS complement(272398..273525) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972998.1 transl_table 11 codon_start 1 locus_tag LOCUS_07850 CDS 273622..274416 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972999.1 transl_table 11 codon_start 1 locus_tag LOCUS_07860 CDS complement(274454..275599) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089388.1 transl_table 11 codon_start 1 locus_tag LOCUS_07870 CDS complement(275739..276863) product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532935.1 transl_table 11 codon_start 1 locus_tag LOCUS_07880 CDS 276998..277189 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07890 tRNA complement(277277..277353) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00140 CDS 277573..278526 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529902.1 transl_table 11 codon_start 1 locus_tag LOCUS_07900 CDS 278543..279181 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205839366.1 transl_table 11 codon_start 1 locus_tag LOCUS_07910 CDS complement(279227..280411) product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529903.1 transl_table 11 codon_start 1 locus_tag LOCUS_07920 gene mnmA CDS 280784..281059 product DUF1153 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529904.1 transl_table 11 codon_start 1 locus_tag LOCUS_07930 CDS complement(281200..281631) product flagellar export protein FliJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529907.1 transl_table 11 codon_start 1 locus_tag LOCUS_07940 CDS 282214..282909 product cell cycle two-component system response regulator CtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006203583.1 transl_table 11 codon_start 1 locus_tag LOCUS_07950 gene ctrA CDS complement(283044..283673) product histidine phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529909.1 transl_table 11 codon_start 1 locus_tag LOCUS_07960 CDS 283963..284544 product DUF1134 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529910.1 transl_table 11 codon_start 1 locus_tag LOCUS_07970 CDS 284642..285700 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07980 CDS complement(285702..286496) product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529912.1 transl_table 11 codon_start 1 locus_tag LOCUS_07990 CDS complement(286617..287012) product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529913.1 transl_table 11 codon_start 1 locus_tag LOCUS_08000 CDS complement(287527..288288) product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529916.1 transl_table 11 codon_start 1 locus_tag LOCUS_08010 CDS complement(288314..289507) product choline ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529958.1 transl_table 11 codon_start 1 locus_tag LOCUS_08020 gene choV CDS complement(289504..290361) product choline ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529957.1 transl_table 11 codon_start 1 locus_tag LOCUS_08030 gene choW CDS complement(290368..291306) product choline ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396076.1 transl_table 11 codon_start 1 locus_tag LOCUS_08040 CDS 291537..292649 product DUF2333 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314644.1 transl_table 11 codon_start 1 locus_tag LOCUS_08050 CDS 292682..294361 product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529948.1 transl_table 11 codon_start 1 locus_tag LOCUS_08060 CDS 294512..294940 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337336.1 transl_table 11 codon_start 1 locus_tag LOCUS_08070 CDS 294974..296065 product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532371.1 transl_table 11 codon_start 1 locus_tag LOCUS_08080 CDS 296134..297672 product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532370.1 transl_table 11 codon_start 1 locus_tag LOCUS_08090 CDS 297941..300130 product anthranilate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529939.1 transl_table 11 codon_start 1 locus_tag LOCUS_08100 CDS 300381..301295 product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529938.1 transl_table 11 codon_start 1 locus_tag LOCUS_08110 CDS 301331..302371 product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529931.1 transl_table 11 codon_start 1 locus_tag LOCUS_08120 CDS 302478..303059 product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066512.1 transl_table 11 codon_start 1 locus_tag LOCUS_08130 CDS 303282..304478 product benzoate/H(+) symporter BenE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972186.1 transl_table 11 codon_start 1 locus_tag LOCUS_08140 CDS 304772..306469 product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242703.1 transl_table 11 codon_start 1 locus_tag LOCUS_08150 gene leuA CDS 306738..308483 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529923.1 transl_table 11 codon_start 1 locus_tag LOCUS_08160 CDS 308541..309296 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529922.1 transl_table 11 codon_start 1 locus_tag LOCUS_08170 CDS complement(309402..309617) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08180 CDS 309501..309971 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08190 CDS complement(309963..310868) product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529920.1 transl_table 11 codon_start 1 locus_tag LOCUS_08200 CDS 310986..311444 product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529919.1 transl_table 11 codon_start 1 locus_tag LOCUS_08210 CDS complement(311456..312439) product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529918.1 transl_table 11 codon_start 1 locus_tag LOCUS_08220 CDS 312720..313232 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529917.1 transl_table 11 codon_start 1 locus_tag LOCUS_08230 CDS complement(313705..315753) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529965.1 transl_table 11 codon_start 1 locus_tag LOCUS_08240 CDS complement(315766..318591) product DUF4159 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529966.1 transl_table 11 codon_start 1 locus_tag LOCUS_08250 CDS complement(318588..319490) product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529967.1 transl_table 11 codon_start 1 locus_tag LOCUS_08260 CDS complement(319501..320508) product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529968.1 transl_table 11 codon_start 1 locus_tag LOCUS_08270 CDS 320633..321262 product DUF1285 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529969.1 transl_table 11 codon_start 1 locus_tag LOCUS_08280 CDS 321259..321894 product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529970.1 transl_table 11 codon_start 1 locus_tag LOCUS_08290 CDS 321891..323150 product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529971.1 transl_table 11 codon_start 1 locus_tag LOCUS_08300 CDS 323332..323523 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08310 CDS complement(323593..323778) product DUF1059 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529972.1 transl_table 11 codon_start 1 locus_tag LOCUS_08320 CDS complement(323898..324812) product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529974.1 transl_table 11 codon_start 1 locus_tag LOCUS_08330 gene hemF CDS 324934..325191 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529975.1 transl_table 11 codon_start 1 locus_tag LOCUS_08340 CDS complement(325233..325721) product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529977.1 transl_table 11 codon_start 1 locus_tag LOCUS_08350 CDS 326478..328328 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972169.1 transl_table 11 codon_start 1 locus_tag LOCUS_08360 CDS 328390..330258 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529980.1 transl_table 11 codon_start 1 locus_tag LOCUS_08370 CDS 330579..331142 product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975691.1 transl_table 11 codon_start 1 locus_tag LOCUS_08380 gene petA CDS 331257..332546 product cytochrome b N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529985.1 transl_table 11 codon_start 1 locus_tag LOCUS_08390 CDS 332546..333406 product cytochrome c1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975689.1 transl_table 11 codon_start 1 locus_tag LOCUS_08400 CDS 333986..335089 product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529993.1 transl_table 11 codon_start 1 locus_tag LOCUS_08410 gene ychF CDS 335201..336163 product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529992.1 transl_table 11 codon_start 1 locus_tag LOCUS_08420 gene corA CDS complement(336182..337273) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162304037.1 transl_table 11 codon_start 1 locus_tag LOCUS_08430 CDS 337459..337920 product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529991.1 transl_table 11 codon_start 1 locus_tag LOCUS_08440 CDS 337929..338357 product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529990.1 transl_table 11 codon_start 1 locus_tag LOCUS_08450 CDS complement(338556..339101) product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529989.1 transl_table 11 codon_start 1 locus_tag LOCUS_08460 CDS complement(339195..339896) product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529994.1 transl_table 11 codon_start 1 locus_tag LOCUS_08470 gene pth CDS complement(339925..340554) product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529995.1 transl_table 11 codon_start 1 locus_tag LOCUS_08480 CDS complement(340745..341548) product ChbG/HpnK family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529675.1 transl_table 11 codon_start 1 locus_tag LOCUS_08490 CDS complement(341541..342494) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529674.1 transl_table 11 codon_start 1 locus_tag LOCUS_08500 CDS 342740..343144 product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529676.1 transl_table 11 codon_start 1 locus_tag LOCUS_08510 CDS complement(343141..344781) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08520 CDS complement(344820..345752) product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530002.1 transl_table 11 codon_start 1 locus_tag LOCUS_08530 CDS complement(345942..346592) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08540 CDS complement(346619..347770) product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530004.1 transl_table 11 codon_start 1 locus_tag LOCUS_08550 CDS complement(347796..348587) product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530005.1 transl_table 11 codon_start 1 locus_tag LOCUS_08560 gene pgeF CDS complement(348671..349723) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530006.1 transl_table 11 codon_start 1 locus_tag LOCUS_08570 CDS complement(349720..350562) product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530007.1 transl_table 11 codon_start 1 locus_tag LOCUS_08580 gene lgt CDS 350677..350937 product accessory factor UbiK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530008.1 transl_table 11 codon_start 1 locus_tag LOCUS_08590 CDS 351360..351860 product YbjN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530009.1 transl_table 11 codon_start 1 locus_tag LOCUS_08600 CDS 351860..352222 product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530010.1 transl_table 11 codon_start 1 locus_tag LOCUS_08610 CDS complement(352263..352400) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08620 CDS 352809..354935 product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528058.1 transl_table 11 codon_start 1 locus_tag LOCUS_08630 CDS 354948..355307 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08640 CDS complement(355428..356735) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530013.1 transl_table 11 codon_start 1 locus_tag LOCUS_08650 CDS complement(356839..357543) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530014.1 transl_table 11 codon_start 1 locus_tag LOCUS_08660 CDS complement(357546..358061) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024505623.1 transl_table 11 codon_start 1 locus_tag LOCUS_08670 CDS 358347..359240 product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530016.1 transl_table 11 codon_start 1 locus_tag LOCUS_08680 CDS 359588..360232 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530018.1 transl_table 11 codon_start 1 locus_tag LOCUS_08690 CDS 360349..360828 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08700 CDS complement(360910..361440) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08710 CDS 361571..361969 product DNA breaking-rejoining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337172.1 transl_table 11 codon_start 1 locus_tag LOCUS_08720 CDS complement(361973..362554) product DUF922 domain-containing Zn-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971994.1 transl_table 11 codon_start 1 locus_tag LOCUS_08730 CDS complement(362833..365868) product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064980587.1 transl_table 11 codon_start 1 locus_tag LOCUS_08740 gene uvrB CDS complement(366014..366490) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08750 CDS 366948..367163 product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003494703.1 transl_table 11 codon_start 1 locus_tag LOCUS_08760 CDS complement(368434..368661) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08770 note possible pseudo, frameshifted CDS complement(369430..370029) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529441.1 transl_table 11 codon_start 1 locus_tag LOCUS_08780 CDS 370434..370826 product BA14K family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530019.1 transl_table 11 codon_start 1 locus_tag LOCUS_08790 CDS 371008..372228 product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970165.1 transl_table 11 codon_start 1 locus_tag LOCUS_08800 CDS 372225..373028 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066853.1 transl_table 11 codon_start 1 locus_tag LOCUS_08810 CDS 373025..373924 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970167.1 transl_table 11 codon_start 1 locus_tag LOCUS_08820 CDS complement(373986..375455) product Na+/H+ antiporter NhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338014.1 transl_table 11 codon_start 1 locus_tag LOCUS_08830 gene nhaC CDS complement(375715..377034) product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530058.1 transl_table 11 codon_start 1 locus_tag LOCUS_08840 CDS complement(377212..378057) product extensin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530062.1 transl_table 11 codon_start 1 locus_tag LOCUS_08850 CDS complement(378419..378841) product DUF3775 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530064.1 transl_table 11 codon_start 1 locus_tag LOCUS_08860 CDS 379105..379578 product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530066.1 transl_table 11 codon_start 1 locus_tag LOCUS_08870 gene greA CDS 379603..380715 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972124.1 transl_table 11 codon_start 1 locus_tag LOCUS_08880 CDS 380691..381437 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08890 CDS complement(381448..381927) product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530077.1 transl_table 11 codon_start 1 locus_tag LOCUS_08900 CDS 382181..383155 product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530078.1 transl_table 11 codon_start 1 locus_tag LOCUS_08910 gene trxB CDS 383306..384202 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530079.1 transl_table 11 codon_start 1 locus_tag LOCUS_08920 CDS complement(384929..386131) product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976362.1 transl_table 11 codon_start 1 locus_tag LOCUS_08930 CDS 386343..387224 product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530085.1 transl_table 11 codon_start 1 locus_tag LOCUS_08940 CDS 387191..388063 product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530086.1 transl_table 11 codon_start 1 locus_tag LOCUS_08950 CDS 388303..389034 product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530096.1 transl_table 11 codon_start 1 locus_tag LOCUS_08960 CDS 389135..389878 product glycosyltransferase family 25 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971875.1 transl_table 11 codon_start 1 locus_tag LOCUS_08970 CDS complement(389959..393441) product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240364.1 transl_table 11 codon_start 1 locus_tag LOCUS_08980 gene carB CDS 393851..394813 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08990 CDS 394921..396126 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063170320.1 transl_table 11 codon_start 1 locus_tag LOCUS_09000 CDS 396227..397156 product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397656.1 transl_table 11 codon_start 1 locus_tag LOCUS_09010 CDS complement(397221..397547) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09020 CDS complement(397547..398275) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971202.1 transl_table 11 codon_start 1 locus_tag LOCUS_09030 CDS 398373..399296 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121650473.1 transl_table 11 codon_start 1 locus_tag LOCUS_09040 CDS complement(399322..400524) product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530125.1 transl_table 11 codon_start 1 locus_tag LOCUS_09050 gene carA CDS 400813..401262 product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532937.1 transl_table 11 codon_start 1 locus_tag LOCUS_09060 CDS complement(401322..401606) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09070 CDS complement(401681..402121) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140187.1 transl_table 11 codon_start 1 locus_tag LOCUS_09080 CDS complement(402318..402956) product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072642918.1 transl_table 11 codon_start 1 locus_tag LOCUS_09090 CDS 403626..403982 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09100 CDS complement(404004..404186) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09110 CDS 404305..405480 product zinc-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242620.1 transl_table 11 codon_start 1 locus_tag LOCUS_09120 CDS complement(405534..405788) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09130 CDS 405969..406466 product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004435461.1 transl_table 11 codon_start 1 locus_tag LOCUS_09140 CDS 406659..408587 product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530148.1 transl_table 11 codon_start 1 locus_tag LOCUS_09150 gene dnaG CDS 408885..410900 product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530149.1 transl_table 11 codon_start 1 locus_tag LOCUS_09160 gene rpoD CDS 410984..411274 product HlyU family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530153.1 transl_table 11 codon_start 1 locus_tag LOCUS_09170 CDS 411405..412256 product lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525079.1 transl_table 11 codon_start 1 locus_tag LOCUS_09180 sequence03 source 1..398075 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(282..1583) product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528196.1 transl_table 11 codon_start 1 locus_tag LOCUS_09190 CDS 1902..4349 product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528198.1 transl_table 11 codon_start 1 locus_tag LOCUS_09200 gene gyrB CDS complement(4456..5295) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064989.1 transl_table 11 codon_start 1 locus_tag LOCUS_09210 CDS 5581..6345 product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537831.1 transl_table 11 codon_start 1 locus_tag LOCUS_09220 CDS 6352..7272 product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384692.1 transl_table 11 codon_start 1 locus_tag LOCUS_09230 CDS 7287..8228 product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384693.1 transl_table 11 codon_start 1 locus_tag LOCUS_09240 CDS 8225..9649 product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388944.1 transl_table 11 codon_start 1 locus_tag LOCUS_09250 gene leuC CDS 9646..10263 product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721055.1 transl_table 11 codon_start 1 locus_tag LOCUS_09260 gene leuD CDS 10289..11530 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807943.1 transl_table 11 codon_start 1 locus_tag LOCUS_09270 CDS 11597..12466 product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942649.1 transl_table 11 codon_start 1 locus_tag LOCUS_09280 CDS 12463..13452 product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942650.1 transl_table 11 codon_start 1 locus_tag LOCUS_09290 CDS 13449..14204 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965992.1 transl_table 11 codon_start 1 locus_tag LOCUS_09300 CDS 14197..14898 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944002.1 transl_table 11 codon_start 1 locus_tag LOCUS_09310 CDS 14916..16316 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040324.1 transl_table 11 codon_start 1 locus_tag LOCUS_09320 CDS 16336..17100 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09330 CDS 17104..17880 product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391583.1 transl_table 11 codon_start 1 locus_tag LOCUS_09340 CDS 17899..18768 product isocitrate lyase/PEP mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039143.1 transl_table 11 codon_start 1 locus_tag LOCUS_09350 CDS complement(18886..19494) product transglutaminase-like cysteine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528717.1 transl_table 11 codon_start 1 locus_tag LOCUS_09360 CDS 19748..20413 product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975097.1 transl_table 11 codon_start 1 locus_tag LOCUS_09370 gene rpe CDS 20511..21287 product DUF3750 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391328.1 transl_table 11 codon_start 1 locus_tag LOCUS_09380 CDS complement(21362..22381) product isopenicillin N synthase family oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530313.1 transl_table 11 codon_start 1 locus_tag LOCUS_09390 CDS complement(22535..23938) product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531781.1 transl_table 11 codon_start 1 locus_tag LOCUS_09400 CDS 24117..24701 product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194572.1 transl_table 11 codon_start 1 locus_tag LOCUS_09410 CDS 24752..25957 product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337442.1 transl_table 11 codon_start 1 locus_tag LOCUS_09420 CDS 25970..27013 product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009564818.1 transl_table 11 codon_start 1 locus_tag LOCUS_09430 gene tdh tRNA complement(27858..27933) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00150 CDS complement(28160..28558) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09440 CDS 28796..29455 product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064255020.1 transl_table 11 codon_start 1 locus_tag LOCUS_09450 gene cmk CDS 29647..31392 product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528183.1 transl_table 11 codon_start 1 locus_tag LOCUS_09460 gene rpsA CDS 31603..32574 product complex I NDUFA9 subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528195.1 transl_table 11 codon_start 1 locus_tag LOCUS_09470 CDS complement(32703..33530) product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528623.1 transl_table 11 codon_start 1 locus_tag LOCUS_09480 CDS complement(33566..33736) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09490 CDS 33660..34427 product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528622.1 transl_table 11 codon_start 1 locus_tag LOCUS_09500 CDS 34430..35578 product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528621.1 transl_table 11 codon_start 1 locus_tag LOCUS_09510 gene queG CDS 35554..36462 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528620.1 transl_table 11 codon_start 1 locus_tag LOCUS_09520 CDS 36535..37455 product penicillin-insensitive murein endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528619.1 transl_table 11 codon_start 1 locus_tag LOCUS_09530 gene mepA CDS 37607..38632 product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528618.1 transl_table 11 codon_start 1 locus_tag LOCUS_09540 CDS 38774..40591 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528617.1 transl_table 11 codon_start 1 locus_tag LOCUS_09550 CDS 40588..41400 product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528616.1 transl_table 11 codon_start 1 locus_tag LOCUS_09560 gene dapB CDS 41426..42046 product 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528615.1 transl_table 11 codon_start 1 locus_tag LOCUS_09570 tRNA 42250..42334 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00160 CDS 42932..43768 product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533652.1 transl_table 11 codon_start 1 locus_tag LOCUS_09580 CDS 43902..45557 product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533654.1 transl_table 11 codon_start 1 locus_tag LOCUS_09590 CDS complement(45573..46217) product thermonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391923.1 transl_table 11 codon_start 1 locus_tag LOCUS_09600 CDS 46412..48205 product acyl-CoA dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970940.1 transl_table 11 codon_start 1 locus_tag LOCUS_09610 CDS 48251..49459 product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391931.1 transl_table 11 codon_start 1 locus_tag LOCUS_09620 CDS 49481..51691 product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533657.1 transl_table 11 codon_start 1 locus_tag LOCUS_09630 CDS 51748..52296 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09640 CDS complement(52342..52785) product MerR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533661.1 transl_table 11 codon_start 1 locus_tag LOCUS_09650 CDS 53082..56294 product peptidoglycan-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241884.1 transl_table 11 codon_start 1 locus_tag LOCUS_09660 CDS 56486..57409 product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533663.1 transl_table 11 codon_start 1 locus_tag LOCUS_09670 CDS 57409..58206 product TIGR02186 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533664.1 transl_table 11 codon_start 1 locus_tag LOCUS_09680 CDS complement(58242..58970) product ligase-associated DNA damage response endonuclease PdeM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533672.1 transl_table 11 codon_start 1 locus_tag LOCUS_09690 gene pdeM CDS complement(58967..61477) product ligase-associated DNA damage response DEXH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063171190.1 transl_table 11 codon_start 1 locus_tag LOCUS_09700 CDS complement(61504..62433) product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527946.1 transl_table 11 codon_start 1 locus_tag LOCUS_09710 CDS 62478..63554 product ligase-associated DNA damage response exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527947.1 transl_table 11 codon_start 1 locus_tag LOCUS_09720 CDS 63551..65167 product cisplatin damage response ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527948.1 transl_table 11 codon_start 1 locus_tag LOCUS_09730 CDS complement(65172..66140) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024503420.1 transl_table 11 codon_start 1 locus_tag LOCUS_09740 tRNA 66360..66435 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00170 CDS complement(66770..66988) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09750 CDS 66875..67663 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529572.1 transl_table 11 codon_start 1 locus_tag LOCUS_09760 CDS complement(67706..67966) product DUF1150 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529590.1 transl_table 11 codon_start 1 locus_tag LOCUS_09770 CDS complement(68029..68457) product Hsp20 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529591.1 transl_table 11 codon_start 1 locus_tag LOCUS_09780 CDS 68579..69523 product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529592.1 transl_table 11 codon_start 1 locus_tag LOCUS_09790 CDS complement(69533..70423) product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529597.1 transl_table 11 codon_start 1 locus_tag LOCUS_09800 CDS complement(70529..71182) product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968425.1 transl_table 11 codon_start 1 locus_tag LOCUS_09810 gene msrA CDS complement(71223..71510) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09820 tRNA 71707..71796 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00180 CDS complement(72283..72507) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09830 CDS complement(72531..72923) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09840 CDS 72956..73291 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09850 CDS complement(73590..75596) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09860 CDS complement(75608..77236) product terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140144.1 transl_table 11 codon_start 1 locus_tag LOCUS_09870 CDS complement(77202..77606) product phage terminase small subunit P27 family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337420.1 transl_table 11 codon_start 1 locus_tag LOCUS_09880 CDS complement(77603..77923) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09890 CDS complement(77920..78333) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09900 CDS complement(78330..78722) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09910 CDS complement(78712..79023) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09920 CDS complement(79353..79700) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09930 CDS complement(79870..81018) product phage major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072867.1 transl_table 11 codon_start 1 locus_tag LOCUS_09940 CDS complement(81018..81536) product HK97 family phage prohead protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971285.1 transl_table 11 codon_start 1 locus_tag LOCUS_09950 CDS complement(81529..81930) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09960 CDS complement(81944..83152) product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337429.1 transl_table 11 codon_start 1 locus_tag LOCUS_09970 CDS complement(83139..83531) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09980 CDS complement(83778..84530) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09990 CDS complement(84966..86087) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10000 CDS complement(86074..86322) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10010 CDS complement(86397..87317) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10020 CDS complement(87424..87630) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10030 CDS complement(87815..88990) product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975508.1 transl_table 11 codon_start 1 locus_tag LOCUS_10040 CDS complement(89107..89286) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10050 CDS 89359..89709 product DUF2200 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970036.1 transl_table 11 codon_start 1 locus_tag LOCUS_10060 CDS 90008..91681 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969063.1 transl_table 11 codon_start 1 locus_tag LOCUS_10070 CDS 91678..92715 product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969064.1 transl_table 11 codon_start 1 locus_tag LOCUS_10080 CDS complement(92716..94347) product GMC family oxidoreductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067082.1 transl_table 11 codon_start 1 locus_tag LOCUS_10090 CDS complement(94464..95474) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004435245.1 transl_table 11 codon_start 1 locus_tag LOCUS_10100 CDS complement(95467..96354) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067080.1 transl_table 11 codon_start 1 locus_tag LOCUS_10110 CDS complement(96358..97068) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313865.1 transl_table 11 codon_start 1 locus_tag LOCUS_10120 CDS complement(97061..97837) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067078.1 transl_table 11 codon_start 1 locus_tag LOCUS_10130 CDS complement(97843..99057) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973580.1 transl_table 11 codon_start 1 locus_tag LOCUS_10140 CDS 99231..100136 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004435265.1 transl_table 11 codon_start 1 locus_tag LOCUS_10150 CDS complement(100121..100672) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529308.1 transl_table 11 codon_start 1 locus_tag LOCUS_10160 CDS 100855..102072 product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529307.1 transl_table 11 codon_start 1 locus_tag LOCUS_10170 CDS 102069..105179 product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529306.1 transl_table 11 codon_start 1 locus_tag LOCUS_10180 CDS 105291..108074 product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528060.1 transl_table 11 codon_start 1 locus_tag LOCUS_10190 CDS 108166..109233 product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528062.1 transl_table 11 codon_start 1 locus_tag LOCUS_10200 gene trpS CDS 109288..109779 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528063.1 transl_table 11 codon_start 1 locus_tag LOCUS_10210 CDS 109893..110477 product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528064.1 transl_table 11 codon_start 1 locus_tag LOCUS_10220 CDS 110495..110884 product Cu(I)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528067.1 transl_table 11 codon_start 1 locus_tag LOCUS_10230 gene cueR CDS 110908..111402 product MmcB family DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050596417.1 transl_table 11 codon_start 1 locus_tag LOCUS_10240 CDS 111444..111977 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972312.1 transl_table 11 codon_start 1 locus_tag LOCUS_10250 CDS complement(111979..112557) product ActR/PrrA/RegA family redox response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528072.1 transl_table 11 codon_start 1 locus_tag LOCUS_10260 CDS complement(112586..113938) product ActS/PrrB/RegB family redox-sensitive histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528073.1 transl_table 11 codon_start 1 locus_tag LOCUS_10270 CDS complement(113951..116416) product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528074.1 transl_table 11 codon_start 1 locus_tag LOCUS_10280 gene hrpB CDS complement(116426..117205) product phosphonate metabolism transcriptional regulator PhnF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173106.1 transl_table 11 codon_start 1 locus_tag LOCUS_10290 gene phnF CDS 117319..117735 product phosphonate C-P lyase system protein PhnG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529524.1 transl_table 11 codon_start 1 locus_tag LOCUS_10300 gene phnG CDS 117735..118349 product phosphonate C-P lyase system protein PhnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529523.1 transl_table 11 codon_start 1 locus_tag LOCUS_10310 gene phnH CDS 118353..119450 product carbon-phosphorus lyase complex subunit PhnI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529522.1 transl_table 11 codon_start 1 locus_tag LOCUS_10320 CDS 119593..120483 product alpha-D-ribose 1-methylphosphonate 5-phosphate C-P-lyase PhnJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529519.1 transl_table 11 codon_start 1 locus_tag LOCUS_10330 CDS 120487..121269 product phosphonate C-P lyase system protein PhnK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529518.1 transl_table 11 codon_start 1 locus_tag LOCUS_10340 gene phnK CDS 121274..122011 product phosphonate C-P lyase system protein PhnL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529517.1 transl_table 11 codon_start 1 locus_tag LOCUS_10350 gene phnL CDS 122008..122625 product DapH/DapD/GlmU-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529516.1 transl_table 11 codon_start 1 locus_tag LOCUS_10360 CDS 122881..123729 product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024311734.1 transl_table 11 codon_start 1 locus_tag LOCUS_10370 gene phnC CDS 123817..124722 product phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970703.1 transl_table 11 codon_start 1 locus_tag LOCUS_10380 gene phnD CDS 124789..125766 product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970702.1 transl_table 11 codon_start 1 locus_tag LOCUS_10390 gene phnE CDS 125766..127118 product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970701.1 transl_table 11 codon_start 1 locus_tag LOCUS_10400 gene phnE CDS 127275..127982 product DUF1045 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528376.1 transl_table 11 codon_start 1 locus_tag LOCUS_10410 CDS 127984..129123 product alpha-D-ribose 1-methylphosphonate 5-triphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528377.1 transl_table 11 codon_start 1 locus_tag LOCUS_10420 CDS 129120..129752 product phosphonate metabolism protein/1,5-bisphosphokinase (PRPP-forming) PhnN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063170982.1 transl_table 11 codon_start 1 locus_tag LOCUS_10430 gene phnN CDS complement(129812..130297) product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527914.1 transl_table 11 codon_start 1 locus_tag LOCUS_10440 gene bfr CDS complement(130263..130571) product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527915.1 transl_table 11 codon_start 1 locus_tag LOCUS_10450 CDS 131237..131557 product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709859.1 transl_table 11 codon_start 1 locus_tag LOCUS_10460 gene trxA CDS complement(131623..132945) product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528322.1 transl_table 11 codon_start 1 locus_tag LOCUS_10470 CDS complement(133068..133991) product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528321.1 transl_table 11 codon_start 1 locus_tag LOCUS_10480 gene accD CDS complement(134158..135003) product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528320.1 transl_table 11 codon_start 1 locus_tag LOCUS_10490 gene trpA CDS complement(135000..135767) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10500 CDS complement(135775..137010) product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528319.1 transl_table 11 codon_start 1 locus_tag LOCUS_10510 gene trpB CDS complement(137043..137684) product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330397.1 transl_table 11 codon_start 1 locus_tag LOCUS_10520 CDS complement(137754..138503) product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528316.1 transl_table 11 codon_start 1 locus_tag LOCUS_10530 CDS complement(138571..139344) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528313.1 transl_table 11 codon_start 1 locus_tag LOCUS_10540 CDS 139668..140072 product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082909774.1 transl_table 11 codon_start 1 locus_tag LOCUS_10550 gene infC CDS 140303..140512 product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012710090.1 transl_table 11 codon_start 1 locus_tag LOCUS_10560 gene rpmI CDS 140542..140943 product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528310.1 transl_table 11 codon_start 1 locus_tag LOCUS_10570 gene rplT CDS 141101..142192 product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528309.1 transl_table 11 codon_start 1 locus_tag LOCUS_10580 gene pheS CDS 142294..144699 product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970769.1 transl_table 11 codon_start 1 locus_tag LOCUS_10590 gene pheT CDS 145029..146954 product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024502156.1 transl_table 11 codon_start 1 locus_tag LOCUS_10600 gene dnaK CDS 147192..148283 product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920656.1 transl_table 11 codon_start 1 locus_tag LOCUS_10610 CDS 148379..149590 product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528587.1 transl_table 11 codon_start 1 locus_tag LOCUS_10620 gene dnaJ CDS 149632..150255 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528588.1 transl_table 11 codon_start 1 locus_tag LOCUS_10630 CDS 150371..150976 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528588.1 transl_table 11 codon_start 1 locus_tag LOCUS_10640 CDS 151027..151614 product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528589.1 transl_table 11 codon_start 1 locus_tag LOCUS_10650 CDS 151611..152309 product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968510.1 transl_table 11 codon_start 1 locus_tag LOCUS_10660 gene pyrF CDS 152327..152623 product DUF1330 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528591.1 transl_table 11 codon_start 1 locus_tag LOCUS_10670 CDS complement(152680..153123) product host attachment family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529560.1 transl_table 11 codon_start 1 locus_tag LOCUS_10680 CDS 153351..154328 product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528637.1 transl_table 11 codon_start 1 locus_tag LOCUS_10690 gene cysK CDS complement(154381..155364) product ferritin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528652.1 transl_table 11 codon_start 1 locus_tag LOCUS_10700 CDS complement(155484..156173) product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528671.1 transl_table 11 codon_start 1 locus_tag LOCUS_10710 CDS complement(156328..156612) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10720 CDS 156508..158199 product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173515202.1 transl_table 11 codon_start 1 locus_tag LOCUS_10730 gene lepA CDS 158286..159182 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532737.1 transl_table 11 codon_start 1 locus_tag LOCUS_10740 CDS complement(159186..159740) product SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527882.1 transl_table 11 codon_start 1 locus_tag LOCUS_10750 CDS 159905..160906 product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527881.1 transl_table 11 codon_start 1 locus_tag LOCUS_10760 CDS complement(161368..162114) product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064255075.1 transl_table 11 codon_start 1 locus_tag LOCUS_10770 CDS complement(162111..163262) product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527878.1 transl_table 11 codon_start 1 locus_tag LOCUS_10780 gene recF CDS complement(163310..164428) product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527877.1 transl_table 11 codon_start 1 locus_tag LOCUS_10790 gene dnaN CDS 164546..164701 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10800 CDS complement(164891..166447) product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024503475.1 transl_table 11 codon_start 1 locus_tag LOCUS_10810 gene dnaA CDS complement(167217..167624) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10820 CDS complement(167657..168454) product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533693.1 transl_table 11 codon_start 1 locus_tag LOCUS_10830 CDS complement(168557..169456) product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968531.1 transl_table 11 codon_start 1 locus_tag LOCUS_10840 gene mutM CDS complement(169449..170687) product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533691.1 transl_table 11 codon_start 1 locus_tag LOCUS_10850 CDS 170828..171718 product PhnD/SsuA/transferrin family substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063171180.1 transl_table 11 codon_start 1 locus_tag LOCUS_10860 CDS complement(171721..172293) product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533689.1 transl_table 11 codon_start 1 locus_tag LOCUS_10870 CDS complement(172307..172687) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10880 CDS complement(172987..173382) product pilus assembly protein N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533687.1 transl_table 11 codon_start 1 locus_tag LOCUS_10890 CDS 173681..173863 product Flp family type IVb pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310069.1 transl_table 11 codon_start 1 locus_tag LOCUS_10900 CDS 174064..174579 product prepilin peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533685.1 transl_table 11 codon_start 1 locus_tag LOCUS_10910 CDS 174713..175513 product Flp pilus assembly protein CpaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533684.1 transl_table 11 codon_start 1 locus_tag LOCUS_10920 gene cpaB CDS 175513..177048 product type II and III secretion system protein family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533683.1 transl_table 11 codon_start 1 locus_tag LOCUS_10930 CDS 177126..177746 product pilus assembly protein CpaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533682.1 transl_table 11 codon_start 1 locus_tag LOCUS_10940 CDS 177928..179052 product CpaE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533681.1 transl_table 11 codon_start 1 locus_tag LOCUS_10950 CDS 179078..180544 product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533680.1 transl_table 11 codon_start 1 locus_tag LOCUS_10960 CDS 180598..181584 product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533679.1 transl_table 11 codon_start 1 locus_tag LOCUS_10970 CDS 181586..182563 product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533678.1 transl_table 11 codon_start 1 locus_tag LOCUS_10980 CDS complement(182619..183389) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533677.1 transl_table 11 codon_start 1 locus_tag LOCUS_10990 CDS 183525..184895 product M17 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533676.1 transl_table 11 codon_start 1 locus_tag LOCUS_11000 CDS 184895..185248 product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533675.1 transl_table 11 codon_start 1 locus_tag LOCUS_11010 CDS 185235..186098 product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173545.1 transl_table 11 codon_start 1 locus_tag LOCUS_11020 CDS 186185..186736 product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626155.1 transl_table 11 codon_start 1 locus_tag LOCUS_11030 CDS 186747..187421 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889094.1 transl_table 11 codon_start 1 locus_tag LOCUS_11040 CDS 187418..188011 product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889093.1 transl_table 11 codon_start 1 locus_tag LOCUS_11050 CDS complement(188029..188997) product glyoxylate/hydroxypyruvate reductase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527944.1 transl_table 11 codon_start 1 locus_tag LOCUS_11060 CDS complement(189058..189978) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11070 CDS complement(190110..191738) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527943.1 transl_table 11 codon_start 1 locus_tag LOCUS_11080 CDS complement(191735..192886) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527942.1 transl_table 11 codon_start 1 locus_tag LOCUS_11090 CDS complement(192886..193980) product microcin C ABC transporter permease YejB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527941.1 transl_table 11 codon_start 1 locus_tag LOCUS_11100 CDS complement(194017..195882) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527940.1 transl_table 11 codon_start 1 locus_tag LOCUS_11110 CDS complement(195895..197775) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527939.1 transl_table 11 codon_start 1 locus_tag LOCUS_11120 CDS complement(198078..198905) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11130 CDS 199098..199832 product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527937.1 transl_table 11 codon_start 1 locus_tag LOCUS_11140 CDS 199829..200704 product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527936.1 transl_table 11 codon_start 1 locus_tag LOCUS_11150 CDS complement(200701..201660) product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527934.1 transl_table 11 codon_start 1 locus_tag LOCUS_11160 gene nudC CDS complement(201657..202082) product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013844995.1 transl_table 11 codon_start 1 locus_tag LOCUS_11170 CDS 202478..204286 product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527932.1 transl_table 11 codon_start 1 locus_tag LOCUS_11180 CDS 204320..204643 product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527931.1 transl_table 11 codon_start 1 locus_tag LOCUS_11190 CDS 204656..205261 product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527928.1 transl_table 11 codon_start 1 locus_tag LOCUS_11200 gene recR CDS 205361..206596 product lytic murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527927.1 transl_table 11 codon_start 1 locus_tag LOCUS_11210 CDS complement(206580..207596) product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528459.1 transl_table 11 codon_start 1 locus_tag LOCUS_11220 CDS complement(207694..208902) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528460.1 transl_table 11 codon_start 1 locus_tag LOCUS_11230 CDS complement(209087..210130) product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528461.1 transl_table 11 codon_start 1 locus_tag LOCUS_11240 CDS complement(210293..211519) product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528468.1 transl_table 11 codon_start 1 locus_tag LOCUS_11250 gene rmuC CDS 211725..212246 product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974268.1 transl_table 11 codon_start 1 locus_tag LOCUS_11260 gene def CDS 212251..213165 product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310212.1 transl_table 11 codon_start 1 locus_tag LOCUS_11270 gene fmt CDS 213162..213674 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528472.1 transl_table 11 codon_start 1 locus_tag LOCUS_11280 CDS 213802..214551 product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974270.1 transl_table 11 codon_start 1 locus_tag LOCUS_11290 gene truA CDS complement(214553..215158) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528474.1 transl_table 11 codon_start 1 locus_tag LOCUS_11300 CDS complement(215250..216443) product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391801.1 transl_table 11 codon_start 1 locus_tag LOCUS_11310 gene dapE CDS complement(216503..216892) product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109667275.1 transl_table 11 codon_start 1 locus_tag LOCUS_11320 CDS complement(217212..217415) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11330 CDS complement(217647..218021) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11340 CDS complement(218134..218988) product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003493576.1 transl_table 11 codon_start 1 locus_tag LOCUS_11350 gene dapD CDS 219120..219962 product LOG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528481.1 transl_table 11 codon_start 1 locus_tag LOCUS_11360 CDS complement(219998..220702) product pyrimidine 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528482.1 transl_table 11 codon_start 1 locus_tag LOCUS_11370 CDS 220792..221697 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968573.1 transl_table 11 codon_start 1 locus_tag LOCUS_11380 CDS complement(221728..222627) product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528489.1 transl_table 11 codon_start 1 locus_tag LOCUS_11390 gene argB CDS complement(222775..223434) product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252558.1 transl_table 11 codon_start 1 locus_tag LOCUS_11400 gene yihA CDS complement(223666..225495) product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528504.1 transl_table 11 codon_start 1 locus_tag LOCUS_11410 gene yidC CDS complement(225507..225842) product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528505.1 transl_table 11 codon_start 1 locus_tag LOCUS_11420 gene rnpA CDS complement(225858..225992) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11430 CDS 226281..227792 product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528506.1 transl_table 11 codon_start 1 locus_tag LOCUS_11440 tRNA 228020..228096 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00190 CDS complement(228170..228877) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11450 CDS complement(228960..229796) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222208.1 transl_table 11 codon_start 1 locus_tag LOCUS_11460 CDS complement(229808..230590) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083244.1 transl_table 11 codon_start 1 locus_tag LOCUS_11470 CDS complement(230593..231660) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11480 CDS complement(231721..232176) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11490 CDS complement(232187..232936) product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143495.1 transl_table 11 codon_start 1 locus_tag LOCUS_11500 gene fabG CDS 233021..234655 product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920494.1 transl_table 11 codon_start 1 locus_tag LOCUS_11510 CDS complement(234699..235403) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11520 CDS 235439..236206 product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530480.1 transl_table 11 codon_start 1 locus_tag LOCUS_11530 CDS 236421..237191 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814390.1 transl_table 11 codon_start 1 locus_tag LOCUS_11540 CDS complement(237206..237976) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038928.1 transl_table 11 codon_start 1 locus_tag LOCUS_11550 CDS complement(237990..238814) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728488.1 transl_table 11 codon_start 1 locus_tag LOCUS_11560 CDS complement(238807..239421) product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085510.1 transl_table 11 codon_start 1 locus_tag LOCUS_11570 CDS complement(239421..240443) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11580 CDS complement(240477..241160) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11590 CDS complement(241352..242806) product fatty-acid--CoA ligase FadD5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726688.1 transl_table 11 codon_start 1 locus_tag LOCUS_11600 gene fadD5 CDS complement(242803..243660) product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421145.1 transl_table 11 codon_start 1 locus_tag LOCUS_11610 CDS 244055..245029 product methionine ABC transporter ATP-binding protein MetN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242531.1 transl_table 11 codon_start 1 locus_tag LOCUS_11620 gene metN CDS 245026..245703 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096946.1 transl_table 11 codon_start 1 locus_tag LOCUS_11630 CDS 245751..246548 product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096945.1 transl_table 11 codon_start 1 locus_tag LOCUS_11640 CDS complement(246622..247482) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396781.1 transl_table 11 codon_start 1 locus_tag LOCUS_11650 CDS complement(247902..248360) product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532225.1 transl_table 11 codon_start 1 locus_tag LOCUS_11660 CDS complement(248407..249207) product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972916.1 transl_table 11 codon_start 1 locus_tag LOCUS_11670 gene thiD CDS complement(249204..249866) product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972915.1 transl_table 11 codon_start 1 locus_tag LOCUS_11680 gene thiE CDS complement(249859..250590) product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972914.1 transl_table 11 codon_start 1 locus_tag LOCUS_11690 CDS complement(250590..251534) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035257402.1 transl_table 11 codon_start 1 locus_tag LOCUS_11700 CDS complement(251566..252369) product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338388.1 transl_table 11 codon_start 1 locus_tag LOCUS_11710 gene thiM CDS complement(252366..253124) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972912.1 transl_table 11 codon_start 1 locus_tag LOCUS_11720 CDS complement(253382..253951) product GDYXXLXY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531317.1 transl_table 11 codon_start 1 locus_tag LOCUS_11730 CDS complement(253948..255057) product DUF2157 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531316.1 transl_table 11 codon_start 1 locus_tag LOCUS_11740 CDS 255217..255948 product META domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329989.1 transl_table 11 codon_start 1 locus_tag LOCUS_11750 CDS complement(255949..256761) product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530223.1 transl_table 11 codon_start 1 locus_tag LOCUS_11760 gene proC CDS complement(256796..258118) product O-antigen ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530224.1 transl_table 11 codon_start 1 locus_tag LOCUS_11770 CDS complement(258087..259079) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530225.1 transl_table 11 codon_start 1 locus_tag LOCUS_11780 CDS 259226..260398 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530226.1 transl_table 11 codon_start 1 locus_tag LOCUS_11790 CDS 260395..261165 product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530227.1 transl_table 11 codon_start 1 locus_tag LOCUS_11800 CDS 261165..262040 product DUF6492 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530228.1 transl_table 11 codon_start 1 locus_tag LOCUS_11810 CDS 262075..263031 product omptin family outer membrane protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261859.1 transl_table 11 codon_start 1 locus_tag LOCUS_11820 CDS complement(263041..264300) product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530229.1 transl_table 11 codon_start 1 locus_tag LOCUS_11830 CDS 264501..266543 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11840 CDS 266641..267549 product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530231.1 transl_table 11 codon_start 1 locus_tag LOCUS_11850 gene folD CDS 267702..268256 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11860 CDS complement(268304..270127) product phosphogluconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530234.1 transl_table 11 codon_start 1 locus_tag LOCUS_11870 gene edd CDS complement(270180..270893) product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530235.1 transl_table 11 codon_start 1 locus_tag LOCUS_11880 gene pgl CDS complement(270896..272368) product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530236.1 transl_table 11 codon_start 1 locus_tag LOCUS_11890 gene zwf CDS 272560..274035 product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448980.1 transl_table 11 codon_start 1 locus_tag LOCUS_11900 CDS 274114..274863 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815983.1 transl_table 11 codon_start 1 locus_tag LOCUS_11910 CDS complement(274896..276191) product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530240.1 transl_table 11 codon_start 1 locus_tag LOCUS_11920 CDS complement(276302..277732) product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027035719.1 transl_table 11 codon_start 1 locus_tag LOCUS_11930 CDS complement(277828..279111) product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975774.1 transl_table 11 codon_start 1 locus_tag LOCUS_11940 CDS complement(279146..279658) product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810020.1 transl_table 11 codon_start 1 locus_tag LOCUS_11950 CDS complement(279722..280711) product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039499.1 transl_table 11 codon_start 1 locus_tag LOCUS_11960 CDS 280991..282118 product polyamine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066875295.1 transl_table 11 codon_start 1 locus_tag LOCUS_11970 CDS 282168..283337 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530249.1 transl_table 11 codon_start 1 locus_tag LOCUS_11980 CDS 283350..284261 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530250.1 transl_table 11 codon_start 1 locus_tag LOCUS_11990 CDS 284263..285084 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530251.1 transl_table 11 codon_start 1 locus_tag LOCUS_12000 CDS complement(285283..285849) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12010 CDS complement(285886..286377) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12020 CDS complement(286506..286985) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12030 CDS complement(287062..288990) product AsmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530252.1 transl_table 11 codon_start 1 locus_tag LOCUS_12040 CDS 289194..291128 product acetoacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530253.1 transl_table 11 codon_start 1 locus_tag LOCUS_12050 CDS complement(291167..294487) product PAS domain S-box protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530254.1 transl_table 11 codon_start 1 locus_tag LOCUS_12060 tRNA 294779..294855 product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00200 CDS 295201..295383 product Flp family type IVb pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310069.1 transl_table 11 codon_start 1 locus_tag LOCUS_12070 CDS complement(295601..297019) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12080 CDS complement(297264..298262) product DUF937 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530340.1 transl_table 11 codon_start 1 locus_tag LOCUS_12090 CDS complement(298357..299730) product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530341.1 transl_table 11 codon_start 1 locus_tag LOCUS_12100 CDS complement(299861..300538) product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530342.1 transl_table 11 codon_start 1 locus_tag LOCUS_12110 CDS 300850..300981 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12120 CDS complement(300978..301733) product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530346.1 transl_table 11 codon_start 1 locus_tag LOCUS_12130 CDS complement(301789..302490) product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530359.1 transl_table 11 codon_start 1 locus_tag LOCUS_12140 gene hisG CDS complement(302487..303614) product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530358.1 transl_table 11 codon_start 1 locus_tag LOCUS_12150 CDS complement(303618..305096) product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399583.1 transl_table 11 codon_start 1 locus_tag LOCUS_12160 gene hisS CDS complement(305203..305841) product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530355.1 transl_table 11 codon_start 1 locus_tag LOCUS_12170 CDS 306021..306842 product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530354.1 transl_table 11 codon_start 1 locus_tag LOCUS_12180 CDS complement(307247..307663) product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532413.1 transl_table 11 codon_start 1 locus_tag LOCUS_12190 CDS complement(307828..309219) product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919970.1 transl_table 11 codon_start 1 locus_tag LOCUS_12200 gene fumC CDS 309460..310167 product glutathione binding-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974611.1 transl_table 11 codon_start 1 locus_tag LOCUS_12210 CDS complement(310216..311004) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968220.1 transl_table 11 codon_start 1 locus_tag LOCUS_12220 CDS complement(311039..311728) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12230 CDS 311609..311938 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12240 CDS 312063..312800 product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121651594.1 transl_table 11 codon_start 1 locus_tag LOCUS_12250 CDS 312905..314158 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531179.1 transl_table 11 codon_start 1 locus_tag LOCUS_12260 CDS complement(314466..316109) product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066875142.1 transl_table 11 codon_start 1 locus_tag LOCUS_12270 gene groL CDS complement(316162..316458) product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706990.1 transl_table 11 codon_start 1 locus_tag LOCUS_12280 gene groES CDS complement(316713..318500) product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174564967.1 transl_table 11 codon_start 1 locus_tag LOCUS_12290 CDS complement(318550..320313) product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174564967.1 transl_table 11 codon_start 1 locus_tag LOCUS_12300 CDS 320592..321467 product TIGR01459 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063170199.1 transl_table 11 codon_start 1 locus_tag LOCUS_12310 CDS 321478..322470 product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532363.1 transl_table 11 codon_start 1 locus_tag LOCUS_12320 CDS 322752..325667 product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532360.1 transl_table 11 codon_start 1 locus_tag LOCUS_12330 gene ileS CDS 325869..326534 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532359.1 transl_table 11 codon_start 1 locus_tag LOCUS_12340 CDS complement(326964..327395) product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971070.1 transl_table 11 codon_start 1 locus_tag LOCUS_12350 CDS 327491..329413 product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971071.1 transl_table 11 codon_start 1 locus_tag LOCUS_12360 CDS 329394..329948 product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532356.1 transl_table 11 codon_start 1 locus_tag LOCUS_12370 gene rsmD CDS 330143..331510 product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532355.1 transl_table 11 codon_start 1 locus_tag LOCUS_12380 CDS 331510..332877 product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532354.1 transl_table 11 codon_start 1 locus_tag LOCUS_12390 CDS 332874..333758 product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532353.1 transl_table 11 codon_start 1 locus_tag LOCUS_12400 CDS complement(333766..333993) product DUF2093 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532341.1 transl_table 11 codon_start 1 locus_tag LOCUS_12410 CDS complement(334083..335951) product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532334.1 transl_table 11 codon_start 1 locus_tag LOCUS_12420 gene mutL CDS complement(336014..338122) product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532323.1 transl_table 11 codon_start 1 locus_tag LOCUS_12430 CDS 338341..339555 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973831.1 transl_table 11 codon_start 1 locus_tag LOCUS_12440 CDS complement(339605..340633) product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532342.1 transl_table 11 codon_start 1 locus_tag LOCUS_12450 gene lpxK CDS complement(340635..341963) product lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532343.1 transl_table 11 codon_start 1 locus_tag LOCUS_12460 gene waaA CDS complement(341960..342736) product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532344.1 transl_table 11 codon_start 1 locus_tag LOCUS_12470 CDS complement(342739..342987) product DUF4170 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037379087.1 transl_table 11 codon_start 1 locus_tag LOCUS_12480 CDS complement(343154..343939) product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532346.1 transl_table 11 codon_start 1 locus_tag LOCUS_12490 CDS complement(343926..345269) product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532347.1 transl_table 11 codon_start 1 locus_tag LOCUS_12500 CDS complement(345804..346145) product TIGR01244 family sulfur transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532310.1 transl_table 11 codon_start 1 locus_tag LOCUS_12510 CDS complement(346346..347575) product zinc metallochaperone GTPase ZigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972825.1 transl_table 11 codon_start 1 locus_tag LOCUS_12520 gene zigA CDS 347682..348104 product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328657.1 transl_table 11 codon_start 1 locus_tag LOCUS_12530 CDS 348344..350041 product N-acetylglutaminylglutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969278.1 transl_table 11 codon_start 1 locus_tag LOCUS_12540 CDS 350031..351863 product N-acetylglutaminylglutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969277.1 transl_table 11 codon_start 1 locus_tag LOCUS_12550 gene ngg CDS 351860..352990 product osmoprotectant NAGGN system M42 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028053720.1 transl_table 11 codon_start 1 locus_tag LOCUS_12560 CDS 353140..354180 product tonB-system energizer ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528968.1 transl_table 11 codon_start 1 locus_tag LOCUS_12570 gene exbB CDS 354186..354656 product TonB system transport protein ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970692.1 transl_table 11 codon_start 1 locus_tag LOCUS_12580 gene exbD CDS 354665..355609 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12590 CDS 355696..356487 product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531940.1 transl_table 11 codon_start 1 locus_tag LOCUS_12600 CDS complement(356488..356949) product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969411.1 transl_table 11 codon_start 1 locus_tag LOCUS_12610 CDS 357057..358637 product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383339.1 transl_table 11 codon_start 1 locus_tag LOCUS_12620 CDS complement(359021..360523) product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532286.1 transl_table 11 codon_start 1 locus_tag LOCUS_12630 gene guaB CDS complement(360785..361780) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992220.1 transl_table 11 codon_start 1 locus_tag LOCUS_12640 CDS 361977..363383 product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532287.1 transl_table 11 codon_start 1 locus_tag LOCUS_12650 CDS complement(363380..364105) product RlmE family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532288.1 transl_table 11 codon_start 1 locus_tag LOCUS_12660 CDS complement(364089..365486) product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532289.1 transl_table 11 codon_start 1 locus_tag LOCUS_12670 CDS 365849..366808 product YbhN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388243.1 transl_table 11 codon_start 1 locus_tag LOCUS_12680 CDS complement(367230..367448) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12690 tRNA 367536..367609 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00210 CDS 368167..369072 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762416.1 transl_table 11 codon_start 1 locus_tag LOCUS_12700 CDS 369215..370720 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163897449.1 transl_table 11 codon_start 1 locus_tag LOCUS_12710 CDS 370747..371607 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12720 CDS 371748..372497 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104116.1 transl_table 11 codon_start 1 locus_tag LOCUS_12730 CDS 372490..373320 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762766.1 transl_table 11 codon_start 1 locus_tag LOCUS_12740 CDS 373310..374086 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878183.1 transl_table 11 codon_start 1 locus_tag LOCUS_12750 CDS 374169..376214 product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970334.1 transl_table 11 codon_start 1 locus_tag LOCUS_12760 CDS complement(376232..377527) product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965673.1 transl_table 11 codon_start 1 locus_tag LOCUS_12770 CDS complement(377556..378260) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089566.1 transl_table 11 codon_start 1 locus_tag LOCUS_12780 CDS 378371..379291 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089568.1 transl_table 11 codon_start 1 locus_tag LOCUS_12790 CDS 379797..380900 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12800 CDS complement(380941..381816) product lysylphosphatidylglycerol synthase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389971.1 transl_table 11 codon_start 1 locus_tag LOCUS_12810 CDS complement(381827..382477) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12820 CDS complement(382488..383480) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389973.1 transl_table 11 codon_start 1 locus_tag LOCUS_12830 CDS complement(383545..384075) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12840 CDS complement(386027..387196) product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005467215.1 transl_table 11 codon_start 1 locus_tag LOCUS_12850 CDS 387792..388670 product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975749.1 transl_table 11 codon_start 1 locus_tag LOCUS_12860 gene rfbA CDS 388663..389217 product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532726.1 transl_table 11 codon_start 1 locus_tag LOCUS_12870 gene rfbC CDS 389256..390311 product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532725.1 transl_table 11 codon_start 1 locus_tag LOCUS_12880 gene rfbB CDS 390311..391207 product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121651858.1 transl_table 11 codon_start 1 locus_tag LOCUS_12890 gene rfbD CDS 391212..393512 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12900 CDS complement(393537..394730) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12910 CDS complement(394765..396114) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038796350.1 transl_table 11 codon_start 1 locus_tag LOCUS_12920 CDS complement(396104..396892) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244130.1 transl_table 11 codon_start 1 locus_tag LOCUS_12930 CDS complement(397098..397280) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12940 sequence04 source 1..326558 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(198..701) product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532244.1 transl_table 11 codon_start 1 locus_tag LOCUS_12950 gene nusB CDS complement(704..1159) product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532245.1 transl_table 11 codon_start 1 locus_tag LOCUS_12960 gene ribH CDS complement(1224..1835) product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391077.1 transl_table 11 codon_start 1 locus_tag LOCUS_12970 CDS complement(1835..2947) product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532249.1 transl_table 11 codon_start 1 locus_tag LOCUS_12980 gene ribD CDS complement(3026..3490) product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532250.1 transl_table 11 codon_start 1 locus_tag LOCUS_12990 gene nrdR CDS complement(3490..4800) product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532252.1 transl_table 11 codon_start 1 locus_tag LOCUS_13000 CDS complement(5081..6340) product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532254.1 transl_table 11 codon_start 1 locus_tag LOCUS_13010 CDS complement(6685..7200) product winged helix DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008875359.1 transl_table 11 codon_start 1 locus_tag LOCUS_13020 CDS 7471..8931 product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382881.1 transl_table 11 codon_start 1 locus_tag LOCUS_13030 CDS 9313..10875 product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390497.1 transl_table 11 codon_start 1 locus_tag LOCUS_13040 CDS 11065..12018 product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538257.1 transl_table 11 codon_start 1 locus_tag LOCUS_13050 gene phnD CDS 12101..12934 product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368503.1 transl_table 11 codon_start 1 locus_tag LOCUS_13060 gene phnC CDS 12934..13743 product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368504.1 transl_table 11 codon_start 1 locus_tag LOCUS_13070 gene phnE CDS 13745..14563 product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_104070585.1 transl_table 11 codon_start 1 locus_tag LOCUS_13080 gene phnE CDS complement(14603..15031) product DUF6163 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532255.1 transl_table 11 codon_start 1 locus_tag LOCUS_13090 CDS complement(15028..16068) product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532256.1 transl_table 11 codon_start 1 locus_tag LOCUS_13100 CDS 16366..17322 product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532258.1 transl_table 11 codon_start 1 locus_tag LOCUS_13110 gene hemB CDS 17425..17907 product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532273.1 transl_table 11 codon_start 1 locus_tag LOCUS_13120 CDS 18019..18768 product arginyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532274.1 transl_table 11 codon_start 1 locus_tag LOCUS_13130 CDS complement(18876..19040) product entericidin A/B family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530686.1 transl_table 11 codon_start 1 locus_tag LOCUS_13140 CDS complement(19148..19717) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13150 CDS complement(19861..22143) product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532278.1 transl_table 11 codon_start 1 locus_tag LOCUS_13160 gene parC CDS 22375..23556 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532279.1 transl_table 11 codon_start 1 locus_tag LOCUS_13170 CDS complement(23622..25412) product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391125.1 transl_table 11 codon_start 1 locus_tag LOCUS_13180 gene aspS CDS 25600..26754 product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532283.1 transl_table 11 codon_start 1 locus_tag LOCUS_13190 gene rnd CDS 26946..28244 product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327153.1 transl_table 11 codon_start 1 locus_tag LOCUS_13200 CDS complement(28320..28958) product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972103.1 transl_table 11 codon_start 1 locus_tag LOCUS_13210 CDS complement(29548..30051) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13220 CDS complement(30112..30387) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13230 CDS complement(30486..31997) product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532415.1 transl_table 11 codon_start 1 locus_tag LOCUS_13240 gene ppx CDS complement(31994..34213) product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532416.1 transl_table 11 codon_start 1 locus_tag LOCUS_13250 CDS 34398..34643 product zinc-finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003495891.1 transl_table 11 codon_start 1 locus_tag LOCUS_13260 CDS 34655..35854 product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532418.1 transl_table 11 codon_start 1 locus_tag LOCUS_13270 CDS complement(35919..36722) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532420.1 transl_table 11 codon_start 1 locus_tag LOCUS_13280 CDS complement(36739..37896) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532421.1 transl_table 11 codon_start 1 locus_tag LOCUS_13290 CDS complement(37898..39088) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066874276.1 transl_table 11 codon_start 1 locus_tag LOCUS_13300 CDS complement(39185..40210) product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532423.1 transl_table 11 codon_start 1 locus_tag LOCUS_13310 CDS 40634..41827 product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532426.1 transl_table 11 codon_start 1 locus_tag LOCUS_13320 CDS complement(41873..42181) product DUF982 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531722.1 transl_table 11 codon_start 1 locus_tag LOCUS_13330 CDS complement(42312..42662) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729125.1 transl_table 11 codon_start 1 locus_tag LOCUS_13340 CDS complement(42735..42986) product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313814.1 transl_table 11 codon_start 1 locus_tag LOCUS_13350 CDS 43225..43428 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13360 CDS 43540..44085 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13370 note possible pseudo, frameshifted CDS 44042..44551 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13380 CDS complement(44621..44782) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014331478.1 transl_table 11 codon_start 1 locus_tag LOCUS_13390 CDS complement(44849..45169) product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115842.1 transl_table 11 codon_start 1 locus_tag LOCUS_13400 CDS complement(45182..45355) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13410 CDS complement(45608..46018) product nucleoside diphosphate kinase regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968462.1 transl_table 11 codon_start 1 locus_tag LOCUS_13420 gene rnk CDS complement(46236..46682) product DUF1232 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398477.1 transl_table 11 codon_start 1 locus_tag LOCUS_13430 CDS 46980..47285 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525091.1 transl_table 11 codon_start 1 locus_tag LOCUS_13440 CDS 47301..47474 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13450 CDS 47617..48036 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13460 CDS complement(48080..48604) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102722.1 transl_table 11 codon_start 1 locus_tag LOCUS_13470 CDS complement(48617..49105) product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972196.1 transl_table 11 codon_start 1 locus_tag LOCUS_13480 CDS 49352..50596 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922385.1 transl_table 11 codon_start 1 locus_tag LOCUS_13490 CDS 50962..51177 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13500 CDS complement(51293..54802) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13510 CDS 55342..55524 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13520 CDS complement(55715..56953) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13530 CDS complement(56950..57138) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13540 tRNA complement(57597..57673) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00220 CDS complement(57714..58019) product ETC complex I subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532440.1 transl_table 11 codon_start 1 locus_tag LOCUS_13550 tRNA complement(58082..58158) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00230 CDS complement(58250..58924) product DnaA regulatory inactivator HdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532442.1 transl_table 11 codon_start 1 locus_tag LOCUS_13560 gene hdaA CDS complement(58947..60140) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532443.1 transl_table 11 codon_start 1 locus_tag LOCUS_13570 CDS complement(60124..60669) product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532444.1 transl_table 11 codon_start 1 locus_tag LOCUS_13580 CDS 60852..61958 product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532445.1 transl_table 11 codon_start 1 locus_tag LOCUS_13590 gene purM CDS 61955..62662 product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532446.1 transl_table 11 codon_start 1 locus_tag LOCUS_13600 gene purN CDS 63273..63932 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13610 CDS 64327..64842 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13620 CDS complement(65217..67337) product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532465.1 transl_table 11 codon_start 1 locus_tag LOCUS_13630 CDS 67434..68285 product 23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532491.1 transl_table 11 codon_start 1 locus_tag LOCUS_13640 CDS 68301..68819 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13650 CDS 68847..69485 product ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971417.1 transl_table 11 codon_start 1 locus_tag LOCUS_13660 CDS 69566..70117 product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532484.1 transl_table 11 codon_start 1 locus_tag LOCUS_13670 CDS complement(70232..70879) product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532483.1 transl_table 11 codon_start 1 locus_tag LOCUS_13680 CDS 71199..72005 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532482.1 transl_table 11 codon_start 1 locus_tag LOCUS_13690 CDS 72073..74082 product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532481.1 transl_table 11 codon_start 1 locus_tag LOCUS_13700 gene uvrC CDS 74192..74785 product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532480.1 transl_table 11 codon_start 1 locus_tag LOCUS_13710 gene pgsA CDS 74789..75043 product molybdopterin converting factor subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532479.1 transl_table 11 codon_start 1 locus_tag LOCUS_13720 gene moaD CDS 75047..75508 product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240872.1 transl_table 11 codon_start 1 locus_tag LOCUS_13730 CDS 75505..75897 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13740 CDS complement(76228..76650) product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003502118.1 transl_table 11 codon_start 1 locus_tag LOCUS_13750 gene ndk CDS complement(76742..77434) product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532474.1 transl_table 11 codon_start 1 locus_tag LOCUS_13760 CDS 77539..79497 product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532466.1 transl_table 11 codon_start 1 locus_tag LOCUS_13770 CDS complement(79562..80137) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13780 CDS complement(80249..80698) product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532504.1 transl_table 11 codon_start 1 locus_tag LOCUS_13790 CDS complement(80775..82268) product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532505.1 transl_table 11 codon_start 1 locus_tag LOCUS_13800 CDS 82648..83853 product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532506.1 transl_table 11 codon_start 1 locus_tag LOCUS_13810 gene lptF CDS 83853..84932 product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174299091.1 transl_table 11 codon_start 1 locus_tag LOCUS_13820 gene lptG CDS 84932..87310 product LPS-assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063171795.1 transl_table 11 codon_start 1 locus_tag LOCUS_13830 CDS 87467..88420 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024504313.1 transl_table 11 codon_start 1 locus_tag LOCUS_13840 CDS 88430..89440 product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532510.1 transl_table 11 codon_start 1 locus_tag LOCUS_13850 gene pdxA CDS 89437..90273 product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314585.1 transl_table 11 codon_start 1 locus_tag LOCUS_13860 gene rsmA CDS complement(90712..91362) product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971396.1 transl_table 11 codon_start 1 locus_tag LOCUS_13870 gene gmk CDS complement(91368..92300) product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532513.1 transl_table 11 codon_start 1 locus_tag LOCUS_13880 CDS complement(92297..93499) product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532514.1 transl_table 11 codon_start 1 locus_tag LOCUS_13890 gene mltG CDS complement(93713..94975) product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974945.1 transl_table 11 codon_start 1 locus_tag LOCUS_13900 gene fabF CDS complement(95112..95348) product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003502080.1 transl_table 11 codon_start 1 locus_tag LOCUS_13910 CDS complement(95583..96320) product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314577.1 transl_table 11 codon_start 1 locus_tag LOCUS_13920 gene fabG CDS complement(96362..97303) product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532517.1 transl_table 11 codon_start 1 locus_tag LOCUS_13930 gene fabD CDS 97586..98191 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13940 CDS 98502..98927 product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314574.1 transl_table 11 codon_start 1 locus_tag LOCUS_13950 gene rpsF CDS 98930..99178 product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006203718.1 transl_table 11 codon_start 1 locus_tag LOCUS_13960 gene rpsR CDS 99396..99989 product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532521.1 transl_table 11 codon_start 1 locus_tag LOCUS_13970 gene rplI CDS 100190..101710 product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336999.1 transl_table 11 codon_start 1 locus_tag LOCUS_13980 gene murJ CDS 101840..103081 product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532522.1 transl_table 11 codon_start 1 locus_tag LOCUS_13990 CDS 103123..104805 product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532525.1 transl_table 11 codon_start 1 locus_tag LOCUS_14000 CDS 104884..106278 product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532526.1 transl_table 11 codon_start 1 locus_tag LOCUS_14010 gene radA CDS 106360..106956 product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532527.1 transl_table 11 codon_start 1 locus_tag LOCUS_14020 CDS 107140..108609 product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532528.1 transl_table 11 codon_start 1 locus_tag LOCUS_14030 gene purF CDS 108727..109482 product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532529.1 transl_table 11 codon_start 1 locus_tag LOCUS_14040 CDS complement(109479..111245) product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525100.1 transl_table 11 codon_start 1 locus_tag LOCUS_14050 CDS 111526..113751 product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532541.1 transl_table 11 codon_start 1 locus_tag LOCUS_14060 CDS complement(113901..114707) product phosphatidylcholine/phosphatidylserine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532542.1 transl_table 11 codon_start 1 locus_tag LOCUS_14070 CDS complement(114718..115416) product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532543.1 transl_table 11 codon_start 1 locus_tag LOCUS_14080 CDS complement(115622..117484) product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532547.1 transl_table 11 codon_start 1 locus_tag LOCUS_14090 CDS complement(117553..117879) product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532548.1 transl_table 11 codon_start 1 locus_tag LOCUS_14100 CDS complement(118004..119308) product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532549.1 transl_table 11 codon_start 1 locus_tag LOCUS_14110 CDS 119501..120100 product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080817300.1 transl_table 11 codon_start 1 locus_tag LOCUS_14120 CDS complement(120114..121046) product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532716.1 transl_table 11 codon_start 1 locus_tag LOCUS_14130 gene rarD CDS complement(121201..122163) product prolyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532557.1 transl_table 11 codon_start 1 locus_tag LOCUS_14140 gene pip CDS complement(122339..122806) product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314552.1 transl_table 11 codon_start 1 locus_tag LOCUS_14150 CDS complement(122858..124276) product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391174.1 transl_table 11 codon_start 1 locus_tag LOCUS_14160 gene cysS CDS complement(124732..125355) product LysE/ArgO family amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943404.1 transl_table 11 codon_start 1 locus_tag LOCUS_14170 CDS complement(125398..126156) product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532563.1 transl_table 11 codon_start 1 locus_tag LOCUS_14180 CDS 126250..126663 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532564.1 transl_table 11 codon_start 1 locus_tag LOCUS_14190 CDS 126675..127025 product TIGR02301 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532565.1 transl_table 11 codon_start 1 locus_tag LOCUS_14200 CDS 127152..127901 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063171775.1 transl_table 11 codon_start 1 locus_tag LOCUS_14210 CDS complement(128124..129467) product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145923747.1 transl_table 11 codon_start 1 locus_tag LOCUS_14220 CDS 129557..130414 product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532568.1 transl_table 11 codon_start 1 locus_tag LOCUS_14230 CDS 130414..131001 product HD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532569.1 transl_table 11 codon_start 1 locus_tag LOCUS_14240 CDS 131050..131700 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14250 CDS 131812..133038 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969038.1 transl_table 11 codon_start 1 locus_tag LOCUS_14260 CDS complement(133035..133763) product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532580.1 transl_table 11 codon_start 1 locus_tag LOCUS_14270 gene recO CDS complement(133962..134873) product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013844236.1 transl_table 11 codon_start 1 locus_tag LOCUS_14280 gene era CDS complement(134870..135586) product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132075459.1 transl_table 11 codon_start 1 locus_tag LOCUS_14290 gene rnc CDS complement(135593..136336) product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532585.1 transl_table 11 codon_start 1 locus_tag LOCUS_14300 gene lepB CDS complement(136441..136842) product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532586.1 transl_table 11 codon_start 1 locus_tag LOCUS_14310 gene acpS CDS complement(136868..139069) product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532590.1 transl_table 11 codon_start 1 locus_tag LOCUS_14320 CDS complement(139211..139594) product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527295.1 transl_table 11 codon_start 1 locus_tag LOCUS_14330 gene rpoZ CDS 139917..140495 product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010915096.1 transl_table 11 codon_start 1 locus_tag LOCUS_14340 CDS 140632..141306 product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532592.1 transl_table 11 codon_start 1 locus_tag LOCUS_14350 CDS complement(141331..141801) product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532594.1 transl_table 11 codon_start 1 locus_tag LOCUS_14360 gene smpB CDS complement(141865..142746) product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532595.1 transl_table 11 codon_start 1 locus_tag LOCUS_14370 gene dapA CDS 143148..145154 product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532596.1 transl_table 11 codon_start 1 locus_tag LOCUS_14380 CDS complement(145200..145781) product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114135.1 transl_table 11 codon_start 1 locus_tag LOCUS_14390 CDS 145921..147312 product ethanolamine ammonia-lyase subunit EutB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004541772.1 transl_table 11 codon_start 1 locus_tag LOCUS_14400 CDS 147309..148106 product ethanolamine ammonia-lyase subunit EutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770129.1 transl_table 11 codon_start 1 locus_tag LOCUS_14410 gene eutC CDS complement(148117..149055) product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969012.1 transl_table 11 codon_start 1 locus_tag LOCUS_14420 CDS complement(149060..149476) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14430 CDS 149621..150451 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968957.1 transl_table 11 codon_start 1 locus_tag LOCUS_14440 CDS complement(150454..150603) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14450 CDS 150547..151269 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971622.1 transl_table 11 codon_start 1 locus_tag LOCUS_14460 CDS 151381..152310 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971621.1 transl_table 11 codon_start 1 locus_tag LOCUS_14470 CDS 152416..152901 product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037975.1 transl_table 11 codon_start 1 locus_tag LOCUS_14480 CDS complement(152967..153284) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14490 CDS 153171..153743 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14500 note possible pseudo, frameshifted CDS complement(153658..154461) product trans-aconitate methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230076.1 transl_table 11 codon_start 1 locus_tag LOCUS_14510 CDS complement(154458..155504) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168117700.1 transl_table 11 codon_start 1 locus_tag LOCUS_14520 CDS complement(155501..155902) product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031076.1 transl_table 11 codon_start 1 locus_tag LOCUS_14530 CDS complement(155912..156907) product zinc-binding alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485699.1 transl_table 11 codon_start 1 locus_tag LOCUS_14540 CDS 157071..158189 product GTP cyclohydrolase II RibA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038822.1 transl_table 11 codon_start 1 locus_tag LOCUS_14550 gene ribA CDS 158186..158971 product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031073.1 transl_table 11 codon_start 1 locus_tag LOCUS_14560 CDS 158968..159702 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14570 CDS complement(159692..160621) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14580 CDS complement(160744..160944) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14590 CDS 160876..162297 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226966.1 transl_table 11 codon_start 1 locus_tag LOCUS_14600 CDS complement(162287..163498) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531181.1 transl_table 11 codon_start 1 locus_tag LOCUS_14610 tRNA complement(163533..163623) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00240 CDS 164458..165528 product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971337.1 transl_table 11 codon_start 1 locus_tag LOCUS_14620 CDS 165699..166808 product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532603.1 transl_table 11 codon_start 1 locus_tag LOCUS_14630 CDS complement(166842..168023) product aspartate/tyrosine/aromatic aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531501.1 transl_table 11 codon_start 1 locus_tag LOCUS_14640 CDS 168213..168806 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532606.1 transl_table 11 codon_start 1 locus_tag LOCUS_14650 CDS 168788..169951 product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532607.1 transl_table 11 codon_start 1 locus_tag LOCUS_14660 CDS 170079..171698 product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532608.1 transl_table 11 codon_start 1 locus_tag LOCUS_14670 CDS 171930..173867 product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532612.1 transl_table 11 codon_start 1 locus_tag LOCUS_14680 CDS complement(173970..174230) product sel1 repeat family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532614.1 transl_table 11 codon_start 1 locus_tag LOCUS_14690 CDS 174665..175009 product DUF2147 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969008.1 transl_table 11 codon_start 1 locus_tag LOCUS_14700 CDS complement(175056..175757) product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969007.1 transl_table 11 codon_start 1 locus_tag LOCUS_14710 CDS 175961..176152 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14720 CDS 176235..177734 product AMP nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024505273.1 transl_table 11 codon_start 1 locus_tag LOCUS_14730 CDS 177915..178952 product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532618.1 transl_table 11 codon_start 1 locus_tag LOCUS_14740 CDS complement(178969..180654) product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532620.1 transl_table 11 codon_start 1 locus_tag LOCUS_14750 CDS 181008..181853 product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063171746.1 transl_table 11 codon_start 1 locus_tag LOCUS_14760 CDS complement(181887..182789) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532624.1 transl_table 11 codon_start 1 locus_tag LOCUS_14770 CDS 183044..185683 product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532626.1 transl_table 11 codon_start 1 locus_tag LOCUS_14780 gene pepN CDS 185865..188189 product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532627.1 transl_table 11 codon_start 1 locus_tag LOCUS_14790 CDS complement(188186..191116) product bifunctional [glutamine synthetase] adenylyltransferase/[glutamine synthetase]-adenylyl-L-tyrosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532629.1 transl_table 11 codon_start 1 locus_tag LOCUS_14800 CDS complement(191140..192561) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532630.1 transl_table 11 codon_start 1 locus_tag LOCUS_14810 CDS complement(192558..193235) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023812818.1 transl_table 11 codon_start 1 locus_tag LOCUS_14820 CDS complement(193377..194906) product Do family serine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532632.1 transl_table 11 codon_start 1 locus_tag LOCUS_14830 CDS complement(195013..195774) product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114411.1 transl_table 11 codon_start 1 locus_tag LOCUS_14840 gene map CDS complement(195771..195983) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14850 CDS complement(196060..196524) product cytochrome c-type biogenesis protein CcmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974838.1 transl_table 11 codon_start 1 locus_tag LOCUS_14860 CDS complement(196521..198503) product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532634.1 transl_table 11 codon_start 1 locus_tag LOCUS_14870 CDS complement(198500..198946) product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532635.1 transl_table 11 codon_start 1 locus_tag LOCUS_14880 gene ccmE CDS complement(198950..200083) product c-type cytochrome biogenesis protein CcmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532636.1 transl_table 11 codon_start 1 locus_tag LOCUS_14890 gene ccmI CDS complement(200244..200708) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532637.1 transl_table 11 codon_start 1 locus_tag LOCUS_14900 CDS complement(200794..202197) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532638.1 transl_table 11 codon_start 1 locus_tag LOCUS_14910 CDS complement(202202..202864) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532639.1 transl_table 11 codon_start 1 locus_tag LOCUS_14920 CDS complement(202879..203130) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14930 CDS complement(203221..203433) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14940 CDS complement(203452..207264) product glycoside hydrolase TIM-barrel-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971295.1 transl_table 11 codon_start 1 locus_tag LOCUS_14950 CDS complement(207294..207713) product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971294.1 transl_table 11 codon_start 1 locus_tag LOCUS_14960 CDS complement(207710..208588) product DUF2163 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971293.1 transl_table 11 codon_start 1 locus_tag LOCUS_14970 CDS complement(208585..209199) product DUF2460 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337517.1 transl_table 11 codon_start 1 locus_tag LOCUS_14980 CDS complement(209211..209753) product phage tail tape measure protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972646.1 transl_table 11 codon_start 1 locus_tag LOCUS_14990 CDS complement(209772..209933) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15000 CDS complement(209978..210388) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15010 CDS complement(210391..210804) product phage major tail protein, TP901-1 family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719628.1 transl_table 11 codon_start 1 locus_tag LOCUS_15020 CDS complement(210918..211322) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15030 CDS complement(211303..211473) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15040 CDS complement(211470..211805) product head-tail adaptor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337513.1 transl_table 11 codon_start 1 locus_tag LOCUS_15050 CDS complement(211805..212359) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15060 CDS complement(212467..213717) product phage major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971286.1 transl_table 11 codon_start 1 locus_tag LOCUS_15070 CDS complement(213698..214267) product HK97 family phage prohead protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971285.1 transl_table 11 codon_start 1 locus_tag LOCUS_15080 CDS complement(214264..214593) product DUF6107 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971284.1 transl_table 11 codon_start 1 locus_tag LOCUS_15090 CDS complement(214723..215874) product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971283.1 transl_table 11 codon_start 1 locus_tag LOCUS_15100 CDS complement(216053..217339) product terminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235776816.1 transl_table 11 codon_start 1 locus_tag LOCUS_15110 CDS complement(217452..218138) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15120 CDS 218319..219914 product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387808.1 transl_table 11 codon_start 1 locus_tag LOCUS_15130 CDS complement(219915..220556) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15140 CDS 221694..221903 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15150 CDS 222756..223070 product MazG nucleotide pyrophosphohydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969337.1 transl_table 11 codon_start 1 locus_tag LOCUS_15160 CDS complement(223281..223892) product IS5-like element ISMac15 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065538.1 transl_table 11 codon_start 1 locus_tag LOCUS_15170 note possible pseudo, internal stop codon CDS complement(224126..224650) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15180 CDS 225704..226231 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15190 assembly_gap 226812..226864 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 227800..230013 product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532650.1 transl_table 11 codon_start 1 locus_tag LOCUS_15200 CDS complement(230118..231011) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15210 CDS 231273..231857 product DUF1214 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532651.1 transl_table 11 codon_start 1 locus_tag LOCUS_15220 CDS 231854..232453 product DUF1254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532652.1 transl_table 11 codon_start 1 locus_tag LOCUS_15230 CDS complement(232465..232656) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15240 CDS 233344..234159 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15250 CDS complement(234192..234557) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15260 CDS 234579..234770 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15270 CDS complement(234822..235247) product DUF1491 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532655.1 transl_table 11 codon_start 1 locus_tag LOCUS_15280 CDS complement(235283..236209) product peptidoglycan-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532656.1 transl_table 11 codon_start 1 locus_tag LOCUS_15290 CDS complement(236184..237932) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532657.1 transl_table 11 codon_start 1 locus_tag LOCUS_15300 CDS 238261..238686 product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532659.1 transl_table 11 codon_start 1 locus_tag LOCUS_15310 CDS complement(239061..239495) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15320 CDS complement(239643..240215) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15330 CDS complement(240451..240753) product PAAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226572031.1 transl_table 11 codon_start 1 locus_tag LOCUS_15340 CDS complement(240758..242659) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15350 CDS complement(242930..243184) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15360 CDS complement(243353..243823) product Hcp family type VI secretion system effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003504561.1 transl_table 11 codon_start 1 locus_tag LOCUS_15370 CDS complement(243868..246633) product type VI secretion system ATPase TssH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973763.1 transl_table 11 codon_start 1 locus_tag LOCUS_15380 gene tssH CDS 247093..247899 product type VI secretion system protein TssA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973762.1 transl_table 11 codon_start 1 locus_tag LOCUS_15390 gene tssA CDS 247968..248483 product type VI secretion system contractile sheath small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973761.1 transl_table 11 codon_start 1 locus_tag LOCUS_15400 gene tssB CDS 248511..249989 product type VI secretion system contractile sheath large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315895.1 transl_table 11 codon_start 1 locus_tag LOCUS_15410 gene tssC CDS 250052..251440 product type VI secretion system contractile sheath large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315896.1 transl_table 11 codon_start 1 locus_tag LOCUS_15420 gene tssC CDS 251437..252237 product type VI secretion system accessory protein TagJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315897.1 transl_table 11 codon_start 1 locus_tag LOCUS_15430 CDS 252230..252739 product type VI secretion system baseplate subunit TssE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315898.1 transl_table 11 codon_start 1 locus_tag LOCUS_15440 gene tssE CDS 252732..254516 product type VI secretion system baseplate subunit TssF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973760.1 transl_table 11 codon_start 1 locus_tag LOCUS_15450 gene tssF CDS 254528..255547 product type VI secretion system baseplate subunit TssG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973759.1 transl_table 11 codon_start 1 locus_tag LOCUS_15460 gene tssG CDS 255537..256655 product type VI secretion system-associated FHA domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973758.1 transl_table 11 codon_start 1 locus_tag LOCUS_15470 CDS 256652..258007 product type VI secretion system baseplate subunit TssK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973757.1 transl_table 11 codon_start 1 locus_tag LOCUS_15480 gene tssK CDS 258004..259509 product type VI secretion system protein TssL, long form inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973756.1 transl_table 11 codon_start 1 locus_tag LOCUS_15490 gene tssL CDS 259509..263018 product type VI secretion system membrane subunit TssM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973755.1 transl_table 11 codon_start 1 locus_tag LOCUS_15500 gene tssM CDS 263033..263722 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15510 CDS 263719..264573 product protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992448.1 transl_table 11 codon_start 1 locus_tag LOCUS_15520 CDS complement(264570..265694) product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092772441.1 transl_table 11 codon_start 1 locus_tag LOCUS_15530 CDS complement(266046..268142) product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532662.1 transl_table 11 codon_start 1 locus_tag LOCUS_15540 CDS 268293..270248 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15550 CDS complement(270206..270604) product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971244.1 transl_table 11 codon_start 1 locus_tag LOCUS_15560 gene msrB CDS 271079..271516 product MucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532660.1 transl_table 11 codon_start 1 locus_tag LOCUS_15570 CDS complement(271596..272018) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15580 CDS 272276..272695 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15590 CDS 272692..273447 product DUF6456 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971251.1 transl_table 11 codon_start 1 locus_tag LOCUS_15600 CDS complement(273505..274416) product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532665.1 transl_table 11 codon_start 1 locus_tag LOCUS_15610 CDS complement(274421..274849) product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532666.1 transl_table 11 codon_start 1 locus_tag LOCUS_15620 CDS complement(275015..275617) product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532667.1 transl_table 11 codon_start 1 locus_tag LOCUS_15630 CDS complement(275747..276625) product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024505546.1 transl_table 11 codon_start 1 locus_tag LOCUS_15640 CDS 277028..277750 product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532670.1 transl_table 11 codon_start 1 locus_tag LOCUS_15650 CDS 277944..279683 product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390241.1 transl_table 11 codon_start 1 locus_tag LOCUS_15660 CDS 279680..280759 product BsuBI/PstI family type II restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390240.1 transl_table 11 codon_start 1 locus_tag LOCUS_15670 CDS 281278..281883 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15680 note possible pseudo, frameshifted CDS 281865..282452 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15690 note possible pseudo, frameshifted CDS complement(282800..284287) product DUF853 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532671.1 transl_table 11 codon_start 1 locus_tag LOCUS_15700 CDS 284510..285841 product methylmalonyl-CoA mutase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532672.1 transl_table 11 codon_start 1 locus_tag LOCUS_15710 CDS complement(285845..286849) product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532676.1 transl_table 11 codon_start 1 locus_tag LOCUS_15720 CDS complement(286969..288138) product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532677.1 transl_table 11 codon_start 1 locus_tag LOCUS_15730 CDS 288456..290171 product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061328.1 transl_table 11 codon_start 1 locus_tag LOCUS_15740 CDS 290168..290908 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15750 note possible pseudo, internal stop codon CDS 290945..291481 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15760 note possible pseudo, internal stop codon tRNA complement(291710..291786) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00250 CDS 292008..292349 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971673.1 transl_table 11 codon_start 1 locus_tag LOCUS_15770 CDS 292566..293318 product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531816.1 transl_table 11 codon_start 1 locus_tag LOCUS_15780 CDS complement(293386..294300) product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529017.1 transl_table 11 codon_start 1 locus_tag LOCUS_15790 CDS complement(294346..294579) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15800 CDS 294464..295375 product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971314.1 transl_table 11 codon_start 1 locus_tag LOCUS_15810 CDS 295520..296626 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327613.1 transl_table 11 codon_start 1 locus_tag LOCUS_15820 CDS 297404..297673 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15830 CDS 297941..298150 product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003508146.1 transl_table 11 codon_start 1 locus_tag LOCUS_15840 CDS 298320..298601 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15850 CDS 298890..299648 product LuxR family transcriptional regulator MalR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205386.1 transl_table 11 codon_start 1 locus_tag LOCUS_15860 gene malR CDS 299805..300512 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15870 CDS complement(300568..302199) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336772.1 transl_table 11 codon_start 1 locus_tag LOCUS_15880 CDS complement(302201..303340) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722143.1 transl_table 11 codon_start 1 locus_tag LOCUS_15890 CDS complement(303351..304274) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385202.1 transl_table 11 codon_start 1 locus_tag LOCUS_15900 CDS complement(304362..305957) product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336774.1 transl_table 11 codon_start 1 locus_tag LOCUS_15910 CDS complement(306247..307878) product alpha-D-glucose phosphate-specific phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532697.1 transl_table 11 codon_start 1 locus_tag LOCUS_15920 CDS 308243..309367 product DegT/DnrJ/EryC1/StrS aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532708.1 transl_table 11 codon_start 1 locus_tag LOCUS_15930 CDS complement(309368..310465) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15940 CDS 310789..311592 product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024503689.1 transl_table 11 codon_start 1 locus_tag LOCUS_15950 gene cysQ CDS complement(311677..312693) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527889.1 transl_table 11 codon_start 1 locus_tag LOCUS_15960 CDS complement(312772..314901) product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527890.1 transl_table 11 codon_start 1 locus_tag LOCUS_15970 gene pnp CDS complement(315126..315395) product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006202929.1 transl_table 11 codon_start 1 locus_tag LOCUS_15980 gene rpsO CDS 315852..316049 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15990 CDS complement(316099..316365) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16000 note possible pseudo, internal stop codon CDS 316597..317211 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390275.1 transl_table 11 codon_start 1 locus_tag LOCUS_16010 CDS complement(317268..318305) product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527892.1 transl_table 11 codon_start 1 locus_tag LOCUS_16020 gene truB CDS complement(318305..318712) product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527893.1 transl_table 11 codon_start 1 locus_tag LOCUS_16030 gene rbfA CDS complement(318928..321918) product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968445.1 transl_table 11 codon_start 1 locus_tag LOCUS_16040 gene infB CDS complement(321915..322571) product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527895.1 transl_table 11 codon_start 1 locus_tag LOCUS_16050 CDS complement(322610..324217) product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527896.1 transl_table 11 codon_start 1 locus_tag LOCUS_16060 gene nusA CDS complement(324342..324998) product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527897.1 transl_table 11 codon_start 1 locus_tag LOCUS_16070 gene rimP CDS complement(325167..325523) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16080 CDS complement(325671..326399) product tRNA (guanosine(46)-N(7))-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527899.1 transl_table 11 codon_start 1 locus_tag LOCUS_16090 sequence05 source 1..321286 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 288..1076 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16100 CDS complement(1103..1711) product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000236728.1 transl_table 11 codon_start 1 locus_tag LOCUS_16110 CDS 2019..3950 product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391403.1 transl_table 11 codon_start 1 locus_tag LOCUS_16120 CDS 4053..5372 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16130 CDS complement(5447..6772) product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728155.1 transl_table 11 codon_start 1 locus_tag LOCUS_16140 CDS 6871..7827 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16150 CDS 7868..8749 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025221252.1 transl_table 11 codon_start 1 locus_tag LOCUS_16160 CDS 8752..9702 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968134.1 transl_table 11 codon_start 1 locus_tag LOCUS_16170 CDS 9699..10475 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973712.1 transl_table 11 codon_start 1 locus_tag LOCUS_16180 CDS 10533..11714 product M20 aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197328.1 transl_table 11 codon_start 1 locus_tag LOCUS_16190 CDS complement(12077..13381) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015489.1 transl_table 11 codon_start 1 locus_tag LOCUS_16200 CDS complement(13530..13694) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16210 CDS 14084..14782 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16220 CDS 14799..16298 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039828.1 transl_table 11 codon_start 1 locus_tag LOCUS_16230 CDS 16434..17381 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811980.1 transl_table 11 codon_start 1 locus_tag LOCUS_16240 CDS 17378..18247 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992460.1 transl_table 11 codon_start 1 locus_tag LOCUS_16250 CDS 18273..20069 product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974101.1 transl_table 11 codon_start 1 locus_tag LOCUS_16260 CDS 20101..20949 product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965087.1 transl_table 11 codon_start 1 locus_tag LOCUS_16270 CDS 20976..22808 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_178372670.1 transl_table 11 codon_start 1 locus_tag LOCUS_16280 CDS 22920..24068 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529322.1 transl_table 11 codon_start 1 locus_tag LOCUS_16290 CDS 24078..24824 product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529323.1 transl_table 11 codon_start 1 locus_tag LOCUS_16300 CDS 25325..25711 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529317.1 transl_table 11 codon_start 1 locus_tag LOCUS_16310 CDS complement(25781..26752) product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529318.1 transl_table 11 codon_start 1 locus_tag LOCUS_16320 CDS complement(26919..27731) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531742.1 transl_table 11 codon_start 1 locus_tag LOCUS_16330 CDS complement(27728..29359) product benzoate-CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966695.1 transl_table 11 codon_start 1 locus_tag LOCUS_16340 CDS complement(29405..30103) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083887.1 transl_table 11 codon_start 1 locus_tag LOCUS_16350 CDS complement(30103..30858) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083886.1 transl_table 11 codon_start 1 locus_tag LOCUS_16360 CDS complement(30851..31849) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083885.1 transl_table 11 codon_start 1 locus_tag LOCUS_16370 CDS complement(31846..32772) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083884.1 transl_table 11 codon_start 1 locus_tag LOCUS_16380 CDS complement(32892..34061) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966696.1 transl_table 11 codon_start 1 locus_tag LOCUS_16390 CDS complement(34197..34643) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088820.1 transl_table 11 codon_start 1 locus_tag LOCUS_16400 CDS complement(34702..35979) product flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088821.1 transl_table 11 codon_start 1 locus_tag LOCUS_16410 CDS 36358..37335 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16420 CDS 37461..39452 product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041170064.1 transl_table 11 codon_start 1 locus_tag LOCUS_16430 CDS 39614..40756 product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000765133.1 transl_table 11 codon_start 1 locus_tag LOCUS_16440 CDS 40753..43824 product SMC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001247622.1 transl_table 11 codon_start 1 locus_tag LOCUS_16450 CDS complement(43898..44701) product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091793.1 transl_table 11 codon_start 1 locus_tag LOCUS_16460 gene phnE CDS complement(44704..45498) product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727093.1 transl_table 11 codon_start 1 locus_tag LOCUS_16470 gene phnC CDS complement(45574..46464) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16480 CDS 46779..47576 product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241359.1 transl_table 11 codon_start 1 locus_tag LOCUS_16490 CDS 47966..49357 product phosphomannomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022277.1 transl_table 11 codon_start 1 locus_tag LOCUS_16500 CDS complement(49367..50050) product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813962.1 transl_table 11 codon_start 1 locus_tag LOCUS_16510 CDS 50111..50533 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175078.1 transl_table 11 codon_start 1 locus_tag LOCUS_16520 CDS 50555..51022 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031562.1 transl_table 11 codon_start 1 locus_tag LOCUS_16530 CDS 51202..51783 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16540 CDS complement(51846..52994) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973788.1 transl_table 11 codon_start 1 locus_tag LOCUS_16550 CDS complement(52991..54046) product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973787.1 transl_table 11 codon_start 1 locus_tag LOCUS_16560 CDS complement(54122..55168) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973786.1 transl_table 11 codon_start 1 locus_tag LOCUS_16570 CDS complement(55176..56159) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315533.1 transl_table 11 codon_start 1 locus_tag LOCUS_16580 CDS complement(56161..57096) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315532.1 transl_table 11 codon_start 1 locus_tag LOCUS_16590 CDS complement(57093..58589) product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973785.1 transl_table 11 codon_start 1 locus_tag LOCUS_16600 CDS complement(58722..59741) product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973784.1 transl_table 11 codon_start 1 locus_tag LOCUS_16610 CDS 59939..60823 product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067045.1 transl_table 11 codon_start 1 locus_tag LOCUS_16620 gene purU CDS 61564..61977 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16630 CDS 62015..62476 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16640 CDS complement(63254..64984) product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973925.1 transl_table 11 codon_start 1 locus_tag LOCUS_16650 CDS complement(64981..65820) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973926.1 transl_table 11 codon_start 1 locus_tag LOCUS_16660 CDS complement(65826..66704) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006316568.1 transl_table 11 codon_start 1 locus_tag LOCUS_16670 CDS complement(66858..68390) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973928.1 transl_table 11 codon_start 1 locus_tag LOCUS_16680 CDS complement(68428..70260) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973929.1 transl_table 11 codon_start 1 locus_tag LOCUS_16690 CDS complement(70271..70846) product winged helix DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395860.1 transl_table 11 codon_start 1 locus_tag LOCUS_16700 CDS 70939..74583 product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974950.1 transl_table 11 codon_start 1 locus_tag LOCUS_16710 CDS complement(74646..75317) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16720 CDS complement(75493..76446) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067691.1 transl_table 11 codon_start 1 locus_tag LOCUS_16730 CDS complement(76480..76893) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313628.1 transl_table 11 codon_start 1 locus_tag LOCUS_16740 CDS complement(76985..77167) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16750 CDS 77444..78313 product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973269.1 transl_table 11 codon_start 1 locus_tag LOCUS_16760 CDS complement(78332..78718) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16770 CDS 78907..81231 product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391213.1 transl_table 11 codon_start 1 locus_tag LOCUS_16780 CDS 81288..81707 product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971196.1 transl_table 11 codon_start 1 locus_tag LOCUS_16790 CDS complement(81712..82068) product DUF779 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532871.1 transl_table 11 codon_start 1 locus_tag LOCUS_16800 CDS complement(82311..83828) product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087552.1 transl_table 11 codon_start 1 locus_tag LOCUS_16810 CDS complement(83958..84923) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165113428.1 transl_table 11 codon_start 1 locus_tag LOCUS_16820 CDS complement(85174..85398) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16830 CDS 85310..86605 product metabolite/H+ symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529121.1 transl_table 11 codon_start 1 locus_tag LOCUS_16840 CDS complement(86682..88703) product YbaL family putative K(+) efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529559.1 transl_table 11 codon_start 1 locus_tag LOCUS_16850 gene ybaL CDS 88862..89080 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265969.1 transl_table 11 codon_start 1 locus_tag LOCUS_16860 CDS complement(89077..90213) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528655.1 transl_table 11 codon_start 1 locus_tag LOCUS_16870 CDS complement(90210..91130) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528656.1 transl_table 11 codon_start 1 locus_tag LOCUS_16880 CDS complement(91127..92077) product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528657.1 transl_table 11 codon_start 1 locus_tag LOCUS_16890 CDS complement(92074..92739) product CerR family C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528658.1 transl_table 11 codon_start 1 locus_tag LOCUS_16900 CDS complement(92839..94854) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16910 CDS complement(95033..95413) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16920 CDS complement(95456..96295) product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328087.1 transl_table 11 codon_start 1 locus_tag LOCUS_16930 gene fghA CDS complement(96313..96981) product DUF1345 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531945.1 transl_table 11 codon_start 1 locus_tag LOCUS_16940 CDS complement(96978..97445) product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315321.1 transl_table 11 codon_start 1 locus_tag LOCUS_16950 CDS complement(97535..98662) product S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105384665.1 transl_table 11 codon_start 1 locus_tag LOCUS_16960 CDS complement(99198..99350) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16970 CDS 99537..101738 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16980 CDS complement(101806..103341) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16990 CDS complement(103582..104703) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398410.1 transl_table 11 codon_start 1 locus_tag LOCUS_17000 CDS complement(104805..105731) product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310651.1 transl_table 11 codon_start 1 locus_tag LOCUS_17010 CDS complement(105737..106423) product D-lyxose/D-mannose family sugar isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532294.1 transl_table 11 codon_start 1 locus_tag LOCUS_17020 CDS complement(106420..107379) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17030 CDS complement(107383..108495) product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535873.1 transl_table 11 codon_start 1 locus_tag LOCUS_17040 gene ugpC CDS complement(108499..109380) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067373.1 transl_table 11 codon_start 1 locus_tag LOCUS_17050 CDS complement(109377..110255) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064251868.1 transl_table 11 codon_start 1 locus_tag LOCUS_17060 CDS complement(110411..111670) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173508652.1 transl_table 11 codon_start 1 locus_tag LOCUS_17070 CDS 111886..112902 product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398617.1 transl_table 11 codon_start 1 locus_tag LOCUS_17080 CDS complement(112893..113798) product hydrogen peroxide-inducible genes activator OxyR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527206.1 transl_table 11 codon_start 1 locus_tag LOCUS_17090 gene oxyR CDS 113932..115437 product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968798.1 transl_table 11 codon_start 1 locus_tag LOCUS_17100 gene katA assembly_gap 115477..115534 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 115606..116889 product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530369.1 transl_table 11 codon_start 1 locus_tag LOCUS_17110 CDS 116946..117398 product tryptophan-rich sensory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085262.1 transl_table 11 codon_start 1 locus_tag LOCUS_17120 CDS 117477..117941 product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530371.1 transl_table 11 codon_start 1 locus_tag LOCUS_17130 CDS 117938..118600 product 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397352.1 transl_table 11 codon_start 1 locus_tag LOCUS_17140 CDS 118670..120232 product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397349.1 transl_table 11 codon_start 1 locus_tag LOCUS_17150 gene guaA CDS 120526..121782 product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530374.1 transl_table 11 codon_start 1 locus_tag LOCUS_17160 CDS complement(121754..122032) product AlpA family phage regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970615.1 transl_table 11 codon_start 1 locus_tag LOCUS_17170 CDS complement(122172..122339) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17180 CDS 122296..123255 product zincin-like metallopeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368621.1 transl_table 11 codon_start 1 locus_tag LOCUS_17190 CDS 123252..123656 product DUF2958 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368622.1 transl_table 11 codon_start 1 locus_tag LOCUS_17200 CDS 123781..125907 product ParB N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368623.1 transl_table 11 codon_start 1 locus_tag LOCUS_17210 CDS 126332..126496 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368625.1 transl_table 11 codon_start 1 locus_tag LOCUS_17220 CDS 126691..127239 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368626.1 transl_table 11 codon_start 1 locus_tag LOCUS_17230 CDS 127304..127720 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368627.1 transl_table 11 codon_start 1 locus_tag LOCUS_17240 CDS 127713..128357 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368628.1 transl_table 11 codon_start 1 locus_tag LOCUS_17250 CDS 128508..132827 product strawberry notch family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368629.1 transl_table 11 codon_start 1 locus_tag LOCUS_17260 CDS 132827..133864 product toprim domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368630.1 transl_table 11 codon_start 1 locus_tag LOCUS_17270 CDS 134207..135133 product DUF2493 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538225.1 transl_table 11 codon_start 1 locus_tag LOCUS_17280 CDS 135400..135840 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368632.1 transl_table 11 codon_start 1 locus_tag LOCUS_17290 CDS 136438..136764 product DUF736 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368635.1 transl_table 11 codon_start 1 locus_tag LOCUS_17300 CDS complement(136830..138071) product HipA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970614.1 transl_table 11 codon_start 1 locus_tag LOCUS_17310 CDS complement(138064..138369) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970613.1 transl_table 11 codon_start 1 locus_tag LOCUS_17320 CDS 138677..138925 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387924.1 transl_table 11 codon_start 1 locus_tag LOCUS_17330 CDS 139043..139303 product DUF2285 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084140443.1 transl_table 11 codon_start 1 locus_tag LOCUS_17340 CDS 139480..139755 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17350 CDS 139802..140245 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17360 note possible pseudo, frameshifted CDS 140381..140662 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036743091.1 transl_table 11 codon_start 1 locus_tag LOCUS_17370 CDS 140683..141831 product replication initiator protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014490269.1 transl_table 11 codon_start 1 locus_tag LOCUS_17380 CDS 141828..142481 product ParA family partition ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368641.1 transl_table 11 codon_start 1 locus_tag LOCUS_17390 gene parA CDS 142478..142732 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082881.1 transl_table 11 codon_start 1 locus_tag LOCUS_17400 CDS 142729..143250 product DUF2840 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082880.1 transl_table 11 codon_start 1 locus_tag LOCUS_17410 CDS 143247..143792 product S26 family signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368397.1 transl_table 11 codon_start 1 locus_tag LOCUS_17420 CDS 143859..144197 product DUF736 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082878.1 transl_table 11 codon_start 1 locus_tag LOCUS_17430 CDS 144201..144977 product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368399.1 transl_table 11 codon_start 1 locus_tag LOCUS_17440 CDS 145221..146960 product VirD2 family relaxase/mobilization nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018269524.1 transl_table 11 codon_start 1 locus_tag LOCUS_17450 CDS 146984..148966 product conjugal transfer protein TraG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018269525.1 transl_table 11 codon_start 1 locus_tag LOCUS_17460 CDS 148972..149403 product ribbon-helix-helix protein, CopG family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082874.1 transl_table 11 codon_start 1 locus_tag LOCUS_17470 CDS 149809..150249 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769271.1 transl_table 11 codon_start 1 locus_tag LOCUS_17480 CDS 150268..151002 product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533148.1 transl_table 11 codon_start 1 locus_tag LOCUS_17490 CDS 151097..152572 product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803913.1 transl_table 11 codon_start 1 locus_tag LOCUS_17500 CDS 152603..153172 product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409718.1 transl_table 11 codon_start 1 locus_tag LOCUS_17510 CDS 153169..154485 product NtaA/DmoA family FMN-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084416.1 transl_table 11 codon_start 1 locus_tag LOCUS_17520 CDS 154955..156403 product tannase/feruloyl esterase family alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229234.1 transl_table 11 codon_start 1 locus_tag LOCUS_17530 CDS 156874..157878 product P-type conjugative transfer ATPase TrbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368408.1 transl_table 11 codon_start 1 locus_tag LOCUS_17540 gene trbB CDS 157875..158207 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17550 CDS 158207..158488 product VirB3 family type IV secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368410.1 transl_table 11 codon_start 1 locus_tag LOCUS_17560 CDS 158498..160990 product conjugal transfer protein TrbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368411.1 transl_table 11 codon_start 1 locus_tag LOCUS_17570 gene trbE CDS 160987..161769 product P-type conjugative transfer protein TrbJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538236.1 transl_table 11 codon_start 1 locus_tag LOCUS_17580 gene trbJ CDS 161790..162074 product putative entry exclusion protein TrbK-alt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368413.1 transl_table 11 codon_start 1 locus_tag LOCUS_17590 gene trbK-alt CDS 162081..163445 product P-type conjugative transfer protein TrbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368414.1 transl_table 11 codon_start 1 locus_tag LOCUS_17600 gene trbL CDS 163442..164131 product conjugal transfer protein TrbF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368415.1 transl_table 11 codon_start 1 locus_tag LOCUS_17610 gene trbF CDS 164128..165144 product P-type conjugative transfer protein TrbG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368416.1 transl_table 11 codon_start 1 locus_tag LOCUS_17620 gene trbG CDS 165141..166280 product TrbI/VirB10 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368417.1 transl_table 11 codon_start 1 locus_tag LOCUS_17630 CDS 166283..166513 product DUF2274 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368418.1 transl_table 11 codon_start 1 locus_tag LOCUS_17640 CDS 166642..167511 product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044008000.1 transl_table 11 codon_start 1 locus_tag LOCUS_17650 CDS 167495..170767 product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000401853.1 transl_table 11 codon_start 1 locus_tag LOCUS_17660 CDS 170764..171513 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17670 CDS 171524..173539 product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197693007.1 transl_table 11 codon_start 1 locus_tag LOCUS_17680 CDS 173625..176642 product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001239259.1 transl_table 11 codon_start 1 locus_tag LOCUS_17690 CDS 176697..178490 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17700 CDS complement(178530..179201) product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065267398.1 transl_table 11 codon_start 1 locus_tag LOCUS_17710 CDS complement(179222..180205) product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970313.1 transl_table 11 codon_start 1 locus_tag LOCUS_17720 CDS 180324..183617 product TM0106 family RecB-like putative nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063831.1 transl_table 11 codon_start 1 locus_tag LOCUS_17730 CDS 183618..186848 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17740 CDS 186848..188164 product IQ calmodulin-binding- domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368619.1 transl_table 11 codon_start 1 locus_tag LOCUS_17750 CDS 188316..189344 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17760 CDS 189367..189864 product TIR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970310.1 transl_table 11 codon_start 1 locus_tag LOCUS_17770 CDS 189861..190736 product DUF4231 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030354.1 transl_table 11 codon_start 1 locus_tag LOCUS_17780 CDS complement(191072..192001) product plasmid partitioning protein RepB C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066867990.1 transl_table 11 codon_start 1 locus_tag LOCUS_17790 CDS complement(191994..192893) product plasmid partitioning protein RepB C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338947.1 transl_table 11 codon_start 1 locus_tag LOCUS_17800 CDS complement(192893..194461) product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338946.1 transl_table 11 codon_start 1 locus_tag LOCUS_17810 CDS 194580..195221 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17820 CDS 195364..196278 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035257737.1 transl_table 11 codon_start 1 locus_tag LOCUS_17830 CDS 196477..197220 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973973.1 transl_table 11 codon_start 1 locus_tag LOCUS_17840 CDS complement(197480..199783) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17850 CDS 199805..200161 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17860 CDS complement(200398..200598) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17870 CDS complement(200606..200803) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17880 CDS complement(200829..201629) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17890 CDS complement(201797..202720) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17900 CDS complement(202802..203716) product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144321.1 transl_table 11 codon_start 1 locus_tag LOCUS_17910 CDS complement(203716..204564) product type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_210326921.1 transl_table 11 codon_start 1 locus_tag LOCUS_17920 CDS 205055..205405 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17930 CDS complement(205730..206434) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17940 CDS complement(206517..207350) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894745.1 transl_table 11 codon_start 1 locus_tag LOCUS_17950 CDS complement(207354..208199) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975126.1 transl_table 11 codon_start 1 locus_tag LOCUS_17960 CDS complement(208201..209115) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356840.1 transl_table 11 codon_start 1 locus_tag LOCUS_17970 CDS complement(209163..210467) product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973776.1 transl_table 11 codon_start 1 locus_tag LOCUS_17980 CDS complement(210517..211599) product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087328.1 transl_table 11 codon_start 1 locus_tag LOCUS_17990 gene ugpC CDS 211915..212691 product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086104.1 transl_table 11 codon_start 1 locus_tag LOCUS_18000 CDS 212695..213831 product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086105.1 transl_table 11 codon_start 1 locus_tag LOCUS_18010 CDS 213874..214752 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966017.1 transl_table 11 codon_start 1 locus_tag LOCUS_18020 CDS 214757..216010 product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086107.1 transl_table 11 codon_start 1 locus_tag LOCUS_18030 CDS 216010..216939 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022102.1 transl_table 11 codon_start 1 locus_tag LOCUS_18040 CDS 216939..217877 product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385089.1 transl_table 11 codon_start 1 locus_tag LOCUS_18050 CDS 218225..219154 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086102.1 transl_table 11 codon_start 1 locus_tag LOCUS_18060 CDS 219174..219953 product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921438.1 transl_table 11 codon_start 1 locus_tag LOCUS_18070 CDS 220001..221026 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086100.1 transl_table 11 codon_start 1 locus_tag LOCUS_18080 CDS 221023..221820 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086099.1 transl_table 11 codon_start 1 locus_tag LOCUS_18090 CDS 221817..222578 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086098.1 transl_table 11 codon_start 1 locus_tag LOCUS_18100 CDS 222586..223881 product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086097.1 transl_table 11 codon_start 1 locus_tag LOCUS_18110 CDS 223893..224393 product pyrimidine utilization flavin reductase protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001028083.1 transl_table 11 codon_start 1 locus_tag LOCUS_18120 gene rutF CDS complement(225106..226458) product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813002.1 transl_table 11 codon_start 1 locus_tag LOCUS_18130 CDS complement(226988..228037) product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164747183.1 transl_table 11 codon_start 1 locus_tag LOCUS_18140 gene arsB CDS complement(228045..228470) product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969944.1 transl_table 11 codon_start 1 locus_tag LOCUS_18150 gene arsC CDS complement(228540..228905) product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398909.1 transl_table 11 codon_start 1 locus_tag LOCUS_18160 CDS complement(229004..229546) product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975352.1 transl_table 11 codon_start 1 locus_tag LOCUS_18170 CDS complement(229634..230470) product ammonia-dependent NAD(+) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525360.1 transl_table 11 codon_start 1 locus_tag LOCUS_18180 gene nadE CDS 230497..230739 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18190 CDS 230872..231174 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18200 CDS 231277..231624 product ArsC family reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098619.1 transl_table 11 codon_start 1 locus_tag LOCUS_18210 CDS 231627..232802 product YbfB/YjiJ family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532852.1 transl_table 11 codon_start 1 locus_tag LOCUS_18220 CDS complement(232803..233747) product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532850.1 transl_table 11 codon_start 1 locus_tag LOCUS_18230 CDS 234026..234691 product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532849.1 transl_table 11 codon_start 1 locus_tag LOCUS_18240 CDS 234692..236122 product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532848.1 transl_table 11 codon_start 1 locus_tag LOCUS_18250 gene der CDS 236122..236622 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18260 CDS 236827..237996 product cell wall hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532845.1 transl_table 11 codon_start 1 locus_tag LOCUS_18270 CDS 238249..238650 product AtpZ/AtpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532844.1 transl_table 11 codon_start 1 locus_tag LOCUS_18280 CDS 238685..239434 product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252120.1 transl_table 11 codon_start 1 locus_tag LOCUS_18290 CDS 239552..239776 product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533642.1 transl_table 11 codon_start 1 locus_tag LOCUS_18300 CDS 239857..240462 product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532842.1 transl_table 11 codon_start 1 locus_tag LOCUS_18310 CDS 240475..240954 product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327528.1 transl_table 11 codon_start 1 locus_tag LOCUS_18320 CDS 241169..241510 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18330 CDS 241558..241992 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18340 CDS complement(242051..242548) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18350 CDS complement(242945..243598) product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532840.1 transl_table 11 codon_start 1 locus_tag LOCUS_18360 CDS complement(243773..244927) product PA0069 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023808673.1 transl_table 11 codon_start 1 locus_tag LOCUS_18370 CDS 245039..245578 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974656.1 transl_table 11 codon_start 1 locus_tag LOCUS_18380 CDS complement(245575..246111) product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965931.1 transl_table 11 codon_start 1 locus_tag LOCUS_18390 gene moaB CDS complement(246115..246984) product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532835.1 transl_table 11 codon_start 1 locus_tag LOCUS_18400 CDS complement(246984..247169) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532834.1 transl_table 11 codon_start 1 locus_tag LOCUS_18410 CDS complement(247255..248100) product S49 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532833.1 transl_table 11 codon_start 1 locus_tag LOCUS_18420 CDS complement(248180..248965) product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532832.1 transl_table 11 codon_start 1 locus_tag LOCUS_18430 CDS complement(248962..249195) product DUF2007 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532831.1 transl_table 11 codon_start 1 locus_tag LOCUS_18440 CDS 249370..250386 product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532830.1 transl_table 11 codon_start 1 locus_tag LOCUS_18450 CDS 250518..252527 product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532826.1 transl_table 11 codon_start 1 locus_tag LOCUS_18460 CDS 252681..253628 product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173992601.1 transl_table 11 codon_start 1 locus_tag LOCUS_18470 CDS 253628..255805 product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532823.1 transl_table 11 codon_start 1 locus_tag LOCUS_18480 gene glyS CDS complement(255879..256412) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18490 CDS 256562..257521 product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063171643.1 transl_table 11 codon_start 1 locus_tag LOCUS_18500 CDS 257543..258952 product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532818.1 transl_table 11 codon_start 1 locus_tag LOCUS_18510 CDS 259235..259801 product DUF6101 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532817.1 transl_table 11 codon_start 1 locus_tag LOCUS_18520 CDS complement(259817..260803) product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173619.1 transl_table 11 codon_start 1 locus_tag LOCUS_18530 gene ubiA CDS 260949..262223 product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532813.1 transl_table 11 codon_start 1 locus_tag LOCUS_18540 gene purD CDS complement(262272..263219) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18550 CDS 263492..265270 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532808.1 transl_table 11 codon_start 1 locus_tag LOCUS_18560 CDS 265275..266027 product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532807.1 transl_table 11 codon_start 1 locus_tag LOCUS_18570 CDS complement(266034..266963) product glutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531363.1 transl_table 11 codon_start 1 locus_tag LOCUS_18580 CDS complement(266984..267616) product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532806.1 transl_table 11 codon_start 1 locus_tag LOCUS_18590 gene pdxH CDS 267771..268127 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18600 CDS 268213..269166 product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532804.1 transl_table 11 codon_start 1 locus_tag LOCUS_18610 CDS 269359..270177 product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532803.1 transl_table 11 codon_start 1 locus_tag LOCUS_18620 gene fabI CDS 270250..270840 product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532802.1 transl_table 11 codon_start 1 locus_tag LOCUS_18630 CDS complement(270855..271121) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18640 CDS 271351..272451 product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532800.1 transl_table 11 codon_start 1 locus_tag LOCUS_18650 gene aroC CDS 272482..273582 product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532799.1 transl_table 11 codon_start 1 locus_tag LOCUS_18660 gene ribB CDS 273607..274539 product histone deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532793.1 transl_table 11 codon_start 1 locus_tag LOCUS_18670 CDS 274543..274794 product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532792.1 transl_table 11 codon_start 1 locus_tag LOCUS_18680 CDS 274928..275686 product TlyA family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327569.1 transl_table 11 codon_start 1 locus_tag LOCUS_18690 CDS 275766..277013 product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532784.1 transl_table 11 codon_start 1 locus_tag LOCUS_18700 CDS complement(277243..277947) product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391392.1 transl_table 11 codon_start 1 locus_tag LOCUS_18710 gene cobB CDS complement(278009..279421) product metalloprotease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532782.1 transl_table 11 codon_start 1 locus_tag LOCUS_18720 gene tldD CDS complement(279512..280033) product invasion associated locus B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532781.1 transl_table 11 codon_start 1 locus_tag LOCUS_18730 CDS 280431..281315 product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974720.1 transl_table 11 codon_start 1 locus_tag LOCUS_18740 gene coxB CDS 281352..282995 product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971136.1 transl_table 11 codon_start 1 locus_tag LOCUS_18750 gene ctaD CDS 283084..284019 product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532778.1 transl_table 11 codon_start 1 locus_tag LOCUS_18760 CDS 284024..284191 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18770 CDS 284289..284909 product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532776.1 transl_table 11 codon_start 1 locus_tag LOCUS_18780 CDS 284902..285786 product cytochrome c oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974725.1 transl_table 11 codon_start 1 locus_tag LOCUS_18790 CDS 285868..286632 product SURF1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392596.1 transl_table 11 codon_start 1 locus_tag LOCUS_18800 CDS 286734..287768 product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532771.1 transl_table 11 codon_start 1 locus_tag LOCUS_18810 gene ispH CDS 287768..288757 product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532770.1 transl_table 11 codon_start 1 locus_tag LOCUS_18820 CDS 288754..289197 product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968914.1 transl_table 11 codon_start 1 locus_tag LOCUS_18830 gene rnhA CDS complement(289231..289716) product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532767.1 transl_table 11 codon_start 1 locus_tag LOCUS_18840 CDS complement(289756..290571) product protein-disulfide reductase DsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532766.1 transl_table 11 codon_start 1 locus_tag LOCUS_18850 CDS 290730..291317 product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532765.1 transl_table 11 codon_start 1 locus_tag LOCUS_18860 CDS complement(291346..294249) product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532764.1 transl_table 11 codon_start 1 locus_tag LOCUS_18870 CDS complement(294251..294847) product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532763.1 transl_table 11 codon_start 1 locus_tag LOCUS_18880 CDS complement(294963..296255) product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532762.1 transl_table 11 codon_start 1 locus_tag LOCUS_18890 CDS complement(296270..297532) product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532761.1 transl_table 11 codon_start 1 locus_tag LOCUS_18900 gene thrC CDS 297413..297715 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18910 CDS 297892..298479 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532760.1 transl_table 11 codon_start 1 locus_tag LOCUS_18920 CDS complement(298522..299712) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383177.1 transl_table 11 codon_start 1 locus_tag LOCUS_18930 CDS complement(299846..300529) product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532759.1 transl_table 11 codon_start 1 locus_tag LOCUS_18940 CDS 300736..301869 product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532758.1 transl_table 11 codon_start 1 locus_tag LOCUS_18950 CDS complement(302049..302657) product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974744.1 transl_table 11 codon_start 1 locus_tag LOCUS_18960 CDS complement(302654..303772) product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968924.1 transl_table 11 codon_start 1 locus_tag LOCUS_18970 gene mutY CDS 303821..304324 product DUF721 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532755.1 transl_table 11 codon_start 1 locus_tag LOCUS_18980 CDS 304494..305186 product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532754.1 transl_table 11 codon_start 1 locus_tag LOCUS_18990 CDS 305250..308708 product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532753.1 transl_table 11 codon_start 1 locus_tag LOCUS_19000 gene smc CDS 308716..309417 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206998.1 transl_table 11 codon_start 1 locus_tag LOCUS_19010 CDS 309441..309956 product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001518898.1 transl_table 11 codon_start 1 locus_tag LOCUS_19020 CDS 310121..310366 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19030 CDS complement(310539..311492) product aliphatic sulfonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103995.1 transl_table 11 codon_start 1 locus_tag LOCUS_19040 CDS complement(311513..312235) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767689.1 transl_table 11 codon_start 1 locus_tag LOCUS_19050 CDS complement(312232..313071) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767688.1 transl_table 11 codon_start 1 locus_tag LOCUS_19060 CDS 313370..314473 product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921653.1 transl_table 11 codon_start 1 locus_tag LOCUS_19070 CDS 314531..314914 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19080 note possible pseudo, frameshifted tRNA complement(315130..315204) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00260 CDS 315636..318314 product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532744.1 transl_table 11 codon_start 1 locus_tag LOCUS_19090 gene ppdK CDS 318600..320018 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039281.1 transl_table 11 codon_start 1 locus_tag LOCUS_19100 CDS 320151..321149 product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528052.1 transl_table 11 codon_start 1 locus_tag LOCUS_19110 sequence06 source 1..303152 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1345..1968) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339004.1 transl_table 11 codon_start 1 locus_tag LOCUS_19120 CDS complement(2033..2974) product ring-cleaving dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339003.1 transl_table 11 codon_start 1 locus_tag LOCUS_19130 CDS 3083..3991 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339002.1 transl_table 11 codon_start 1 locus_tag LOCUS_19140 CDS 4024..4854 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037400622.1 transl_table 11 codon_start 1 locus_tag LOCUS_19150 CDS complement(4991..5200) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19160 CDS 5090..6322 product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969758.1 transl_table 11 codon_start 1 locus_tag LOCUS_19170 CDS complement(6309..6860) product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978539.1 transl_table 11 codon_start 1 locus_tag LOCUS_19180 CDS complement(6857..7792) product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974720.1 transl_table 11 codon_start 1 locus_tag LOCUS_19190 CDS complement(7789..9960) product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339126.1 transl_table 11 codon_start 1 locus_tag LOCUS_19200 CDS complement(9957..10925) product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339125.1 transl_table 11 codon_start 1 locus_tag LOCUS_19210 CDS complement(10922..11446) product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151613181.1 transl_table 11 codon_start 1 locus_tag LOCUS_19220 CDS 11779..12627 product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972968.1 transl_table 11 codon_start 1 locus_tag LOCUS_19230 CDS 12707..13450 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035257378.1 transl_table 11 codon_start 1 locus_tag LOCUS_19240 CDS 13447..14232 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972970.1 transl_table 11 codon_start 1 locus_tag LOCUS_19250 CDS 14248..15042 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972971.1 transl_table 11 codon_start 1 locus_tag LOCUS_19260 CDS 15114..16376 product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972972.1 transl_table 11 codon_start 1 locus_tag LOCUS_19270 CDS 16398..17699 product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972973.1 transl_table 11 codon_start 1 locus_tag LOCUS_19280 CDS 18223..19479 product Hsp70 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533665.1 transl_table 11 codon_start 1 locus_tag LOCUS_19290 CDS 19673..19819 product DUF1127 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531315.1 transl_table 11 codon_start 1 locus_tag LOCUS_19300 CDS 20279..21094 product DUF3100 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439094.1 transl_table 11 codon_start 1 locus_tag LOCUS_19310 CDS 21108..21626 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029492212.1 transl_table 11 codon_start 1 locus_tag LOCUS_19320 CDS 21690..22847 product M20 aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390621.1 transl_table 11 codon_start 1 locus_tag LOCUS_19330 CDS 22901..23809 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064573.1 transl_table 11 codon_start 1 locus_tag LOCUS_19340 CDS 23923..24804 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767820.1 transl_table 11 codon_start 1 locus_tag LOCUS_19350 CDS 24816..26354 product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268490.1 transl_table 11 codon_start 1 locus_tag LOCUS_19360 CDS complement(26411..27313) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002228687.1 transl_table 11 codon_start 1 locus_tag LOCUS_19370 CDS complement(27396..28154) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973056.1 transl_table 11 codon_start 1 locus_tag LOCUS_19380 CDS complement(28151..29005) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973057.1 transl_table 11 codon_start 1 locus_tag LOCUS_19390 CDS complement(29010..29894) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315060.1 transl_table 11 codon_start 1 locus_tag LOCUS_19400 CDS complement(29894..30979) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315059.1 transl_table 11 codon_start 1 locus_tag LOCUS_19410 CDS complement(31058..31411) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19420 CDS complement(31526..32680) product mandelate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973053.1 transl_table 11 codon_start 1 locus_tag LOCUS_19430 CDS complement(32752..33615) product D-galactarolactone isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972788.1 transl_table 11 codon_start 1 locus_tag LOCUS_19440 CDS complement(33612..34748) product D-galactarolactone cycloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972789.1 transl_table 11 codon_start 1 locus_tag LOCUS_19450 CDS complement(34749..35672) product 5-dehydro-4-deoxyglucarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972790.1 transl_table 11 codon_start 1 locus_tag LOCUS_19460 gene kdgD CDS complement(35743..36474) product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972794.1 transl_table 11 codon_start 1 locus_tag LOCUS_19470 CDS 36632..37429 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972793.1 transl_table 11 codon_start 1 locus_tag LOCUS_19480 CDS 37432..38946 product aldehyde dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969503.1 transl_table 11 codon_start 1 locus_tag LOCUS_19490 CDS complement(39055..40665) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973055.1 transl_table 11 codon_start 1 locus_tag LOCUS_19500 CDS complement(40756..41391) product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973054.1 transl_table 11 codon_start 1 locus_tag LOCUS_19510 CDS 42255..43034 product DUF2243 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525039.1 transl_table 11 codon_start 1 locus_tag LOCUS_19520 CDS complement(43057..43362) product alkylphosphonate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974886.1 transl_table 11 codon_start 1 locus_tag LOCUS_19530 CDS complement(43482..44465) product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186471.1 transl_table 11 codon_start 1 locus_tag LOCUS_19540 CDS complement(44572..45465) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086730.1 transl_table 11 codon_start 1 locus_tag LOCUS_19550 CDS complement(45527..45994) product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974137.1 transl_table 11 codon_start 1 locus_tag LOCUS_19560 CDS 46115..47593 product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974136.1 transl_table 11 codon_start 1 locus_tag LOCUS_19570 CDS 47605..49008 product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974135.1 transl_table 11 codon_start 1 locus_tag LOCUS_19580 CDS 49186..50634 product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974134.1 transl_table 11 codon_start 1 locus_tag LOCUS_19590 CDS 50749..51720 product hydroxyectoine utilization dehydratase EutB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992461.1 transl_table 11 codon_start 1 locus_tag LOCUS_19600 gene eutB CDS 51717..52730 product ectoine utilization protein EutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974132.1 transl_table 11 codon_start 1 locus_tag LOCUS_19610 gene eutC CDS 52727..53905 product ectoine hydrolase DoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974131.1 transl_table 11 codon_start 1 locus_tag LOCUS_19620 gene doeA CDS 53911..54924 product N(2)-acetyl-L-2,4-diaminobutanoate deacetylase DoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974130.1 transl_table 11 codon_start 1 locus_tag LOCUS_19630 gene doeB CDS 54989..55840 product ectoine/hydroxyectoine ABC transporter substrate-binding protein EhuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974129.1 transl_table 11 codon_start 1 locus_tag LOCUS_19640 gene ehuB CDS 55898..56563 product ectoine/hydroxyectoine ABC transporter permease subunit EhuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974128.1 transl_table 11 codon_start 1 locus_tag LOCUS_19650 gene ehuC CDS 56575..57267 product ectoine/hydroxyectoine ABC transporter permease subunit EhuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974127.1 transl_table 11 codon_start 1 locus_tag LOCUS_19660 gene ehuD CDS 57264..58043 product ectoine/hydroxyectoine ABC transporter ATP-binding protein EhuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311385.1 transl_table 11 codon_start 1 locus_tag LOCUS_19670 gene ehuA CDS complement(58436..59608) product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086213.1 transl_table 11 codon_start 1 locus_tag LOCUS_19680 CDS complement(59613..60959) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703351.1 transl_table 11 codon_start 1 locus_tag LOCUS_19690 CDS complement(61010..62638) product ATP-dependent acyl-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086217.1 transl_table 11 codon_start 1 locus_tag LOCUS_19700 CDS 62820..63734 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550801.1 transl_table 11 codon_start 1 locus_tag LOCUS_19710 CDS 63909..64697 product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527969.1 transl_table 11 codon_start 1 locus_tag LOCUS_19720 CDS 64765..66354 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527968.1 transl_table 11 codon_start 1 locus_tag LOCUS_19730 CDS 66373..66882 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527967.1 transl_table 11 codon_start 1 locus_tag LOCUS_19740 CDS complement(66919..68241) product aromatic acid/H+ symport family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001183081.1 transl_table 11 codon_start 1 locus_tag LOCUS_19750 CDS complement(68259..69806) product indolepyruvate oxidoreductase subunit beta family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086194.1 transl_table 11 codon_start 1 locus_tag LOCUS_19760 CDS complement(69817..71970) product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086195.1 transl_table 11 codon_start 1 locus_tag LOCUS_19770 CDS 72355..73539 product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249503.1 transl_table 11 codon_start 1 locus_tag LOCUS_19780 CDS complement(73587..74699) product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074059.1 transl_table 11 codon_start 1 locus_tag LOCUS_19790 CDS complement(74696..76099) product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267550.1 transl_table 11 codon_start 1 locus_tag LOCUS_19800 CDS complement(76120..77142) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970066.1 transl_table 11 codon_start 1 locus_tag LOCUS_19810 CDS complement(77139..78122) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085658.1 transl_table 11 codon_start 1 locus_tag LOCUS_19820 CDS complement(78122..79063) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040761.1 transl_table 11 codon_start 1 locus_tag LOCUS_19830 CDS complement(79060..80031) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014906119.1 transl_table 11 codon_start 1 locus_tag LOCUS_19840 CDS complement(80042..81193) product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813846.1 transl_table 11 codon_start 1 locus_tag LOCUS_19850 gene argE CDS complement(81193..82842) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815878.1 transl_table 11 codon_start 1 locus_tag LOCUS_19860 CDS complement(83032..83739) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533053.1 transl_table 11 codon_start 1 locus_tag LOCUS_19870 CDS 83931..84761 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527986.1 transl_table 11 codon_start 1 locus_tag LOCUS_19880 CDS 84781..85533 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527987.1 transl_table 11 codon_start 1 locus_tag LOCUS_19890 CDS 85773..86609 product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090839.1 transl_table 11 codon_start 1 locus_tag LOCUS_19900 CDS 86669..87331 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090840.1 transl_table 11 codon_start 1 locus_tag LOCUS_19910 CDS 87328..88107 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090841.1 transl_table 11 codon_start 1 locus_tag LOCUS_19920 CDS 88126..89259 product muconate cycloisomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090843.1 transl_table 11 codon_start 1 locus_tag LOCUS_19930 CDS 89359..90621 product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089551.1 transl_table 11 codon_start 1 locus_tag LOCUS_19940 CDS 90712..92466 product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807539.1 transl_table 11 codon_start 1 locus_tag LOCUS_19950 CDS complement(93629..94507) product manganese catalase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245071.1 transl_table 11 codon_start 1 locus_tag LOCUS_19960 CDS complement(94635..96989) product glucose/quinate/shikimate family membrane-bound PQQ-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337648.1 transl_table 11 codon_start 1 locus_tag LOCUS_19970 CDS complement(97257..97520) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533191.1 transl_table 11 codon_start 1 locus_tag LOCUS_19980 CDS complement(97588..98331) product TIGR04290 family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969528.1 transl_table 11 codon_start 1 locus_tag LOCUS_19990 CDS complement(98328..99317) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969527.1 transl_table 11 codon_start 1 locus_tag LOCUS_20000 CDS complement(99326..100408) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969526.1 transl_table 11 codon_start 1 locus_tag LOCUS_20010 CDS complement(100405..101496) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975133.1 transl_table 11 codon_start 1 locus_tag LOCUS_20020 CDS complement(101493..102620) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338286.1 transl_table 11 codon_start 1 locus_tag LOCUS_20030 CDS complement(102623..103732) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969523.1 transl_table 11 codon_start 1 locus_tag LOCUS_20040 CDS complement(103729..105759) product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338288.1 transl_table 11 codon_start 1 locus_tag LOCUS_20050 CDS complement(105756..106850) product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975137.1 transl_table 11 codon_start 1 locus_tag LOCUS_20060 CDS 107090..108466 product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389965.1 transl_table 11 codon_start 1 locus_tag LOCUS_20070 CDS 108496..109485 product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975138.1 transl_table 11 codon_start 1 locus_tag LOCUS_20080 CDS 109482..110513 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969519.1 transl_table 11 codon_start 1 locus_tag LOCUS_20090 CDS complement(110565..111374) product DUF3618 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525135.1 transl_table 11 codon_start 1 locus_tag LOCUS_20100 CDS complement(111371..111772) product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525134.1 transl_table 11 codon_start 1 locus_tag LOCUS_20110 CDS complement(111762..112424) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20120 CDS 112738..113484 product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383492.1 transl_table 11 codon_start 1 locus_tag LOCUS_20130 CDS 113481..113981 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20140 CDS complement(113959..114462) product DUF2231 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023004192.1 transl_table 11 codon_start 1 locus_tag LOCUS_20150 CDS 114625..115182 product cytochrome b561 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640905.1 transl_table 11 codon_start 1 locus_tag LOCUS_20160 CDS 115179..117683 product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339037.1 transl_table 11 codon_start 1 locus_tag LOCUS_20170 gene ctaD CDS 117683..117985 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20180 CDS complement(118014..118817) product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083120.1 transl_table 11 codon_start 1 locus_tag LOCUS_20190 gene fdhD CDS complement(118814..121102) product FdhF/YdeP family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533185.1 transl_table 11 codon_start 1 locus_tag LOCUS_20200 CDS complement(121203..121619) product group III truncated hemoglobin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812026.1 transl_table 11 codon_start 1 locus_tag LOCUS_20210 CDS 121893..122855 product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969507.1 transl_table 11 codon_start 1 locus_tag LOCUS_20220 CDS 123021..123896 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721079.1 transl_table 11 codon_start 1 locus_tag LOCUS_20230 CDS complement(123929..126127) product malate synthase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398130.1 transl_table 11 codon_start 1 locus_tag LOCUS_20240 CDS complement(126221..127123) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313134.1 transl_table 11 codon_start 1 locus_tag LOCUS_20250 CDS complement(127163..127819) product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529253.1 transl_table 11 codon_start 1 locus_tag LOCUS_20260 CDS 128067..129218 product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975931.1 transl_table 11 codon_start 1 locus_tag LOCUS_20270 gene ugpC CDS 129253..130389 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20280 CDS 130450..131280 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211226.1 transl_table 11 codon_start 1 locus_tag LOCUS_20290 CDS 131277..132125 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538207.1 transl_table 11 codon_start 1 locus_tag LOCUS_20300 CDS 132263..133153 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081159170.1 transl_table 11 codon_start 1 locus_tag LOCUS_20310 CDS 133339..134487 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992208.1 transl_table 11 codon_start 1 locus_tag LOCUS_20320 CDS 134484..135410 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970865.1 transl_table 11 codon_start 1 locus_tag LOCUS_20330 CDS 135410..136231 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310642.1 transl_table 11 codon_start 1 locus_tag LOCUS_20340 CDS 136274..137566 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310644.1 transl_table 11 codon_start 1 locus_tag LOCUS_20350 CDS 137631..138431 product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970866.1 transl_table 11 codon_start 1 locus_tag LOCUS_20360 CDS complement(138508..139461) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20370 CDS complement(139451..140743) product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089551.1 transl_table 11 codon_start 1 locus_tag LOCUS_20380 CDS complement(140755..141843) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028605124.1 transl_table 11 codon_start 1 locus_tag LOCUS_20390 CDS complement(141861..143375) product ATP-dependent acyl-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259624.1 transl_table 11 codon_start 1 locus_tag LOCUS_20400 CDS complement(143429..145168) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121537498.1 transl_table 11 codon_start 1 locus_tag LOCUS_20410 CDS complement(145165..146244) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970338.1 transl_table 11 codon_start 1 locus_tag LOCUS_20420 CDS complement(146362..147420) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970337.1 transl_table 11 codon_start 1 locus_tag LOCUS_20430 CDS complement(147511..148263) product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917897.1 transl_table 11 codon_start 1 locus_tag LOCUS_20440 CDS 148461..149243 product IclR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808900.1 transl_table 11 codon_start 1 locus_tag LOCUS_20450 CDS 149341..149652 product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382315.1 transl_table 11 codon_start 1 locus_tag LOCUS_20460 CDS 149649..151040 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007247117.1 transl_table 11 codon_start 1 locus_tag LOCUS_20470 CDS 151037..152194 product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092809287.1 transl_table 11 codon_start 1 locus_tag LOCUS_20480 CDS complement(152200..153678) product siroheme synthase CysG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035256894.1 transl_table 11 codon_start 1 locus_tag LOCUS_20490 gene cysG CDS complement(153656..156331) product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975944.1 transl_table 11 codon_start 1 locus_tag LOCUS_20500 CDS complement(156328..156660) product nitrite reductase small subunit NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003519747.1 transl_table 11 codon_start 1 locus_tag LOCUS_20510 gene nirD CDS complement(156664..157035) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20520 note possible pseudo, frameshifted CDS complement(157067..159112) product nitrite reductase large subunit NirB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061458.1 transl_table 11 codon_start 1 locus_tag LOCUS_20530 gene nirB note possible pseudo, frameshifted CDS complement(159132..160433) product nitrate/nitrite transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003525898.1 transl_table 11 codon_start 1 locus_tag LOCUS_20540 CDS complement(160765..161973) product CmpA/NrtA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027160926.1 transl_table 11 codon_start 1 locus_tag LOCUS_20550 CDS complement(161970..162572) product ANTAR domain-containing response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530455.1 transl_table 11 codon_start 1 locus_tag LOCUS_20560 CDS 162949..164019 product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972908.1 transl_table 11 codon_start 1 locus_tag LOCUS_20570 gene ugpC CDS 164037..165269 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972909.1 transl_table 11 codon_start 1 locus_tag LOCUS_20580 CDS 165277..166188 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992469.1 transl_table 11 codon_start 1 locus_tag LOCUS_20590 CDS 166189..167028 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314872.1 transl_table 11 codon_start 1 locus_tag LOCUS_20600 CDS complement(167025..168149) product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092772473.1 transl_table 11 codon_start 1 locus_tag LOCUS_20610 CDS complement(168281..169705) product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048655408.1 transl_table 11 codon_start 1 locus_tag LOCUS_20620 CDS complement(169931..171262) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972099.1 transl_table 11 codon_start 1 locus_tag LOCUS_20630 CDS complement(171457..172221) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268530.1 transl_table 11 codon_start 1 locus_tag LOCUS_20640 CDS complement(172194..173099) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767688.1 transl_table 11 codon_start 1 locus_tag LOCUS_20650 CDS complement(173111..174103) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20660 CDS complement(174131..175468) product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103996.1 transl_table 11 codon_start 1 locus_tag LOCUS_20670 CDS complement(175696..176259) product FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528153.1 transl_table 11 codon_start 1 locus_tag LOCUS_20680 gene msuE CDS 176468..176920 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085194.1 transl_table 11 codon_start 1 locus_tag LOCUS_20690 CDS 177088..178329 product glucoamylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391049.1 transl_table 11 codon_start 1 locus_tag LOCUS_20700 CDS complement(178317..178787) product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004438693.1 transl_table 11 codon_start 1 locus_tag LOCUS_20710 CDS 178915..180045 product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972917.1 transl_table 11 codon_start 1 locus_tag LOCUS_20720 gene alr CDS 180075..181331 product D-amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972918.1 transl_table 11 codon_start 1 locus_tag LOCUS_20730 CDS 181516..183444 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20740 CDS complement(183437..183832) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974063.1 transl_table 11 codon_start 1 locus_tag LOCUS_20750 CDS 184012..184467 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20760 CDS 185098..186303 product plasmid partitioning protein RepA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253454.1 transl_table 11 codon_start 1 locus_tag LOCUS_20770 gene repA CDS 186303..187334 product plasmid partitioning protein RepB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976299.1 transl_table 11 codon_start 1 locus_tag LOCUS_20780 gene repB CDS 187550..188758 product plasmid replication protein RepC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244395.1 transl_table 11 codon_start 1 locus_tag LOCUS_20790 gene repC CDS 188780..189142 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969576.1 transl_table 11 codon_start 1 locus_tag LOCUS_20800 CDS complement(189143..189712) product DUF2239 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083415.1 transl_table 11 codon_start 1 locus_tag LOCUS_20810 CDS complement(189782..190984) product 3-oxoadipyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528954.1 transl_table 11 codon_start 1 locus_tag LOCUS_20820 gene pcaF CDS complement(191774..191911) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20830 CDS 192163..192540 product MbcA/ParS/Xre antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531903.1 transl_table 11 codon_start 1 locus_tag LOCUS_20840 CDS 192575..193264 product RES family NAD+ phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992241.1 transl_table 11 codon_start 1 locus_tag LOCUS_20850 CDS complement(193279..194589) product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153437724.1 transl_table 11 codon_start 1 locus_tag LOCUS_20860 CDS complement(194579..196243) product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090638.1 transl_table 11 codon_start 1 locus_tag LOCUS_20870 CDS complement(196403..211597) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20880 CDS complement(212002..212592) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688682.1 transl_table 11 codon_start 1 locus_tag LOCUS_20890 CDS complement(212938..213777) product DUF296 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975592.1 transl_table 11 codon_start 1 locus_tag LOCUS_20900 CDS complement(213782..214537) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014529496.1 transl_table 11 codon_start 1 locus_tag LOCUS_20910 CDS complement(214547..216211) product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974195.1 transl_table 11 codon_start 1 locus_tag LOCUS_20920 CDS complement(216211..217062) product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530962.1 transl_table 11 codon_start 1 locus_tag LOCUS_20930 CDS complement(217062..217865) product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969397.1 transl_table 11 codon_start 1 locus_tag LOCUS_20940 CDS complement(217941..218957) product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975598.1 transl_table 11 codon_start 1 locus_tag LOCUS_20950 CDS complement(219045..220913) product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969399.1 transl_table 11 codon_start 1 locus_tag LOCUS_20960 CDS complement(221229..221627) product YbaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385268.1 transl_table 11 codon_start 1 locus_tag LOCUS_20970 CDS complement(221632..222276) product biliverdin-producing heme oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972364.1 transl_table 11 codon_start 1 locus_tag LOCUS_20980 CDS complement(222355..224928) product TIGR02302 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529406.1 transl_table 11 codon_start 1 locus_tag LOCUS_20990 CDS complement(225028..226287) product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529408.1 transl_table 11 codon_start 1 locus_tag LOCUS_21000 gene lysA CDS complement(226302..226541) product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529409.1 transl_table 11 codon_start 1 locus_tag LOCUS_21010 CDS complement(226542..227915) product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529410.1 transl_table 11 codon_start 1 locus_tag LOCUS_21020 gene argH CDS 227985..228692 product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529411.1 transl_table 11 codon_start 1 locus_tag LOCUS_21030 CDS complement(228794..230131) product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920685.1 transl_table 11 codon_start 1 locus_tag LOCUS_21040 CDS complement(230176..231606) product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385764.1 transl_table 11 codon_start 1 locus_tag LOCUS_21050 CDS complement(231634..233241) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972985.1 transl_table 11 codon_start 1 locus_tag LOCUS_21060 CDS complement(233241..234035) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972986.1 transl_table 11 codon_start 1 locus_tag LOCUS_21070 CDS complement(234053..235006) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970012.1 transl_table 11 codon_start 1 locus_tag LOCUS_21080 CDS complement(235011..236579) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_217481233.1 transl_table 11 codon_start 1 locus_tag LOCUS_21090 CDS complement(236617..237780) product C45 family autoproteolytic acyltransferase/hydolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258014.1 transl_table 11 codon_start 1 locus_tag LOCUS_21100 CDS 237882..238763 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174047183.1 transl_table 11 codon_start 1 locus_tag LOCUS_21110 CDS 238975..240234 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974322.1 transl_table 11 codon_start 1 locus_tag LOCUS_21120 CDS 240283..241164 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974323.1 transl_table 11 codon_start 1 locus_tag LOCUS_21130 CDS 241154..241963 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974324.1 transl_table 11 codon_start 1 locus_tag LOCUS_21140 CDS 241987..242748 product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974325.1 transl_table 11 codon_start 1 locus_tag LOCUS_21150 CDS 242745..243776 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974326.1 transl_table 11 codon_start 1 locus_tag LOCUS_21160 CDS 243779..244717 product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974327.1 transl_table 11 codon_start 1 locus_tag LOCUS_21170 CDS complement(244913..246349) product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315769.1 transl_table 11 codon_start 1 locus_tag LOCUS_21180 CDS complement(246455..247474) product DNA topoisomerase IB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529828.1 transl_table 11 codon_start 1 locus_tag LOCUS_21190 CDS complement(247533..248609) product NAD/NADP-dependent octopine/nopaline dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969480.1 transl_table 11 codon_start 1 locus_tag LOCUS_21200 CDS 249051..250151 product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969482.1 transl_table 11 codon_start 1 locus_tag LOCUS_21210 CDS 250252..251238 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969483.1 transl_table 11 codon_start 1 locus_tag LOCUS_21220 CDS 251238..252029 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315838.1 transl_table 11 codon_start 1 locus_tag LOCUS_21230 CDS 252035..253105 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974670.1 transl_table 11 codon_start 1 locus_tag LOCUS_21240 CDS 253142..254602 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974671.1 transl_table 11 codon_start 1 locus_tag LOCUS_21250 CDS 254615..255214 product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974672.1 transl_table 11 codon_start 1 locus_tag LOCUS_21260 CDS 255218..255718 product CMD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974673.1 transl_table 11 codon_start 1 locus_tag LOCUS_21270 CDS 255720..256301 product peroxidase-related enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974674.1 transl_table 11 codon_start 1 locus_tag LOCUS_21280 CDS 256339..257703 product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974675.1 transl_table 11 codon_start 1 locus_tag LOCUS_21290 CDS complement(257688..258065) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21300 CDS complement(258076..258912) product TIGR02587 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973592.1 transl_table 11 codon_start 1 locus_tag LOCUS_21310 CDS 259021..259782 product trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299673.1 transl_table 11 codon_start 1 locus_tag LOCUS_21320 gene otsB CDS 259872..261278 product alpha,alpha-trehalose-phosphate synthase (UDP-forming) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192381.1 transl_table 11 codon_start 1 locus_tag LOCUS_21330 gene otsA CDS complement(261282..262004) product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975640.1 transl_table 11 codon_start 1 locus_tag LOCUS_21340 CDS 262084..263262 product M20 aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975639.1 transl_table 11 codon_start 1 locus_tag LOCUS_21350 CDS complement(263944..265728) product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973838.1 transl_table 11 codon_start 1 locus_tag LOCUS_21360 CDS complement(265725..266657) product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975637.1 transl_table 11 codon_start 1 locus_tag LOCUS_21370 CDS complement(266657..267685) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973836.1 transl_table 11 codon_start 1 locus_tag LOCUS_21380 CDS complement(267678..268457) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975636.1 transl_table 11 codon_start 1 locus_tag LOCUS_21390 CDS complement(268454..269281) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534077.1 transl_table 11 codon_start 1 locus_tag LOCUS_21400 CDS complement(269349..270368) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061537.1 transl_table 11 codon_start 1 locus_tag LOCUS_21410 CDS complement(270365..271435) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061536.1 transl_table 11 codon_start 1 locus_tag LOCUS_21420 CDS 272364..273077 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21430 CDS complement(273165..274043) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395032.1 transl_table 11 codon_start 1 locus_tag LOCUS_21440 CDS 274278..275432 product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973005.1 transl_table 11 codon_start 1 locus_tag LOCUS_21450 gene argE CDS 275447..276370 product glyoxylate/hydroxypyruvate reductase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173510794.1 transl_table 11 codon_start 1 locus_tag LOCUS_21460 CDS 276390..276746 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064685941.1 transl_table 11 codon_start 1 locus_tag LOCUS_21470 CDS 276837..278300 product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973008.1 transl_table 11 codon_start 1 locus_tag LOCUS_21480 CDS 278311..279351 product tartrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066869097.1 transl_table 11 codon_start 1 locus_tag LOCUS_21490 CDS 279364..280818 product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027998733.1 transl_table 11 codon_start 1 locus_tag LOCUS_21500 CDS complement(280891..282168) product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243597.1 transl_table 11 codon_start 1 locus_tag LOCUS_21510 CDS complement(282186..282854) product haloacid dehalogenase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243598.1 transl_table 11 codon_start 1 locus_tag LOCUS_21520 CDS 283193..284023 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081159240.1 transl_table 11 codon_start 1 locus_tag LOCUS_21530 CDS 284037..285413 product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012170558.1 transl_table 11 codon_start 1 locus_tag LOCUS_21540 CDS 285710..286426 product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035257353.1 transl_table 11 codon_start 1 locus_tag LOCUS_21550 CDS 286502..288109 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970446.1 transl_table 11 codon_start 1 locus_tag LOCUS_21560 CDS 288191..289141 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970445.1 transl_table 11 codon_start 1 locus_tag LOCUS_21570 CDS 289138..290001 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967983.1 transl_table 11 codon_start 1 locus_tag LOCUS_21580 CDS 290003..291667 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066869078.1 transl_table 11 codon_start 1 locus_tag LOCUS_21590 CDS complement(291719..292243) product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887171.1 transl_table 11 codon_start 1 locus_tag LOCUS_21600 CDS 292438..293763 product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253392.1 transl_table 11 codon_start 1 locus_tag LOCUS_21610 CDS complement(293766..294953) product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086528237.1 transl_table 11 codon_start 1 locus_tag LOCUS_21620 CDS complement(294950..297145) product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208470.1 transl_table 11 codon_start 1 locus_tag LOCUS_21630 CDS complement(297142..298344) product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098387.1 transl_table 11 codon_start 1 locus_tag LOCUS_21640 misc_feature complement(298652..>303152) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003147473.1:Ig-like domain-containing protein locus_tag LOCUS_21650 sequence07 source 1..266974 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(140..1951) product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529166.1 transl_table 11 codon_start 1 locus_tag LOCUS_21660 CDS complement(1955..2611) product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529167.1 transl_table 11 codon_start 1 locus_tag LOCUS_21670 CDS 2610..2759 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21680 CDS 2870..3862 product thiamine ABC transporter substrate binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529168.1 transl_table 11 codon_start 1 locus_tag LOCUS_21690 gene thiB CDS complement(3901..7359) product pyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529098.1 transl_table 11 codon_start 1 locus_tag LOCUS_21700 gene pyc CDS complement(7582..8769) product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003525631.1 transl_table 11 codon_start 1 locus_tag LOCUS_21710 CDS complement(8864..9217) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529096.1 transl_table 11 codon_start 1 locus_tag LOCUS_21720 CDS complement(9260..9988) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529095.1 transl_table 11 codon_start 1 locus_tag LOCUS_21730 CDS complement(9985..11040) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21740 CDS complement(11040..12434) product high-affinity branched-chain amino acid ABC transporter permease LivM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394369.1 transl_table 11 codon_start 1 locus_tag LOCUS_21750 gene livM CDS complement(12438..13379) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529092.1 transl_table 11 codon_start 1 locus_tag LOCUS_21760 CDS complement(13653..14654) product 4-hydroxyproline epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529091.1 transl_table 11 codon_start 1 locus_tag LOCUS_21770 CDS complement(14666..15913) product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024502893.1 transl_table 11 codon_start 1 locus_tag LOCUS_21780 CDS 16046..16708 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173266.1 transl_table 11 codon_start 1 locus_tag LOCUS_21790 CDS complement(16732..16917) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21800 CDS 16841..17827 product thiosulfate ABC transporter substrate-binding protein CysP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973096.1 transl_table 11 codon_start 1 locus_tag LOCUS_21810 gene cysP CDS 17841..18665 product sulfate ABC transporter permease subunit CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973095.1 transl_table 11 codon_start 1 locus_tag LOCUS_21820 gene cysT CDS 18662..19552 product sulfate ABC transporter permease subunit CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973094.1 transl_table 11 codon_start 1 locus_tag LOCUS_21830 gene cysW CDS 19549..20568 product sulfate/molybdate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973093.1 transl_table 11 codon_start 1 locus_tag LOCUS_21840 CDS 20679..22010 product FAD/NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528704.1 transl_table 11 codon_start 1 locus_tag LOCUS_21850 CDS complement(22060..22245) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21860 CDS complement(22267..22590) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21870 CDS 23015..24073 product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032808652.1 transl_table 11 codon_start 1 locus_tag LOCUS_21880 CDS complement(24081..26045) product Fe(3+)-hydroxamate ABC transporter permease FhuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313727.1 transl_table 11 codon_start 1 locus_tag LOCUS_21890 gene fhuB CDS complement(26042..26908) product iron-siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992428.1 transl_table 11 codon_start 1 locus_tag LOCUS_21900 CDS complement(26905..27717) product Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704433.1 transl_table 11 codon_start 1 locus_tag LOCUS_21910 gene fhuC CDS complement(27718..29892) product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973505.1 transl_table 11 codon_start 1 locus_tag LOCUS_21920 CDS complement(30063..31358) product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973517.1 transl_table 11 codon_start 1 locus_tag LOCUS_21930 CDS 31843..35184 product type II CRISPR RNA-guided endonuclease Cas9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864485.1 transl_table 11 codon_start 1 locus_tag LOCUS_21940 gene cas9 CDS 35212..36147 product type II CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963638.1 transl_table 11 codon_start 1 locus_tag LOCUS_21950 gene cas1 CDS 36128..36493 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21960 repeat_region 36566..36865 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq attctagcagttcagaaaaagcggtccagcggcaac CDS complement(36915..37322) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21970 CDS 37534..38826 product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014527246.1 transl_table 11 codon_start 1 locus_tag LOCUS_21980 CDS 38959..39252 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972670.1 transl_table 11 codon_start 1 locus_tag LOCUS_21990 CDS 39275..39871 product IMPACT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313743.1 transl_table 11 codon_start 1 locus_tag LOCUS_22000 CDS complement(39943..40440) product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086781.1 transl_table 11 codon_start 1 locus_tag LOCUS_22010 CDS complement(40437..41075) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313741.1 transl_table 11 codon_start 1 locus_tag LOCUS_22020 CDS complement(41084..41761) product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973520.1 transl_table 11 codon_start 1 locus_tag LOCUS_22030 CDS 41975..42634 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22040 CDS 42689..43702 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082945.1 transl_table 11 codon_start 1 locus_tag LOCUS_22050 CDS 43763..44536 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082944.1 transl_table 11 codon_start 1 locus_tag LOCUS_22060 CDS 44526..45377 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966629.1 transl_table 11 codon_start 1 locus_tag LOCUS_22070 CDS 45388..46659 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895440.1 transl_table 11 codon_start 1 locus_tag LOCUS_22080 tRNA complement(46749..46838) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00270 CDS 47357..47746 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22090 CDS 47863..48132 product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067214.1 transl_table 11 codon_start 1 locus_tag LOCUS_22100 gene rpmA CDS 48212..48841 product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173273.1 transl_table 11 codon_start 1 locus_tag LOCUS_22110 CDS 48968..50005 product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529067.1 transl_table 11 codon_start 1 locus_tag LOCUS_22120 gene obgE CDS 50012..51169 product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529068.1 transl_table 11 codon_start 1 locus_tag LOCUS_22130 gene proB CDS 51153..52433 product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529069.1 transl_table 11 codon_start 1 locus_tag LOCUS_22140 CDS 52493..53092 product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529070.1 transl_table 11 codon_start 1 locus_tag LOCUS_22150 CDS 53155..53640 product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529073.1 transl_table 11 codon_start 1 locus_tag LOCUS_22160 gene rsfS CDS 53788..54270 product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529074.1 transl_table 11 codon_start 1 locus_tag LOCUS_22170 gene rlmH CDS 54404..55744 product murein hydrolase activator EnvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529075.1 transl_table 11 codon_start 1 locus_tag LOCUS_22180 CDS 55734..57071 product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529076.1 transl_table 11 codon_start 1 locus_tag LOCUS_22190 CDS 57250..58491 product divergent polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529077.1 transl_table 11 codon_start 1 locus_tag LOCUS_22200 CDS 58501..59022 product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529078.1 transl_table 11 codon_start 1 locus_tag LOCUS_22210 CDS complement(59023..60138) product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009565536.1 transl_table 11 codon_start 1 locus_tag LOCUS_22220 CDS complement(60828..61232) product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529039.1 transl_table 11 codon_start 1 locus_tag LOCUS_22230 CDS complement(61294..62838) product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067133.1 transl_table 11 codon_start 1 locus_tag LOCUS_22240 gene atpD CDS complement(62908..63786) product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037389782.1 transl_table 11 codon_start 1 locus_tag LOCUS_22250 CDS complement(63817..65346) product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037389785.1 transl_table 11 codon_start 1 locus_tag LOCUS_22260 gene atpA CDS complement(65346..65906) product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529035.1 transl_table 11 codon_start 1 locus_tag LOCUS_22270 CDS complement(66160..66552) product DUF4345 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529034.1 transl_table 11 codon_start 1 locus_tag LOCUS_22280 CDS complement(66635..68818) product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529032.1 transl_table 11 codon_start 1 locus_tag LOCUS_22290 CDS 68913..69566 product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067139.1 transl_table 11 codon_start 1 locus_tag LOCUS_22300 gene fsa CDS complement(69601..69915) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22310 CDS complement(69929..70843) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530281.1 transl_table 11 codon_start 1 locus_tag LOCUS_22320 CDS complement(70967..71509) product LPS assembly lipoprotein LptE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529029.1 transl_table 11 codon_start 1 locus_tag LOCUS_22330 gene lptE CDS complement(71496..74120) product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529028.1 transl_table 11 codon_start 1 locus_tag LOCUS_22340 gene leuS CDS 74237..74917 product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529027.1 transl_table 11 codon_start 1 locus_tag LOCUS_22350 CDS complement(74937..75206) product usg protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529022.1 transl_table 11 codon_start 1 locus_tag LOCUS_22360 CDS 75475..77430 product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529021.1 transl_table 11 codon_start 1 locus_tag LOCUS_22370 gene acs CDS complement(77485..77703) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22380 CDS 77858..78847 product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531758.1 transl_table 11 codon_start 1 locus_tag LOCUS_22390 gene htpX CDS 78844..80226 product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173296.1 transl_table 11 codon_start 1 locus_tag LOCUS_22400 CDS 80313..82025 product heparinase II/III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529012.1 transl_table 11 codon_start 1 locus_tag LOCUS_22410 CDS 82136..83752 product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529011.1 transl_table 11 codon_start 1 locus_tag LOCUS_22420 gene purH CDS complement(83803..85176) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529010.1 transl_table 11 codon_start 1 locus_tag LOCUS_22430 CDS complement(85221..89966) product NAD-glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529008.1 transl_table 11 codon_start 1 locus_tag LOCUS_22440 CDS complement(90285..92117) product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529003.1 transl_table 11 codon_start 1 locus_tag LOCUS_22450 gene typA CDS complement(92266..94299) product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528986.1 transl_table 11 codon_start 1 locus_tag LOCUS_22460 CDS 94437..94886 product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310829.1 transl_table 11 codon_start 1 locus_tag LOCUS_22470 CDS 94886..96118 product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393947.1 transl_table 11 codon_start 1 locus_tag LOCUS_22480 CDS complement(96136..96795) product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528988.1 transl_table 11 codon_start 1 locus_tag LOCUS_22490 CDS complement(96847..97701) product pyridoxal kinase PdxY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060563606.1 transl_table 11 codon_start 1 locus_tag LOCUS_22500 gene pdxY CDS complement(97698..97910) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22510 CDS 98075..98635 product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528992.1 transl_table 11 codon_start 1 locus_tag LOCUS_22520 CDS 98637..99467 product YgcG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528993.1 transl_table 11 codon_start 1 locus_tag LOCUS_22530 CDS 99471..100109 product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528995.1 transl_table 11 codon_start 1 locus_tag LOCUS_22540 CDS 100157..100663 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528996.1 transl_table 11 codon_start 1 locus_tag LOCUS_22550 CDS 100780..101316 product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024310859.1 transl_table 11 codon_start 1 locus_tag LOCUS_22560 gene ppa CDS complement(101387..101686) product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528977.1 transl_table 11 codon_start 1 locus_tag LOCUS_22570 CDS complement(101806..102531) product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970397.1 transl_table 11 codon_start 1 locus_tag LOCUS_22580 CDS complement(102547..103014) product TerB family tellurite resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528912.1 transl_table 11 codon_start 1 locus_tag LOCUS_22590 CDS complement(103035..104672) product heme biosynthesis protein HemY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528911.1 transl_table 11 codon_start 1 locus_tag LOCUS_22600 CDS complement(104673..106001) product COG4223 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528910.1 transl_table 11 codon_start 1 locus_tag LOCUS_22610 CDS complement(106118..106807) product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528909.1 transl_table 11 codon_start 1 locus_tag LOCUS_22620 CDS complement(106821..107630) product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970392.1 transl_table 11 codon_start 1 locus_tag LOCUS_22630 gene hemC CDS 107952..109061 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174299077.1 transl_table 11 codon_start 1 locus_tag LOCUS_22640 gene tsaD CDS 109058..110056 product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173340.1 transl_table 11 codon_start 1 locus_tag LOCUS_22650 CDS 110059..110355 product YciI-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970389.1 transl_table 11 codon_start 1 locus_tag LOCUS_22660 CDS 110369..110800 product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528904.1 transl_table 11 codon_start 1 locus_tag LOCUS_22670 CDS 110877..111464 product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972461.1 transl_table 11 codon_start 1 locus_tag LOCUS_22680 CDS complement(111454..111663) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22690 CDS 112060..112800 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528898.1 transl_table 11 codon_start 1 locus_tag LOCUS_22700 CDS 112899..113357 product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528897.1 transl_table 11 codon_start 1 locus_tag LOCUS_22710 CDS complement(113360..114172) product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528894.1 transl_table 11 codon_start 1 locus_tag LOCUS_22720 CDS complement(114292..114957) product outer membrane lipoprotein carrier protein LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528893.1 transl_table 11 codon_start 1 locus_tag LOCUS_22730 CDS complement(115025..117844) product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528892.1 transl_table 11 codon_start 1 locus_tag LOCUS_22740 CDS complement(118011..119366) product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310939.1 transl_table 11 codon_start 1 locus_tag LOCUS_22750 CDS complement(119390..119728) product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008142813.1 transl_table 11 codon_start 1 locus_tag LOCUS_22760 CDS complement(119971..120831) product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528888.1 transl_table 11 codon_start 1 locus_tag LOCUS_22770 gene tesB CDS 120944..122188 product ubiquinone biosynthesis hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027163307.1 transl_table 11 codon_start 1 locus_tag LOCUS_22780 CDS 122273..122710 product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528883.1 transl_table 11 codon_start 1 locus_tag LOCUS_22790 CDS 122843..123967 product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962697.1 transl_table 11 codon_start 1 locus_tag LOCUS_22800 CDS complement(124011..124346) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22810 CDS complement(124464..124931) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22820 CDS complement(125284..126090) product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527887.1 transl_table 11 codon_start 1 locus_tag LOCUS_22830 gene fabI CDS complement(126099..127319) product beta-ketoacyl-ACP synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330670.1 transl_table 11 codon_start 1 locus_tag LOCUS_22840 gene fabB CDS complement(127348..127854) product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037377826.1 transl_table 11 codon_start 1 locus_tag LOCUS_22850 gene fabA CDS 128068..128502 product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024503471.1 transl_table 11 codon_start 1 locus_tag LOCUS_22860 CDS complement(128506..129690) product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528871.1 transl_table 11 codon_start 1 locus_tag LOCUS_22870 CDS 129997..130443 product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528874.1 transl_table 11 codon_start 1 locus_tag LOCUS_22880 gene sdhC CDS 130467..130841 product succinate dehydrogenase, hydrophobic membrane anchor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026615499.1 transl_table 11 codon_start 1 locus_tag LOCUS_22890 gene sdhD CDS 130846..132678 product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528876.1 transl_table 11 codon_start 1 locus_tag LOCUS_22900 gene sdhA CDS 132715..133494 product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528877.1 transl_table 11 codon_start 1 locus_tag LOCUS_22910 CDS complement(133562..136138) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528822.1 transl_table 11 codon_start 1 locus_tag LOCUS_22920 CDS complement(136135..136824) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528821.1 transl_table 11 codon_start 1 locus_tag LOCUS_22930 CDS 136876..137520 product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528820.1 transl_table 11 codon_start 1 locus_tag LOCUS_22940 CDS 137563..138210 product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528819.1 transl_table 11 codon_start 1 locus_tag LOCUS_22950 gene thpR CDS complement(138147..138362) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22960 CDS 138749..139099 product YkvA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528816.1 transl_table 11 codon_start 1 locus_tag LOCUS_22970 CDS 139339..139851 product invasion associated locus B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528815.1 transl_table 11 codon_start 1 locus_tag LOCUS_22980 CDS 140062..141294 product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528813.1 transl_table 11 codon_start 1 locus_tag LOCUS_22990 gene rlmN CDS 141297..141767 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23000 CDS complement(141755..142396) product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528810.1 transl_table 11 codon_start 1 locus_tag LOCUS_23010 CDS 142540..143766 product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330161.1 transl_table 11 codon_start 1 locus_tag LOCUS_23020 CDS complement(143837..145246) product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529677.1 transl_table 11 codon_start 1 locus_tag LOCUS_23030 gene leuC CDS complement(145558..146130) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23040 CDS complement(146235..146957) product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528859.1 transl_table 11 codon_start 1 locus_tag LOCUS_23050 gene trmD CDS complement(146954..147532) product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528858.1 transl_table 11 codon_start 1 locus_tag LOCUS_23060 gene rimM CDS 147678..148613 product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393732.1 transl_table 11 codon_start 1 locus_tag LOCUS_23070 CDS 148628..149620 product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528856.1 transl_table 11 codon_start 1 locus_tag LOCUS_23080 CDS 149870..150229 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23090 CDS complement(150297..151706) product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528854.1 transl_table 11 codon_start 1 locus_tag LOCUS_23100 gene lpdA CDS complement(151766..152221) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528852.1 transl_table 11 codon_start 1 locus_tag LOCUS_23110 CDS complement(152276..152692) product MAPEG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972451.1 transl_table 11 codon_start 1 locus_tag LOCUS_23120 CDS complement(152757..154010) product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528851.1 transl_table 11 codon_start 1 locus_tag LOCUS_23130 gene odhB CDS complement(154042..157029) product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067152.1 transl_table 11 codon_start 1 locus_tag LOCUS_23140 CDS complement(157155..158057) product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310787.1 transl_table 11 codon_start 1 locus_tag LOCUS_23150 gene sucD CDS complement(158076..159269) product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972454.1 transl_table 11 codon_start 1 locus_tag LOCUS_23160 gene sucC CDS complement(159293..160258) product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530257.1 transl_table 11 codon_start 1 locus_tag LOCUS_23170 gene mdh CDS complement(160453..161625) product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528845.1 transl_table 11 codon_start 1 locus_tag LOCUS_23180 gene zapE CDS complement(161753..162301) product protease inhibitor Inh/omp19 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528844.1 transl_table 11 codon_start 1 locus_tag LOCUS_23190 CDS 162599..163459 product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018209256.1 transl_table 11 codon_start 1 locus_tag LOCUS_23200 gene dapF CDS 163456..164760 product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528840.1 transl_table 11 codon_start 1 locus_tag LOCUS_23210 gene mtaB CDS 164784..166112 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23220 CDS 166113..166745 product septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330142.1 transl_table 11 codon_start 1 locus_tag LOCUS_23230 CDS complement(166749..167300) product DsbE family thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528832.1 transl_table 11 codon_start 1 locus_tag LOCUS_23240 CDS complement(167454..168221) product heme ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532296.1 transl_table 11 codon_start 1 locus_tag LOCUS_23250 CDS complement(168282..168947) product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528830.1 transl_table 11 codon_start 1 locus_tag LOCUS_23260 gene ccmB CDS complement(168944..169558) product heme ABC exporter ATP-binding protein CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528829.1 transl_table 11 codon_start 1 locus_tag LOCUS_23270 gene ccmA CDS 169819..172509 product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528828.1 transl_table 11 codon_start 1 locus_tag LOCUS_23280 gene acnA CDS 172651..173412 product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528826.1 transl_table 11 codon_start 1 locus_tag LOCUS_23290 CDS 173666..174031 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23300 CDS complement(174028..174621) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528824.1 transl_table 11 codon_start 1 locus_tag LOCUS_23310 CDS complement(174669..175493) product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398646.1 transl_table 11 codon_start 1 locus_tag LOCUS_23320 CDS 175850..178348 product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967531.1 transl_table 11 codon_start 1 locus_tag LOCUS_23330 CDS complement(178406..179440) product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003514078.1 transl_table 11 codon_start 1 locus_tag LOCUS_23340 CDS 179943..181823 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312115.1 transl_table 11 codon_start 1 locus_tag LOCUS_23350 CDS complement(181894..183006) product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037390438.1 transl_table 11 codon_start 1 locus_tag LOCUS_23360 gene leuB CDS complement(183141..183746) product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972565.1 transl_table 11 codon_start 1 locus_tag LOCUS_23370 gene leuD CDS 183856..184725 product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024504050.1 transl_table 11 codon_start 1 locus_tag LOCUS_23380 CDS 184728..184934 product DUF1737 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003505258.1 transl_table 11 codon_start 1 locus_tag LOCUS_23390 CDS complement(184928..185353) product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528779.1 transl_table 11 codon_start 1 locus_tag LOCUS_23400 CDS complement(185416..185625) product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528775.1 transl_table 11 codon_start 1 locus_tag LOCUS_23410 CDS complement(185637..186311) product LON peptidase substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528774.1 transl_table 11 codon_start 1 locus_tag LOCUS_23420 CDS complement(186328..187284) product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528773.1 transl_table 11 codon_start 1 locus_tag LOCUS_23430 gene trxA tRNA 187582..187656 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00280 CDS complement(187757..188800) product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528740.1 transl_table 11 codon_start 1 locus_tag LOCUS_23440 gene holA CDS 189047..190594 product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528802.1 transl_table 11 codon_start 1 locus_tag LOCUS_23450 gene ffh CDS 190606..190920 product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310875.1 transl_table 11 codon_start 1 locus_tag LOCUS_23460 CDS 190971..191345 product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529742.1 transl_table 11 codon_start 1 locus_tag LOCUS_23470 gene rpsP CDS complement(191386..191706) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23480 CDS complement(192404..194383) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23490 CDS complement(194438..195304) product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528737.1 transl_table 11 codon_start 1 locus_tag LOCUS_23500 CDS complement(195321..196133) product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528736.1 transl_table 11 codon_start 1 locus_tag LOCUS_23510 CDS complement(196123..196782) product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528735.1 transl_table 11 codon_start 1 locus_tag LOCUS_23520 gene rsmG CDS complement(196779..197636) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23530 CDS complement(198722..200017) product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528733.1 transl_table 11 codon_start 1 locus_tag LOCUS_23540 gene mnmE CDS complement(200083..201348) product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970587.1 transl_table 11 codon_start 1 locus_tag LOCUS_23550 gene rho CDS complement(201490..201984) product protoporphyrinogen oxidase HemJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528731.1 transl_table 11 codon_start 1 locus_tag LOCUS_23560 gene hemJ CDS complement(201981..202472) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23570 CDS 203398..204228 product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528729.1 transl_table 11 codon_start 1 locus_tag LOCUS_23580 CDS 204262..204858 product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528728.1 transl_table 11 codon_start 1 locus_tag LOCUS_23590 CDS 204851..205684 product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528727.1 transl_table 11 codon_start 1 locus_tag LOCUS_23600 CDS 205681..206268 product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121651353.1 transl_table 11 codon_start 1 locus_tag LOCUS_23610 gene coaE CDS 206320..207021 product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531724.1 transl_table 11 codon_start 1 locus_tag LOCUS_23620 gene dnaQ CDS complement(207071..207571) product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528724.1 transl_table 11 codon_start 1 locus_tag LOCUS_23630 gene secB CDS complement(207670..208146) product membrane protein FxsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528723.1 transl_table 11 codon_start 1 locus_tag LOCUS_23640 gene fxsA CDS 208270..209031 product Tim44/TimA family putative adaptor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528722.1 transl_table 11 codon_start 1 locus_tag LOCUS_23650 CDS complement(209335..209565) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23660 CDS 209739..210149 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23670 CDS 210155..210700 product Smr/MutS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528720.1 transl_table 11 codon_start 1 locus_tag LOCUS_23680 CDS 210697..211071 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528719.1 transl_table 11 codon_start 1 locus_tag LOCUS_23690 CDS complement(211072..211998) product DUF1402 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063170435.1 transl_table 11 codon_start 1 locus_tag LOCUS_23700 CDS complement(212199..213509) product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528355.1 transl_table 11 codon_start 1 locus_tag LOCUS_23710 gene hslU CDS complement(213571..214116) product DUF2585 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528354.1 transl_table 11 codon_start 1 locus_tag LOCUS_23720 CDS complement(214174..214722) product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528351.1 transl_table 11 codon_start 1 locus_tag LOCUS_23730 gene hslV CDS 214926..215534 product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528350.1 transl_table 11 codon_start 1 locus_tag LOCUS_23740 gene hisB CDS 215539..215964 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23750 CDS 215986..216639 product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528348.1 transl_table 11 codon_start 1 locus_tag LOCUS_23760 gene hisH CDS 216636..217376 product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531989.1 transl_table 11 codon_start 1 locus_tag LOCUS_23770 gene hisA CDS 217373..218173 product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330419.1 transl_table 11 codon_start 1 locus_tag LOCUS_23780 gene hisF CDS 218170..218499 product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311110.1 transl_table 11 codon_start 1 locus_tag LOCUS_23790 CDS 218524..219486 product type I pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528342.1 transl_table 11 codon_start 1 locus_tag LOCUS_23800 gene coaA CDS complement(219538..221145) product phosphoenolpyruvate carboxykinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528338.1 transl_table 11 codon_start 1 locus_tag LOCUS_23810 CDS 221450..222151 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528337.1 transl_table 11 codon_start 1 locus_tag LOCUS_23820 CDS 222205..223986 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528336.1 transl_table 11 codon_start 1 locus_tag LOCUS_23830 CDS complement(224076..224456) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23840 CDS 224604..225005 product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010912939.1 transl_table 11 codon_start 1 locus_tag LOCUS_23850 CDS 225024..225311 product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311103.1 transl_table 11 codon_start 1 locus_tag LOCUS_23860 CDS 225440..226831 product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528332.1 transl_table 11 codon_start 1 locus_tag LOCUS_23870 gene ahcY CDS 227145..229586 product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528331.1 transl_table 11 codon_start 1 locus_tag LOCUS_23880 CDS 229586..231094 product bifunctional tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE/phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528330.1 transl_table 11 codon_start 1 locus_tag LOCUS_23890 CDS 231097..231822 product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528329.1 transl_table 11 codon_start 1 locus_tag LOCUS_23900 CDS 231819..234947 product double-strand break repair protein AddB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528328.1 transl_table 11 codon_start 1 locus_tag LOCUS_23910 gene addB CDS 234944..238432 product double-strand break repair helicase AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528327.1 transl_table 11 codon_start 1 locus_tag LOCUS_23920 gene addA CDS 238449..239075 product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314066.1 transl_table 11 codon_start 1 locus_tag LOCUS_23930 CDS complement(239088..241820) product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528055.1 transl_table 11 codon_start 1 locus_tag LOCUS_23940 gene mutS CDS 241938..244223 product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528054.1 transl_table 11 codon_start 1 locus_tag LOCUS_23950 CDS 244236..244949 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968552.1 transl_table 11 codon_start 1 locus_tag LOCUS_23960 gene tsaB CDS 244952..245473 product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527909.1 transl_table 11 codon_start 1 locus_tag LOCUS_23970 gene rimI CDS 245480..246268 product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527908.1 transl_table 11 codon_start 1 locus_tag LOCUS_23980 CDS 246398..247777 product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024503457.1 transl_table 11 codon_start 1 locus_tag LOCUS_23990 gene miaB CDS 247774..248832 product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527906.1 transl_table 11 codon_start 1 locus_tag LOCUS_24000 CDS 248829..249371 product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527905.1 transl_table 11 codon_start 1 locus_tag LOCUS_24010 gene ybeY CDS 249523..250443 product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527904.1 transl_table 11 codon_start 1 locus_tag LOCUS_24020 CDS 250644..252257 product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527902.1 transl_table 11 codon_start 1 locus_tag LOCUS_24030 gene lnt CDS 252358..252777 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970843.1 transl_table 11 codon_start 1 locus_tag LOCUS_24040 CDS 252912..254441 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529633.1 transl_table 11 codon_start 1 locus_tag LOCUS_24050 CDS 254441..255574 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529632.1 transl_table 11 codon_start 1 locus_tag LOCUS_24060 CDS 255576..256547 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529631.1 transl_table 11 codon_start 1 locus_tag LOCUS_24070 CDS 256549..256950 product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529630.1 transl_table 11 codon_start 1 locus_tag LOCUS_24080 gene cdd CDS 256947..257750 product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529629.1 transl_table 11 codon_start 1 locus_tag LOCUS_24090 CDS 257808..259127 product thymidine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529628.1 transl_table 11 codon_start 1 locus_tag LOCUS_24100 gene deoA CDS complement(259152..259781) product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529626.1 transl_table 11 codon_start 1 locus_tag LOCUS_24110 gene upp CDS complement(259861..260856) product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970674.1 transl_table 11 codon_start 1 locus_tag LOCUS_24120 CDS 260960..261736 product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529624.1 transl_table 11 codon_start 1 locus_tag LOCUS_24130 gene ubiE CDS 261746..263320 product 2-polyprenylphenol 6-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529623.1 transl_table 11 codon_start 1 locus_tag LOCUS_24140 gene ubiB CDS 263350..264573 product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529620.1 transl_table 11 codon_start 1 locus_tag LOCUS_24150 gene coaBC CDS complement(264611..266200) product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528039.1 transl_table 11 codon_start 1 locus_tag LOCUS_24160 CDS 266423..266893 product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970813.1 transl_table 11 codon_start 1 locus_tag LOCUS_24170 gene dut sequence08 source 1..249832 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1185..1592 product YcgN family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530173.1 transl_table 11 codon_start 1 locus_tag LOCUS_24180 CDS 1623..1841 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24190 CDS 1993..2352 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24200 CDS complement(2386..3093) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24210 CDS 3342..4538 product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528870.1 transl_table 11 codon_start 1 locus_tag LOCUS_24220 CDS complement(4595..5119) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24230 tRNA complement(5414..5490) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00290 CDS 5606..6322 product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530175.1 transl_table 11 codon_start 1 locus_tag LOCUS_24240 CDS 6403..6861 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966268.1 transl_table 11 codon_start 1 locus_tag LOCUS_24250 CDS complement(6889..9459) product HWE histidine kinase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972107.1 transl_table 11 codon_start 1 locus_tag LOCUS_24260 CDS 9640..10140 product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974554.1 transl_table 11 codon_start 1 locus_tag LOCUS_24270 CDS 10307..11632 product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529313.1 transl_table 11 codon_start 1 locus_tag LOCUS_24280 CDS 11638..12666 product thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252663.1 transl_table 11 codon_start 1 locus_tag LOCUS_24290 CDS 12663..13661 product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529315.1 transl_table 11 codon_start 1 locus_tag LOCUS_24300 CDS 13661..14974 product pyruvate dehydrogenase complex dihydrolipoamide acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529316.1 transl_table 11 codon_start 1 locus_tag LOCUS_24310 CDS complement(15089..15751) product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529325.1 transl_table 11 codon_start 1 locus_tag LOCUS_24320 CDS 15966..16409 product transcriptional regulator GutM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529327.1 transl_table 11 codon_start 1 locus_tag LOCUS_24330 CDS 16448..17209 product PTS glucitol/sorbitol transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529328.1 transl_table 11 codon_start 1 locus_tag LOCUS_24340 CDS 17225..18250 product PTS glucitol/sorbitol transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529329.1 transl_table 11 codon_start 1 locus_tag LOCUS_24350 CDS 18345..18725 product PTS glucitol/sorbitol transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529330.1 transl_table 11 codon_start 1 locus_tag LOCUS_24360 CDS 18792..20765 product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529331.1 transl_table 11 codon_start 1 locus_tag LOCUS_24370 gene ptsP CDS 20984..21943 product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529333.1 transl_table 11 codon_start 1 locus_tag LOCUS_24380 CDS complement(21997..23919) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470598.1 transl_table 11 codon_start 1 locus_tag LOCUS_24390 CDS complement(24249..24485) product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027999378.1 transl_table 11 codon_start 1 locus_tag LOCUS_24400 CDS 24642..25124 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527979.1 transl_table 11 codon_start 1 locus_tag LOCUS_24410 CDS complement(25178..26938) product glucan ABC transporter ATP-binding protein/ permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532297.1 transl_table 11 codon_start 1 locus_tag LOCUS_24420 CDS complement(27144..35738) product glucoamylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532298.1 transl_table 11 codon_start 1 locus_tag LOCUS_24430 CDS 35968..36861 product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066923.1 transl_table 11 codon_start 1 locus_tag LOCUS_24440 gene galU CDS 37169..39019 product autotransporter assembly complex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530880.1 transl_table 11 codon_start 1 locus_tag LOCUS_24450 CDS 39078..41357 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24460 note possible pseudo, frameshifted assembly_gap 41136..41202 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 41350..43248 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24470 note possible pseudo, frameshifted CDS complement(43364..45019) product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530919.1 transl_table 11 codon_start 1 locus_tag LOCUS_24480 CDS complement(45016..46197) product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530920.1 transl_table 11 codon_start 1 locus_tag LOCUS_24490 CDS complement(46294..47220) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396993.1 transl_table 11 codon_start 1 locus_tag LOCUS_24500 CDS 47320..48969 product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242905.1 transl_table 11 codon_start 1 locus_tag LOCUS_24510 gene ettA CDS 49188..49727 product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972294.1 transl_table 11 codon_start 1 locus_tag LOCUS_24520 CDS 49783..50550 product trans-aconitate 2-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530924.1 transl_table 11 codon_start 1 locus_tag LOCUS_24530 gene tam CDS 50644..51261 product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530927.1 transl_table 11 codon_start 1 locus_tag LOCUS_24540 CDS complement(51265..51579) product DUF2293 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530931.1 transl_table 11 codon_start 1 locus_tag LOCUS_24550 CDS 51721..52740 product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530933.1 transl_table 11 codon_start 1 locus_tag LOCUS_24560 CDS 52740..53645 product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530934.1 transl_table 11 codon_start 1 locus_tag LOCUS_24570 gene metF CDS complement(54036..55208) product lytic murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530937.1 transl_table 11 codon_start 1 locus_tag LOCUS_24580 CDS complement(55318..56136) product GH25 family lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530938.1 transl_table 11 codon_start 1 locus_tag LOCUS_24590 CDS complement(56331..56999) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530940.1 transl_table 11 codon_start 1 locus_tag LOCUS_24600 CDS complement(57002..58243) product DUF3419 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530941.1 transl_table 11 codon_start 1 locus_tag LOCUS_24610 CDS 58396..58833 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24620 CDS 59068..59745 product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530945.1 transl_table 11 codon_start 1 locus_tag LOCUS_24630 CDS 59927..60730 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24640 CDS 61626..62078 product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530948.1 transl_table 11 codon_start 1 locus_tag LOCUS_24650 gene mraZ CDS 62075..63073 product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530949.1 transl_table 11 codon_start 1 locus_tag LOCUS_24660 gene rsmH CDS 63077..63466 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530950.1 transl_table 11 codon_start 1 locus_tag LOCUS_24670 CDS 63463..65175 product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530951.1 transl_table 11 codon_start 1 locus_tag LOCUS_24680 CDS 65232..66680 product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530952.1 transl_table 11 codon_start 1 locus_tag LOCUS_24690 CDS 66677..68098 product UDP-N-acetylmuramoylalanyl-D-glutamyl-2,6-diaminopimelate--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530953.1 transl_table 11 codon_start 1 locus_tag LOCUS_24700 CDS 68287..69369 product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530954.1 transl_table 11 codon_start 1 locus_tag LOCUS_24710 gene mraY CDS 69376..70782 product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530955.1 transl_table 11 codon_start 1 locus_tag LOCUS_24720 gene murD CDS 70776..71927 product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530956.1 transl_table 11 codon_start 1 locus_tag LOCUS_24730 gene ftsW CDS 71924..73024 product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976212.1 transl_table 11 codon_start 1 locus_tag LOCUS_24740 gene murG CDS 73077..74483 product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530958.1 transl_table 11 codon_start 1 locus_tag LOCUS_24750 gene murC CDS 74480..75439 product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530959.1 transl_table 11 codon_start 1 locus_tag LOCUS_24760 gene murB CDS 75860..76786 product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530960.1 transl_table 11 codon_start 1 locus_tag LOCUS_24770 CDS 76774..77709 product cell division protein FtsQ/DivIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530961.1 transl_table 11 codon_start 1 locus_tag LOCUS_24780 CDS 77706..79016 product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530962.1 transl_table 11 codon_start 1 locus_tag LOCUS_24790 gene ftsA CDS 79174..80913 product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530963.1 transl_table 11 codon_start 1 locus_tag LOCUS_24800 gene ftsZ CDS complement(81078..82274) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24810 CDS 82427..83332 product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530964.1 transl_table 11 codon_start 1 locus_tag LOCUS_24820 gene lpxC CDS 83487..84329 product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530965.1 transl_table 11 codon_start 1 locus_tag LOCUS_24830 CDS 84339..86006 product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530966.1 transl_table 11 codon_start 1 locus_tag LOCUS_24840 gene recN CDS complement(86028..86660) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24850 CDS 87500..89668 product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242938.1 transl_table 11 codon_start 1 locus_tag LOCUS_24860 gene ligA CDS 89861..90649 product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530969.1 transl_table 11 codon_start 1 locus_tag LOCUS_24870 CDS 90646..90951 product AzlD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530970.1 transl_table 11 codon_start 1 locus_tag LOCUS_24880 CDS 91050..92165 product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267808.1 transl_table 11 codon_start 1 locus_tag LOCUS_24890 CDS complement(92207..94039) product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530971.1 transl_table 11 codon_start 1 locus_tag LOCUS_24900 CDS 94371..94550 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24910 CDS complement(94630..95382) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369251.1 transl_table 11 codon_start 1 locus_tag LOCUS_24920 CDS 95524..96396 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109873241.1 transl_table 11 codon_start 1 locus_tag LOCUS_24930 CDS complement(96420..97310) product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530972.1 transl_table 11 codon_start 1 locus_tag LOCUS_24940 CDS complement(97340..97927) product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530973.1 transl_table 11 codon_start 1 locus_tag LOCUS_24950 CDS complement(97948..98097) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24960 CDS 98251..98730 product CreA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530974.1 transl_table 11 codon_start 1 locus_tag LOCUS_24970 CDS 98727..99386 product DapH/DapD/GlmU-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530975.1 transl_table 11 codon_start 1 locus_tag LOCUS_24980 CDS complement(99752..101116) product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971161.1 transl_table 11 codon_start 1 locus_tag LOCUS_24990 CDS complement(101381..103876) product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530996.1 transl_table 11 codon_start 1 locus_tag LOCUS_25000 CDS complement(104010..104249) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25010 CDS complement(104400..104897) product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531007.1 transl_table 11 codon_start 1 locus_tag LOCUS_25020 CDS 104994..106409 product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531008.1 transl_table 11 codon_start 1 locus_tag LOCUS_25030 CDS complement(106446..107441) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25040 CDS complement(107619..109763) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25050 CDS 110045..113596 product AsmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531011.1 transl_table 11 codon_start 1 locus_tag LOCUS_25060 CDS complement(113599..113817) product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976159.1 transl_table 11 codon_start 1 locus_tag LOCUS_25070 CDS complement(113814..114329) product SspB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531016.1 transl_table 11 codon_start 1 locus_tag LOCUS_25080 CDS 114219..114536 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25090 CDS 115050..115361 product DUF2853 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311776.1 transl_table 11 codon_start 1 locus_tag LOCUS_25100 CDS 115502..116413 product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126922044.1 transl_table 11 codon_start 1 locus_tag LOCUS_25110 CDS 116416..116910 product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531029.1 transl_table 11 codon_start 1 locus_tag LOCUS_25120 CDS 117287..117493 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25130 CDS 117502..118422 product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531030.1 transl_table 11 codon_start 1 locus_tag LOCUS_25140 gene hflK CDS 118422..119342 product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531031.1 transl_table 11 codon_start 1 locus_tag LOCUS_25150 CDS 119358..119543 product DUF2065 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531032.1 transl_table 11 codon_start 1 locus_tag LOCUS_25160 CDS 119740..121200 product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531033.1 transl_table 11 codon_start 1 locus_tag LOCUS_25170 CDS complement(121266..121832) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531034.1 transl_table 11 codon_start 1 locus_tag LOCUS_25180 CDS complement(121829..122764) product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531035.1 transl_table 11 codon_start 1 locus_tag LOCUS_25190 gene serB CDS 122724..123680 product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531036.1 transl_table 11 codon_start 1 locus_tag LOCUS_25200 gene miaA CDS 123785..124579 product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531037.1 transl_table 11 codon_start 1 locus_tag LOCUS_25210 CDS complement(124590..126749) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25220 CDS 127118..128905 product acetolactate synthase 3 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082827432.1 transl_table 11 codon_start 1 locus_tag LOCUS_25230 CDS 128930..129505 product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531048.1 transl_table 11 codon_start 1 locus_tag LOCUS_25240 gene ilvN CDS 129505..130125 product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531049.1 transl_table 11 codon_start 1 locus_tag LOCUS_25250 CDS 130244..131371 product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531055.1 transl_table 11 codon_start 1 locus_tag LOCUS_25260 CDS complement(131399..131794) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25270 CDS 131901..132641 product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531057.1 transl_table 11 codon_start 1 locus_tag LOCUS_25280 CDS 132809..134719 product potassium transporter Kup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531058.1 transl_table 11 codon_start 1 locus_tag LOCUS_25290 CDS 134863..135504 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173714.1 transl_table 11 codon_start 1 locus_tag LOCUS_25300 CDS 135525..136544 product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328859.1 transl_table 11 codon_start 1 locus_tag LOCUS_25310 gene ilvC CDS complement(136715..136903) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25320 CDS 137416..137769 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25330 CDS complement(137835..138881) product glycine betaine/L-proline ABC transporter substrate-binding protein ProX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370071.1 transl_table 11 codon_start 1 locus_tag LOCUS_25340 gene proX CDS complement(138975..139730) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25350 tRNA complement(139888..139963) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00300 CDS complement(140061..140621) product putative glycolipid-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531407.1 transl_table 11 codon_start 1 locus_tag LOCUS_25360 CDS complement(140634..141545) product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531073.1 transl_table 11 codon_start 1 locus_tag LOCUS_25370 CDS 141621..142826 product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531089.1 transl_table 11 codon_start 1 locus_tag LOCUS_25380 CDS complement(142818..143618) product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531124.1 transl_table 11 codon_start 1 locus_tag LOCUS_25390 CDS 143783..146287 product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531144.1 transl_table 11 codon_start 1 locus_tag LOCUS_25400 CDS 146436..147875 product UbiA family prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531146.1 transl_table 11 codon_start 1 locus_tag LOCUS_25410 CDS 147875..149194 product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531147.1 transl_table 11 codon_start 1 locus_tag LOCUS_25420 CDS 149356..149844 product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531148.1 transl_table 11 codon_start 1 locus_tag LOCUS_25430 CDS 149844..150866 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531149.1 transl_table 11 codon_start 1 locus_tag LOCUS_25440 CDS 150863..152299 product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109667839.1 transl_table 11 codon_start 1 locus_tag LOCUS_25450 CDS 152373..153557 product glycosyltransferase 87 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531151.1 transl_table 11 codon_start 1 locus_tag LOCUS_25460 CDS 153664..154578 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531163.1 transl_table 11 codon_start 1 locus_tag LOCUS_25470 CDS complement(154575..155240) product exopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390496.1 transl_table 11 codon_start 1 locus_tag LOCUS_25480 CDS complement(155259..155828) product DUF4893 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531172.1 transl_table 11 codon_start 1 locus_tag LOCUS_25490 CDS complement(156181..157068) product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531206.1 transl_table 11 codon_start 1 locus_tag LOCUS_25500 gene mmsB CDS complement(157094..158263) product isobutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531207.1 transl_table 11 codon_start 1 locus_tag LOCUS_25510 CDS complement(158456..159208) product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531111.1 transl_table 11 codon_start 1 locus_tag LOCUS_25520 gene lipB tRNA 159584..159668 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00310 CDS complement(159728..159970) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25530 CDS complement(160036..160245) product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967067.1 transl_table 11 codon_start 1 locus_tag LOCUS_25540 CDS complement(160499..161149) product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968514.1 transl_table 11 codon_start 1 locus_tag LOCUS_25550 CDS 161239..162237 product glutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314081.1 transl_table 11 codon_start 1 locus_tag LOCUS_25560 CDS complement(162640..163176) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25570 CDS 163182..163364 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25580 CDS 163623..165050 product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531112.1 transl_table 11 codon_start 1 locus_tag LOCUS_25590 gene mgtE CDS 165180..165572 product MerR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531113.1 transl_table 11 codon_start 1 locus_tag LOCUS_25600 CDS complement(166055..166303) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25610 CDS 166479..167489 product DUF1624 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531115.1 transl_table 11 codon_start 1 locus_tag LOCUS_25620 CDS 167563..167754 product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968084.1 transl_table 11 codon_start 1 locus_tag LOCUS_25630 CDS complement(167818..168309) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967890.1 transl_table 11 codon_start 1 locus_tag LOCUS_25640 CDS 168415..169221 product Ku protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395528.1 transl_table 11 codon_start 1 locus_tag LOCUS_25650 CDS complement(169222..171714) product DNA ligase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395526.1 transl_table 11 codon_start 1 locus_tag LOCUS_25660 gene ligD CDS complement(171718..172533) product Ku protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253416.1 transl_table 11 codon_start 1 locus_tag LOCUS_25670 CDS complement(172797..173843) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530819.1 transl_table 11 codon_start 1 locus_tag LOCUS_25680 CDS 173934..174950 product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974199.1 transl_table 11 codon_start 1 locus_tag LOCUS_25690 CDS 174922..175620 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25700 CDS 175630..176913 product ribulose-bisphosphate carboxylase large subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064440.1 transl_table 11 codon_start 1 locus_tag LOCUS_25710 CDS 176916..178193 product four-carbon acid sugar kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975440.1 transl_table 11 codon_start 1 locus_tag LOCUS_25720 CDS complement(178177..178713) product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975569.1 transl_table 11 codon_start 1 locus_tag LOCUS_25730 CDS 178785..179099 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531559.1 transl_table 11 codon_start 1 locus_tag LOCUS_25740 CDS 179131..179634 product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531567.1 transl_table 11 codon_start 1 locus_tag LOCUS_25750 CDS 179701..180246 product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972952.1 transl_table 11 codon_start 1 locus_tag LOCUS_25760 CDS complement(180243..180485) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25770 CDS complement(180647..180832) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25780 CDS 180937..181791 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329942.1 transl_table 11 codon_start 1 locus_tag LOCUS_25790 CDS 182139..183038 product transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528412.1 transl_table 11 codon_start 1 locus_tag LOCUS_25800 gene gcvA CDS complement(183048..183287) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534932.1 transl_table 11 codon_start 1 locus_tag LOCUS_25810 CDS 183317..183520 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25820 CDS 183576..183860 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25830 CDS 184000..184242 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25840 CDS complement(184810..188577) product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529536.1 transl_table 11 codon_start 1 locus_tag LOCUS_25850 CDS complement(189139..190659) product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337282.1 transl_table 11 codon_start 1 locus_tag LOCUS_25860 CDS complement(190802..191287) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532018.1 transl_table 11 codon_start 1 locus_tag LOCUS_25870 CDS complement(191400..191666) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25880 CDS complement(191733..192233) product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532017.1 transl_table 11 codon_start 1 locus_tag LOCUS_25890 gene gpt CDS complement(192297..193133) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532016.1 transl_table 11 codon_start 1 locus_tag LOCUS_25900 CDS complement(193208..193975) product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532015.1 transl_table 11 codon_start 1 locus_tag LOCUS_25910 CDS 194159..194758 product NAD(P)H:quinone oxidoreductase type IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003528068.1 transl_table 11 codon_start 1 locus_tag LOCUS_25920 gene wrbA CDS complement(194856..195311) product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531233.1 transl_table 11 codon_start 1 locus_tag LOCUS_25930 CDS 195483..199100 product bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase PutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531234.1 transl_table 11 codon_start 1 locus_tag LOCUS_25940 gene putA CDS complement(199200..199514) product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531236.1 transl_table 11 codon_start 1 locus_tag LOCUS_25950 CDS complement(199626..201779) product TonB-dependent hemoglobin/transferrin/lactoferrin family receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531239.1 transl_table 11 codon_start 1 locus_tag LOCUS_25960 CDS 201974..202180 product hemin uptake protein HemP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066560.1 transl_table 11 codon_start 1 locus_tag LOCUS_25970 gene hemP CDS 202197..203285 product hemin-degrading factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531241.1 transl_table 11 codon_start 1 locus_tag LOCUS_25980 CDS 203296..204180 product hemin ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969934.1 transl_table 11 codon_start 1 locus_tag LOCUS_25990 CDS 204259..205338 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531243.1 transl_table 11 codon_start 1 locus_tag LOCUS_26000 CDS 205349..206146 product heme ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531244.1 transl_table 11 codon_start 1 locus_tag LOCUS_26010 CDS complement(206171..206632) product iron-responsive transcriptional regulator RirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531245.1 transl_table 11 codon_start 1 locus_tag LOCUS_26020 gene rirA CDS 206873..207463 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086935.1 transl_table 11 codon_start 1 locus_tag LOCUS_26030 CDS complement(207571..208269) product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531256.1 transl_table 11 codon_start 1 locus_tag LOCUS_26040 CDS complement(208411..208863) product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968461.1 transl_table 11 codon_start 1 locus_tag LOCUS_26050 CDS complement(208997..209704) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26060 CDS 209856..210842 product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531715.1 transl_table 11 codon_start 1 locus_tag LOCUS_26070 CDS 210916..211557 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26080 CDS complement(211558..213069) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531714.1 transl_table 11 codon_start 1 locus_tag LOCUS_26090 CDS 213167..213793 product thermonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063167987.1 transl_table 11 codon_start 1 locus_tag LOCUS_26100 CDS 213819..214430 product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531712.1 transl_table 11 codon_start 1 locus_tag LOCUS_26110 CDS 214501..215040 product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531711.1 transl_table 11 codon_start 1 locus_tag LOCUS_26120 CDS 215148..215636 product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006205209.1 transl_table 11 codon_start 1 locus_tag LOCUS_26130 CDS complement(215693..216562) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531708.1 transl_table 11 codon_start 1 locus_tag LOCUS_26140 CDS complement(216582..217394) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531707.1 transl_table 11 codon_start 1 locus_tag LOCUS_26150 CDS complement(217391..218101) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975738.1 transl_table 11 codon_start 1 locus_tag LOCUS_26160 CDS complement(218179..218934) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531705.1 transl_table 11 codon_start 1 locus_tag LOCUS_26170 CDS complement(219086..219586) product molybdopterin-guanine dinucleotide biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085099.1 transl_table 11 codon_start 1 locus_tag LOCUS_26180 gene mobB CDS complement(219597..220190) product molybdenum cofactor guanylyltransferase MobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971807.1 transl_table 11 codon_start 1 locus_tag LOCUS_26190 gene mobA CDS complement(220180..221100) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531702.1 transl_table 11 codon_start 1 locus_tag LOCUS_26200 CDS complement(221193..222209) product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531699.1 transl_table 11 codon_start 1 locus_tag LOCUS_26210 gene moaA CDS 222300..222647 product DUF971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531698.1 transl_table 11 codon_start 1 locus_tag LOCUS_26220 CDS 222656..223270 product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531697.1 transl_table 11 codon_start 1 locus_tag LOCUS_26230 CDS complement(223336..223953) product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172955.1 transl_table 11 codon_start 1 locus_tag LOCUS_26240 CDS 224267..226195 product murein L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531691.1 transl_table 11 codon_start 1 locus_tag LOCUS_26250 CDS 226274..228469 product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399174.1 transl_table 11 codon_start 1 locus_tag LOCUS_26260 CDS complement(228474..228887) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530143.1 transl_table 11 codon_start 1 locus_tag LOCUS_26270 tRNA complement(228997..229071) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00320 CDS complement(229165..229848) product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531667.1 transl_table 11 codon_start 1 locus_tag LOCUS_26280 CDS 229992..230687 product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531666.1 transl_table 11 codon_start 1 locus_tag LOCUS_26290 gene rpiA CDS 230706..231242 product DUF2059 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531665.1 transl_table 11 codon_start 1 locus_tag LOCUS_26300 CDS 231377..232768 product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971739.1 transl_table 11 codon_start 1 locus_tag LOCUS_26310 gene gor CDS 232770..233372 product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456648.1 transl_table 11 codon_start 1 locus_tag LOCUS_26320 CDS 233589..234965 product 3-deoxy-7-phosphoheptulonate synthase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531905.1 transl_table 11 codon_start 1 locus_tag LOCUS_26330 CDS 235185..236423 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966287.1 transl_table 11 codon_start 1 locus_tag LOCUS_26340 CDS complement(236445..236627) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26350 CDS complement(236606..237997) product methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531313.1 transl_table 11 codon_start 1 locus_tag LOCUS_26360 gene trmFO CDS 238176..241634 product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531941.1 transl_table 11 codon_start 1 locus_tag LOCUS_26370 gene dnaE CDS complement(241631..242125) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26380 CDS complement(242264..243589) product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531937.1 transl_table 11 codon_start 1 locus_tag LOCUS_26390 CDS complement(243669..243959) product DUF3572 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531933.1 transl_table 11 codon_start 1 locus_tag LOCUS_26400 CDS 244135..244506 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531932.1 transl_table 11 codon_start 1 locus_tag LOCUS_26410 CDS 244537..245910 product PleD family two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531931.1 transl_table 11 codon_start 1 locus_tag LOCUS_26420 CDS complement(245957..246241) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531420.1 transl_table 11 codon_start 1 locus_tag LOCUS_26430 CDS 246654..247025 product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003507760.1 transl_table 11 codon_start 1 locus_tag LOCUS_26440 gene rpsL CDS 247106..247576 product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008875664.1 transl_table 11 codon_start 1 locus_tag LOCUS_26450 gene rpsG CDS 247607..249715 product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531421.1 transl_table 11 codon_start 1 locus_tag LOCUS_26460 gene fusA sequence09 source 1..231674 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 391..2334 product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173803.1 transl_table 11 codon_start 1 locus_tag LOCUS_26470 CDS complement(2849..4267) product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529466.1 transl_table 11 codon_start 1 locus_tag LOCUS_26480 CDS complement(4396..7002) product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529464.1 transl_table 11 codon_start 1 locus_tag LOCUS_26490 gene clpB CDS complement(7221..8000) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26500 CDS complement(8303..9172) product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529462.1 transl_table 11 codon_start 1 locus_tag LOCUS_26510 gene prmC CDS complement(9165..10244) product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529461.1 transl_table 11 codon_start 1 locus_tag LOCUS_26520 gene prfA CDS complement(10307..12577) product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529460.1 transl_table 11 codon_start 1 locus_tag LOCUS_26530 gene ptsP CDS complement(12875..14131) product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529459.1 transl_table 11 codon_start 1 locus_tag LOCUS_26540 CDS complement(14277..15038) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089319.1 transl_table 11 codon_start 1 locus_tag LOCUS_26550 CDS complement(15035..15961) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921202.1 transl_table 11 codon_start 1 locus_tag LOCUS_26560 CDS 16148..16915 product bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529456.1 transl_table 11 codon_start 1 locus_tag LOCUS_26570 gene ubiG CDS complement(16922..17347) product DUF1178 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529451.1 transl_table 11 codon_start 1 locus_tag LOCUS_26580 CDS complement(17408..18247) product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529450.1 transl_table 11 codon_start 1 locus_tag LOCUS_26590 CDS complement(18244..18507) product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315748.1 transl_table 11 codon_start 1 locus_tag LOCUS_26600 gene grxC CDS complement(18529..19140) product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529448.1 transl_table 11 codon_start 1 locus_tag LOCUS_26610 CDS 19388..20245 product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529447.1 transl_table 11 codon_start 1 locus_tag LOCUS_26620 CDS complement(20260..20433) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26630 CDS complement(20531..20833) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529445.1 transl_table 11 codon_start 1 locus_tag LOCUS_26640 CDS complement(20921..21331) product 8-oxo-dGTP diphosphatase MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709175.1 transl_table 11 codon_start 1 locus_tag LOCUS_26650 gene mutT CDS complement(21324..22106) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529443.1 transl_table 11 codon_start 1 locus_tag LOCUS_26660 CDS complement(22087..23370) product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529442.1 transl_table 11 codon_start 1 locus_tag LOCUS_26670 gene argJ CDS complement(23486..24454) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529440.1 transl_table 11 codon_start 1 locus_tag LOCUS_26680 CDS 24723..27431 product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529439.1 transl_table 11 codon_start 1 locus_tag LOCUS_26690 gene secA CDS 27651..28919 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529437.1 transl_table 11 codon_start 1 locus_tag LOCUS_26700 CDS 29049..29684 product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972103.1 transl_table 11 codon_start 1 locus_tag LOCUS_26710 tRNA complement(29745..29829) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00330 CDS 30112..30630 product disulfide bond formation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529434.1 transl_table 11 codon_start 1 locus_tag LOCUS_26720 CDS complement(30631..31188) product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006328497.1 transl_table 11 codon_start 1 locus_tag LOCUS_26730 CDS complement(31332..31970) product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529433.1 transl_table 11 codon_start 1 locus_tag LOCUS_26740 CDS 32053..32925 product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253819.1 transl_table 11 codon_start 1 locus_tag LOCUS_26750 gene gluQRS CDS complement(32920..33210) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26760 CDS complement(33294..34148) product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529430.1 transl_table 11 codon_start 1 locus_tag LOCUS_26770 CDS 34263..35099 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529429.1 transl_table 11 codon_start 1 locus_tag LOCUS_26780 CDS 35124..35315 product twin transmembrane helix small protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066750.1 transl_table 11 codon_start 1 locus_tag LOCUS_26790 CDS 35326..35907 product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529427.1 transl_table 11 codon_start 1 locus_tag LOCUS_26800 CDS 35932..36705 product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529426.1 transl_table 11 codon_start 1 locus_tag LOCUS_26810 CDS 36905..37654 product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109982194.1 transl_table 11 codon_start 1 locus_tag LOCUS_26820 CDS 37673..38602 product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529424.1 transl_table 11 codon_start 1 locus_tag LOCUS_26830 CDS 38737..39618 product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529423.1 transl_table 11 codon_start 1 locus_tag LOCUS_26840 CDS complement(39696..40085) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024503765.1 transl_table 11 codon_start 1 locus_tag LOCUS_26850 CDS complement(40229..40768) product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529401.1 transl_table 11 codon_start 1 locus_tag LOCUS_26860 gene hpt CDS 41276..41416 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26870 CDS 41590..42249 product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010911739.1 transl_table 11 codon_start 1 locus_tag LOCUS_26880 gene ftsE CDS 42242..43225 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529399.1 transl_table 11 codon_start 1 locus_tag LOCUS_26890 CDS 43339..44001 product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529398.1 transl_table 11 codon_start 1 locus_tag LOCUS_26900 CDS 44094..44894 product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529394.1 transl_table 11 codon_start 1 locus_tag LOCUS_26910 CDS complement(44891..45415) product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529391.1 transl_table 11 codon_start 1 locus_tag LOCUS_26920 CDS 45477..46451 product DUF2125 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529390.1 transl_table 11 codon_start 1 locus_tag LOCUS_26930 CDS complement(46504..47439) product prephenate/arogenate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027162911.1 transl_table 11 codon_start 1 locus_tag LOCUS_26940 CDS complement(47443..48546) product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529387.1 transl_table 11 codon_start 1 locus_tag LOCUS_26950 gene hisC CDS complement(48728..48979) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26960 CDS 48878..49945 product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529386.1 transl_table 11 codon_start 1 locus_tag LOCUS_26970 CDS 49942..50559 product methionine biosynthesis protein MetW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529385.1 transl_table 11 codon_start 1 locus_tag LOCUS_26980 gene metW CDS complement(50556..51311) product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529379.1 transl_table 11 codon_start 1 locus_tag LOCUS_26990 CDS 51467..52234 product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529378.1 transl_table 11 codon_start 1 locus_tag LOCUS_27000 gene gloB CDS complement(52240..53025) product DUF3108 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529374.1 transl_table 11 codon_start 1 locus_tag LOCUS_27010 CDS 53293..53595 product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529373.1 transl_table 11 codon_start 1 locus_tag LOCUS_27020 gene rpmB CDS 53707..54384 product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529372.1 transl_table 11 codon_start 1 locus_tag LOCUS_27030 CDS complement(54404..55381) product esterase-like activity of phytase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529370.1 transl_table 11 codon_start 1 locus_tag LOCUS_27040 CDS complement(55378..57270) product cobaltochelatase subunit CobT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529369.1 transl_table 11 codon_start 1 locus_tag LOCUS_27050 gene cobT CDS complement(57277..58266) product cobaltochelatase subunit CobS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529367.1 transl_table 11 codon_start 1 locus_tag LOCUS_27060 gene cobS CDS complement(58352..58981) product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529366.1 transl_table 11 codon_start 1 locus_tag LOCUS_27070 CDS 59209..59514 product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529365.1 transl_table 11 codon_start 1 locus_tag LOCUS_27080 CDS complement(59515..60633) product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529358.1 transl_table 11 codon_start 1 locus_tag LOCUS_27090 gene aroB CDS complement(60630..61217) product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529357.1 transl_table 11 codon_start 1 locus_tag LOCUS_27100 CDS 61553..62467 product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529355.1 transl_table 11 codon_start 1 locus_tag LOCUS_27110 CDS 62566..63516 product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529354.1 transl_table 11 codon_start 1 locus_tag LOCUS_27120 CDS 63666..65024 product murein L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529353.1 transl_table 11 codon_start 1 locus_tag LOCUS_27130 CDS complement(65029..65241) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27140 CDS complement(65262..66368) product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529351.1 transl_table 11 codon_start 1 locus_tag LOCUS_27150 CDS complement(66379..67623) product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529350.1 transl_table 11 codon_start 1 locus_tag LOCUS_27160 CDS 67832..68998 product M20 aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529349.1 transl_table 11 codon_start 1 locus_tag LOCUS_27170 tRNA 69062..69138 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00340 CDS complement(69237..70100) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528510.1 transl_table 11 codon_start 1 locus_tag LOCUS_27180 CDS 70461..71504 product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703849.1 transl_table 11 codon_start 1 locus_tag LOCUS_27190 CDS 71575..71937 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967413.1 transl_table 11 codon_start 1 locus_tag LOCUS_27200 CDS complement(72047..72823) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969223.1 transl_table 11 codon_start 1 locus_tag LOCUS_27210 CDS complement(72831..74528) product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967372.1 transl_table 11 codon_start 1 locus_tag LOCUS_27220 CDS complement(74525..75505) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315795.1 transl_table 11 codon_start 1 locus_tag LOCUS_27230 CDS complement(75507..76619) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969226.1 transl_table 11 codon_start 1 locus_tag LOCUS_27240 CDS complement(76622..77452) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969227.1 transl_table 11 codon_start 1 locus_tag LOCUS_27250 CDS complement(77464..78372) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969228.1 transl_table 11 codon_start 1 locus_tag LOCUS_27260 CDS complement(78486..79778) product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969229.1 transl_table 11 codon_start 1 locus_tag LOCUS_27270 CDS complement(79821..80990) product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967366.1 transl_table 11 codon_start 1 locus_tag LOCUS_27280 CDS complement(80987..81916) product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974694.1 transl_table 11 codon_start 1 locus_tag LOCUS_27290 CDS 82049..82987 product 2-dehydro-3-deoxygalactonokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974693.1 transl_table 11 codon_start 1 locus_tag LOCUS_27300 CDS 83027..83653 product 2-dehydro-3-deoxy-6-phosphogalactonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001116472.1 transl_table 11 codon_start 1 locus_tag LOCUS_27310 CDS complement(83740..85623) product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640291.1 transl_table 11 codon_start 1 locus_tag LOCUS_27320 CDS complement(85620..87203) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267761.1 transl_table 11 codon_start 1 locus_tag LOCUS_27330 CDS complement(87216..88244) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_113175527.1 transl_table 11 codon_start 1 locus_tag LOCUS_27340 CDS complement(88241..89230) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104208.1 transl_table 11 codon_start 1 locus_tag LOCUS_27350 CDS complement(89245..90144) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040797.1 transl_table 11 codon_start 1 locus_tag LOCUS_27360 CDS complement(90141..91112) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162734144.1 transl_table 11 codon_start 1 locus_tag LOCUS_27370 CDS 91272..92177 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098566.1 transl_table 11 codon_start 1 locus_tag LOCUS_27380 CDS complement(92264..92737) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27390 CDS complement(92737..93063) product DUF883 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529287.1 transl_table 11 codon_start 1 locus_tag LOCUS_27400 CDS complement(93103..93651) product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529285.1 transl_table 11 codon_start 1 locus_tag LOCUS_27410 CDS complement(93652..93858) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27420 CDS 94084..94878 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529283.1 transl_table 11 codon_start 1 locus_tag LOCUS_27430 CDS 94951..95121 product DUF1328 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529282.1 transl_table 11 codon_start 1 locus_tag LOCUS_27440 CDS 95208..96233 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063169141.1 transl_table 11 codon_start 1 locus_tag LOCUS_27450 CDS 96483..96740 product YMGG-like glycine zipper-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_120705985.1 transl_table 11 codon_start 1 locus_tag LOCUS_27460 CDS complement(96866..97555) product phosphate regulon transcriptional regulator PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010911896.1 transl_table 11 codon_start 1 locus_tag LOCUS_27470 gene phoB CDS complement(97718..98413) product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529272.1 transl_table 11 codon_start 1 locus_tag LOCUS_27480 gene phoU CDS complement(98523..99401) product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706734.1 transl_table 11 codon_start 1 locus_tag LOCUS_27490 gene pstB CDS complement(99398..100774) product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207314.1 transl_table 11 codon_start 1 locus_tag LOCUS_27500 gene pstA CDS complement(100777..102150) product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119004.1 transl_table 11 codon_start 1 locus_tag LOCUS_27510 gene pstC CDS complement(102291..103304) product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066878074.1 transl_table 11 codon_start 1 locus_tag LOCUS_27520 CDS 103477..103662 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27530 tRNA complement(104534..104608) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00350 CDS complement(104672..105031) product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529257.1 transl_table 11 codon_start 1 locus_tag LOCUS_27540 CDS 105053..106108 product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529256.1 transl_table 11 codon_start 1 locus_tag LOCUS_27550 CDS 106351..107250 product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529255.1 transl_table 11 codon_start 1 locus_tag LOCUS_27560 gene rpoH CDS complement(107328..108827) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529163.1 transl_table 11 codon_start 1 locus_tag LOCUS_27570 CDS complement(109061..110350) product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529162.1 transl_table 11 codon_start 1 locus_tag LOCUS_27580 CDS 110555..111457 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970157.1 transl_table 11 codon_start 1 locus_tag LOCUS_27590 CDS complement(111515..113113) product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529159.1 transl_table 11 codon_start 1 locus_tag LOCUS_27600 gene serA CDS complement(113223..114398) product phosphoserine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529158.1 transl_table 11 codon_start 1 locus_tag LOCUS_27610 CDS complement(114606..115364) product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529156.1 transl_table 11 codon_start 1 locus_tag LOCUS_27620 assembly_gap 115487..115519 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(115549..116898) product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529155.1 transl_table 11 codon_start 1 locus_tag LOCUS_27630 gene glmM CDS complement(117228..119156) product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310285.1 transl_table 11 codon_start 1 locus_tag LOCUS_27640 gene ftsH CDS complement(119259..120542) product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529151.1 transl_table 11 codon_start 1 locus_tag LOCUS_27650 gene tilS CDS complement(120536..121585) product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529150.1 transl_table 11 codon_start 1 locus_tag LOCUS_27660 gene ybgF CDS complement(121836..122429) product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529149.1 transl_table 11 codon_start 1 locus_tag LOCUS_27670 gene pal CDS complement(122620..123927) product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529148.1 transl_table 11 codon_start 1 locus_tag LOCUS_27680 gene tolB CDS complement(123957..125009) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27690 CDS complement(125016..125447) product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066848.1 transl_table 11 codon_start 1 locus_tag LOCUS_27700 gene tolR assembly_gap 125401..125432 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(125460..126212) product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529145.1 transl_table 11 codon_start 1 locus_tag LOCUS_27710 gene tolQ CDS 126579..128810 product TonB-dependent hemoglobin/transferrin/lactoferrin family receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531239.1 transl_table 11 codon_start 1 locus_tag LOCUS_27720 CDS 128917..129672 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27730 CDS complement(129955..130434) product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529144.1 transl_table 11 codon_start 1 locus_tag LOCUS_27740 gene ybgC CDS 130487..131761 product cellulase family glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529143.1 transl_table 11 codon_start 1 locus_tag LOCUS_27750 CDS complement(132171..133208) product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529141.1 transl_table 11 codon_start 1 locus_tag LOCUS_27760 gene ruvB CDS complement(133255..133875) product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529140.1 transl_table 11 codon_start 1 locus_tag LOCUS_27770 gene ruvA CDS complement(133948..134460) product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529137.1 transl_table 11 codon_start 1 locus_tag LOCUS_27780 gene ruvC CDS complement(134511..135032) product DUF1465 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529136.1 transl_table 11 codon_start 1 locus_tag LOCUS_27790 CDS complement(135388..136548) product OpgC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532270.1 transl_table 11 codon_start 1 locus_tag LOCUS_27800 CDS 136862..137536 product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529129.1 transl_table 11 codon_start 1 locus_tag LOCUS_27810 CDS 137563..138603 product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529128.1 transl_table 11 codon_start 1 locus_tag LOCUS_27820 CDS 138754..139320 product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529127.1 transl_table 11 codon_start 1 locus_tag LOCUS_27830 gene efp CDS 139455..140255 product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529126.1 transl_table 11 codon_start 1 locus_tag LOCUS_27840 CDS 140369..141091 product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027162532.1 transl_table 11 codon_start 1 locus_tag LOCUS_27850 CDS 141166..142173 product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529124.1 transl_table 11 codon_start 1 locus_tag LOCUS_27860 CDS 142173..143204 product peptidoglycan -binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529123.1 transl_table 11 codon_start 1 locus_tag LOCUS_27870 CDS complement(143248..143694) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529104.1 transl_table 11 codon_start 1 locus_tag LOCUS_27880 CDS complement(143787..144620) product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529106.1 transl_table 11 codon_start 1 locus_tag LOCUS_27890 CDS 144987..145217 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27900 CDS 145214..145810 product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529107.1 transl_table 11 codon_start 1 locus_tag LOCUS_27910 CDS 145823..146647 product YmdB family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529108.1 transl_table 11 codon_start 1 locus_tag LOCUS_27920 CDS 146930..147691 product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529109.1 transl_table 11 codon_start 1 locus_tag LOCUS_27930 CDS complement(147725..148582) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243391.1 transl_table 11 codon_start 1 locus_tag LOCUS_27940 CDS 148761..149510 product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066860.1 transl_table 11 codon_start 1 locus_tag LOCUS_27950 CDS complement(149648..149869) product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529118.1 transl_table 11 codon_start 1 locus_tag LOCUS_27960 gene rpmE CDS 150109..151902 product ABC transporter transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529119.1 transl_table 11 codon_start 1 locus_tag LOCUS_27970 CDS complement(152442..153938) product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529086.1 transl_table 11 codon_start 1 locus_tag LOCUS_27980 CDS 154080..154988 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529085.1 transl_table 11 codon_start 1 locus_tag LOCUS_27990 CDS complement(154995..155474) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527979.1 transl_table 11 codon_start 1 locus_tag LOCUS_28000 CDS 155669..156013 product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388929.1 transl_table 11 codon_start 1 locus_tag LOCUS_28010 CDS 156103..157293 product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529103.1 transl_table 11 codon_start 1 locus_tag LOCUS_28020 CDS complement(157505..158620) product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971276.1 transl_table 11 codon_start 1 locus_tag LOCUS_28030 CDS 158743..159174 product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242567.1 transl_table 11 codon_start 1 locus_tag LOCUS_28040 CDS complement(159433..160434) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267760.1 transl_table 11 codon_start 1 locus_tag LOCUS_28050 CDS complement(160434..161414) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974516.1 transl_table 11 codon_start 1 locus_tag LOCUS_28060 CDS complement(161411..162325) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_113175525.1 transl_table 11 codon_start 1 locus_tag LOCUS_28070 CDS complement(162330..163304) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267757.1 transl_table 11 codon_start 1 locus_tag LOCUS_28080 CDS complement(163318..164928) product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016769.1 transl_table 11 codon_start 1 locus_tag LOCUS_28090 gene ggt CDS complement(164925..165779) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227200.1 transl_table 11 codon_start 1 locus_tag LOCUS_28100 CDS complement(165835..167415) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815318.1 transl_table 11 codon_start 1 locus_tag LOCUS_28110 CDS 167603..168367 product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227853.1 transl_table 11 codon_start 1 locus_tag LOCUS_28120 CDS complement(168411..168680) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28130 CDS complement(168802..169722) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089568.1 transl_table 11 codon_start 1 locus_tag LOCUS_28140 CDS 169854..171953 product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970334.1 transl_table 11 codon_start 1 locus_tag LOCUS_28150 CDS 171985..173607 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973016.1 transl_table 11 codon_start 1 locus_tag LOCUS_28160 CDS complement(173730..174491) product ribonuclease activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018324898.1 transl_table 11 codon_start 1 locus_tag LOCUS_28170 CDS complement(174488..176134) product L-arabinonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165224571.1 transl_table 11 codon_start 1 locus_tag LOCUS_28180 gene araD CDS complement(176211..177137) product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532966.1 transl_table 11 codon_start 1 locus_tag LOCUS_28190 CDS complement(177141..178016) product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968359.1 transl_table 11 codon_start 1 locus_tag LOCUS_28200 CDS complement(178013..178381) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28210 CDS complement(178400..179242) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230679.1 transl_table 11 codon_start 1 locus_tag LOCUS_28220 CDS complement(179245..180174) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230680.1 transl_table 11 codon_start 1 locus_tag LOCUS_28230 CDS complement(180171..181244) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230681.1 transl_table 11 codon_start 1 locus_tag LOCUS_28240 CDS complement(181329..182510) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200876235.1 transl_table 11 codon_start 1 locus_tag LOCUS_28250 CDS complement(182879..183568) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943981.1 transl_table 11 codon_start 1 locus_tag LOCUS_28260 CDS complement(183962..184222) product DUF2312 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529099.1 transl_table 11 codon_start 1 locus_tag LOCUS_28270 CDS complement(184358..184633) product DUF1244 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529201.1 transl_table 11 codon_start 1 locus_tag LOCUS_28280 CDS 184875..185366 product DUF1036 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529203.1 transl_table 11 codon_start 1 locus_tag LOCUS_28290 CDS 185391..186827 product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529204.1 transl_table 11 codon_start 1 locus_tag LOCUS_28300 gene pyk CDS complement(186897..187457) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529206.1 transl_table 11 codon_start 1 locus_tag LOCUS_28310 CDS complement(187680..187844) product type B 50S ribosomal protein L36 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970191.1 transl_table 11 codon_start 1 locus_tag LOCUS_28320 gene ykgO CDS complement(187932..189017) product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529208.1 transl_table 11 codon_start 1 locus_tag LOCUS_28330 CDS complement(189014..189511) product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529209.1 transl_table 11 codon_start 1 locus_tag LOCUS_28340 gene purE CDS complement(189607..189810) product DUF465 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529216.1 transl_table 11 codon_start 1 locus_tag LOCUS_28350 CDS 190029..190208 product YdcH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529217.1 transl_table 11 codon_start 1 locus_tag LOCUS_28360 CDS complement(190336..191625) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529233.1 transl_table 11 codon_start 1 locus_tag LOCUS_28370 CDS complement(191735..191914) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28380 CDS 192025..193035 product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529235.1 transl_table 11 codon_start 1 locus_tag LOCUS_28390 CDS 193164..193862 product DUF1013 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531751.1 transl_table 11 codon_start 1 locus_tag LOCUS_28400 CDS complement(193913..195829) product propionyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528095.1 transl_table 11 codon_start 1 locus_tag LOCUS_28410 CDS 196008..196172 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080577376.1 transl_table 11 codon_start 1 locus_tag LOCUS_28420 CDS 196274..198088 product potassium/proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529248.1 transl_table 11 codon_start 1 locus_tag LOCUS_28430 CDS 198190..199389 product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066872.1 transl_table 11 codon_start 1 locus_tag LOCUS_28440 CDS 199607..200632 product fructose-bisphosphate aldolase class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314723.1 transl_table 11 codon_start 1 locus_tag LOCUS_28450 CDS complement(200685..201482) product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173231.1 transl_table 11 codon_start 1 locus_tag LOCUS_28460 CDS complement(201631..201873) product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014762084.1 transl_table 11 codon_start 1 locus_tag LOCUS_28470 gene rpsU CDS 202146..203423 product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024502967.1 transl_table 11 codon_start 1 locus_tag LOCUS_28480 gene ispG CDS 203435..204277 product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529219.1 transl_table 11 codon_start 1 locus_tag LOCUS_28490 CDS complement(204314..205231) product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529224.1 transl_table 11 codon_start 1 locus_tag LOCUS_28500 CDS 205397..206167 product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067328.1 transl_table 11 codon_start 1 locus_tag LOCUS_28510 gene mtgA CDS 206319..206498 product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535764.1 transl_table 11 codon_start 1 locus_tag LOCUS_28520 gene rpmF CDS complement(206576..207205) product polyhydroxyalkanoate synthesis repressor PhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529185.1 transl_table 11 codon_start 1 locus_tag LOCUS_28530 gene phaR CDS 207532..208728 product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037390321.1 transl_table 11 codon_start 1 locus_tag LOCUS_28540 CDS 209288..212302 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529182.1 transl_table 11 codon_start 1 locus_tag LOCUS_28550 CDS 212392..212772 product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529181.1 transl_table 11 codon_start 1 locus_tag LOCUS_28560 CDS 212938..213276 product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082989.1 transl_table 11 codon_start 1 locus_tag LOCUS_28570 CDS 213880..214470 product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709746.1 transl_table 11 codon_start 1 locus_tag LOCUS_28580 CDS complement(214559..216103) product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024502938.1 transl_table 11 codon_start 1 locus_tag LOCUS_28590 CDS complement(216314..217036) product thiamine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529170.1 transl_table 11 codon_start 1 locus_tag LOCUS_28600 gene thiQ CDS complement(217029..218630) product thiamine/thiamine pyrophosphate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529169.1 transl_table 11 codon_start 1 locus_tag LOCUS_28610 gene thiP CDS 218725..219903 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529200.1 transl_table 11 codon_start 1 locus_tag LOCUS_28620 CDS complement(219963..220970) product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314726.1 transl_table 11 codon_start 1 locus_tag LOCUS_28630 gene gap CDS complement(221196..223181) product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535989.1 transl_table 11 codon_start 1 locus_tag LOCUS_28640 gene tkt CDS 223413..223685 product DUF4164 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529251.1 transl_table 11 codon_start 1 locus_tag LOCUS_28650 CDS 223727..224089 product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529252.1 transl_table 11 codon_start 1 locus_tag LOCUS_28660 CDS complement(224433..225242) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969708.1 transl_table 11 codon_start 1 locus_tag LOCUS_28670 CDS complement(225239..226267) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969709.1 transl_table 11 codon_start 1 locus_tag LOCUS_28680 CDS complement(226264..227298) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399818.1 transl_table 11 codon_start 1 locus_tag LOCUS_28690 CDS complement(227773..227952) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28700 CDS 229002..229241 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28710 note possible pseudo, frameshifted CDS 229432..229788 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28720 note possible pseudo, frameshifted CDS complement(230150..230677) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28730 note possible pseudo, internal stop codon CDS 230768..231031 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28740 CDS complement(231115..231294) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28750 note possible pseudo, internal stop codon, frameshifted tRNA complement(231524..231600) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00360 sequence10 source 1..215813 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(594..1262) product FCD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383489.1 transl_table 11 codon_start 1 locus_tag LOCUS_28760 CDS 1412..2392 product TRAP transporter substrate-binding protein DctP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970021.1 transl_table 11 codon_start 1 locus_tag LOCUS_28770 gene dctP CDS 2493..3041 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28780 CDS 3041..4357 product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970023.1 transl_table 11 codon_start 1 locus_tag LOCUS_28790 CDS 4375..5688 product malonyl-CoA decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089468.1 transl_table 11 codon_start 1 locus_tag LOCUS_28800 CDS 5681..7207 product malonyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338678.1 transl_table 11 codon_start 1 locus_tag LOCUS_28810 CDS complement(7256..8716) product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000451023.1 transl_table 11 codon_start 1 locus_tag LOCUS_28820 CDS complement(8844..9203) product DUF1850 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528643.1 transl_table 11 codon_start 1 locus_tag LOCUS_28830 CDS complement(9205..11307) product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528642.1 transl_table 11 codon_start 1 locus_tag LOCUS_28840 CDS complement(11404..12357) product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528641.1 transl_table 11 codon_start 1 locus_tag LOCUS_28850 CDS 12599..14803 product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337057.1 transl_table 11 codon_start 1 locus_tag LOCUS_28860 CDS 16171..17841 product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263560.1 transl_table 11 codon_start 1 locus_tag LOCUS_28870 CDS 18327..19490 product plasmid partitioning protein RepA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035215636.1 transl_table 11 codon_start 1 locus_tag LOCUS_28880 gene repA CDS 19475..20515 product plasmid partitioning protein RepB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969817.1 transl_table 11 codon_start 1 locus_tag LOCUS_28890 gene repB CDS complement(20668..20964) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28900 CDS complement(21534..21656) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28910 CDS 22096..22689 product peroxidase-related enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339294.1 transl_table 11 codon_start 1 locus_tag LOCUS_28920 CDS 23249..23818 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383455.1 transl_table 11 codon_start 1 locus_tag LOCUS_28930 CDS 23879..25093 product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064255119.1 transl_table 11 codon_start 1 locus_tag LOCUS_28940 CDS 25118..28252 product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972841.1 transl_table 11 codon_start 1 locus_tag LOCUS_28950 CDS 28386..28940 product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082827403.1 transl_table 11 codon_start 1 locus_tag LOCUS_28960 CDS 28933..29718 product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531511.1 transl_table 11 codon_start 1 locus_tag LOCUS_28970 CDS 29756..30472 product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531512.1 transl_table 11 codon_start 1 locus_tag LOCUS_28980 CDS 30620..31192 product DUF2076 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723572.1 transl_table 11 codon_start 1 locus_tag LOCUS_28990 CDS 31316..31801 product CAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032899511.1 transl_table 11 codon_start 1 locus_tag LOCUS_29000 CDS complement(31785..33425) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29010 CDS 33571..33849 product metal/formaldehyde-sensitive transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383336.1 transl_table 11 codon_start 1 locus_tag LOCUS_29020 CDS 33859..34818 product CDF family Co(II)/Ni(II) efflux transporter DmeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975930.1 transl_table 11 codon_start 1 locus_tag LOCUS_29030 gene dmeF CDS 35185..36432 product glycine betaine/L-proline ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000370606.1 transl_table 11 codon_start 1 locus_tag LOCUS_29040 CDS 36416..37363 product glycine betaine/L-proline ABC transporter permease ProW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000774988.1 transl_table 11 codon_start 1 locus_tag LOCUS_29050 gene proW CDS 37453..38496 product glycine betaine/L-proline ABC transporter substrate-binding protein ProX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370071.1 transl_table 11 codon_start 1 locus_tag LOCUS_29060 gene proX CDS 38657..40138 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29070 CDS complement(40178..42139) product MacB family efflux pump subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208367.1 transl_table 11 codon_start 1 locus_tag LOCUS_29080 CDS complement(42142..43371) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086489.1 transl_table 11 codon_start 1 locus_tag LOCUS_29090 CDS 43542..43856 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528869.1 transl_table 11 codon_start 1 locus_tag LOCUS_29100 CDS 43869..44144 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530627.1 transl_table 11 codon_start 1 locus_tag LOCUS_29110 CDS 44162..44788 product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531545.1 transl_table 11 codon_start 1 locus_tag LOCUS_29120 CDS complement(44806..45009) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29130 CDS complement(45072..46787) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528963.1 transl_table 11 codon_start 1 locus_tag LOCUS_29140 CDS 46968..47729 product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810210.1 transl_table 11 codon_start 1 locus_tag LOCUS_29150 CDS 47757..48746 product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970694.1 transl_table 11 codon_start 1 locus_tag LOCUS_29160 CDS 48806..50017 product chromate efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972738.1 transl_table 11 codon_start 1 locus_tag LOCUS_29170 gene chrA CDS 50084..51022 product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338820.1 transl_table 11 codon_start 1 locus_tag LOCUS_29180 CDS complement(51052..51486) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29190 CDS 51636..52556 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268308.1 transl_table 11 codon_start 1 locus_tag LOCUS_29200 CDS complement(52821..53369) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180939484.1 transl_table 11 codon_start 1 locus_tag LOCUS_29210 CDS 53505..54839 product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_199194805.1 transl_table 11 codon_start 1 locus_tag LOCUS_29220 CDS complement(54891..56216) product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972735.1 transl_table 11 codon_start 1 locus_tag LOCUS_29230 CDS complement(56443..56715) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29240 CDS complement(56834..57205) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29250 CDS complement(57407..58924) product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530573.1 transl_table 11 codon_start 1 locus_tag LOCUS_29260 CDS complement(58959..59450) product tripartite tricarboxylate transporter TctB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312079.1 transl_table 11 codon_start 1 locus_tag LOCUS_29270 CDS complement(59447..60391) product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530569.1 transl_table 11 codon_start 1 locus_tag LOCUS_29280 CDS complement(60615..61688) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976236.1 transl_table 11 codon_start 1 locus_tag LOCUS_29290 CDS 61810..62487 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969886.1 transl_table 11 codon_start 1 locus_tag LOCUS_29300 CDS 62484..63863 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972344.1 transl_table 11 codon_start 1 locus_tag LOCUS_29310 CDS complement(63852..64823) product DUF808 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337878.1 transl_table 11 codon_start 1 locus_tag LOCUS_29320 CDS complement(64900..65697) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967928.1 transl_table 11 codon_start 1 locus_tag LOCUS_29330 CDS complement(65700..66869) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967929.1 transl_table 11 codon_start 1 locus_tag LOCUS_29340 CDS complement(66871..67950) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051076795.1 transl_table 11 codon_start 1 locus_tag LOCUS_29350 CDS complement(68106..69158) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967931.1 transl_table 11 codon_start 1 locus_tag LOCUS_29360 CDS complement(69322..70710) product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086907.1 transl_table 11 codon_start 1 locus_tag LOCUS_29370 CDS complement(70885..71616) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041170044.1 transl_table 11 codon_start 1 locus_tag LOCUS_29380 CDS complement(71701..72378) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967933.1 transl_table 11 codon_start 1 locus_tag LOCUS_29390 CDS 72641..74476 product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970221.1 transl_table 11 codon_start 1 locus_tag LOCUS_29400 gene ilvD CDS complement(74525..76225) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970878.1 transl_table 11 codon_start 1 locus_tag LOCUS_29410 CDS complement(76273..77289) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970877.1 transl_table 11 codon_start 1 locus_tag LOCUS_29420 CDS complement(77345..78427) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970876.1 transl_table 11 codon_start 1 locus_tag LOCUS_29430 CDS 78540..79664 product N-methyl-L-tryptophan oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259547.1 transl_table 11 codon_start 1 locus_tag LOCUS_29440 gene solA CDS complement(79668..80819) product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531843.1 transl_table 11 codon_start 1 locus_tag LOCUS_29450 CDS 81112..81894 product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975064.1 transl_table 11 codon_start 1 locus_tag LOCUS_29460 CDS 81891..83444 product phospholipase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037836.1 transl_table 11 codon_start 1 locus_tag LOCUS_29470 CDS complement(83446..84189) product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976098.1 transl_table 11 codon_start 1 locus_tag LOCUS_29480 CDS complement(84215..86053) product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038196.1 transl_table 11 codon_start 1 locus_tag LOCUS_29490 CDS complement(86116..87495) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368556.1 transl_table 11 codon_start 1 locus_tag LOCUS_29500 CDS complement(87499..88158) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313598.1 transl_table 11 codon_start 1 locus_tag LOCUS_29510 CDS complement(88161..88463) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29520 CDS 88579..88869 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29530 CDS 88929..89522 product exopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946834.1 transl_table 11 codon_start 1 locus_tag LOCUS_29540 CDS 89596..90024 product PACE efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525507.1 transl_table 11 codon_start 1 locus_tag LOCUS_29550 CDS 90353..91447 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339274.1 transl_table 11 codon_start 1 locus_tag LOCUS_29560 CDS 91540..92688 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339273.1 transl_table 11 codon_start 1 locus_tag LOCUS_29570 CDS 92688..93587 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339272.1 transl_table 11 codon_start 1 locus_tag LOCUS_29580 CDS 93680..94477 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724163.1 transl_table 11 codon_start 1 locus_tag LOCUS_29590 CDS 94505..95245 product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894753.1 transl_table 11 codon_start 1 locus_tag LOCUS_29600 CDS 95271..96095 product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339275.1 transl_table 11 codon_start 1 locus_tag LOCUS_29610 CDS 96108..96776 product 4-hydroxy-4-methyl-2-oxoglutarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368435.1 transl_table 11 codon_start 1 locus_tag LOCUS_29620 CDS 96901..97890 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811054.1 transl_table 11 codon_start 1 locus_tag LOCUS_29630 CDS 98123..99163 product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310751.1 transl_table 11 codon_start 1 locus_tag LOCUS_29640 CDS 99160..100305 product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067612.1 transl_table 11 codon_start 1 locus_tag LOCUS_29650 gene nagA CDS complement(100263..101114) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29660 CDS complement(101149..102219) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975169.1 transl_table 11 codon_start 1 locus_tag LOCUS_29670 CDS complement(102226..103986) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855561.1 transl_table 11 codon_start 1 locus_tag LOCUS_29680 CDS complement(104030..106114) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29690 CDS 106386..106838 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337179.1 transl_table 11 codon_start 1 locus_tag LOCUS_29700 CDS complement(106878..107867) product glucosamine--fructose-6-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336747.1 transl_table 11 codon_start 1 locus_tag LOCUS_29710 CDS complement(107884..108837) product BadF/BadG/BcrA/BcrD ATPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336746.1 transl_table 11 codon_start 1 locus_tag LOCUS_29720 CDS complement(108839..109948) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336745.1 transl_table 11 codon_start 1 locus_tag LOCUS_29730 CDS complement(109963..110841) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722082.1 transl_table 11 codon_start 1 locus_tag LOCUS_29740 CDS complement(110838..111725) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722079.1 transl_table 11 codon_start 1 locus_tag LOCUS_29750 CDS complement(111787..113052) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336743.1 transl_table 11 codon_start 1 locus_tag LOCUS_29760 CDS complement(113192..114331) product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336742.1 transl_table 11 codon_start 1 locus_tag LOCUS_29770 CDS 114583..115590 product L-sulfolactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876829.1 transl_table 11 codon_start 1 locus_tag LOCUS_29780 gene comC CDS 115769..116734 product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942649.1 transl_table 11 codon_start 1 locus_tag LOCUS_29790 CDS 116734..118530 product branched-chain amino acid ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813865.1 transl_table 11 codon_start 1 locus_tag LOCUS_29800 CDS 118523..119230 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942375.1 transl_table 11 codon_start 1 locus_tag LOCUS_29810 CDS 119249..120529 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399216.1 transl_table 11 codon_start 1 locus_tag LOCUS_29820 CDS 120599..121483 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29830 CDS complement(121484..121903) product OB-fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812328.1 transl_table 11 codon_start 1 locus_tag LOCUS_29840 CDS complement(121949..123112) product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926482.1 transl_table 11 codon_start 1 locus_tag LOCUS_29850 CDS complement(123125..124168) product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903331.1 transl_table 11 codon_start 1 locus_tag LOCUS_29860 CDS complement(124165..124341) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29870 CDS 124438..124581 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29880 CDS complement(124599..125732) product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926482.1 transl_table 11 codon_start 1 locus_tag LOCUS_29890 CDS 125890..126726 product MaoC family dehydratase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267474.1 transl_table 11 codon_start 1 locus_tag LOCUS_29900 CDS complement(126733..127914) product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813988.1 transl_table 11 codon_start 1 locus_tag LOCUS_29910 CDS complement(127911..129275) product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979878.1 transl_table 11 codon_start 1 locus_tag LOCUS_29920 CDS 129471..130709 product 2-methylfumaryl-CoA isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256085.1 transl_table 11 codon_start 1 locus_tag LOCUS_29930 CDS 130720..132390 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390812.1 transl_table 11 codon_start 1 locus_tag LOCUS_29940 CDS 132390..133541 product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965471.1 transl_table 11 codon_start 1 locus_tag LOCUS_29950 CDS 133538..135004 product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243012.1 transl_table 11 codon_start 1 locus_tag LOCUS_29960 CDS 135001..135798 product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525151.1 transl_table 11 codon_start 1 locus_tag LOCUS_29970 CDS 135829..136212 product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008567285.1 transl_table 11 codon_start 1 locus_tag LOCUS_29980 CDS 136241..137143 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173543.1 transl_table 11 codon_start 1 locus_tag LOCUS_29990 CDS 137153..137947 product N-acyl homoserine lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210055.1 transl_table 11 codon_start 1 locus_tag LOCUS_30000 CDS complement(138003..139166) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918994.1 transl_table 11 codon_start 1 locus_tag LOCUS_30010 CDS 139369..140385 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525156.1 transl_table 11 codon_start 1 locus_tag LOCUS_30020 CDS 140549..141538 product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767091.1 transl_table 11 codon_start 1 locus_tag LOCUS_30030 CDS 141542..143122 product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876295.1 transl_table 11 codon_start 1 locus_tag LOCUS_30040 CDS complement(143185..143901) product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088674.1 transl_table 11 codon_start 1 locus_tag LOCUS_30050 CDS 144114..145070 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368516.1 transl_table 11 codon_start 1 locus_tag LOCUS_30060 CDS 145067..145876 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723717.1 transl_table 11 codon_start 1 locus_tag LOCUS_30070 CDS 145873..146739 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368518.1 transl_table 11 codon_start 1 locus_tag LOCUS_30080 CDS 146777..147499 product FCD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538263.1 transl_table 11 codon_start 1 locus_tag LOCUS_30090 CDS 147503..149095 product gamma-glutamyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095724.1 transl_table 11 codon_start 1 locus_tag LOCUS_30100 CDS 149839..149979 product DUF1127 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531315.1 transl_table 11 codon_start 1 locus_tag LOCUS_30110 CDS complement(150159..150896) product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385678.1 transl_table 11 codon_start 1 locus_tag LOCUS_30120 CDS 151127..154960 product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538150.1 transl_table 11 codon_start 1 locus_tag LOCUS_30130 CDS 155055..156587 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538149.1 transl_table 11 codon_start 1 locus_tag LOCUS_30140 CDS 156648..157655 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385674.1 transl_table 11 codon_start 1 locus_tag LOCUS_30150 CDS 157652..158548 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385673.1 transl_table 11 codon_start 1 locus_tag LOCUS_30160 CDS 158560..159447 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060486324.1 transl_table 11 codon_start 1 locus_tag LOCUS_30170 CDS 159444..160271 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385671.1 transl_table 11 codon_start 1 locus_tag LOCUS_30180 CDS 160658..160837 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30190 CDS complement(160977..161723) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223997.1 transl_table 11 codon_start 1 locus_tag LOCUS_30200 CDS 161822..162187 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742073.1 transl_table 11 codon_start 1 locus_tag LOCUS_30210 CDS complement(162535..163935) product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969867.1 transl_table 11 codon_start 1 locus_tag LOCUS_30220 CDS 164053..165585 product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244072.1 transl_table 11 codon_start 1 locus_tag LOCUS_30230 CDS 165730..167736 product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392124.1 transl_table 11 codon_start 1 locus_tag LOCUS_30240 CDS 167776..169911 product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392131.1 transl_table 11 codon_start 1 locus_tag LOCUS_30250 gene scpA CDS complement(169936..171168) product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330316.1 transl_table 11 codon_start 1 locus_tag LOCUS_30260 CDS complement(171181..172707) product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242406.1 transl_table 11 codon_start 1 locus_tag LOCUS_30270 CDS complement(172866..174263) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242408.1 transl_table 11 codon_start 1 locus_tag LOCUS_30280 CDS 174368..175270 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535214.1 transl_table 11 codon_start 1 locus_tag LOCUS_30290 CDS 175570..176085 product DUF892 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525107.1 transl_table 11 codon_start 1 locus_tag LOCUS_30300 CDS 176097..176306 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974997.1 transl_table 11 codon_start 1 locus_tag LOCUS_30310 CDS 176303..176680 product succinate dehydrogenase, hydrophobic membrane anchor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015316581.1 transl_table 11 codon_start 1 locus_tag LOCUS_30320 gene sdhD CDS complement(176707..177264) product tyrosine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531123.1 transl_table 11 codon_start 1 locus_tag LOCUS_30330 CDS complement(177231..178253) product threonine-phosphate decarboxylase CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531122.1 transl_table 11 codon_start 1 locus_tag LOCUS_30340 gene cobD CDS 178246..179211 product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972582.1 transl_table 11 codon_start 1 locus_tag LOCUS_30350 gene cbiB CDS 179728..181359 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968443.1 transl_table 11 codon_start 1 locus_tag LOCUS_30360 CDS complement(181360..182427) product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050984070.1 transl_table 11 codon_start 1 locus_tag LOCUS_30370 CDS 182756..183877 product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971836.1 transl_table 11 codon_start 1 locus_tag LOCUS_30380 CDS complement(183889..185355) product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972581.1 transl_table 11 codon_start 1 locus_tag LOCUS_30390 CDS complement(185355..185969) product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972580.1 transl_table 11 codon_start 1 locus_tag LOCUS_30400 gene cobO CDS complement(185982..186494) product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531119.1 transl_table 11 codon_start 1 locus_tag LOCUS_30410 gene cobU CDS 187550..187741 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30420 CDS 187738..188793 product cobalamin biosynthesis protein CobW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531087.1 transl_table 11 codon_start 1 locus_tag LOCUS_30430 gene cobW CDS 188801..192133 product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531086.1 transl_table 11 codon_start 1 locus_tag LOCUS_30440 gene cobN CDS 192126..193391 product precorrin-3B synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972576.1 transl_table 11 codon_start 1 locus_tag LOCUS_30450 gene cobG CDS 193393..194022 product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531084.1 transl_table 11 codon_start 1 locus_tag LOCUS_30460 CDS 194019..194765 product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531083.1 transl_table 11 codon_start 1 locus_tag LOCUS_30470 CDS 194762..195526 product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394055.1 transl_table 11 codon_start 1 locus_tag LOCUS_30480 CDS complement(195490..196281) product cobalt-precorrin-6A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311006.1 transl_table 11 codon_start 1 locus_tag LOCUS_30490 CDS 196286..197536 product bifunctional cobalt-precorrin-7 (C(5))-methyltransferase/cobalt-precorrin-6B (C(15))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972573.1 transl_table 11 codon_start 1 locus_tag LOCUS_30500 CDS 197533..197943 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30510 CDS 197940..198698 product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066878846.1 transl_table 11 codon_start 1 locus_tag LOCUS_30520 gene cobM CDS complement(198671..199792) product cobalt-precorrin-5B (C(1))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035258096.1 transl_table 11 codon_start 1 locus_tag LOCUS_30530 CDS 199867..200655 product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972569.1 transl_table 11 codon_start 1 locus_tag LOCUS_30540 gene cobA CDS 200652..201962 product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972568.1 transl_table 11 codon_start 1 locus_tag LOCUS_30550 CDS 201962..202720 product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531075.1 transl_table 11 codon_start 1 locus_tag LOCUS_30560 gene cobS CDS 202733..203758 product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531074.1 transl_table 11 codon_start 1 locus_tag LOCUS_30570 gene cobT CDS 203828..204220 product DUF2384 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969987.1 transl_table 11 codon_start 1 locus_tag LOCUS_30580 CDS 204217..204723 product RES family NAD+ phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525332.1 transl_table 11 codon_start 1 locus_tag LOCUS_30590 CDS complement(204728..205663) product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970642.1 transl_table 11 codon_start 1 locus_tag LOCUS_30600 CDS complement(205754..208756) product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973524.1 transl_table 11 codon_start 1 locus_tag LOCUS_30610 CDS complement(208866..209981) product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975407.1 transl_table 11 codon_start 1 locus_tag LOCUS_30620 CDS 210172..210666 product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530535.1 transl_table 11 codon_start 1 locus_tag LOCUS_30630 CDS 210755..212446 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30640 misc_feature complement(212495..>215813) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001237656.1:Ig-like domain repeat protein locus_tag LOCUS_30650 sequence11 source 1..177199 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 494..1972 product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331455.1 transl_table 11 codon_start 1 locus_tag LOCUS_30660 CDS complement(2079..2246) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30670 CDS 2361..2546 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30680 CDS complement(2604..3413) product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063172648.1 transl_table 11 codon_start 1 locus_tag LOCUS_30690 CDS 3494..3730 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315784.1 transl_table 11 codon_start 1 locus_tag LOCUS_30700 tRNA complement(3831..3904) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00370 tRNA complement(3937..4021) product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00380 CDS 4199..5032 product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531400.1 transl_table 11 codon_start 1 locus_tag LOCUS_30710 gene rlmB CDS complement(5078..5320) product DUF2171 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532118.1 transl_table 11 codon_start 1 locus_tag LOCUS_30720 CDS 5509..5751 product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313814.1 transl_table 11 codon_start 1 locus_tag LOCUS_30730 CDS complement(5887..7872) product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531976.1 transl_table 11 codon_start 1 locus_tag LOCUS_30740 gene thrS CDS complement(8081..8476) product DUF1801 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971992.1 transl_table 11 codon_start 1 locus_tag LOCUS_30750 CDS complement(8476..8886) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30760 CDS complement(9331..9849) product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975227.1 transl_table 11 codon_start 1 locus_tag LOCUS_30770 CDS 9989..10615 product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531982.1 transl_table 11 codon_start 1 locus_tag LOCUS_30780 gene folE CDS 10621..11031 product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531983.1 transl_table 11 codon_start 1 locus_tag LOCUS_30790 gene hisI CDS 11182..12144 product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173662.1 transl_table 11 codon_start 1 locus_tag LOCUS_30800 CDS complement(12697..14202) product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006309942.1 transl_table 11 codon_start 1 locus_tag LOCUS_30810 CDS complement(14217..14690) product tripartite tricarboxylate transporter TctB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006309941.1 transl_table 11 codon_start 1 locus_tag LOCUS_30820 CDS complement(14857..15816) product tripartite tricarboxylate transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537727.1 transl_table 11 codon_start 1 locus_tag LOCUS_30830 CDS complement(15917..17491) product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090588.1 transl_table 11 codon_start 1 locus_tag LOCUS_30840 CDS complement(17595..19391) product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531985.1 transl_table 11 codon_start 1 locus_tag LOCUS_30850 gene recJ CDS complement(19614..20450) product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531987.1 transl_table 11 codon_start 1 locus_tag LOCUS_30860 gene glpX CDS 20346..20576 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30870 CDS complement(20718..22031) product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531990.1 transl_table 11 codon_start 1 locus_tag LOCUS_30880 CDS complement(22149..23366) product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531991.1 transl_table 11 codon_start 1 locus_tag LOCUS_30890 CDS complement(23545..24567) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30900 CDS complement(24750..25082) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531992.1 transl_table 11 codon_start 1 locus_tag LOCUS_30910 CDS 25196..27016 product class I poly(R)-hydroxyalkanoic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531993.1 transl_table 11 codon_start 1 locus_tag LOCUS_30920 gene phaC CDS 27227..28420 product YcbK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082827387.1 transl_table 11 codon_start 1 locus_tag LOCUS_30930 tRNA 28701..28775 product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00390 CDS complement(31303..32874) product ATP-dependent acyl-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000892286.1 transl_table 11 codon_start 1 locus_tag LOCUS_30940 CDS 33052..33834 product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908720.1 transl_table 11 codon_start 1 locus_tag LOCUS_30950 CDS 33855..35387 product malonyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970025.1 transl_table 11 codon_start 1 locus_tag LOCUS_30960 CDS 35422..36219 product IclR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808900.1 transl_table 11 codon_start 1 locus_tag LOCUS_30970 CDS complement(36178..37170) product class A beta-lactamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974796.1 transl_table 11 codon_start 1 locus_tag LOCUS_30980 gene bla CDS complement(37167..38042) product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041170158.1 transl_table 11 codon_start 1 locus_tag LOCUS_30990 CDS complement(38039..39394) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31000 CDS complement(39394..40428) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267760.1 transl_table 11 codon_start 1 locus_tag LOCUS_31010 CDS complement(40415..41419) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815325.1 transl_table 11 codon_start 1 locus_tag LOCUS_31020 CDS complement(41416..42330) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931685.1 transl_table 11 codon_start 1 locus_tag LOCUS_31030 CDS complement(42327..43301) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162734144.1 transl_table 11 codon_start 1 locus_tag LOCUS_31040 CDS complement(43401..44960) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974513.1 transl_table 11 codon_start 1 locus_tag LOCUS_31050 CDS complement(45946..53016) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31060 CDS complement(53051..53806) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147272284.1 transl_table 11 codon_start 1 locus_tag LOCUS_31070 CDS complement(54073..54444) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31080 tRNA 55432..55506 product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00400 CDS complement(56236..57084) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970497.1 transl_table 11 codon_start 1 locus_tag LOCUS_31090 CDS complement(57093..58064) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084029.1 transl_table 11 codon_start 1 locus_tag LOCUS_31100 CDS complement(58101..59681) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084030.1 transl_table 11 codon_start 1 locus_tag LOCUS_31110 CDS complement(59714..61318) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974864.1 transl_table 11 codon_start 1 locus_tag LOCUS_31120 CDS complement(61359..62342) product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583525.1 transl_table 11 codon_start 1 locus_tag LOCUS_31130 CDS complement(62335..63306) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001034325.1 transl_table 11 codon_start 1 locus_tag LOCUS_31140 CDS complement(63328..63720) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31150 CDS complement(63751..64368) product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971683.1 transl_table 11 codon_start 1 locus_tag LOCUS_31160 CDS 64634..65347 product FCD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384632.1 transl_table 11 codon_start 1 locus_tag LOCUS_31170 CDS complement(65442..65618) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31180 CDS complement(65747..66271) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31190 CDS 66488..67321 product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532002.1 transl_table 11 codon_start 1 locus_tag LOCUS_31200 gene map CDS 67384..68226 product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532006.1 transl_table 11 codon_start 1 locus_tag LOCUS_31210 gene radC CDS complement(68231..68542) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31220 CDS complement(68677..70149) product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532009.1 transl_table 11 codon_start 1 locus_tag LOCUS_31230 gene tig tRNA 71332..71416 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00410 CDS complement(71474..71758) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31240 CDS complement(71812..72168) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529710.1 transl_table 11 codon_start 1 locus_tag LOCUS_31250 CDS 72419..72772 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31260 CDS 73288..73683 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339147.1 transl_table 11 codon_start 1 locus_tag LOCUS_31270 CDS 73731..74243 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31280 CDS 74240..75805 product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090223.1 transl_table 11 codon_start 1 locus_tag LOCUS_31290 CDS 75875..76255 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31300 CDS 76344..77135 product acetoin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026965.1 transl_table 11 codon_start 1 locus_tag LOCUS_31310 CDS 77255..78943 product D-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097938.1 transl_table 11 codon_start 1 locus_tag LOCUS_31320 gene dld CDS complement(79086..79328) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31330 CDS complement(79588..80298) product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530376.1 transl_table 11 codon_start 1 locus_tag LOCUS_31340 CDS 80783..80923 product DUF1127 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531315.1 transl_table 11 codon_start 1 locus_tag LOCUS_31350 CDS complement(81136..82416) product O-acetylhomoserine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969134.1 transl_table 11 codon_start 1 locus_tag LOCUS_31360 CDS complement(82539..82979) product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312735.1 transl_table 11 codon_start 1 locus_tag LOCUS_31370 CDS complement(82983..83795) product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532203.1 transl_table 11 codon_start 1 locus_tag LOCUS_31380 CDS 83925..84389 product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532204.1 transl_table 11 codon_start 1 locus_tag LOCUS_31390 CDS 84455..85231 product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174479.1 transl_table 11 codon_start 1 locus_tag LOCUS_31400 CDS 85453..85917 product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532205.1 transl_table 11 codon_start 1 locus_tag LOCUS_31410 gene rplM CDS 85920..86399 product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532206.1 transl_table 11 codon_start 1 locus_tag LOCUS_31420 gene rpsI CDS 86505..87461 product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532211.1 transl_table 11 codon_start 1 locus_tag LOCUS_31430 gene speB CDS 87462..88472 product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969129.1 transl_table 11 codon_start 1 locus_tag LOCUS_31440 gene argC CDS complement(88624..89724) product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532214.1 transl_table 11 codon_start 1 locus_tag LOCUS_31450 CDS 89962..90201 product DUF2842 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532215.1 transl_table 11 codon_start 1 locus_tag LOCUS_31460 CDS complement(90211..91110) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31470 CDS complement(91282..91923) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089232.1 transl_table 11 codon_start 1 locus_tag LOCUS_31480 CDS 92025..92471 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31490 CDS 93270..93452 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31500 CDS 93516..93671 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31510 CDS 93852..94346 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31520 CDS 94522..95085 product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532220.1 transl_table 11 codon_start 1 locus_tag LOCUS_31530 CDS 95288..96811 product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532222.1 transl_table 11 codon_start 1 locus_tag LOCUS_31540 CDS 96962..97972 product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813068.1 transl_table 11 codon_start 1 locus_tag LOCUS_31550 CDS 98319..98951 product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931061.1 transl_table 11 codon_start 1 locus_tag LOCUS_31560 gene queE CDS 98948..99304 product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090505.1 transl_table 11 codon_start 1 locus_tag LOCUS_31570 gene queD CDS 99294..100013 product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190026.1 transl_table 11 codon_start 1 locus_tag LOCUS_31580 gene queC CDS complement(100067..100252) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31590 CDS 100468..101592 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385515.1 transl_table 11 codon_start 1 locus_tag LOCUS_31600 CDS 101630..102589 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385516.1 transl_table 11 codon_start 1 locus_tag LOCUS_31610 CDS 102602..104281 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385517.1 transl_table 11 codon_start 1 locus_tag LOCUS_31620 CDS 104315..104716 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31630 CDS 105041..105235 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31640 CDS 105219..105659 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31650 CDS 105663..105860 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31660 CDS 105959..106174 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31670 CDS 106171..106506 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31680 CDS 106806..107546 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31690 CDS 107555..107767 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31700 CDS 108227..108400 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31710 CDS complement(108419..108652) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31720 CDS complement(108709..108990) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31730 CDS complement(109118..109387) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31740 CDS complement(109387..110103) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31750 CDS 110202..111191 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31760 CDS complement(111217..111834) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31770 CDS complement(111834..112787) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31780 CDS complement(112777..112986) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31790 CDS complement(113011..116016) product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976007.1 transl_table 11 codon_start 1 locus_tag LOCUS_31800 CDS complement(116023..116436) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975785.1 transl_table 11 codon_start 1 locus_tag LOCUS_31810 CDS complement(116421..117005) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976010.1 transl_table 11 codon_start 1 locus_tag LOCUS_31820 CDS complement(117002..117664) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976011.1 transl_table 11 codon_start 1 locus_tag LOCUS_31830 CDS complement(117664..119934) product phage tail length tape measure family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976013.1 transl_table 11 codon_start 1 locus_tag LOCUS_31840 CDS 119994..120287 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31850 CDS 120352..120978 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31860 CDS complement(121502..121771) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31870 CDS complement(121816..122241) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31880 CDS complement(122241..122762) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31890 CDS complement(122801..123238) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31900 CDS 123256..123456 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31910 CDS complement(123407..123823) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976019.1 transl_table 11 codon_start 1 locus_tag LOCUS_31920 CDS complement(123828..124856) product phage minor head protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976020.1 transl_table 11 codon_start 1 locus_tag LOCUS_31930 CDS complement(124865..125233) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31940 CDS complement(125233..125694) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976023.1 transl_table 11 codon_start 1 locus_tag LOCUS_31950 CDS 125767..126000 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31960 CDS complement(126039..127055) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31970 CDS complement(127173..127559) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31980 CDS complement(127559..128581) product major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104533.1 transl_table 11 codon_start 1 locus_tag LOCUS_31990 CDS complement(128596..128961) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32000 CDS complement(128965..130092) product DUF2213 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976027.1 transl_table 11 codon_start 1 locus_tag LOCUS_32010 CDS 130131..130853 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32020 CDS complement(130850..132706) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32030 CDS complement(132714..134081) product phage terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003697216.1 transl_table 11 codon_start 1 locus_tag LOCUS_32040 gene terL CDS complement(134149..134613) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32050 CDS 134612..135304 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32060 CDS 135528..135773 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32070 CDS complement(136035..136694) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32080 CDS complement(136694..137140) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32090 CDS 137200..137478 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32100 CDS complement(137529..137996) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32110 CDS complement(137993..138367) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32120 CDS complement(138364..139818) product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971386.1 transl_table 11 codon_start 1 locus_tag LOCUS_32130 CDS 139860..140504 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32140 CDS complement(140507..141079) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32150 CDS complement(141076..143646) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32160 CDS complement(143649..144191) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32170 CDS complement(144210..144422) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32180 CDS complement(144343..144732) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32190 CDS complement(144690..144884) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32200 CDS complement(144884..145024) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32210 CDS complement(145021..145446) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32220 CDS complement(145443..145748) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32230 CDS complement(145749..146207) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32240 CDS 146282..146572 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32250 CDS complement(146578..146823) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975815.1 transl_table 11 codon_start 1 locus_tag LOCUS_32260 CDS 146909..147697 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32270 CDS 147712..148017 product TM2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003140884.1 transl_table 11 codon_start 1 locus_tag LOCUS_32280 CDS 148137..148691 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32290 CDS 149374..149721 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32300 CDS 149721..149909 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32310 CDS 149909..150244 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32320 CDS 150241..150393 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32330 CDS 150476..150682 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32340 CDS 150679..151800 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32350 CDS 151800..152696 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32360 CDS 152696..153094 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32370 CDS 153094..153504 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32380 CDS 153497..154057 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32390 CDS 154057..154281 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32400 CDS 154278..154577 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32410 CDS 154643..155590 product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087764.1 transl_table 11 codon_start 1 locus_tag LOCUS_32420 tRNA 155724..155800 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00420 CDS 156201..156833 product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972103.1 transl_table 11 codon_start 1 locus_tag LOCUS_32430 CDS complement(156955..157845) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32440 CDS complement(157814..159790) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32450 CDS complement(160096..160671) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32460 CDS complement(160710..160874) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32470 CDS complement(161652..163121) product PAS domain S-box protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368447.1 transl_table 11 codon_start 1 locus_tag LOCUS_32480 CDS complement(163244..163750) product superoxide dismutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336992.1 transl_table 11 codon_start 1 locus_tag LOCUS_32490 CDS 164236..164958 product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530376.1 transl_table 11 codon_start 1 locus_tag LOCUS_32500 CDS 165082..165276 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32510 CDS complement(165338..165877) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532230.1 transl_table 11 codon_start 1 locus_tag LOCUS_32520 CDS complement(166024..166347) product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532231.1 transl_table 11 codon_start 1 locus_tag LOCUS_32530 CDS complement(166443..167414) product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971448.1 transl_table 11 codon_start 1 locus_tag LOCUS_32540 CDS complement(167411..168469) product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024504675.1 transl_table 11 codon_start 1 locus_tag LOCUS_32550 gene plsX CDS complement(168740..169291) product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532234.1 transl_table 11 codon_start 1 locus_tag LOCUS_32560 CDS complement(169308..169859) product ubiquinol-cytochrome C chaperone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532235.1 transl_table 11 codon_start 1 locus_tag LOCUS_32570 CDS 170152..170658 product outer membrane protein assembly factor BamE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532236.1 transl_table 11 codon_start 1 locus_tag LOCUS_32580 CDS complement(170749..172890) product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532237.1 transl_table 11 codon_start 1 locus_tag LOCUS_32590 CDS complement(173087..173836) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532238.1 transl_table 11 codon_start 1 locus_tag LOCUS_32600 CDS complement(173833..174771) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532239.1 transl_table 11 codon_start 1 locus_tag LOCUS_32610 CDS complement(174768..175934) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532240.1 transl_table 11 codon_start 1 locus_tag LOCUS_32620 CDS complement(175961..176875) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975666.1 transl_table 11 codon_start 1 locus_tag LOCUS_32630 sequence12 source 1..147030 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 74..150 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00430 CDS complement(1567..2028) product PTS IIA-like nitrogen regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529589.1 transl_table 11 codon_start 1 locus_tag LOCUS_32640 gene ptsN CDS complement(2264..2848) product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529588.1 transl_table 11 codon_start 1 locus_tag LOCUS_32650 gene raiA CDS complement(3026..4357) product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529587.1 transl_table 11 codon_start 1 locus_tag LOCUS_32660 gene rpoN CDS complement(4510..5886) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328309.1 transl_table 11 codon_start 1 locus_tag LOCUS_32670 CDS 6022..7614 product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401887.1 transl_table 11 codon_start 1 locus_tag LOCUS_32680 CDS 7651..7830 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32690 CDS complement(7901..8704) product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529586.1 transl_table 11 codon_start 1 locus_tag LOCUS_32700 gene lptB CDS complement(8737..9312) product LptA/OstA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173992582.1 transl_table 11 codon_start 1 locus_tag LOCUS_32710 CDS complement(9287..10015) product LPS export ABC transporter periplasmic protein LptC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529584.1 transl_table 11 codon_start 1 locus_tag LOCUS_32720 gene lptC CDS 10355..11326 product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529583.1 transl_table 11 codon_start 1 locus_tag LOCUS_32730 gene sppA CDS 11369..11656 product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006200394.1 transl_table 11 codon_start 1 locus_tag LOCUS_32740 CDS 11686..12006 product LapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529582.1 transl_table 11 codon_start 1 locus_tag LOCUS_32750 CDS complement(12013..12693) product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532759.1 transl_table 11 codon_start 1 locus_tag LOCUS_32760 CDS 12852..13994 product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529577.1 transl_table 11 codon_start 1 locus_tag LOCUS_32770 CDS 13991..14848 product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529576.1 transl_table 11 codon_start 1 locus_tag LOCUS_32780 CDS 14841..15341 product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529575.1 transl_table 11 codon_start 1 locus_tag LOCUS_32790 gene lspA CDS 15568..17706 product PAS domain-containing hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529573.1 transl_table 11 codon_start 1 locus_tag LOCUS_32800 CDS complement(17780..18619) product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527132.1 transl_table 11 codon_start 1 locus_tag LOCUS_32810 CDS complement(18616..19467) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080577474.1 transl_table 11 codon_start 1 locus_tag LOCUS_32820 CDS complement(19471..20394) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527129.1 transl_table 11 codon_start 1 locus_tag LOCUS_32830 CDS complement(20409..21413) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527127.1 transl_table 11 codon_start 1 locus_tag LOCUS_32840 CDS complement(21613..23208) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395213.1 transl_table 11 codon_start 1 locus_tag LOCUS_32850 CDS 23480..24022 product DUF924 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207956.1 transl_table 11 codon_start 1 locus_tag LOCUS_32860 CDS 24137..25861 product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527994.1 transl_table 11 codon_start 1 locus_tag LOCUS_32870 CDS complement(25909..26889) product zinc ABC transporter substrate-binding protein AztC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972822.1 transl_table 11 codon_start 1 locus_tag LOCUS_32880 gene aztC CDS 27006..28220 product zinc metallochaperone AztD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969726.1 transl_table 11 codon_start 1 locus_tag LOCUS_32890 gene aztD CDS complement(28260..28988) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527996.1 transl_table 11 codon_start 1 locus_tag LOCUS_32900 CDS complement(28985..30619) product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527997.1 transl_table 11 codon_start 1 locus_tag LOCUS_32910 gene pgi CDS 30852..32336 product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527998.1 transl_table 11 codon_start 1 locus_tag LOCUS_32920 CDS 32411..32881 product carbon monoxide dehydrogenase subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528005.1 transl_table 11 codon_start 1 locus_tag LOCUS_32930 CDS complement(32882..34033) product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528006.1 transl_table 11 codon_start 1 locus_tag LOCUS_32940 CDS 34233..35510 product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972400.1 transl_table 11 codon_start 1 locus_tag LOCUS_32950 CDS 35592..36473 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529254.1 transl_table 11 codon_start 1 locus_tag LOCUS_32960 CDS complement(36474..37340) product N-acetylglucosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528576.1 transl_table 11 codon_start 1 locus_tag LOCUS_32970 CDS complement(37342..38160) product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528564.1 transl_table 11 codon_start 1 locus_tag LOCUS_32980 CDS 38348..38950 product bifunctional nicotinamidase/pyrazinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528448.1 transl_table 11 codon_start 1 locus_tag LOCUS_32990 gene pncA CDS complement(38953..39654) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528446.1 transl_table 11 codon_start 1 locus_tag LOCUS_33000 CDS complement(39651..40358) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528445.1 transl_table 11 codon_start 1 locus_tag LOCUS_33010 CDS complement(40355..41296) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528444.1 transl_table 11 codon_start 1 locus_tag LOCUS_33020 CDS complement(41293..42177) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528443.1 transl_table 11 codon_start 1 locus_tag LOCUS_33030 CDS complement(42177..43469) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528442.1 transl_table 11 codon_start 1 locus_tag LOCUS_33040 CDS complement(43589..44902) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528441.1 transl_table 11 codon_start 1 locus_tag LOCUS_33050 CDS complement(44902..46206) product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528440.1 transl_table 11 codon_start 1 locus_tag LOCUS_33060 gene pncB CDS complement(46325..47713) product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528421.1 transl_table 11 codon_start 1 locus_tag LOCUS_33070 CDS 47919..48878 product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528601.1 transl_table 11 codon_start 1 locus_tag LOCUS_33080 gene gshB CDS 48942..50474 product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528602.1 transl_table 11 codon_start 1 locus_tag LOCUS_33090 CDS complement(50497..51579) product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533617.1 transl_table 11 codon_start 1 locus_tag LOCUS_33100 CDS complement(51576..51923) product DUF952 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173552.1 transl_table 11 codon_start 1 locus_tag LOCUS_33110 CDS 52076..52723 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533614.1 transl_table 11 codon_start 1 locus_tag LOCUS_33120 CDS complement(53117..56599) product PAS-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173555.1 transl_table 11 codon_start 1 locus_tag LOCUS_33130 CDS 56860..57297 product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533610.1 transl_table 11 codon_start 1 locus_tag LOCUS_33140 gene mscL CDS complement(57355..58608) product 5-aminolevulinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533608.1 transl_table 11 codon_start 1 locus_tag LOCUS_33150 gene hemA CDS complement(58737..59450) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33160 CDS 59334..59648 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33170 CDS complement(59635..59946) product DUF6460 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533620.1 transl_table 11 codon_start 1 locus_tag LOCUS_33180 tRNA 60018..60091 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00440 CDS complement(60156..61487) product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532939.1 transl_table 11 codon_start 1 locus_tag LOCUS_33190 CDS 61724..63571 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398965.1 transl_table 11 codon_start 1 locus_tag LOCUS_33200 CDS 63574..64923 product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253256.1 transl_table 11 codon_start 1 locus_tag LOCUS_33210 CDS complement(64920..66014) product 2'-deoxycytidine 5'-triphosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533637.1 transl_table 11 codon_start 1 locus_tag LOCUS_33220 CDS 66260..67459 product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533638.1 transl_table 11 codon_start 1 locus_tag LOCUS_33230 CDS 67764..69707 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33240 CDS complement(69718..72621) product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173101.1 transl_table 11 codon_start 1 locus_tag LOCUS_33250 gene polA CDS 72998..74389 product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067585.1 transl_table 11 codon_start 1 locus_tag LOCUS_33260 CDS 74463..75080 product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529549.1 transl_table 11 codon_start 1 locus_tag LOCUS_33270 CDS complement(75232..75582) product septal ring lytic transglycosylase RlpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528714.1 transl_table 11 codon_start 1 locus_tag LOCUS_33280 CDS complement(75979..77376) product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528744.1 transl_table 11 codon_start 1 locus_tag LOCUS_33290 gene lpdA CDS complement(77378..78691) product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528743.1 transl_table 11 codon_start 1 locus_tag LOCUS_33300 CDS complement(78688..79692) product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394030.1 transl_table 11 codon_start 1 locus_tag LOCUS_33310 CDS complement(79710..80978) product 3-methyl-2-oxobutanoate dehydrogenase (2-methylpropanoyl-transferring) subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528741.1 transl_table 11 codon_start 1 locus_tag LOCUS_33320 CDS 81077..81355 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33330 CDS 81487..82809 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388484.1 transl_table 11 codon_start 1 locus_tag LOCUS_33340 CDS 82991..85156 product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529554.1 transl_table 11 codon_start 1 locus_tag LOCUS_33350 CDS 85252..86472 product polyhydroxyalkanoate depolymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528715.1 transl_table 11 codon_start 1 locus_tag LOCUS_33360 CDS 86488..87009 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528399.1 transl_table 11 codon_start 1 locus_tag LOCUS_33370 CDS 87211..87960 product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533651.1 transl_table 11 codon_start 1 locus_tag LOCUS_33380 CDS complement(87978..88952) product Hsp33 family molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533641.1 transl_table 11 codon_start 1 locus_tag LOCUS_33390 CDS complement(89095..90006) product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533642.1 transl_table 11 codon_start 1 locus_tag LOCUS_33400 gene argF CDS complement(90006..91226) product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533643.1 transl_table 11 codon_start 1 locus_tag LOCUS_33410 CDS 91693..92265 product GcrA family cell cycle regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533644.1 transl_table 11 codon_start 1 locus_tag LOCUS_33420 CDS complement(92332..93054) product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533646.1 transl_table 11 codon_start 1 locus_tag LOCUS_33430 gene phoU CDS complement(93192..94463) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063171201.1 transl_table 11 codon_start 1 locus_tag LOCUS_33440 CDS 94709..95629 product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533648.1 transl_table 11 codon_start 1 locus_tag LOCUS_33450 gene ppk2 CDS complement(95634..96074) product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530317.1 transl_table 11 codon_start 1 locus_tag LOCUS_33460 CDS 96229..97140 product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970360.1 transl_table 11 codon_start 1 locus_tag LOCUS_33470 CDS 97137..97997 product manganese/iron ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172901062.1 transl_table 11 codon_start 1 locus_tag LOCUS_33480 CDS 97994..98860 product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970362.1 transl_table 11 codon_start 1 locus_tag LOCUS_33490 CDS 98857..99711 product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067128.1 transl_table 11 codon_start 1 locus_tag LOCUS_33500 CDS 99790..101037 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085615.1 transl_table 11 codon_start 1 locus_tag LOCUS_33510 CDS complement(101034..101771) product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529604.1 transl_table 11 codon_start 1 locus_tag LOCUS_33520 gene nth CDS 101770..102285 product DUF2244 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529603.1 transl_table 11 codon_start 1 locus_tag LOCUS_33530 CDS 102301..103254 product bifunctional helix-turn-helix domain-containing protein/methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529602.1 transl_table 11 codon_start 1 locus_tag LOCUS_33540 CDS 103462..104460 product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529637.1 transl_table 11 codon_start 1 locus_tag LOCUS_33550 CDS 105045..105242 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33560 tRNA complement(105298..105372) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00450 CDS 105538..105723 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33570 CDS 105796..107115 product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968701.1 transl_table 11 codon_start 1 locus_tag LOCUS_33580 gene murA CDS 107157..108449 product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530199.1 transl_table 11 codon_start 1 locus_tag LOCUS_33590 gene hisD CDS 108476..109042 product UPF0262 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530198.1 transl_table 11 codon_start 1 locus_tag LOCUS_33600 CDS 109042..109524 product low molecular weight phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970965.1 transl_table 11 codon_start 1 locus_tag LOCUS_33610 CDS 109630..109848 product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006200926.1 transl_table 11 codon_start 1 locus_tag LOCUS_33620 gene infA CDS 109900..110529 product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530196.1 transl_table 11 codon_start 1 locus_tag LOCUS_33630 CDS 110639..110848 product DNA gyrase inhibitor YacG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530195.1 transl_table 11 codon_start 1 locus_tag LOCUS_33640 gene yacG tRNA 111032..111107 product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00460 CDS 111449..112069 product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975255.1 transl_table 11 codon_start 1 locus_tag LOCUS_33650 CDS complement(112074..112784) product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009562709.1 transl_table 11 codon_start 1 locus_tag LOCUS_33660 CDS 113058..113996 product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085835.1 transl_table 11 codon_start 1 locus_tag LOCUS_33670 CDS 114048..114557 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33680 CDS 114569..116056 product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724194.1 transl_table 11 codon_start 1 locus_tag LOCUS_33690 CDS 116141..117304 product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382304.1 transl_table 11 codon_start 1 locus_tag LOCUS_33700 CDS 117351..119090 product L-arabinonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973469.1 transl_table 11 codon_start 1 locus_tag LOCUS_33710 gene araD CDS 119100..119996 product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106713570.1 transl_table 11 codon_start 1 locus_tag LOCUS_33720 CDS 120289..121176 product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368588.1 transl_table 11 codon_start 1 locus_tag LOCUS_33730 CDS complement(121206..122081) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089677.1 transl_table 11 codon_start 1 locus_tag LOCUS_33740 CDS 122264..123211 product ring-cleaving dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969975.1 transl_table 11 codon_start 1 locus_tag LOCUS_33750 CDS 123362..123994 product isochorismate family cysteine hydrolase YcaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000046156.1 transl_table 11 codon_start 1 locus_tag LOCUS_33760 gene ycaC CDS 124548..125249 product gluconate 2-dehydrogenase subunit 3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809653.1 transl_table 11 codon_start 1 locus_tag LOCUS_33770 CDS 125253..127022 product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064275.1 transl_table 11 codon_start 1 locus_tag LOCUS_33780 CDS 127034..128353 product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064274.1 transl_table 11 codon_start 1 locus_tag LOCUS_33790 CDS 128736..131627 product monovalent cation/H+ antiporter subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972638.1 transl_table 11 codon_start 1 locus_tag LOCUS_33800 CDS 131627..131965 product Na+/H+ antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003493763.1 transl_table 11 codon_start 1 locus_tag LOCUS_33810 CDS 131962..133587 product monovalent cation/H+ antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162687984.1 transl_table 11 codon_start 1 locus_tag LOCUS_33820 CDS 133589..134065 product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970946.1 transl_table 11 codon_start 1 locus_tag LOCUS_33830 CDS 134062..134346 product K+/H+ antiporter subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313274.1 transl_table 11 codon_start 1 locus_tag LOCUS_33840 CDS 134343..134750 product monovalent cation/H(+) antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970945.1 transl_table 11 codon_start 1 locus_tag LOCUS_33850 gene mnhG CDS complement(134798..135601) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33860 note possible pseudo, frameshifted CDS complement(135598..136479) product spermidine/putrescine ABC transporter permease PotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000715491.1 transl_table 11 codon_start 1 locus_tag LOCUS_33870 gene potB CDS complement(136472..137536) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804129.1 transl_table 11 codon_start 1 locus_tag LOCUS_33880 CDS complement(137614..138735) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000731892.1 transl_table 11 codon_start 1 locus_tag LOCUS_33890 CDS 139237..139935 product sulfate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037400525.1 transl_table 11 codon_start 1 locus_tag LOCUS_33900 CDS complement(139938..140576) product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529571.1 transl_table 11 codon_start 1 locus_tag LOCUS_33910 CDS complement(140671..141333) product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529570.1 transl_table 11 codon_start 1 locus_tag LOCUS_33920 gene grpE CDS complement(141433..142503) product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528633.1 transl_table 11 codon_start 1 locus_tag LOCUS_33930 gene hrcA CDS 142651..143367 product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528632.1 transl_table 11 codon_start 1 locus_tag LOCUS_33940 gene rph CDS 143370..143780 product glyoxalase/bleomycin resistance/extradiol dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528631.1 transl_table 11 codon_start 1 locus_tag LOCUS_33950 CDS 143783..144430 product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528630.1 transl_table 11 codon_start 1 locus_tag LOCUS_33960 gene rdgB CDS 144427..145593 product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528629.1 transl_table 11 codon_start 1 locus_tag LOCUS_33970 gene hemW CDS 145598..146494 product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173477.1 transl_table 11 codon_start 1 locus_tag LOCUS_33980 gene rsmI CDS 146487..146867 product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_210328395.1 transl_table 11 codon_start 1 locus_tag LOCUS_33990 sequence13 source 1..52353 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 375..728 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34000 note possible pseudo, frameshifted CDS 908..1450 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34010 note possible pseudo, frameshifted CDS 1649..2344 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34020 CDS complement(2422..3855) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34030 CDS complement(3924..16925) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34040 CDS complement(16988..17578) product tail assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419708.1 transl_table 11 codon_start 1 locus_tag LOCUS_34050 CDS complement(17630..18043) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34060 CDS complement(18085..18795) product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096343.1 transl_table 11 codon_start 1 locus_tag LOCUS_34070 CDS complement(18797..19552) product phage minor tail protein L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000055651.1 transl_table 11 codon_start 1 locus_tag LOCUS_34080 CDS complement(19549..19887) product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267966.1 transl_table 11 codon_start 1 locus_tag LOCUS_34090 CDS complement(19887..23243) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34100 CDS complement(23476..23841) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34110 CDS complement(23899..24360) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34120 CDS complement(24392..24793) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34130 CDS complement(24790..25179) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34140 CDS complement(25160..25498) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34150 CDS complement(25495..25791) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34160 CDS complement(25793..26053) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34170 CDS complement(26112..27398) product phage major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336913.1 transl_table 11 codon_start 1 locus_tag LOCUS_34180 CDS complement(27476..28396) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34190 CDS complement(28433..29692) product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000523689.1 transl_table 11 codon_start 1 locus_tag LOCUS_34200 CDS complement(29692..29871) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34210 CDS complement(29865..31574) product terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000088178.1 transl_table 11 codon_start 1 locus_tag LOCUS_34220 CDS complement(31609..32031) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34230 CDS complement(32546..32977) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000218787.1 transl_table 11 codon_start 1 locus_tag LOCUS_34240 CDS complement(32974..33258) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34250 CDS complement(33601..34857) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34260 CDS complement(35124..35423) product DUF4406 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001266130.1 transl_table 11 codon_start 1 locus_tag LOCUS_34270 CDS complement(35432..35587) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34280 CDS complement(35535..35759) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34290 CDS 35900..36184 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34300 CDS complement(36170..36661) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34310 CDS complement(36658..36969) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34320 CDS complement(37028..38089) product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000935548.1 transl_table 11 codon_start 1 locus_tag LOCUS_34330 CDS complement(38407..38634) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34340 CDS complement(38646..38885) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34350 CDS 39038..39346 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34360 CDS 39346..39633 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391158.1 transl_table 11 codon_start 1 locus_tag LOCUS_34370 CDS complement(40233..40559) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34380 CDS complement(40552..40893) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34390 CDS complement(40890..41183) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34400 CDS complement(41184..41516) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34410 CDS complement(41644..42216) product exonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001090717.1 transl_table 11 codon_start 1 locus_tag LOCUS_34420 CDS complement(42462..42683) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34430 CDS complement(42664..43401) product bacteriophage antitermination protein Q inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001097238.1 transl_table 11 codon_start 1 locus_tag LOCUS_34440 CDS complement(43391..43624) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34450 CDS 43746..44654 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34460 CDS 44590..45177 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34470 CDS 45229..45417 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34480 CDS 45407..45775 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34490 CDS 45754..47166 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34500 CDS 47159..47455 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34510 CDS 47452..47739 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34520 CDS complement(48419..49552) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34530 CDS 49968..50198 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34540 CDS 50195..50449 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34550 CDS 50424..50720 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34560 CDS complement(50824..51024) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34570 CDS 50977..51222 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34580 CDS complement(51225..51407) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34590 sequence14 source 1..30530 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 208..474 product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073326483.1 transl_table 11 codon_start 1 locus_tag LOCUS_34600 CDS 468..1028 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34610 note possible pseudo, frameshifted CDS 1034..1306 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34620 note possible pseudo, frameshifted CDS complement(1241..1492) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34630 note possible pseudo, internal stop codon CDS 1583..1813 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34640 CDS complement(1822..1989) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34650 note possible pseudo, internal stop codon, frameshifted CDS complement(1932..2111) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34660 note possible pseudo, internal stop codon, frameshifted CDS 2189..2410 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34670 note possible pseudo, frameshifted CDS 2407..2979 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34680 note possible pseudo, frameshifted CDS 3327..3848 product DUF992 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973508.1 transl_table 11 codon_start 1 locus_tag LOCUS_34690 CDS 4258..5184 product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313710.1 transl_table 11 codon_start 1 locus_tag LOCUS_34700 gene rocF CDS complement(5181..5765) product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972333.1 transl_table 11 codon_start 1 locus_tag LOCUS_34710 CDS complement(6025..7356) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392424.1 transl_table 11 codon_start 1 locus_tag LOCUS_34720 CDS 7791..8987 product ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061310.1 transl_table 11 codon_start 1 locus_tag LOCUS_34730 gene cyoA CDS 9030..11036 product cytochrome o ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970677.1 transl_table 11 codon_start 1 locus_tag LOCUS_34740 gene cyoB CDS 11041..11661 product cytochrome o ubiquinol oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970676.1 transl_table 11 codon_start 1 locus_tag LOCUS_34750 gene cyoC CDS 11661..12071 product cytochrome o ubiquinol oxidase subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976137.1 transl_table 11 codon_start 1 locus_tag LOCUS_34760 gene cyoD CDS 12171..12950 product SURF1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061306.1 transl_table 11 codon_start 1 locus_tag LOCUS_34770 CDS 13149..13856 product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197905.1 transl_table 11 codon_start 1 locus_tag LOCUS_34780 CDS complement(14311..14721) product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975762.1 transl_table 11 codon_start 1 locus_tag LOCUS_34790 CDS complement(14923..16899) product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536383.1 transl_table 11 codon_start 1 locus_tag LOCUS_34800 CDS complement(16901..17299) product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527982.1 transl_table 11 codon_start 1 locus_tag LOCUS_34810 CDS complement(17313..18476) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086221.1 transl_table 11 codon_start 1 locus_tag LOCUS_34820 CDS complement(18478..19308) product enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815000.1 transl_table 11 codon_start 1 locus_tag LOCUS_34830 CDS complement(19329..20114) product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927121.1 transl_table 11 codon_start 1 locus_tag LOCUS_34840 CDS complement(20125..22458) product bifunctional salicylyl-CoA 5-hydroxylase/oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086220.1 transl_table 11 codon_start 1 locus_tag LOCUS_34850 CDS 22928..23581 product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531644.1 transl_table 11 codon_start 1 locus_tag LOCUS_34860 CDS 23779..25188 product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048655303.1 transl_table 11 codon_start 1 locus_tag LOCUS_34870 CDS 25190..26128 product alpha-E domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061414.1 transl_table 11 codon_start 1 locus_tag LOCUS_34880 CDS 26142..26936 product transglutaminase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976011.1 transl_table 11 codon_start 1 locus_tag LOCUS_34890 CDS 26971..27711 product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531816.1 transl_table 11 codon_start 1 locus_tag LOCUS_34900 CDS complement(27705..28766) product molybdenum ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394039.1 transl_table 11 codon_start 1 locus_tag LOCUS_34910 gene modC CDS complement(28766..29467) product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972402.1 transl_table 11 codon_start 1 locus_tag LOCUS_34920 gene modB CDS complement(29468..30244) product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972401.1 transl_table 11 codon_start 1 locus_tag LOCUS_34930 gene modA sequence15 source 1..9779 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(204..575) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34940 CDS complement(849..1094) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34950 CDS 1421..3106 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34960 CDS 3116..3373 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34970 CDS 3427..3615 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34980 CDS 4750..6714 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34990 CDS 6714..7445 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35000 CDS 7452..7982 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35010 CDS complement(8009..8197) product Rop family plasmid primer RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213433.1 transl_table 11 codon_start 1 locus_tag LOCUS_35020 CDS complement(8214..8642) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35030 CDS complement(8806..9120) product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071641.1 transl_table 11 codon_start 1 locus_tag LOCUS_35040 CDS complement(9108..9494) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35050 sequence16 source 1..5150 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 135..443 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35060 CDS complement(625..870) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35070 CDS 1121..1630 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35080 CDS 1637..1849 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35090 CDS 2516..2740 product TraY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390943.1 transl_table 11 codon_start 1 locus_tag LOCUS_35100 CDS 2724..2990 product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971059.1 transl_table 11 codon_start 1 locus_tag LOCUS_35110 CDS complement(3060..3455) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35120 CDS complement(3476..4021) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35130 CDS complement(4047..4373) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35140 sequence17 source 1..3048 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1509..2480 product protein rep inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002322009.1 transl_table 11 codon_start 1 locus_tag LOCUS_35150 sequence18 source 1..2650 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 865..941 product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00470 tRNA 979..1054 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00480 sequence19 source 1..1306 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1..1272) product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527900.1 transl_table 11 codon_start 1 locus_tag LOCUS_35160 gene metK sequence20 source 1..1021 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence21 source 1..953 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..800 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000019441.1:IS5-like element ISKpn26 family transposase locus_tag LOCUS_35170 sequence22 source 1..934 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence23 source 1..852 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence24 source 1..602 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@