>Feature sequence01 1641 682 gene locus_tag LOCUS_00010 gene coxB 1641 682 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028168.1 protein_id gnl|my_center|LOCUS_00010 1943 3277 gene locus_tag LOCUS_00020 1943 3277 CDS product cysteine desulfurase/sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028169.1 protein_id gnl|my_center|LOCUS_00020 4336 3362 gene locus_tag LOCUS_00030 4336 3362 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326033.1 protein_id gnl|my_center|LOCUS_00030 4468 4677 gene locus_tag LOCUS_00040 4468 4677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976656.1 protein_id gnl|my_center|LOCUS_00040 4751 6178 gene locus_tag LOCUS_00050 4751 6178 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028170.1 protein_id gnl|my_center|LOCUS_00050 6599 6243 gene locus_tag LOCUS_00060 6599 6243 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976654.1 protein_id gnl|my_center|LOCUS_00060 6842 8026 gene locus_tag LOCUS_00070 gene nadA 6842 8026 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030869444.1 protein_id gnl|my_center|LOCUS_00070 11244 8131 gene locus_tag LOCUS_00080 11244 8131 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976652.1 protein_id gnl|my_center|LOCUS_00080 12081 11398 gene locus_tag LOCUS_00090 12081 11398 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976651.1 protein_id gnl|my_center|LOCUS_00090 13298 12078 gene locus_tag LOCUS_00100 13298 12078 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976650.1 protein_id gnl|my_center|LOCUS_00100 13743 13459 gene locus_tag LOCUS_00110 13743 13459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976649.1 protein_id gnl|my_center|LOCUS_00110 14650 13775 gene locus_tag LOCUS_00120 14650 13775 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063739112.1 protein_id gnl|my_center|LOCUS_00120 14813 15439 gene locus_tag LOCUS_00130 14813 15439 CDS product DUF3043 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028173.1 protein_id gnl|my_center|LOCUS_00130 15496 16224 gene locus_tag LOCUS_00140 15496 16224 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028174.1 protein_id gnl|my_center|LOCUS_00140 16288 17364 gene locus_tag LOCUS_00150 16288 17364 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028175.1 protein_id gnl|my_center|LOCUS_00150 17673 17461 gene locus_tag LOCUS_00160 17673 17461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976644.1 protein_id gnl|my_center|LOCUS_00160 17813 19033 gene locus_tag LOCUS_00170 17813 19033 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030869456.1 protein_id gnl|my_center|LOCUS_00170 19746 19030 gene locus_tag LOCUS_00180 19746 19030 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191849152.1 protein_id gnl|my_center|LOCUS_00180 19888 21009 gene locus_tag LOCUS_00190 gene cobT 19888 21009 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028178.1 protein_id gnl|my_center|LOCUS_00190 21051 21827 gene locus_tag LOCUS_00200 21051 21827 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028180.1 protein_id gnl|my_center|LOCUS_00200 22044 23585 gene locus_tag LOCUS_00210 22044 23585 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028182.1 protein_id gnl|my_center|LOCUS_00210 23884 25272 gene locus_tag LOCUS_00220 gene lpdA 23884 25272 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030873385.1 protein_id gnl|my_center|LOCUS_00220 25335 27182 gene locus_tag LOCUS_00230 25335 27182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_00230 27382 28005 gene locus_tag LOCUS_00240 27382 28005 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976633.1 protein_id gnl|my_center|LOCUS_00240 28360 31071 gene locus_tag LOCUS_00250 gene aceE 28360 31071 CDS product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976632.1 protein_id gnl|my_center|LOCUS_00250 31141 32124 gene locus_tag LOCUS_00260 31141 32124 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976631.1 protein_id gnl|my_center|LOCUS_00260 32221 32739 gene locus_tag LOCUS_00270 32221 32739 CDS product DUF4240 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870944.1 protein_id gnl|my_center|LOCUS_00270 33089 32817 gene locus_tag LOCUS_00280 33089 32817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 33913 33086 gene locus_tag LOCUS_00290 33913 33086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00290 34130 35314 gene locus_tag LOCUS_00300 34130 35314 CDS product MarP family serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136209493.1 protein_id gnl|my_center|LOCUS_00300 35810 35322 gene locus_tag LOCUS_00310 35810 35322 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037667418.1 protein_id gnl|my_center|LOCUS_00310 35882 36790 gene locus_tag LOCUS_00320 35882 36790 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870932.1 protein_id gnl|my_center|LOCUS_00320 37379 38827 gene locus_tag LOCUS_00330 37379 38827 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028190.1 protein_id gnl|my_center|LOCUS_00330 40351 38888 gene locus_tag LOCUS_00340 40351 38888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028191.1 protein_id gnl|my_center|LOCUS_00340 40605 41423 gene locus_tag LOCUS_00350 gene lipB 40605 41423 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976622.1 protein_id gnl|my_center|LOCUS_00350 41543 42508 gene locus_tag LOCUS_00360 gene lipA 41543 42508 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976621.1 protein_id gnl|my_center|LOCUS_00360 42774 42974 gene locus_tag LOCUS_00370 42774 42974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028192.1 protein_id gnl|my_center|LOCUS_00370 43045 43749 gene locus_tag LOCUS_00380 43045 43749 CDS product DUF4191 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976619.1 protein_id gnl|my_center|LOCUS_00380 44370 43846 gene locus_tag LOCUS_00390 44370 43846 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976618.1 protein_id gnl|my_center|LOCUS_00390 44523 45932 gene locus_tag LOCUS_00400 gene glnA 44523 45932 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976617.1 protein_id gnl|my_center|LOCUS_00400 46068 46325 gene locus_tag LOCUS_00410 46068 46325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173668721.1 protein_id gnl|my_center|LOCUS_00410 46652 46368 gene locus_tag LOCUS_00420 46652 46368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 46733 48025 gene locus_tag LOCUS_00430 46733 48025 CDS product winged helix DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028195.1 protein_id gnl|my_center|LOCUS_00430 48413 48087 gene locus_tag LOCUS_00440 48413 48087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976610.1 protein_id gnl|my_center|LOCUS_00440 48587 48946 gene locus_tag LOCUS_00450 48587 48946 CDS product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223911.1 protein_id gnl|my_center|LOCUS_00450 49271 50302 gene locus_tag LOCUS_00460 49271 50302 CDS product glutamine synthetase beta-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028199.1 protein_id gnl|my_center|LOCUS_00460 50679 51257 gene locus_tag LOCUS_00470 50679 51257 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028201.1 protein_id gnl|my_center|LOCUS_00470 51350 52615 gene locus_tag LOCUS_00480 51350 52615 CDS product sensor domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028203.1 protein_id gnl|my_center|LOCUS_00480 52600 53256 gene locus_tag LOCUS_00490 52600 53256 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028204.1 protein_id gnl|my_center|LOCUS_00490 53374 54858 gene locus_tag LOCUS_00500 53374 54858 CDS product DUF1996 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028205.1 protein_id gnl|my_center|LOCUS_00500 55313 54927 gene locus_tag LOCUS_00510 55313 54927 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976597.1 protein_id gnl|my_center|LOCUS_00510 55601 57040 gene locus_tag LOCUS_00520 55601 57040 CDS product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775825.1 protein_id gnl|my_center|LOCUS_00520 59276 57123 gene locus_tag LOCUS_00530 59276 57123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109032946.1 protein_id gnl|my_center|LOCUS_00530 59460 61376 gene locus_tag LOCUS_00540 59460 61376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028207.1 protein_id gnl|my_center|LOCUS_00540 61486 62079 gene locus_tag LOCUS_00550 61486 62079 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080680.1 protein_id gnl|my_center|LOCUS_00550 62958 62119 gene locus_tag LOCUS_00560 62958 62119 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275478.1 protein_id gnl|my_center|LOCUS_00560 63111 63776 gene locus_tag LOCUS_00570 63111 63776 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976592.1 protein_id gnl|my_center|LOCUS_00570 64126 63773 gene locus_tag LOCUS_00580 64126 63773 CDS product 5-carboxymethyl-2-hydroxymuconate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976590.1 protein_id gnl|my_center|LOCUS_00580 69561 64171 gene locus_tag LOCUS_00590 gene pulA 69561 64171 CDS product pullulanase-type alpha-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486784.1 protein_id gnl|my_center|LOCUS_00590 71071 69698 gene locus_tag LOCUS_00600 71071 69698 CDS product carbohydrate-binding module family 20 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486988.1 protein_id gnl|my_center|LOCUS_00600 73003 71195 gene locus_tag LOCUS_00610 73003 71195 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028213.1 protein_id gnl|my_center|LOCUS_00610 73920 73018 gene locus_tag LOCUS_00620 73920 73018 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976585.1 protein_id gnl|my_center|LOCUS_00620 74932 73928 gene locus_tag LOCUS_00630 74932 73928 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976584.1 protein_id gnl|my_center|LOCUS_00630 76308 75040 gene locus_tag LOCUS_00640 76308 75040 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976583.1 protein_id gnl|my_center|LOCUS_00640 76715 77704 gene locus_tag LOCUS_00650 76715 77704 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976582.1 protein_id gnl|my_center|LOCUS_00650 77816 78643 gene locus_tag LOCUS_00660 77816 78643 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028214.1 protein_id gnl|my_center|LOCUS_00660 82068 79066 gene locus_tag LOCUS_00670 82068 79066 CDS product bifunctional [glutamine synthetase] adenylyltransferase/[glutamine synthetase]-adenylyl-L-tyrosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028215.1 protein_id gnl|my_center|LOCUS_00670 84058 82304 gene locus_tag LOCUS_00680 84058 82304 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136208946.1 protein_id gnl|my_center|LOCUS_00680 84923 84297 gene locus_tag LOCUS_00690 84923 84297 CDS product DUF305 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229546.1 protein_id gnl|my_center|LOCUS_00690 85585 84920 gene locus_tag LOCUS_00700 85585 84920 CDS product DUF3105 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028218.1 protein_id gnl|my_center|LOCUS_00700 85895 87256 gene locus_tag LOCUS_00710 gene glnA 85895 87256 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976572.1 protein_id gnl|my_center|LOCUS_00710 87680 87318 gene locus_tag LOCUS_00720 87680 87318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 88571 87828 gene locus_tag LOCUS_00730 88571 87828 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903333.1 protein_id gnl|my_center|LOCUS_00730 89734 88568 gene locus_tag LOCUS_00740 89734 88568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 89969 90457 gene locus_tag LOCUS_00750 89969 90457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 90508 91041 gene locus_tag LOCUS_00760 90508 91041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 91144 91884 gene locus_tag LOCUS_00770 91144 91884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 93140 91923 gene locus_tag LOCUS_00780 93140 91923 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028228.1 protein_id gnl|my_center|LOCUS_00780 94367 93315 gene locus_tag LOCUS_00790 gene vanJ 94367 93315 CDS product teicoplanin resistance protein VanJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029107.1 protein_id gnl|my_center|LOCUS_00790 94666 95541 gene locus_tag LOCUS_00800 gene panB 94666 95541 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976556.1 protein_id gnl|my_center|LOCUS_00800 95710 96759 gene locus_tag LOCUS_00810 95710 96759 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976555.1 protein_id gnl|my_center|LOCUS_00810 96756 97616 gene locus_tag LOCUS_00820 96756 97616 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976554.1 protein_id gnl|my_center|LOCUS_00820 100936 97628 gene locus_tag LOCUS_00830 100936 97628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00830 101081 101878 gene locus_tag LOCUS_00840 101081 101878 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976552.1 protein_id gnl|my_center|LOCUS_00840 102053 101868 gene locus_tag LOCUS_00850 102053 101868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326075.1 protein_id gnl|my_center|LOCUS_00850 102825 102118 gene locus_tag LOCUS_00860 gene npdG 102825 102118 CDS product NADPH-dependent F420 reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028232.1 protein_id gnl|my_center|LOCUS_00860 103916 102822 gene locus_tag LOCUS_00870 103916 102822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 104392 104165 gene locus_tag LOCUS_00880 104392 104165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976547.1 protein_id gnl|my_center|LOCUS_00880 104451 105308 gene locus_tag LOCUS_00890 gene map 104451 105308 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976546.1 protein_id gnl|my_center|LOCUS_00890 105957 105313 gene locus_tag LOCUS_00900 105957 105313 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028237.1 protein_id gnl|my_center|LOCUS_00900 106061 107053 gene locus_tag LOCUS_00910 106061 107053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270025.1 protein_id gnl|my_center|LOCUS_00910 107840 107106 gene locus_tag LOCUS_00920 107840 107106 CDS product bifunctional DNA primase/polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976534.1 protein_id gnl|my_center|LOCUS_00920 108537 107932 gene locus_tag LOCUS_00930 108537 107932 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976533.1 protein_id gnl|my_center|LOCUS_00930 109600 108611 gene locus_tag LOCUS_00940 109600 108611 CDS product small ribosomal subunit Rsm22 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028248.1 protein_id gnl|my_center|LOCUS_00940 110954 109974 gene locus_tag LOCUS_00950 110954 109974 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173943938.1 protein_id gnl|my_center|LOCUS_00950 112402 111101 gene locus_tag LOCUS_00960 112402 111101 CDS product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028249.1 protein_id gnl|my_center|LOCUS_00960 112514 113530 gene locus_tag LOCUS_00970 112514 113530 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168715519.1 protein_id gnl|my_center|LOCUS_00970 115157 113517 gene locus_tag LOCUS_00980 115157 113517 CDS product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028251.1 protein_id gnl|my_center|LOCUS_00980 115322 116077 gene locus_tag LOCUS_00990 115322 116077 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028252.1 protein_id gnl|my_center|LOCUS_00990 116499 117044 gene locus_tag LOCUS_01000 116499 117044 CDS product DoxX family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976524.1 protein_id gnl|my_center|LOCUS_01000 117213 118235 gene locus_tag LOCUS_01010 117213 118235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 120033 118270 gene locus_tag LOCUS_01020 120033 118270 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028573.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01020 119929 120513 gene locus_tag LOCUS_01030 119929 120513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 120506 121159 gene locus_tag LOCUS_01040 120506 121159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204026379.1 protein_id gnl|my_center|LOCUS_01040 121998 121150 gene locus_tag LOCUS_01050 121998 121150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031057.1 protein_id gnl|my_center|LOCUS_01050 122017 122229 gene locus_tag LOCUS_01060 122017 122229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 122323 123558 gene locus_tag LOCUS_01070 122323 123558 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925399.1 protein_id gnl|my_center|LOCUS_01070 123561 124040 gene locus_tag LOCUS_01080 123561 124040 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727872.1 protein_id gnl|my_center|LOCUS_01080 124093 124509 gene locus_tag LOCUS_01090 124093 124509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 124684 124854 gene locus_tag LOCUS_01100 124684 124854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 131200 125003 gene locus_tag LOCUS_01110 131200 125003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 132168 131608 gene locus_tag LOCUS_01120 132168 131608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484581.1 protein_id gnl|my_center|LOCUS_01120 133782 132850 gene locus_tag LOCUS_01130 133782 132850 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043688023.1 protein_id gnl|my_center|LOCUS_01130 134632 133805 gene locus_tag LOCUS_01140 134632 133805 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028257.1 protein_id gnl|my_center|LOCUS_01140 134852 135625 gene locus_tag LOCUS_01150 134852 135625 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028258.1 protein_id gnl|my_center|LOCUS_01150 135622 136221 gene locus_tag LOCUS_01160 135622 136221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028259.1 protein_id gnl|my_center|LOCUS_01160 136272 137057 gene locus_tag LOCUS_01170 gene yaaA 136272 137057 CDS product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976516.1 protein_id gnl|my_center|LOCUS_01170 137139 137786 gene locus_tag LOCUS_01180 gene eda 137139 137786 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028260.1 protein_id gnl|my_center|LOCUS_01180 139080 137761 gene locus_tag LOCUS_01190 139080 137761 CDS product bifunctional RNase H/acid phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028261.1 protein_id gnl|my_center|LOCUS_01190 139914 139093 gene locus_tag LOCUS_01200 139914 139093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 140672 139833 gene locus_tag LOCUS_01210 140672 139833 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028263.1 protein_id gnl|my_center|LOCUS_01210 140873 142030 gene locus_tag LOCUS_01220 140873 142030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107098776.1 protein_id gnl|my_center|LOCUS_01220 142128 142298 gene locus_tag LOCUS_01230 142128 142298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976510.1 protein_id gnl|my_center|LOCUS_01230 143340 142453 gene locus_tag LOCUS_01240 143340 142453 CDS product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030871467.1 protein_id gnl|my_center|LOCUS_01240 143504 145243 gene locus_tag LOCUS_01250 143504 145243 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225330.1 protein_id gnl|my_center|LOCUS_01250 145351 146001 gene locus_tag LOCUS_01260 145351 146001 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976501.1 protein_id gnl|my_center|LOCUS_01260 146022 146927 gene locus_tag LOCUS_01270 146022 146927 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028273.1 protein_id gnl|my_center|LOCUS_01270 147052 147888 gene locus_tag LOCUS_01280 147052 147888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 148013 148300 gene locus_tag LOCUS_01290 148013 148300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976498.1 protein_id gnl|my_center|LOCUS_01290 149411 148341 gene locus_tag LOCUS_01300 149411 148341 CDS product prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028275.1 protein_id gnl|my_center|LOCUS_01300 150142 149408 gene locus_tag LOCUS_01310 150142 149408 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976496.1 protein_id gnl|my_center|LOCUS_01310 151515 150136 gene locus_tag LOCUS_01320 151515 150136 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028276.1 protein_id gnl|my_center|LOCUS_01320 151638 152384 gene locus_tag LOCUS_01330 151638 152384 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976494.1 protein_id gnl|my_center|LOCUS_01330 152709 153929 gene locus_tag LOCUS_01340 152709 153929 CDS product terpene cyclase/mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976492.1 protein_id gnl|my_center|LOCUS_01340 153926 154594 gene locus_tag LOCUS_01350 153926 154594 CDS product SCO2322 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028279.1 protein_id gnl|my_center|LOCUS_01350 154584 155735 gene locus_tag LOCUS_01360 154584 155735 CDS product CbiQ family ECF transporter T component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028280.1 protein_id gnl|my_center|LOCUS_01360 155732 157408 gene locus_tag LOCUS_01370 155732 157408 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028281.1 protein_id gnl|my_center|LOCUS_01370 157405 158250 gene locus_tag LOCUS_01380 157405 158250 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028282.1 protein_id gnl|my_center|LOCUS_01380 158366 159997 gene locus_tag LOCUS_01390 158366 159997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028289.1 protein_id gnl|my_center|LOCUS_01390 162011 159951 gene locus_tag LOCUS_01400 162011 159951 CDS product bifunctional glycosyltransferase 87/phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270029.1 protein_id gnl|my_center|LOCUS_01400 162480 162307 gene locus_tag LOCUS_01410 162480 162307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 162398 163780 gene locus_tag LOCUS_01420 gene proP 162398 163780 CDS product glycine betaine/L-proline transporter ProP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028291.1 protein_id gnl|my_center|LOCUS_01420 164354 163962 gene locus_tag LOCUS_01430 164354 163962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326109.1 protein_id gnl|my_center|LOCUS_01430 165140 164493 gene locus_tag LOCUS_01440 165140 164493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976463.1 protein_id gnl|my_center|LOCUS_01440 165781 165146 gene locus_tag LOCUS_01450 165781 165146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976462.1 protein_id gnl|my_center|LOCUS_01450 165980 166483 gene locus_tag LOCUS_01460 165980 166483 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976461.1 protein_id gnl|my_center|LOCUS_01460 168535 166487 gene locus_tag LOCUS_01470 168535 166487 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028294.1 protein_id gnl|my_center|LOCUS_01470 168706 169866 gene locus_tag LOCUS_01480 168706 169866 CDS product peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486742.1 protein_id gnl|my_center|LOCUS_01480 170666 170004 gene locus_tag LOCUS_01490 170666 170004 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028296.1 protein_id gnl|my_center|LOCUS_01490 171465 170884 gene locus_tag LOCUS_01500 171465 170884 CDS product TMEM165/GDT1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028297.1 protein_id gnl|my_center|LOCUS_01500 171849 172493 gene locus_tag LOCUS_01510 171849 172493 CDS product HNH endonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976456.1 protein_id gnl|my_center|LOCUS_01510 172561 174192 gene locus_tag LOCUS_01520 172561 174192 CDS product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028298.1 protein_id gnl|my_center|LOCUS_01520 174386 174838 gene locus_tag LOCUS_01530 174386 174838 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976454.1 protein_id gnl|my_center|LOCUS_01530 175394 174894 gene locus_tag LOCUS_01540 175394 174894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 175695 176306 gene locus_tag LOCUS_01550 175695 176306 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976453.1 protein_id gnl|my_center|LOCUS_01550 177155 176334 gene locus_tag LOCUS_01560 177155 176334 CDS product glycoside hydrolase family 6 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804931.1 protein_id gnl|my_center|LOCUS_01560 177532 178545 gene locus_tag LOCUS_01570 177532 178545 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804930.1 protein_id gnl|my_center|LOCUS_01570 178754 179860 gene locus_tag LOCUS_01580 178754 179860 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225151.1 protein_id gnl|my_center|LOCUS_01580 180136 179906 gene locus_tag LOCUS_01590 180136 179906 CDS product DUF2277 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028299.1 protein_id gnl|my_center|LOCUS_01590 180675 180169 gene locus_tag LOCUS_01600 180675 180169 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028300.1 protein_id gnl|my_center|LOCUS_01600 180744 181088 gene locus_tag LOCUS_01610 180744 181088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028301.1 protein_id gnl|my_center|LOCUS_01610 181411 181337 gene locus_tag LOCUS_t00010 181411 181337 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 181569 182339 gene locus_tag LOCUS_01620 181569 182339 CDS product DUF4097 family beta strand repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976449.1 protein_id gnl|my_center|LOCUS_01620 182411 183739 gene locus_tag LOCUS_01630 182411 183739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028302.1 protein_id gnl|my_center|LOCUS_01630 183847 184074 gene locus_tag LOCUS_01640 183847 184074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 184133 184795 gene locus_tag LOCUS_01650 184133 184795 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037897986.1 protein_id gnl|my_center|LOCUS_01650 185591 184788 gene locus_tag LOCUS_01660 185591 184788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028306.1 protein_id gnl|my_center|LOCUS_01660 188311 185591 gene locus_tag LOCUS_01670 188311 185591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 189550 188384 gene locus_tag LOCUS_01680 189550 188384 CDS product HpcH/HpaI aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028308.1 protein_id gnl|my_center|LOCUS_01680 189770 190675 gene locus_tag LOCUS_01690 189770 190675 CDS product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976440.1 protein_id gnl|my_center|LOCUS_01690 191429 190692 gene locus_tag LOCUS_01700 191429 190692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976439.1 protein_id gnl|my_center|LOCUS_01700 192739 191597 gene locus_tag LOCUS_01710 192739 191597 CDS product DUF475 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028309.1 protein_id gnl|my_center|LOCUS_01710 193365 192790 gene locus_tag LOCUS_01720 193365 192790 CDS product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976437.1 protein_id gnl|my_center|LOCUS_01720 194055 193480 gene locus_tag LOCUS_01730 194055 193480 CDS product calcium homeostasis/redox stress adaptation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976436.1 protein_id gnl|my_center|LOCUS_01730 194623 194165 gene locus_tag LOCUS_01740 194623 194165 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976435.1 protein_id gnl|my_center|LOCUS_01740 195191 194754 gene locus_tag LOCUS_01750 195191 194754 CDS product DUF3052 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202437260.1 protein_id gnl|my_center|LOCUS_01750 195556 198288 gene locus_tag LOCUS_01760 gene aceE 195556 198288 CDS product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976432.1 protein_id gnl|my_center|LOCUS_01760 198728 198423 gene locus_tag LOCUS_01770 198728 198423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028310.1 protein_id gnl|my_center|LOCUS_01770 200594 198975 gene locus_tag LOCUS_01780 200594 198975 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027641.1 protein_id gnl|my_center|LOCUS_01780 200706 201374 gene locus_tag LOCUS_01790 200706 201374 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028311.1 protein_id gnl|my_center|LOCUS_01790 201517 202692 gene locus_tag LOCUS_01800 201517 202692 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028312.1 protein_id gnl|my_center|LOCUS_01800 202760 203611 gene locus_tag LOCUS_01810 202760 203611 CDS product DUF4429 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976427.1 protein_id gnl|my_center|LOCUS_01810 204661 203645 gene locus_tag LOCUS_01820 204661 203645 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028313.1 protein_id gnl|my_center|LOCUS_01820 205116 204658 gene locus_tag LOCUS_01830 205116 204658 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326123.1 protein_id gnl|my_center|LOCUS_01830 205223 205693 gene locus_tag LOCUS_01840 205223 205693 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976424.1 protein_id gnl|my_center|LOCUS_01840 205713 206534 gene locus_tag LOCUS_01850 205713 206534 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028315.1 protein_id gnl|my_center|LOCUS_01850 206817 206548 gene locus_tag LOCUS_01860 206817 206548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 207581 206922 gene locus_tag LOCUS_01870 207581 206922 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028320.1 protein_id gnl|my_center|LOCUS_01870 207644 208849 gene locus_tag LOCUS_01880 gene fasR 207644 208849 CDS product fatty acid biosynthesis transcriptional regulator FasR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028321.1 protein_id gnl|my_center|LOCUS_01880 208939 209853 gene locus_tag LOCUS_01890 208939 209853 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028322.1 protein_id gnl|my_center|LOCUS_01890 209870 210871 gene locus_tag LOCUS_01900 209870 210871 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976418.1 protein_id gnl|my_center|LOCUS_01900 210948 211196 gene locus_tag LOCUS_01910 210948 211196 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976417.1 protein_id gnl|my_center|LOCUS_01910 211305 212576 gene locus_tag LOCUS_01920 211305 212576 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028323.1 protein_id gnl|my_center|LOCUS_01920 213126 212656 gene locus_tag LOCUS_01930 213126 212656 CDS product DUF3145 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976415.1 protein_id gnl|my_center|LOCUS_01930 213411 214298 gene locus_tag LOCUS_01940 213411 214298 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976414.1 protein_id gnl|my_center|LOCUS_01940 214326 215303 gene locus_tag LOCUS_01950 214326 215303 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028324.1 protein_id gnl|my_center|LOCUS_01950 216303 215488 gene locus_tag LOCUS_01960 216303 215488 CDS product EI24 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028326.1 protein_id gnl|my_center|LOCUS_01960 216765 216346 gene locus_tag LOCUS_01970 216765 216346 CDS product organic hydroperoxide resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976410.1 protein_id gnl|my_center|LOCUS_01970 217890 216868 gene locus_tag LOCUS_01980 217890 216868 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976409.1 protein_id gnl|my_center|LOCUS_01980 217994 218446 gene locus_tag LOCUS_01990 217994 218446 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028328.1 protein_id gnl|my_center|LOCUS_01990 218602 218925 gene locus_tag LOCUS_02000 218602 218925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 219566 218922 gene locus_tag LOCUS_02010 219566 218922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028330.1 protein_id gnl|my_center|LOCUS_02010 219773 220939 gene locus_tag LOCUS_02020 219773 220939 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028331.1 protein_id gnl|my_center|LOCUS_02020 220936 221940 gene locus_tag LOCUS_02030 220936 221940 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976404.1 protein_id gnl|my_center|LOCUS_02030 222063 223031 gene locus_tag LOCUS_02040 222063 223031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028332.1 protein_id gnl|my_center|LOCUS_02040 223247 223026 gene locus_tag LOCUS_02050 223247 223026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 223129 224241 gene locus_tag LOCUS_02060 gene chvE 223129 224241 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976402.1 protein_id gnl|my_center|LOCUS_02060 224274 225824 gene locus_tag LOCUS_02070 gene gguA 224274 225824 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976401.1 protein_id gnl|my_center|LOCUS_02070 225821 227065 gene locus_tag LOCUS_02080 gene gguB 225821 227065 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976400.1 protein_id gnl|my_center|LOCUS_02080 227126 228274 gene locus_tag LOCUS_02090 227126 228274 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326127.1 protein_id gnl|my_center|LOCUS_02090 228412 229803 gene locus_tag LOCUS_02100 228412 229803 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028334.1 protein_id gnl|my_center|LOCUS_02100 230819 229851 gene locus_tag LOCUS_02110 230819 229851 CDS product arabinan endo-1,5-alpha-L-arabinosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976379.1 protein_id gnl|my_center|LOCUS_02110 231400 230945 gene locus_tag LOCUS_02120 231400 230945 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030759.1 protein_id gnl|my_center|LOCUS_02120 231530 232339 gene locus_tag LOCUS_02130 231530 232339 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226025318.1 protein_id gnl|my_center|LOCUS_02130 232336 232578 gene locus_tag LOCUS_02140 232336 232578 CDS product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030757.1 protein_id gnl|my_center|LOCUS_02140 233265 232645 gene locus_tag LOCUS_02150 233265 232645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 233749 233300 gene locus_tag LOCUS_02160 233749 233300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 237152 233823 gene locus_tag LOCUS_02170 237152 233823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 237490 237149 gene locus_tag LOCUS_02180 237490 237149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 238453 237527 gene locus_tag LOCUS_02190 238453 237527 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729296.1 protein_id gnl|my_center|LOCUS_02190 238733 241381 gene locus_tag LOCUS_02200 238733 241381 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028348.1 protein_id gnl|my_center|LOCUS_02200 242891 241386 gene locus_tag LOCUS_02210 242891 241386 CDS product alpha-N-arabinofuranosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976375.1 protein_id gnl|my_center|LOCUS_02210 243840 242986 gene locus_tag LOCUS_02220 243840 242986 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976374.1 protein_id gnl|my_center|LOCUS_02220 244778 243837 gene locus_tag LOCUS_02230 244778 243837 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976373.1 protein_id gnl|my_center|LOCUS_02230 246133 244775 gene locus_tag LOCUS_02240 246133 244775 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028349.1 protein_id gnl|my_center|LOCUS_02240 246320 247531 gene locus_tag LOCUS_02250 246320 247531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028351.1 protein_id gnl|my_center|LOCUS_02250 247639 248130 gene locus_tag LOCUS_02260 247639 248130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028350.1 protein_id gnl|my_center|LOCUS_02260 248127 249326 gene locus_tag LOCUS_02270 248127 249326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028351.1 protein_id gnl|my_center|LOCUS_02270 249358 250545 gene locus_tag LOCUS_02280 249358 250545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028352.1 protein_id gnl|my_center|LOCUS_02280 250584 251969 gene locus_tag LOCUS_02290 250584 251969 CDS product NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028353.1 protein_id gnl|my_center|LOCUS_02290 252814 251972 gene locus_tag LOCUS_02300 252814 251972 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028354.1 protein_id gnl|my_center|LOCUS_02300 253659 252886 gene locus_tag LOCUS_02310 253659 252886 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976366.1 protein_id gnl|my_center|LOCUS_02310 253822 254400 gene locus_tag LOCUS_02320 253822 254400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976365.1 protein_id gnl|my_center|LOCUS_02320 255262 254390 gene locus_tag LOCUS_02330 255262 254390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224688.1 protein_id gnl|my_center|LOCUS_02330 255466 255909 gene locus_tag LOCUS_02340 255466 255909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 256046 257494 gene locus_tag LOCUS_02350 256046 257494 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028356.1 protein_id gnl|my_center|LOCUS_02350 257487 258857 gene locus_tag LOCUS_02360 257487 258857 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028357.1 protein_id gnl|my_center|LOCUS_02360 262724 259101 gene locus_tag LOCUS_02370 262724 259101 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028358.1 protein_id gnl|my_center|LOCUS_02370 262843 263289 gene locus_tag LOCUS_02380 262843 263289 CDS product CU044_2847 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976358.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02380 263286 264935 gene locus_tag LOCUS_02390 263286 264935 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976357.1 protein_id gnl|my_center|LOCUS_02390 265027 266055 gene locus_tag LOCUS_02400 265027 266055 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976356.1 protein_id gnl|my_center|LOCUS_02400 266045 269953 gene locus_tag LOCUS_02410 266045 269953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 270124 271161 gene locus_tag LOCUS_02420 270124 271161 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976353.1 protein_id gnl|my_center|LOCUS_02420 271173 272558 gene locus_tag LOCUS_02430 271173 272558 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028361.1 protein_id gnl|my_center|LOCUS_02430 273631 272660 gene locus_tag LOCUS_02440 273631 272660 CDS product anti-sigma factor RsbA family regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027235.1 protein_id gnl|my_center|LOCUS_02440 273981 273628 gene locus_tag LOCUS_02450 273981 273628 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978263.1 protein_id gnl|my_center|LOCUS_02450 274183 274836 gene locus_tag LOCUS_02460 274183 274836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 274902 275039 gene locus_tag LOCUS_02470 274902 275039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 275419 276009 gene locus_tag LOCUS_02480 275419 276009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 276211 276136 gene locus_tag LOCUS_t00020 276211 276136 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 276429 276356 gene locus_tag LOCUS_t00030 276429 276356 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 276507 276434 gene locus_tag LOCUS_t00040 276507 276434 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 276658 276954 gene locus_tag LOCUS_02490 276658 276954 CDS product YtxH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326153.1 protein_id gnl|my_center|LOCUS_02490 277022 278476 gene locus_tag LOCUS_02500 277022 278476 CDS product FGGY family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976342.1 protein_id gnl|my_center|LOCUS_02500 278594 280327 gene locus_tag LOCUS_02510 278594 280327 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_067016493.1 protein_id gnl|my_center|LOCUS_02510 280327 282255 gene locus_tag LOCUS_02520 280327 282255 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976340.1 protein_id gnl|my_center|LOCUS_02520 283496 282279 gene locus_tag LOCUS_02530 283496 282279 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976339.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02530 285704 283794 gene locus_tag LOCUS_02540 gene dnaG 285704 283794 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976336.1 protein_id gnl|my_center|LOCUS_02540 287097 285832 gene locus_tag LOCUS_02550 287097 285832 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976335.1 protein_id gnl|my_center|LOCUS_02550 288442 287177 gene locus_tag LOCUS_02560 288442 287177 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028369.1 protein_id gnl|my_center|LOCUS_02560 289312 288521 gene locus_tag LOCUS_02570 289312 288521 CDS product CbiX/SirB N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173943936.1 protein_id gnl|my_center|LOCUS_02570 289503 290159 gene locus_tag LOCUS_02580 289503 290159 CDS product ElyC/SanA/YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976332.1 protein_id gnl|my_center|LOCUS_02580 290299 292476 gene locus_tag LOCUS_02590 290299 292476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 293074 292478 gene locus_tag LOCUS_02600 293074 292478 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976326.1 protein_id gnl|my_center|LOCUS_02600 293355 293885 gene locus_tag LOCUS_02610 293355 293885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028375.1 protein_id gnl|my_center|LOCUS_02610 294009 294623 gene locus_tag LOCUS_02620 294009 294623 CDS product class F sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976324.1 protein_id gnl|my_center|LOCUS_02620 294776 295153 gene locus_tag LOCUS_02630 294776 295153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 296006 295224 gene locus_tag LOCUS_02640 296006 295224 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028380.1 protein_id gnl|my_center|LOCUS_02640 296840 296442 gene locus_tag LOCUS_02650 296840 296442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 297193 296834 gene locus_tag LOCUS_02660 297193 296834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 297627 297316 gene locus_tag LOCUS_02670 297627 297316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 298289 298092 gene locus_tag LOCUS_02680 298289 298092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 298444 299166 gene locus_tag LOCUS_02690 298444 299166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 299437 299237 gene locus_tag LOCUS_02700 299437 299237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 300364 299642 gene locus_tag LOCUS_02710 300364 299642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 300832 300395 gene locus_tag LOCUS_02720 300832 300395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 301490 301044 gene locus_tag LOCUS_02730 301490 301044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 308298 301507 gene locus_tag LOCUS_02740 308298 301507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 312137 308478 gene locus_tag LOCUS_02750 312137 308478 CDS product LamG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184834092.1 protein_id gnl|my_center|LOCUS_02750 313750 312152 gene locus_tag LOCUS_02760 313750 312152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 314351 313953 gene locus_tag LOCUS_02770 314351 313953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 314611 315825 gene locus_tag LOCUS_02780 314611 315825 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028381.1 protein_id gnl|my_center|LOCUS_02780 315826 318432 gene locus_tag LOCUS_02790 gene nirB 315826 318432 CDS product nitrite reductase large subunit NirB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028382.1 protein_id gnl|my_center|LOCUS_02790 318429 318779 gene locus_tag LOCUS_02800 gene nirD 318429 318779 CDS product nitrite reductase small subunit NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976316.1 protein_id gnl|my_center|LOCUS_02800 318982 320139 gene locus_tag LOCUS_02810 318982 320139 CDS product PhoX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030620.1 protein_id gnl|my_center|LOCUS_02810 320242 320748 gene locus_tag LOCUS_02820 320242 320748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 321534 320752 gene locus_tag LOCUS_02830 gene map 321534 320752 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084151.1 protein_id gnl|my_center|LOCUS_02830 321706 321921 gene locus_tag LOCUS_02840 321706 321921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 324755 322035 gene locus_tag LOCUS_02850 gene ppdK 324755 322035 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976309.1 protein_id gnl|my_center|LOCUS_02850 326361 325123 gene locus_tag LOCUS_02860 326361 325123 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868921.1 protein_id gnl|my_center|LOCUS_02860 326591 328537 gene locus_tag LOCUS_02870 326591 328537 CDS product glycogen debranching N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031702.1 protein_id gnl|my_center|LOCUS_02870 329813 328680 gene locus_tag LOCUS_02880 gene dusB 329813 328680 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028387.1 protein_id gnl|my_center|LOCUS_02880 329903 331363 gene locus_tag LOCUS_02890 329903 331363 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976304.1 protein_id gnl|my_center|LOCUS_02890 331953 331468 gene locus_tag LOCUS_02900 331953 331468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02900 335813 331839 gene locus_tag LOCUS_02910 335813 331839 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028388.1 protein_id gnl|my_center|LOCUS_02910 336179 335823 gene locus_tag LOCUS_02920 336179 335823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 336064 336615 gene locus_tag LOCUS_02930 336064 336615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 337727 336795 gene locus_tag LOCUS_02940 337727 336795 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976301.1 protein_id gnl|my_center|LOCUS_02940 337828 339255 gene locus_tag LOCUS_02950 337828 339255 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028390.1 protein_id gnl|my_center|LOCUS_02950 340736 339354 gene locus_tag LOCUS_02960 340736 339354 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976298.1 protein_id gnl|my_center|LOCUS_02960 340876 341826 gene locus_tag LOCUS_02970 340876 341826 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976297.1 protein_id gnl|my_center|LOCUS_02970 341823 342614 gene locus_tag LOCUS_02980 341823 342614 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028392.1 protein_id gnl|my_center|LOCUS_02980 342614 343516 gene locus_tag LOCUS_02990 342614 343516 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028393.1 protein_id gnl|my_center|LOCUS_02990 343576 343986 gene locus_tag LOCUS_03000 343576 343986 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007449657.1 protein_id gnl|my_center|LOCUS_03000 344928 344113 gene locus_tag LOCUS_03010 344928 344113 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976293.1 protein_id gnl|my_center|LOCUS_03010 345696 344941 gene locus_tag LOCUS_03020 gene recO 345696 344941 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030863758.1 protein_id gnl|my_center|LOCUS_03020 345938 345723 gene locus_tag LOCUS_03030 345938 345723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028395.1 protein_id gnl|my_center|LOCUS_03030 347256 346153 gene locus_tag LOCUS_03040 347256 346153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976283.1 protein_id gnl|my_center|LOCUS_03040 348288 347329 gene locus_tag LOCUS_03050 348288 347329 CDS product SCO2521 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028403.1 protein_id gnl|my_center|LOCUS_03050 349255 348290 gene locus_tag LOCUS_03060 349255 348290 CDS product SCO2522 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485045.1 protein_id gnl|my_center|LOCUS_03060 350169 349252 gene locus_tag LOCUS_03070 350169 349252 CDS product SCO2523 family variant P-loop protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976280.1 protein_id gnl|my_center|LOCUS_03070 352015 350174 gene locus_tag LOCUS_03080 352015 350174 CDS product SCO2524 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028405.1 protein_id gnl|my_center|LOCUS_03080 352811 352062 gene locus_tag LOCUS_03090 352811 352062 CDS product SCO2525 family SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976278.1 protein_id gnl|my_center|LOCUS_03090 353156 353698 gene locus_tag LOCUS_03100 353156 353698 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028406.1 protein_id gnl|my_center|LOCUS_03100 354510 353818 gene locus_tag LOCUS_03110 354510 353818 CDS product TerB family tellurite resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028407.1 protein_id gnl|my_center|LOCUS_03110 356431 354710 gene locus_tag LOCUS_03120 gene leuA 356431 354710 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976275.1 protein_id gnl|my_center|LOCUS_03120 356430 356735 gene locus_tag LOCUS_03130 356430 356735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 356768 357838 gene locus_tag LOCUS_03140 356768 357838 CDS product M4 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028408.1 protein_id gnl|my_center|LOCUS_03140 357860 358126 gene locus_tag LOCUS_03150 357860 358126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976273.1 protein_id gnl|my_center|LOCUS_03150 358130 359470 gene locus_tag LOCUS_03160 358130 359470 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028409.1 protein_id gnl|my_center|LOCUS_03160 360442 359474 gene locus_tag LOCUS_03170 gene era 360442 359474 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326176.1 protein_id gnl|my_center|LOCUS_03170 360858 360505 gene locus_tag LOCUS_03180 360858 360505 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093456125.1 protein_id gnl|my_center|LOCUS_03180 361770 360889 gene locus_tag LOCUS_03190 361770 360889 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485043.1 protein_id gnl|my_center|LOCUS_03190 361860 363308 gene locus_tag LOCUS_03200 361860 363308 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976267.1 protein_id gnl|my_center|LOCUS_03200 363629 363270 gene locus_tag LOCUS_03210 363629 363270 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028411.1 protein_id gnl|my_center|LOCUS_03210 364738 363626 gene locus_tag LOCUS_03220 364738 363626 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412229.1 protein_id gnl|my_center|LOCUS_03220 365412 364915 gene locus_tag LOCUS_03230 gene ybeY 365412 364915 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976270.1 protein_id gnl|my_center|LOCUS_03230 366504 365425 gene locus_tag LOCUS_03240 366504 365425 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976271.1 protein_id gnl|my_center|LOCUS_03240 367762 366629 gene locus_tag LOCUS_03250 367762 366629 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485041.1 protein_id gnl|my_center|LOCUS_03250 369154 367865 gene locus_tag LOCUS_03260 369154 367865 CDS product glucarate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028417.1 protein_id gnl|my_center|LOCUS_03260 369308 370090 gene locus_tag LOCUS_03270 369308 370090 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028419.1 protein_id gnl|my_center|LOCUS_03270 370268 371584 gene locus_tag LOCUS_03280 370268 371584 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028420.1 protein_id gnl|my_center|LOCUS_03280 372586 371594 gene locus_tag LOCUS_03290 372586 371594 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270038.1 protein_id gnl|my_center|LOCUS_03290 373512 372607 gene locus_tag LOCUS_03300 373512 372607 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028422.1 protein_id gnl|my_center|LOCUS_03300 373872 373519 gene locus_tag LOCUS_03310 373872 373519 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976256.1 protein_id gnl|my_center|LOCUS_03310 377170 373973 gene locus_tag LOCUS_03320 377170 373973 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028423.1 protein_id gnl|my_center|LOCUS_03320 377761 377216 gene locus_tag LOCUS_03330 377761 377216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326181.1 protein_id gnl|my_center|LOCUS_03330 378580 377837 gene locus_tag LOCUS_03340 378580 377837 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976252.1 protein_id gnl|my_center|LOCUS_03340 379662 378577 gene locus_tag LOCUS_03350 379662 378577 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976251.1 protein_id gnl|my_center|LOCUS_03350 380874 379738 gene locus_tag LOCUS_03360 gene dnaJ 380874 379738 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976250.1 protein_id gnl|my_center|LOCUS_03360 381891 380875 gene locus_tag LOCUS_03370 gene hrcA 381891 380875 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976249.1 protein_id gnl|my_center|LOCUS_03370 382051 382776 gene locus_tag LOCUS_03380 382051 382776 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028425.1 protein_id gnl|my_center|LOCUS_03380 382811 383614 gene locus_tag LOCUS_03390 382811 383614 CDS product DUF3097 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976247.1 protein_id gnl|my_center|LOCUS_03390 384883 383651 gene locus_tag LOCUS_03400 gene hemW 384883 383651 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326185.1 protein_id gnl|my_center|LOCUS_03400 386935 384911 gene locus_tag LOCUS_03410 386935 384911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 387426 387109 gene locus_tag LOCUS_03420 387426 387109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 387410 387988 gene locus_tag LOCUS_03430 387410 387988 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030434.1 protein_id gnl|my_center|LOCUS_03430 389882 388005 gene locus_tag LOCUS_03440 389882 388005 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485037.1 protein_id gnl|my_center|LOCUS_03440 392010 390142 gene locus_tag LOCUS_03450 gene lepA 392010 390142 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976242.1 protein_id gnl|my_center|LOCUS_03450 392264 392530 gene locus_tag LOCUS_03460 gene rpsT 392264 392530 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976241.1 protein_id gnl|my_center|LOCUS_03460 393797 392847 gene locus_tag LOCUS_03470 gene holA 393797 392847 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485035.1 protein_id gnl|my_center|LOCUS_03470 394142 393897 gene locus_tag LOCUS_03480 394142 393897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037666679.1 protein_id gnl|my_center|LOCUS_03480 396853 394256 gene locus_tag LOCUS_03490 396853 394256 CDS product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028431.1 protein_id gnl|my_center|LOCUS_03490 397899 396850 gene locus_tag LOCUS_03500 397899 396850 CDS product ComEA family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028432.1 protein_id gnl|my_center|LOCUS_03500 398898 398053 gene locus_tag LOCUS_03510 398898 398053 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976234.1 protein_id gnl|my_center|LOCUS_03510 399711 398992 gene locus_tag LOCUS_03520 399711 398992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028433.1 protein_id gnl|my_center|LOCUS_03520 402718 399848 gene locus_tag LOCUS_03530 gene leuS 402718 399848 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976232.1 protein_id gnl|my_center|LOCUS_03530 403144 404388 gene locus_tag LOCUS_03540 403144 404388 CDS product ferric reductase-like transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976231.1 protein_id gnl|my_center|LOCUS_03540 404385 406001 gene locus_tag LOCUS_03550 404385 406001 CDS product NADH-quinone oxidoreductase subunit NuoF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326195.1 protein_id gnl|my_center|LOCUS_03550 406138 406065 gene locus_tag LOCUS_t00050 406138 406065 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 406487 406254 gene locus_tag LOCUS_03560 406487 406254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976229.1 protein_id gnl|my_center|LOCUS_03560 406952 406879 gene locus_tag LOCUS_t00060 406952 406879 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 407714 407043 gene locus_tag LOCUS_03570 407714 407043 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976227.1 protein_id gnl|my_center|LOCUS_03570 408157 407711 gene locus_tag LOCUS_03580 gene rsfS 408157 407711 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976226.1 protein_id gnl|my_center|LOCUS_03580 409931 408237 gene locus_tag LOCUS_03590 gene pdtA 409931 408237 CDS product polydiglycosylphosphate transferase PdtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976225.1 protein_id gnl|my_center|LOCUS_03590 410632 409952 gene locus_tag LOCUS_03600 gene nadD 410632 409952 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485033.1 protein_id gnl|my_center|LOCUS_03600 410894 410730 gene locus_tag LOCUS_03610 410894 410730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976223.1 protein_id gnl|my_center|LOCUS_03610 411182 411021 gene locus_tag LOCUS_03620 411182 411021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030869987.1 protein_id gnl|my_center|LOCUS_03620 411316 412527 gene locus_tag LOCUS_03630 411316 412527 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028434.1 protein_id gnl|my_center|LOCUS_03630 413599 412529 gene locus_tag LOCUS_03640 413599 412529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028435.1 protein_id gnl|my_center|LOCUS_03640 414311 413712 gene locus_tag LOCUS_03650 414311 413712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326198.1 protein_id gnl|my_center|LOCUS_03650 415657 414371 gene locus_tag LOCUS_03660 415657 414371 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976218.1 protein_id gnl|my_center|LOCUS_03660 416241 415741 gene locus_tag LOCUS_03670 416241 415741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028437.1 protein_id gnl|my_center|LOCUS_03670 417482 416376 gene locus_tag LOCUS_03680 gene proB 417482 416376 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028438.1 protein_id gnl|my_center|LOCUS_03680 417761 419113 gene locus_tag LOCUS_03690 417761 419113 CDS product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775825.1 protein_id gnl|my_center|LOCUS_03690 419244 421322 gene locus_tag LOCUS_03700 419244 421322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109032946.1 protein_id gnl|my_center|LOCUS_03700 422514 421291 gene locus_tag LOCUS_03710 422514 421291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 424809 422701 gene locus_tag LOCUS_03720 424809 422701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109032946.1 protein_id gnl|my_center|LOCUS_03720 426463 424967 gene locus_tag LOCUS_03730 426463 424967 CDS product bifunctional cytidylyltransferase/SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107920.1 protein_id gnl|my_center|LOCUS_03730 427824 426670 gene locus_tag LOCUS_03740 427824 426670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 429511 427952 gene locus_tag LOCUS_03750 429511 427952 CDS product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530132.1 protein_id gnl|my_center|LOCUS_03750 431149 429713 gene locus_tag LOCUS_03760 gene obgE 431149 429713 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976206.1 protein_id gnl|my_center|LOCUS_03760 431507 431253 gene locus_tag LOCUS_03770 gene rpmA 431507 431253 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976205.1 protein_id gnl|my_center|LOCUS_03770 431842 431522 gene locus_tag LOCUS_03780 gene rplU 431842 431522 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976204.1 protein_id gnl|my_center|LOCUS_03780 432083 432685 gene locus_tag LOCUS_03790 432083 432685 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776120.1 protein_id gnl|my_center|LOCUS_03790 437262 432874 gene locus_tag LOCUS_03800 437262 432874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_03800 438313 437540 gene locus_tag LOCUS_03810 438313 437540 CDS product TIGR03936 family radical SAM-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976201.1 protein_id gnl|my_center|LOCUS_03810 438724 439842 gene locus_tag LOCUS_03820 438724 439842 CDS product thioester reductase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027686.1 protein_id gnl|my_center|LOCUS_03820 439921 440193 gene locus_tag LOCUS_03830 439921 440193 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977559.1 protein_id gnl|my_center|LOCUS_03830 440193 441155 gene locus_tag LOCUS_03840 440193 441155 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027685.1 protein_id gnl|my_center|LOCUS_03840 441166 442161 gene locus_tag LOCUS_03850 441166 442161 CDS product thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027684.1 protein_id gnl|my_center|LOCUS_03850 442176 443171 gene locus_tag LOCUS_03860 442176 443171 CDS product transketolase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027683.1 protein_id gnl|my_center|LOCUS_03860 443168 444286 gene locus_tag LOCUS_03870 443168 444286 CDS product 2-oxo acid dehydrogenase subunit E2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027682.1 protein_id gnl|my_center|LOCUS_03870 444371 444628 gene locus_tag LOCUS_03880 444371 444628 CDS product phosphopantetheine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027681.1 protein_id gnl|my_center|LOCUS_03880 444625 445893 gene locus_tag LOCUS_03890 444625 445893 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027680.1 protein_id gnl|my_center|LOCUS_03890 448059 446002 gene locus_tag LOCUS_03900 448059 446002 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190850422.1 protein_id gnl|my_center|LOCUS_03900 448489 448280 gene locus_tag LOCUS_03910 448489 448280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 449308 448547 gene locus_tag LOCUS_03920 449308 448547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03920 449395 449841 gene locus_tag LOCUS_03930 449395 449841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 451999 450026 gene locus_tag LOCUS_03940 451999 450026 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976193.1 protein_id gnl|my_center|LOCUS_03940 453593 452088 gene locus_tag LOCUS_03950 453593 452088 CDS product CYTH and CHAD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978319.1 protein_id gnl|my_center|LOCUS_03950 454993 453794 gene locus_tag LOCUS_03960 gene rodA 454993 453794 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976192.1 protein_id gnl|my_center|LOCUS_03960 457245 454990 gene locus_tag LOCUS_03970 gene mrdA 457245 454990 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028453.1 protein_id gnl|my_center|LOCUS_03970 458033 457362 gene locus_tag LOCUS_03980 gene mreD 458033 457362 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976190.1 protein_id gnl|my_center|LOCUS_03980 459037 458048 gene locus_tag LOCUS_03990 gene mreC 459037 458048 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976189.1 protein_id gnl|my_center|LOCUS_03990 460334 459315 gene locus_tag LOCUS_04000 460334 459315 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107906544.1 protein_id gnl|my_center|LOCUS_04000 461046 460633 gene locus_tag LOCUS_04010 gene ndk 461046 460633 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976187.1 protein_id gnl|my_center|LOCUS_04010 461494 461138 gene locus_tag LOCUS_04020 461494 461138 CDS product DUF4233 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976186.1 protein_id gnl|my_center|LOCUS_04020 463012 461501 gene locus_tag LOCUS_04030 463012 461501 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485025.1 protein_id gnl|my_center|LOCUS_04030 465822 463198 gene locus_tag LOCUS_04040 465822 463198 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028455.1 protein_id gnl|my_center|LOCUS_04040 465937 466938 gene locus_tag LOCUS_04050 465937 466938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 468293 467007 gene locus_tag LOCUS_04060 gene clpX 468293 467007 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028457.1 protein_id gnl|my_center|LOCUS_04060 469154 468474 gene locus_tag LOCUS_04070 469154 468474 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173668811.1 protein_id gnl|my_center|LOCUS_04070 469826 469209 gene locus_tag LOCUS_04080 469826 469209 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030186848.1 protein_id gnl|my_center|LOCUS_04080 471459 470071 gene locus_tag LOCUS_04090 gene tig 471459 470071 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976179.1 protein_id gnl|my_center|LOCUS_04090 471714 471638 gene locus_tag LOCUS_t00070 471714 471638 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 471830 471902 gene locus_tag LOCUS_t00080 471830 471902 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 472149 471955 gene locus_tag LOCUS_04100 472149 471955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976178.1 protein_id gnl|my_center|LOCUS_04100 472663 473769 gene locus_tag LOCUS_04110 472663 473769 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028459.1 protein_id gnl|my_center|LOCUS_04110 474242 473784 gene locus_tag LOCUS_04120 474242 473784 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028460.1 protein_id gnl|my_center|LOCUS_04120 475622 474429 gene locus_tag LOCUS_04130 475622 474429 CDS product PP2C family protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976175.1 protein_id gnl|my_center|LOCUS_04130 475857 477119 gene locus_tag LOCUS_04140 475857 477119 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028461.1 protein_id gnl|my_center|LOCUS_04140 477963 477157 gene locus_tag LOCUS_04150 477963 477157 CDS product Fpg/Nei family DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228580.1 protein_id gnl|my_center|LOCUS_04150 478516 478031 gene locus_tag LOCUS_04160 478516 478031 CDS product ribose-5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037666673.1 protein_id gnl|my_center|LOCUS_04160 478722 480179 gene locus_tag LOCUS_04170 478722 480179 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030869905.1 protein_id gnl|my_center|LOCUS_04170 481034 480456 gene locus_tag LOCUS_04180 481034 480456 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167469637.1 protein_id gnl|my_center|LOCUS_04180 481390 482766 gene locus_tag LOCUS_04190 481390 482766 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976169.1 protein_id gnl|my_center|LOCUS_04190 482903 483544 gene locus_tag LOCUS_04200 482903 483544 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976168.1 protein_id gnl|my_center|LOCUS_04200 484309 483671 gene locus_tag LOCUS_04210 484309 483671 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326218.1 protein_id gnl|my_center|LOCUS_04210 484457 487036 gene locus_tag LOCUS_04220 gene pepN 484457 487036 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326219.1 protein_id gnl|my_center|LOCUS_04220 487263 488297 gene locus_tag LOCUS_04230 487263 488297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270042.1 protein_id gnl|my_center|LOCUS_04230 490470 488830 gene locus_tag LOCUS_04240 490470 488830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 492617 490476 gene locus_tag LOCUS_04250 492617 490476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 494561 492789 gene locus_tag LOCUS_04260 494561 492789 CDS product TIGR03767 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230137.1 protein_id gnl|my_center|LOCUS_04260 495060 498356 gene locus_tag LOCUS_04270 495060 498356 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028469.1 protein_id gnl|my_center|LOCUS_04270 499140 498418 gene locus_tag LOCUS_04280 499140 498418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028470.1 protein_id gnl|my_center|LOCUS_04280 499678 499142 gene locus_tag LOCUS_04290 499678 499142 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976162.1 protein_id gnl|my_center|LOCUS_04290 499890 500906 gene locus_tag LOCUS_04300 499890 500906 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028472.1 protein_id gnl|my_center|LOCUS_04300 501394 500924 gene locus_tag LOCUS_04310 501394 500924 CDS product DUF1203 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028474.1 protein_id gnl|my_center|LOCUS_04310 501508 504078 gene locus_tag LOCUS_04320 gene pepN 501508 504078 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028475.1 protein_id gnl|my_center|LOCUS_04320 505645 504176 gene locus_tag LOCUS_04330 505645 504176 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227506.1 protein_id gnl|my_center|LOCUS_04330 505791 506420 gene locus_tag LOCUS_04340 505791 506420 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727835.1 protein_id gnl|my_center|LOCUS_04340 506873 506586 gene locus_tag LOCUS_04350 506873 506586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028480.1 protein_id gnl|my_center|LOCUS_04350 509026 506933 gene locus_tag LOCUS_04360 gene malQ 509026 506933 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028481.1 protein_id gnl|my_center|LOCUS_04360 509265 509026 gene locus_tag LOCUS_04370 509265 509026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028482.1 protein_id gnl|my_center|LOCUS_04370 509992 509456 gene locus_tag LOCUS_04380 509992 509456 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028487.1 protein_id gnl|my_center|LOCUS_04380 510296 511432 gene locus_tag LOCUS_04390 510296 511432 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189283001.1 protein_id gnl|my_center|LOCUS_04390 511596 511333 gene locus_tag LOCUS_04400 511596 511333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 511674 513053 gene locus_tag LOCUS_04410 511674 513053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976138.1 protein_id gnl|my_center|LOCUS_04410 513092 514132 gene locus_tag LOCUS_04420 513092 514132 CDS product glutamate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028495.1 protein_id gnl|my_center|LOCUS_04420 514183 515451 gene locus_tag LOCUS_04430 514183 515451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028496.1 protein_id gnl|my_center|LOCUS_04430 515823 515521 gene locus_tag LOCUS_04440 515823 515521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 515783 518113 gene locus_tag LOCUS_04450 515783 518113 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028497.1 protein_id gnl|my_center|LOCUS_04450 517206 517115 gene locus_tag LOCUS_t00090 517206 517115 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 518126 519382 gene locus_tag LOCUS_04460 518126 519382 CDS product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028498.1 protein_id gnl|my_center|LOCUS_04460 519488 520834 gene locus_tag LOCUS_04470 519488 520834 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484988.1 protein_id gnl|my_center|LOCUS_04470 520869 522557 gene locus_tag LOCUS_04480 520869 522557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04480 523524 522538 gene locus_tag LOCUS_04490 523524 522538 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028500.1 protein_id gnl|my_center|LOCUS_04490 523588 524001 gene locus_tag LOCUS_04500 523588 524001 CDS product globin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028501.1 protein_id gnl|my_center|LOCUS_04500 524148 527408 gene locus_tag LOCUS_04510 524148 527408 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484982.1 protein_id gnl|my_center|LOCUS_04510 527405 527812 gene locus_tag LOCUS_04520 527405 527812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 527819 530614 gene locus_tag LOCUS_04530 527819 530614 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484980.1 protein_id gnl|my_center|LOCUS_04530 530661 531626 gene locus_tag LOCUS_04540 530661 531626 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028504.1 protein_id gnl|my_center|LOCUS_04540 532338 531670 gene locus_tag LOCUS_04550 532338 531670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030866307.1 protein_id gnl|my_center|LOCUS_04550 532748 532335 gene locus_tag LOCUS_04560 532748 532335 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028505.1 protein_id gnl|my_center|LOCUS_04560 534419 532755 gene locus_tag LOCUS_04570 gene ettA 534419 532755 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976122.1 protein_id gnl|my_center|LOCUS_04570 534655 534924 gene locus_tag LOCUS_04580 534655 534924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 535444 534974 gene locus_tag LOCUS_04590 535444 534974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04590 535737 535441 gene locus_tag LOCUS_04600 535737 535441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04600 535815 536093 gene locus_tag LOCUS_04610 535815 536093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028875.1 protein_id gnl|my_center|LOCUS_04610 536107 536418 gene locus_tag LOCUS_04620 536107 536418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029355.1 protein_id gnl|my_center|LOCUS_04620 536675 536950 gene locus_tag LOCUS_04630 536675 536950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028870.1 protein_id gnl|my_center|LOCUS_04630 537732 538088 gene locus_tag LOCUS_04640 537732 538088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 538690 539601 gene locus_tag LOCUS_04650 538690 539601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 540161 540457 gene locus_tag LOCUS_04660 540161 540457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 540436 540762 gene locus_tag LOCUS_04670 540436 540762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04670 540951 541190 gene locus_tag LOCUS_04680 540951 541190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 542798 541386 gene locus_tag LOCUS_04690 542798 541386 CDS product TQXA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028511.1 protein_id gnl|my_center|LOCUS_04690 543621 543094 gene locus_tag LOCUS_04700 543621 543094 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976116.1 protein_id gnl|my_center|LOCUS_04700 545915 543849 gene locus_tag LOCUS_04710 545915 543849 CDS product YfjP family GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484979.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_04710 547517 545919 gene locus_tag LOCUS_04720 547517 545919 CDS product dynamin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028513.1 protein_id gnl|my_center|LOCUS_04720 547849 547923 gene locus_tag LOCUS_t00100 547849 547923 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 548022 548978 gene locus_tag LOCUS_04730 548022 548978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 549215 548997 gene locus_tag LOCUS_04740 549215 548997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 549777 549379 gene locus_tag LOCUS_04750 549777 549379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 549954 550439 gene locus_tag LOCUS_04760 549954 550439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 550321 550593 gene locus_tag LOCUS_04770 550321 550593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 550689 551024 gene locus_tag LOCUS_04780 550689 551024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 551021 551644 gene locus_tag LOCUS_04790 551021 551644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 551641 551769 gene locus_tag LOCUS_04800 551641 551769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 551766 552173 gene locus_tag LOCUS_04810 551766 552173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 552170 552757 gene locus_tag LOCUS_04820 552170 552757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 552754 553287 gene locus_tag LOCUS_04830 552754 553287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 553280 553525 gene locus_tag LOCUS_04840 553280 553525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 553522 553761 gene locus_tag LOCUS_04850 553522 553761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 553761 554702 gene locus_tag LOCUS_04860 553761 554702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 554702 555880 gene locus_tag LOCUS_04870 554702 555880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 555880 556614 gene locus_tag LOCUS_04880 555880 556614 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030642.1 protein_id gnl|my_center|LOCUS_04880 556614 557051 gene locus_tag LOCUS_04890 556614 557051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 557048 557257 gene locus_tag LOCUS_04900 557048 557257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 557254 557748 gene locus_tag LOCUS_04910 557254 557748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 557745 558194 gene locus_tag LOCUS_04920 557745 558194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 558191 558838 gene locus_tag LOCUS_04930 558191 558838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 558835 559038 gene locus_tag LOCUS_04940 558835 559038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 559035 559454 gene locus_tag LOCUS_04950 559035 559454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 559489 559812 gene locus_tag LOCUS_04960 559489 559812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 559812 560126 gene locus_tag LOCUS_04970 559812 560126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 560138 561946 gene locus_tag LOCUS_04980 560138 561946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 561943 562320 gene locus_tag LOCUS_04990 561943 562320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 562317 562676 gene locus_tag LOCUS_05000 562317 562676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 562673 562978 gene locus_tag LOCUS_05010 562673 562978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 563053 564123 gene locus_tag LOCUS_05020 563053 564123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 564120 564407 gene locus_tag LOCUS_05030 564120 564407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 564404 564652 gene locus_tag LOCUS_05040 564404 564652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 564709 564996 gene locus_tag LOCUS_05050 564709 564996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 564993 565364 gene locus_tag LOCUS_05060 564993 565364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 565446 565706 gene locus_tag LOCUS_05070 565446 565706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 566303 565770 gene locus_tag LOCUS_05080 566303 565770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 566957 566457 gene locus_tag LOCUS_05090 566957 566457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 567228 566950 gene locus_tag LOCUS_05100 567228 566950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 567423 567629 gene locus_tag LOCUS_05110 567423 567629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 567762 568514 gene locus_tag LOCUS_05120 567762 568514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 568667 570115 gene locus_tag LOCUS_05130 568667 570115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 570130 572193 gene locus_tag LOCUS_05140 570130 572193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 572203 572646 gene locus_tag LOCUS_05150 572203 572646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 572802 573092 gene locus_tag LOCUS_05160 572802 573092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 573342 573142 gene locus_tag LOCUS_05170 573342 573142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 573448 573837 gene locus_tag LOCUS_05180 573448 573837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 573990 574535 gene locus_tag LOCUS_05190 573990 574535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 574532 575869 gene locus_tag LOCUS_05200 574532 575869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 576130 577707 gene locus_tag LOCUS_05210 576130 577707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 577704 578756 gene locus_tag LOCUS_05220 577704 578756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 578768 580129 gene locus_tag LOCUS_05230 578768 580129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 580221 580661 gene locus_tag LOCUS_05240 580221 580661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 580663 581118 gene locus_tag LOCUS_05250 580663 581118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 581153 581896 gene locus_tag LOCUS_05260 581153 581896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 581893 583269 gene locus_tag LOCUS_05270 581893 583269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 583307 583645 gene locus_tag LOCUS_05280 583307 583645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 583642 584109 gene locus_tag LOCUS_05290 583642 584109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 584110 584862 gene locus_tag LOCUS_05300 584110 584862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 584862 585311 gene locus_tag LOCUS_05310 584862 585311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 585318 585725 gene locus_tag LOCUS_05320 585318 585725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 585739 586140 gene locus_tag LOCUS_05330 585739 586140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 586282 590121 gene locus_tag LOCUS_05340 586282 590121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 590121 594020 gene locus_tag LOCUS_05350 590121 594020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 594030 594569 gene locus_tag LOCUS_05360 594030 594569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 594581 594799 gene locus_tag LOCUS_05370 594581 594799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 594808 595719 gene locus_tag LOCUS_05380 594808 595719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 595723 595956 gene locus_tag LOCUS_05390 595723 595956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 595960 596217 gene locus_tag LOCUS_05400 595960 596217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 596217 596660 gene locus_tag LOCUS_05410 596217 596660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 596657 597016 gene locus_tag LOCUS_05420 596657 597016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 597738 597070 gene locus_tag LOCUS_05430 597738 597070 CDS product haloacid dehalogenase-like hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228563.1 protein_id gnl|my_center|LOCUS_05430 597820 599022 gene locus_tag LOCUS_05440 597820 599022 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228562.1 protein_id gnl|my_center|LOCUS_05440 599126 599764 gene locus_tag LOCUS_05450 599126 599764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 599891 600055 gene locus_tag LOCUS_05460 599891 600055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 600417 600184 gene locus_tag LOCUS_05470 600417 600184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 601181 601786 gene locus_tag LOCUS_05480 601181 601786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 602404 602316 gene locus_tag LOCUS_t00110 602404 602316 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 602427 604004 gene locus_tag LOCUS_05490 602427 604004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 607179 604012 gene locus_tag LOCUS_05500 607179 604012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 609073 607307 gene locus_tag LOCUS_05510 609073 607307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 610154 609159 gene locus_tag LOCUS_05520 610154 609159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 610478 610969 gene locus_tag LOCUS_05530 610478 610969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 611825 611013 gene locus_tag LOCUS_05540 611825 611013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 611968 612324 gene locus_tag LOCUS_05550 611968 612324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 612361 613008 gene locus_tag LOCUS_05560 612361 613008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 613397 614218 gene locus_tag LOCUS_05570 613397 614218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 614383 614667 gene locus_tag LOCUS_05580 614383 614667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 615870 614821 gene locus_tag LOCUS_05590 615870 614821 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029498.1 protein_id gnl|my_center|LOCUS_05590 616063 616455 gene locus_tag LOCUS_05600 616063 616455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 618341 616530 gene locus_tag LOCUS_05610 618341 616530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 620044 618329 gene locus_tag LOCUS_05620 620044 618329 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080790597.1 protein_id gnl|my_center|LOCUS_05620 621534 620041 gene locus_tag LOCUS_05630 621534 620041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068083.1 protein_id gnl|my_center|LOCUS_05630 623015 621699 gene locus_tag LOCUS_05640 623015 621699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 623766 623017 gene locus_tag LOCUS_05650 623766 623017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 624079 623780 gene locus_tag LOCUS_05660 624079 623780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 624509 624168 gene locus_tag LOCUS_05670 624509 624168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 624898 624506 gene locus_tag LOCUS_05680 624898 624506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 625005 625469 gene locus_tag LOCUS_05690 625005 625469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 625574 626395 gene locus_tag LOCUS_05700 625574 626395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 626407 627600 gene locus_tag LOCUS_05710 626407 627600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 627796 628341 gene locus_tag LOCUS_05720 627796 628341 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975857.1 protein_id gnl|my_center|LOCUS_05720 631255 628352 gene locus_tag LOCUS_05730 631255 628352 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225477.1 protein_id gnl|my_center|LOCUS_05730 631512 631742 gene locus_tag LOCUS_05740 631512 631742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 632220 631939 gene locus_tag LOCUS_05750 632220 631939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 632754 632470 gene locus_tag LOCUS_05760 632754 632470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 633297 633016 gene locus_tag LOCUS_05770 633297 633016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 633185 633421 gene locus_tag LOCUS_05780 633185 633421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 633690 633442 gene locus_tag LOCUS_05790 633690 633442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 634271 633768 gene locus_tag LOCUS_05800 634271 633768 CDS product DUF5949 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971686.1 protein_id gnl|my_center|LOCUS_05800 635256 634390 gene locus_tag LOCUS_05810 635256 634390 CDS product tyrosinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976100.1 protein_id gnl|my_center|LOCUS_05810 635686 635240 gene locus_tag LOCUS_05820 635686 635240 CDS product tyrosinase cofactor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028525.1 protein_id gnl|my_center|LOCUS_05820 636071 635775 gene locus_tag LOCUS_05830 636071 635775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 637013 636240 gene locus_tag LOCUS_05840 637013 636240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_05840 637356 638525 gene locus_tag LOCUS_05850 637356 638525 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028527.1 protein_id gnl|my_center|LOCUS_05850 638522 639937 gene locus_tag LOCUS_05860 638522 639937 CDS product exopolysaccharide biosynthesis polyprenyl glycosylphosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028528.1 protein_id gnl|my_center|LOCUS_05860 639940 641394 gene locus_tag LOCUS_05870 639940 641394 CDS product O-antigen ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028529.1 protein_id gnl|my_center|LOCUS_05870 641391 643103 gene locus_tag LOCUS_05880 641391 643103 CDS product lipid II flippase MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030866257.1 protein_id gnl|my_center|LOCUS_05880 643165 643854 gene locus_tag LOCUS_05890 643165 643854 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976090.1 protein_id gnl|my_center|LOCUS_05890 643856 645013 gene locus_tag LOCUS_05900 643856 645013 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028531.1 protein_id gnl|my_center|LOCUS_05900 645010 645723 gene locus_tag LOCUS_05910 645010 645723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028532.1 protein_id gnl|my_center|LOCUS_05910 645720 646823 gene locus_tag LOCUS_05920 645720 646823 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028533.1 protein_id gnl|my_center|LOCUS_05920 648171 646849 gene locus_tag LOCUS_05930 648171 646849 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028534.1 protein_id gnl|my_center|LOCUS_05930 648338 649630 gene locus_tag LOCUS_05940 648338 649630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028535.1 protein_id gnl|my_center|LOCUS_05940 650496 649714 gene locus_tag LOCUS_05950 gene chpA 650496 649714 CDS product LAXTG-anchored chaplin ChpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976084.1 protein_id gnl|my_center|LOCUS_05950 650798 650571 gene locus_tag LOCUS_05960 gene chpG 650798 650571 CDS product chaplin ChpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007449696.1 protein_id gnl|my_center|LOCUS_05960 652923 650998 gene locus_tag LOCUS_05970 652923 650998 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028538.1 protein_id gnl|my_center|LOCUS_05970 653914 653036 gene locus_tag LOCUS_05980 653914 653036 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028540.1 protein_id gnl|my_center|LOCUS_05980 656548 653918 gene locus_tag LOCUS_05990 656548 653918 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484949.1 protein_id gnl|my_center|LOCUS_05990 658055 656643 gene locus_tag LOCUS_06000 658055 656643 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028542.1 protein_id gnl|my_center|LOCUS_06000 659876 658374 gene locus_tag LOCUS_06010 gene mmsA 659876 658374 CDS product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028544.1 protein_id gnl|my_center|LOCUS_06010 660512 660285 gene locus_tag LOCUS_06020 660512 660285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 660417 660617 gene locus_tag LOCUS_06030 660417 660617 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326277.1 protein_id gnl|my_center|LOCUS_06030 660746 660985 gene locus_tag LOCUS_06040 660746 660985 CDS product heavy-metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027541.1 protein_id gnl|my_center|LOCUS_06040 661150 663441 gene locus_tag LOCUS_06050 661150 663441 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028547.1 protein_id gnl|my_center|LOCUS_06050 665342 664041 gene locus_tag LOCUS_06060 665342 664041 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976064.1 protein_id gnl|my_center|LOCUS_06060 667820 665565 gene locus_tag LOCUS_06070 667820 665565 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028552.1 protein_id gnl|my_center|LOCUS_06070 667968 669143 gene locus_tag LOCUS_06080 667968 669143 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225076.1 protein_id gnl|my_center|LOCUS_06080 669276 670319 gene locus_tag LOCUS_06090 669276 670319 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976055.1 protein_id gnl|my_center|LOCUS_06090 670316 671842 gene locus_tag LOCUS_06100 670316 671842 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028557.1 protein_id gnl|my_center|LOCUS_06100 671832 673778 gene locus_tag LOCUS_06110 671832 673778 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976053.1 protein_id gnl|my_center|LOCUS_06110 673847 674749 gene locus_tag LOCUS_06120 673847 674749 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028558.1 protein_id gnl|my_center|LOCUS_06120 674746 675135 gene locus_tag LOCUS_06130 gene rbsD 674746 675135 CDS product D-ribose pyranase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028559.1 protein_id gnl|my_center|LOCUS_06130 675802 675921 gene locus_tag LOCUS_06140 675802 675921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 677209 676376 gene locus_tag LOCUS_06150 677209 676376 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028560.1 protein_id gnl|my_center|LOCUS_06150 678366 677206 gene locus_tag LOCUS_06160 678366 677206 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028561.1 protein_id gnl|my_center|LOCUS_06160 679514 678363 gene locus_tag LOCUS_06170 679514 678363 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093456192.1 protein_id gnl|my_center|LOCUS_06170 679758 680804 gene locus_tag LOCUS_06180 679758 680804 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976047.1 protein_id gnl|my_center|LOCUS_06180 681100 681708 gene locus_tag LOCUS_06190 681100 681708 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258304.1 protein_id gnl|my_center|LOCUS_06190 681739 682536 gene locus_tag LOCUS_06200 681739 682536 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976046.1 protein_id gnl|my_center|LOCUS_06200 683593 682589 gene locus_tag LOCUS_06210 683593 682589 CDS product DUF2637 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173668830.1 protein_id gnl|my_center|LOCUS_06210 684790 683843 gene locus_tag LOCUS_06220 684790 683843 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976044.1 protein_id gnl|my_center|LOCUS_06220 684881 685798 gene locus_tag LOCUS_06230 684881 685798 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028565.1 protein_id gnl|my_center|LOCUS_06230 685912 687759 gene locus_tag LOCUS_06240 685912 687759 CDS product glycoside hydrolase family 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028566.1 protein_id gnl|my_center|LOCUS_06240 689263 687839 gene locus_tag LOCUS_06250 689263 687839 CDS product S28 family serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028568.1 protein_id gnl|my_center|LOCUS_06250 689750 689361 gene locus_tag LOCUS_06260 689750 689361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976038.1 protein_id gnl|my_center|LOCUS_06260 693549 689830 gene locus_tag LOCUS_06270 693549 689830 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028569.1 protein_id gnl|my_center|LOCUS_06270 694695 693637 gene locus_tag LOCUS_06280 694695 693637 CDS product esterase-like activity of phytase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484938.1 protein_id gnl|my_center|LOCUS_06280 695699 694884 gene locus_tag LOCUS_06290 695699 694884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_06290 696505 695696 gene locus_tag LOCUS_06300 696505 695696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 696786 697223 gene locus_tag LOCUS_06310 696786 697223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 698971 697286 gene locus_tag LOCUS_06320 698971 697286 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028574.1 protein_id gnl|my_center|LOCUS_06320 699936 698968 gene locus_tag LOCUS_06330 gene speB 699936 698968 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895813.1 protein_id gnl|my_center|LOCUS_06330 701450 699990 gene locus_tag LOCUS_06340 701450 699990 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224493.1 protein_id gnl|my_center|LOCUS_06340 701553 703034 gene locus_tag LOCUS_06350 701553 703034 CDS product PucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742168.1 protein_id gnl|my_center|LOCUS_06350 703061 703849 gene locus_tag LOCUS_06360 703061 703849 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976029.1 protein_id gnl|my_center|LOCUS_06360 704857 703880 gene locus_tag LOCUS_06370 704857 703880 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028575.1 protein_id gnl|my_center|LOCUS_06370 705735 704863 gene locus_tag LOCUS_06380 705735 704863 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028576.1 protein_id gnl|my_center|LOCUS_06380 706928 705771 gene locus_tag LOCUS_06390 706928 705771 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028577.1 protein_id gnl|my_center|LOCUS_06390 707682 707095 gene locus_tag LOCUS_06400 707682 707095 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028578.1 protein_id gnl|my_center|LOCUS_06400 707766 709382 gene locus_tag LOCUS_06410 707766 709382 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028579.1 protein_id gnl|my_center|LOCUS_06410 709397 711475 gene locus_tag LOCUS_06420 709397 711475 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028580.1 protein_id gnl|my_center|LOCUS_06420 711472 712404 gene locus_tag LOCUS_06430 711472 712404 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028581.1 protein_id gnl|my_center|LOCUS_06430 712409 713569 gene locus_tag LOCUS_06440 712409 713569 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976021.1 protein_id gnl|my_center|LOCUS_06440 713696 714739 gene locus_tag LOCUS_06450 gene desE 713696 714739 CDS product siderophore-binding protein DesE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976020.1 protein_id gnl|my_center|LOCUS_06450 714801 715658 gene locus_tag LOCUS_06460 714801 715658 CDS product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028582.1 protein_id gnl|my_center|LOCUS_06460 715811 717253 gene locus_tag LOCUS_06470 gene desA 715811 717253 CDS product lysine decarboxylase DesA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028583.1 protein_id gnl|my_center|LOCUS_06470 717237 718511 gene locus_tag LOCUS_06480 717237 718511 CDS product lysine N(6)-hydroxylase/L-ornithine N(5)-oxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326291.1 protein_id gnl|my_center|LOCUS_06480 718508 719038 gene locus_tag LOCUS_06490 718508 719038 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976016.1 protein_id gnl|my_center|LOCUS_06490 719035 720804 gene locus_tag LOCUS_06500 gene desD 719035 720804 CDS product desferrioxamine E synthetase DesD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028585.1 protein_id gnl|my_center|LOCUS_06500 720834 721724 gene locus_tag LOCUS_06510 720834 721724 CDS product DUF4429 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976013.1 protein_id gnl|my_center|LOCUS_06510 723311 721737 gene locus_tag LOCUS_06520 723311 721737 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110463.1 protein_id gnl|my_center|LOCUS_06520 723462 723719 gene locus_tag LOCUS_06530 723462 723719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976012.1 protein_id gnl|my_center|LOCUS_06530 723753 725570 gene locus_tag LOCUS_06540 gene glmS 723753 725570 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976011.1 protein_id gnl|my_center|LOCUS_06540 726333 725806 gene locus_tag LOCUS_06550 726333 725806 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976010.1 protein_id gnl|my_center|LOCUS_06550 726583 726921 gene locus_tag LOCUS_06560 726583 726921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 727308 728546 gene locus_tag LOCUS_06570 727308 728546 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028588.1 protein_id gnl|my_center|LOCUS_06570 728662 729264 gene locus_tag LOCUS_06580 gene orn 728662 729264 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976007.1 protein_id gnl|my_center|LOCUS_06580 729363 729436 gene locus_tag LOCUS_t00120 729363 729436 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 730802 729747 gene locus_tag LOCUS_06590 730802 729747 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976006.1 protein_id gnl|my_center|LOCUS_06590 731155 732480 gene locus_tag LOCUS_06600 731155 732480 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028589.1 protein_id gnl|my_center|LOCUS_06600 732477 733493 gene locus_tag LOCUS_06610 732477 733493 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028590.1 protein_id gnl|my_center|LOCUS_06610 733506 734417 gene locus_tag LOCUS_06620 733506 734417 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028591.1 protein_id gnl|my_center|LOCUS_06620 734552 735994 gene locus_tag LOCUS_06630 734552 735994 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976002.1 protein_id gnl|my_center|LOCUS_06630 737497 736073 gene locus_tag LOCUS_06640 737497 736073 CDS product cellulose binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028592.1 protein_id gnl|my_center|LOCUS_06640 739029 737617 gene locus_tag LOCUS_06650 739029 737617 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976000.1 protein_id gnl|my_center|LOCUS_06650 739730 739026 gene locus_tag LOCUS_06660 739730 739026 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326297.1 protein_id gnl|my_center|LOCUS_06660 739827 740360 gene locus_tag LOCUS_06670 739827 740360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270050.1 protein_id gnl|my_center|LOCUS_06670 741234 740365 gene locus_tag LOCUS_06680 741234 740365 CDS product fused MFS/spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028594.1 protein_id gnl|my_center|LOCUS_06680 741672 741268 gene locus_tag LOCUS_06690 741672 741268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975996.1 protein_id gnl|my_center|LOCUS_06690 742478 741882 gene locus_tag LOCUS_06700 742478 741882 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028596.1 protein_id gnl|my_center|LOCUS_06700 742670 743635 gene locus_tag LOCUS_06710 742670 743635 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028597.1 protein_id gnl|my_center|LOCUS_06710 743532 744713 gene locus_tag LOCUS_06720 743532 744713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485125.1 protein_id gnl|my_center|LOCUS_06720 744817 746415 gene locus_tag LOCUS_06730 744817 746415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484926.1 protein_id gnl|my_center|LOCUS_06730 746412 747773 gene locus_tag LOCUS_06740 746412 747773 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975990.1 protein_id gnl|my_center|LOCUS_06740 748055 748423 gene locus_tag LOCUS_06750 748055 748423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975980.1 protein_id gnl|my_center|LOCUS_06750 748537 749103 gene locus_tag LOCUS_06760 748537 749103 CDS product bifunctional DNA primase/polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028603.1 protein_id gnl|my_center|LOCUS_06760 749094 749169 gene locus_tag LOCUS_t00130 749094 749169 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 750596 749265 gene locus_tag LOCUS_06770 750596 749265 CDS product M6 family metalloprotease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028602.1 protein_id gnl|my_center|LOCUS_06770 750984 752756 gene locus_tag LOCUS_06780 750984 752756 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975983.1 protein_id gnl|my_center|LOCUS_06780 753832 752732 gene locus_tag LOCUS_06790 753832 752732 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028601.1 protein_id gnl|my_center|LOCUS_06790 754010 754082 gene locus_tag LOCUS_t00140 754010 754082 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 754945 754142 gene locus_tag LOCUS_06800 754945 754142 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029831.1 protein_id gnl|my_center|LOCUS_06800 755138 755210 gene locus_tag LOCUS_t00150 755138 755210 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 756011 755274 gene locus_tag LOCUS_06810 756011 755274 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975978.1 protein_id gnl|my_center|LOCUS_06810 756244 757164 gene locus_tag LOCUS_06820 gene ehuB 756244 757164 CDS product ectoine/hydroxyectoine ABC transporter substrate-binding protein EhuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975972.1 protein_id gnl|my_center|LOCUS_06820 757161 757865 gene locus_tag LOCUS_06830 gene ehuC 757161 757865 CDS product ectoine/hydroxyectoine ABC transporter permease subunit EhuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975971.1 protein_id gnl|my_center|LOCUS_06830 757862 758512 gene locus_tag LOCUS_06840 gene ehuD 757862 758512 CDS product ectoine/hydroxyectoine ABC transporter permease subunit EhuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975970.1 protein_id gnl|my_center|LOCUS_06840 758502 759287 gene locus_tag LOCUS_06850 gene ehuA 758502 759287 CDS product ectoine/hydroxyectoine ABC transporter ATP-binding protein EhuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975969.1 protein_id gnl|my_center|LOCUS_06850 759429 760175 gene locus_tag LOCUS_06860 759429 760175 CDS product IclR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030866451.1 protein_id gnl|my_center|LOCUS_06860 760271 760345 gene locus_tag LOCUS_t00160 760271 760345 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 761016 760408 gene locus_tag LOCUS_06870 761016 760408 CDS product lytic polysaccharide monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975967.1 protein_id gnl|my_center|LOCUS_06870 762314 761184 gene locus_tag LOCUS_06880 762314 761184 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975966.1 protein_id gnl|my_center|LOCUS_06880 763808 762360 gene locus_tag LOCUS_06890 763808 762360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 763844 763919 gene locus_tag LOCUS_t00170 763844 763919 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 764190 766076 gene locus_tag LOCUS_06900 764190 766076 CDS product cellulose synthase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028608.1 protein_id gnl|my_center|LOCUS_06900 766073 768010 gene locus_tag LOCUS_06910 766073 768010 CDS product kelch motif-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028609.1 protein_id gnl|my_center|LOCUS_06910 769057 768023 gene locus_tag LOCUS_06920 769057 768023 CDS product glycoside hydrolase family 6 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168715516.1 protein_id gnl|my_center|LOCUS_06920 769821 769147 gene locus_tag LOCUS_06930 769821 769147 CDS product class F sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028613.1 protein_id gnl|my_center|LOCUS_06930 770378 769824 gene locus_tag LOCUS_06940 770378 769824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028614.1 protein_id gnl|my_center|LOCUS_06940 771261 770482 gene locus_tag LOCUS_06950 771261 770482 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975956.1 protein_id gnl|my_center|LOCUS_06950 772397 771351 gene locus_tag LOCUS_06960 772397 771351 CDS product 2-aminoethylphosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533035.1 protein_id gnl|my_center|LOCUS_06960 773233 772436 gene locus_tag LOCUS_06970 773233 772436 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533032.1 protein_id gnl|my_center|LOCUS_06970 774089 773220 gene locus_tag LOCUS_06980 774089 773220 CDS product 2-aminoethylphosphonate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533033.1 protein_id gnl|my_center|LOCUS_06980 775155 774082 gene locus_tag LOCUS_06990 gene phnT 775155 774082 CDS product 2-aminoethylphosphonate ABC transport system ATP-binding subunit PhnT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703873.1 protein_id gnl|my_center|LOCUS_06990 775850 775155 gene locus_tag LOCUS_07000 775850 775155 CDS product phosphonatase-like hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084718.1 protein_id gnl|my_center|LOCUS_07000 777073 775949 gene locus_tag LOCUS_07010 777073 775949 CDS product TIGR03364 family FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876725.1 protein_id gnl|my_center|LOCUS_07010 777961 777206 gene locus_tag LOCUS_07020 777961 777206 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224434.1 protein_id gnl|my_center|LOCUS_07020 778764 778015 gene locus_tag LOCUS_07030 778764 778015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 780317 779157 gene locus_tag LOCUS_07040 780317 779157 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975954.1 protein_id gnl|my_center|LOCUS_07040 780373 781452 gene locus_tag LOCUS_07050 780373 781452 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975953.1 protein_id gnl|my_center|LOCUS_07050 781449 781952 gene locus_tag LOCUS_07060 781449 781952 CDS product heme-degrading domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028617.1 protein_id gnl|my_center|LOCUS_07060 782053 782928 gene locus_tag LOCUS_07070 782053 782928 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975951.1 protein_id gnl|my_center|LOCUS_07070 783956 783090 gene locus_tag LOCUS_07080 783956 783090 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028618.1 protein_id gnl|my_center|LOCUS_07080 784875 784102 gene locus_tag LOCUS_07090 784875 784102 CDS product YidC/Oxa1 family membrane protein insertase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028619.1 protein_id gnl|my_center|LOCUS_07090 785249 784932 gene locus_tag LOCUS_07100 785249 784932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 785862 785332 gene locus_tag LOCUS_07110 785862 785332 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326320.1 protein_id gnl|my_center|LOCUS_07110 786006 787424 gene locus_tag LOCUS_07120 786006 787424 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028622.1 protein_id gnl|my_center|LOCUS_07120 787786 788805 gene locus_tag LOCUS_07130 787786 788805 CDS product SEC-C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028623.1 protein_id gnl|my_center|LOCUS_07130 788842 789297 gene locus_tag LOCUS_07140 788842 789297 CDS product very short patch repair endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831429.1 protein_id gnl|my_center|LOCUS_07140 789319 790353 gene locus_tag LOCUS_07150 789319 790353 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003693270.1 protein_id gnl|my_center|LOCUS_07150 790350 791882 gene locus_tag LOCUS_07160 790350 791882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 792768 791893 gene locus_tag LOCUS_07170 792768 791893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 793760 792765 gene locus_tag LOCUS_07180 793760 792765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 795908 793764 gene locus_tag LOCUS_07190 795908 793764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 796330 796509 gene locus_tag LOCUS_07200 796330 796509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 796644 801392 gene locus_tag LOCUS_07210 796644 801392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 801389 803293 gene locus_tag LOCUS_07220 801389 803293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07220 803290 806532 gene locus_tag LOCUS_07230 803290 806532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 806529 808394 gene locus_tag LOCUS_07240 806529 808394 CDS product DUF1998 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861851.1 protein_id gnl|my_center|LOCUS_07240 809030 808413 gene locus_tag LOCUS_07250 809030 808413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 809265 810113 gene locus_tag LOCUS_07260 809265 810113 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224344.1 protein_id gnl|my_center|LOCUS_07260 810110 810328 gene locus_tag LOCUS_07270 810110 810328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 810408 810710 gene locus_tag LOCUS_07280 810408 810710 CDS product DUF6247 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126277046.1 protein_id gnl|my_center|LOCUS_07280 810707 810991 gene locus_tag LOCUS_07290 810707 810991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 811515 811141 gene locus_tag LOCUS_07300 811515 811141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 812091 811618 gene locus_tag LOCUS_07310 812091 811618 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028645.1 protein_id gnl|my_center|LOCUS_07310 813069 812185 gene locus_tag LOCUS_07320 813069 812185 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028646.1 protein_id gnl|my_center|LOCUS_07320 814815 813145 gene locus_tag LOCUS_07330 814815 813145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 815381 815776 gene locus_tag LOCUS_07340 815381 815776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 816315 815860 gene locus_tag LOCUS_07350 816315 815860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 816844 816419 gene locus_tag LOCUS_07360 816844 816419 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224922.1 protein_id gnl|my_center|LOCUS_07360 817028 817330 gene locus_tag LOCUS_07370 817028 817330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028647.1 protein_id gnl|my_center|LOCUS_07370 817336 817434 gene locus_tag LOCUS_t00180 817336 817434 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 818968 817448 gene locus_tag LOCUS_07380 818968 817448 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028648.1 protein_id gnl|my_center|LOCUS_07380 820619 819099 gene locus_tag LOCUS_07390 820619 819099 CDS product DUF445 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222356.1 protein_id gnl|my_center|LOCUS_07390 820805 822172 gene locus_tag LOCUS_07400 820805 822172 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028649.1 protein_id gnl|my_center|LOCUS_07400 822965 822180 gene locus_tag LOCUS_07410 822965 822180 CDS product DUF1707 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028650.1 protein_id gnl|my_center|LOCUS_07410 824023 822998 gene locus_tag LOCUS_07420 824023 822998 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030865419.1 protein_id gnl|my_center|LOCUS_07420 824850 824029 gene locus_tag LOCUS_07430 824850 824029 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028652.1 protein_id gnl|my_center|LOCUS_07430 825643 824843 gene locus_tag LOCUS_07440 825643 824843 CDS product ABC-2 family transporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975914.1 protein_id gnl|my_center|LOCUS_07440 825739 828297 gene locus_tag LOCUS_07450 825739 828297 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173943963.1 protein_id gnl|my_center|LOCUS_07450 828611 828291 gene locus_tag LOCUS_07460 828611 828291 CDS product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975912.1 protein_id gnl|my_center|LOCUS_07460 829118 828762 gene locus_tag LOCUS_07470 829118 828762 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975911.1 protein_id gnl|my_center|LOCUS_07470 829471 829142 gene locus_tag LOCUS_07480 829471 829142 CDS product DUF3618 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028653.1 protein_id gnl|my_center|LOCUS_07480 829567 830034 gene locus_tag LOCUS_07490 gene bcp 829567 830034 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730061.1 protein_id gnl|my_center|LOCUS_07490 830075 830160 gene locus_tag LOCUS_t00190 830075 830160 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 830813 830211 gene locus_tag LOCUS_07500 gene rdgB 830813 830211 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028655.1 protein_id gnl|my_center|LOCUS_07500 831258 830860 gene locus_tag LOCUS_07510 831258 830860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975907.1 protein_id gnl|my_center|LOCUS_07510 832146 831409 gene locus_tag LOCUS_07520 gene rph 832146 831409 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975906.1 protein_id gnl|my_center|LOCUS_07520 832457 832224 gene locus_tag LOCUS_07530 832457 832224 CDS product PTS glucose/sucrose transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975905.1 protein_id gnl|my_center|LOCUS_07530 832634 833923 gene locus_tag LOCUS_07540 832634 833923 CDS product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028656.1 protein_id gnl|my_center|LOCUS_07540 834018 835268 gene locus_tag LOCUS_07550 834018 835268 CDS product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028657.1 protein_id gnl|my_center|LOCUS_07550 836092 835340 gene locus_tag LOCUS_07560 836092 835340 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975902.1 protein_id gnl|my_center|LOCUS_07560 836296 836751 gene locus_tag LOCUS_07570 836296 836751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 837720 836770 gene locus_tag LOCUS_07580 837720 836770 CDS product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975900.1 protein_id gnl|my_center|LOCUS_07580 838004 837726 gene locus_tag LOCUS_07590 838004 837726 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975899.1 protein_id gnl|my_center|LOCUS_07590 838750 838328 gene locus_tag LOCUS_07600 838750 838328 CDS product M67 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028660.1 protein_id gnl|my_center|LOCUS_07600 840275 838833 gene locus_tag LOCUS_07610 840275 838833 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028661.1 protein_id gnl|my_center|LOCUS_07610 841193 840585 gene locus_tag LOCUS_07620 841193 840585 CDS product DUF2017 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975896.1 protein_id gnl|my_center|LOCUS_07620 841515 841207 gene locus_tag LOCUS_07630 gene clpS 841515 841207 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030180153.1 protein_id gnl|my_center|LOCUS_07630 841614 842960 gene locus_tag LOCUS_07640 841614 842960 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028662.1 protein_id gnl|my_center|LOCUS_07640 843100 843687 gene locus_tag LOCUS_07650 843100 843687 CDS product nicotinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975893.1 protein_id gnl|my_center|LOCUS_07650 844054 843719 gene locus_tag LOCUS_07660 844054 843719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975892.1 protein_id gnl|my_center|LOCUS_07660 846532 844175 gene locus_tag LOCUS_07670 846532 844175 CDS product immune inhibitor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028663.1 protein_id gnl|my_center|LOCUS_07670 846935 847219 gene locus_tag LOCUS_07680 846935 847219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037667371.1 protein_id gnl|my_center|LOCUS_07680 848030 847236 gene locus_tag LOCUS_07690 848030 847236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 849568 848120 gene locus_tag LOCUS_07700 849568 848120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 849773 850186 gene locus_tag LOCUS_07710 849773 850186 CDS product SsgA family sporulation/cell division regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975886.1 protein_id gnl|my_center|LOCUS_07710 851620 850220 gene locus_tag LOCUS_07720 851620 850220 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975885.1 protein_id gnl|my_center|LOCUS_07720 851720 853132 gene locus_tag LOCUS_07730 851720 853132 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270060.1 protein_id gnl|my_center|LOCUS_07730 854287 853142 gene locus_tag LOCUS_07740 gene hppD 854287 853142 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975883.1 protein_id gnl|my_center|LOCUS_07740 854414 854893 gene locus_tag LOCUS_07750 854414 854893 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028667.1 protein_id gnl|my_center|LOCUS_07750 854927 855574 gene locus_tag LOCUS_07760 854927 855574 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975880.1 protein_id gnl|my_center|LOCUS_07760 855567 856814 gene locus_tag LOCUS_07770 855567 856814 CDS product betaine/proline/choline family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975879.1 protein_id gnl|my_center|LOCUS_07770 856814 857650 gene locus_tag LOCUS_07780 856814 857650 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975878.1 protein_id gnl|my_center|LOCUS_07780 857647 858612 gene locus_tag LOCUS_07790 857647 858612 CDS product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028669.1 protein_id gnl|my_center|LOCUS_07790 859399 858620 gene locus_tag LOCUS_07800 859399 858620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028670.1 protein_id gnl|my_center|LOCUS_07800 860328 859687 gene locus_tag LOCUS_07810 860328 859687 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975875.1 protein_id gnl|my_center|LOCUS_07810 862308 860620 gene locus_tag LOCUS_07820 862308 860620 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975874.1 protein_id gnl|my_center|LOCUS_07820 864052 862595 gene locus_tag LOCUS_07830 864052 862595 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076054423.1 protein_id gnl|my_center|LOCUS_07830 864264 864336 gene locus_tag LOCUS_t00200 864264 864336 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 865098 864457 gene locus_tag LOCUS_07840 865098 864457 CDS product SUKH-4 family immunity protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162495170.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07840 867562 865253 gene locus_tag LOCUS_07850 867562 865253 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028673.1 protein_id gnl|my_center|LOCUS_07850 869682 867559 gene locus_tag LOCUS_07860 869682 867559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 870572 869679 gene locus_tag LOCUS_07870 870572 869679 CDS product FAD binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030865474.1 protein_id gnl|my_center|LOCUS_07870 872484 870856 gene locus_tag LOCUS_07880 872484 870856 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028675.1 protein_id gnl|my_center|LOCUS_07880 873310 872486 gene locus_tag LOCUS_07890 873310 872486 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028676.1 protein_id gnl|my_center|LOCUS_07890 874197 873307 gene locus_tag LOCUS_07900 874197 873307 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270062.1 protein_id gnl|my_center|LOCUS_07900 875492 874194 gene locus_tag LOCUS_07910 875492 874194 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975864.1 protein_id gnl|my_center|LOCUS_07910 875959 875675 gene locus_tag LOCUS_07920 875959 875675 CDS product DUF3039 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030402030.1 protein_id gnl|my_center|LOCUS_07920 876571 875990 gene locus_tag LOCUS_07930 876571 875990 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030865482.1 protein_id gnl|my_center|LOCUS_07930 876816 878162 gene locus_tag LOCUS_07940 gene murA 876816 878162 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975861.1 protein_id gnl|my_center|LOCUS_07940 878619 878338 gene locus_tag LOCUS_07950 878619 878338 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003950507.1 protein_id gnl|my_center|LOCUS_07950 880390 878972 gene locus_tag LOCUS_07960 880390 878972 CDS product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975860.1 protein_id gnl|my_center|LOCUS_07960 883119 880795 gene locus_tag LOCUS_07970 883119 880795 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975859.1 protein_id gnl|my_center|LOCUS_07970 883949 883179 gene locus_tag LOCUS_07980 gene rsuA 883949 883179 CDS product anti-sigma U factor RsuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975858.1 protein_id gnl|my_center|LOCUS_07980 884590 884012 gene locus_tag LOCUS_07990 884590 884012 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975857.1 protein_id gnl|my_center|LOCUS_07990 885518 884925 gene locus_tag LOCUS_08000 885518 884925 CDS product CGNR zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028679.1 protein_id gnl|my_center|LOCUS_08000 886757 885606 gene locus_tag LOCUS_08010 886757 885606 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028682.1 protein_id gnl|my_center|LOCUS_08010 888241 886856 gene locus_tag LOCUS_08020 888241 886856 CDS product NarK family nitrate/nitrite MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028683.1 protein_id gnl|my_center|LOCUS_08020 888518 889564 gene locus_tag LOCUS_08030 888518 889564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 889604 890005 gene locus_tag LOCUS_08040 889604 890005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 891341 890049 gene locus_tag LOCUS_08050 891341 890049 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975851.1 protein_id gnl|my_center|LOCUS_08050 893548 891338 gene locus_tag LOCUS_08060 893548 891338 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028686.1 protein_id gnl|my_center|LOCUS_08060 894753 893548 gene locus_tag LOCUS_08070 894753 893548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484861.1 protein_id gnl|my_center|LOCUS_08070 895877 894912 gene locus_tag LOCUS_08080 gene stgR 895877 894912 CDS product LysR family transcriptional regulator StgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028688.1 protein_id gnl|my_center|LOCUS_08080 895961 897244 gene locus_tag LOCUS_08090 895961 897244 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484859.1 protein_id gnl|my_center|LOCUS_08090 897329 898360 gene locus_tag LOCUS_08100 897329 898360 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226192.1 protein_id gnl|my_center|LOCUS_08100 898889 898491 gene locus_tag LOCUS_tm00010 898889 898491 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 899540 898989 gene locus_tag LOCUS_08110 gene smpB 899540 898989 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975846.1 protein_id gnl|my_center|LOCUS_08110 900719 899601 gene locus_tag LOCUS_08120 900719 899601 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173668732.1 protein_id gnl|my_center|LOCUS_08120 901765 900848 gene locus_tag LOCUS_08130 gene ftsX 901765 900848 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975844.1 protein_id gnl|my_center|LOCUS_08130 902500 901811 gene locus_tag LOCUS_08140 gene ftsE 902500 901811 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975843.1 protein_id gnl|my_center|LOCUS_08140 902725 902916 gene locus_tag LOCUS_08150 902725 902916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975842.1 protein_id gnl|my_center|LOCUS_08150 903087 903935 gene locus_tag LOCUS_08160 903087 903935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 905313 904207 gene locus_tag LOCUS_08170 gene prfB 905313 904207 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975840.1 protein_id gnl|my_center|LOCUS_08170 906623 905370 gene locus_tag LOCUS_08180 906623 905370 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028691.1 protein_id gnl|my_center|LOCUS_08180 908376 906817 gene locus_tag LOCUS_08190 908376 906817 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975838.1 protein_id gnl|my_center|LOCUS_08190 908257 908529 gene locus_tag LOCUS_08200 908257 908529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 908814 912527 gene locus_tag LOCUS_08210 908814 912527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_08210 912524 912712 gene locus_tag LOCUS_08220 912524 912712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 912768 914144 gene locus_tag LOCUS_08230 912768 914144 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975833.1 protein_id gnl|my_center|LOCUS_08230 914149 915495 gene locus_tag LOCUS_08240 914149 915495 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030865510.1 protein_id gnl|my_center|LOCUS_08240 915492 916376 gene locus_tag LOCUS_08250 915492 916376 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975831.1 protein_id gnl|my_center|LOCUS_08250 916522 918792 gene locus_tag LOCUS_08260 916522 918792 CDS product bifunctional glycosyltransferase family 2 protein/CDP-glycerol:glycerophosphate glycerophosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975830.1 protein_id gnl|my_center|LOCUS_08260 918955 921165 gene locus_tag LOCUS_08270 918955 921165 CDS product bifunctional glycosyltransferase family 2 protein/CDP-glycerol:glycerophosphate glycerophosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028695.1 protein_id gnl|my_center|LOCUS_08270 921173 923392 gene locus_tag LOCUS_08280 921173 923392 CDS product bifunctional glycosyltransferase/CDP-glycerol:glycerophosphate glycerophosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028696.1 protein_id gnl|my_center|LOCUS_08280 923407 924747 gene locus_tag LOCUS_08290 923407 924747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028697.1 protein_id gnl|my_center|LOCUS_08290 924829 926400 gene locus_tag LOCUS_08300 924829 926400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028698.1 protein_id gnl|my_center|LOCUS_08300 926847 926434 gene locus_tag LOCUS_08310 926847 926434 CDS product organic hydroperoxide resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975825.1 protein_id gnl|my_center|LOCUS_08310 926965 927414 gene locus_tag LOCUS_08320 926965 927414 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028699.1 protein_id gnl|my_center|LOCUS_08320 927552 928532 gene locus_tag LOCUS_08330 gene galE 927552 928532 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975823.1 protein_id gnl|my_center|LOCUS_08330 929348 928626 gene locus_tag LOCUS_08340 929348 928626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 929577 930500 gene locus_tag LOCUS_08350 929577 930500 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975816.1 protein_id gnl|my_center|LOCUS_08350 930493 931470 gene locus_tag LOCUS_08360 930493 931470 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975815.1 protein_id gnl|my_center|LOCUS_08360 936502 931553 gene locus_tag LOCUS_08370 936502 931553 CDS product NAD-glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028707.1 protein_id gnl|my_center|LOCUS_08370 937796 937131 gene locus_tag LOCUS_08380 937796 937131 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028708.1 protein_id gnl|my_center|LOCUS_08380 938346 937831 gene locus_tag LOCUS_08390 938346 937831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028709.1 protein_id gnl|my_center|LOCUS_08390 938665 939435 gene locus_tag LOCUS_08400 938665 939435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 942347 939528 gene locus_tag LOCUS_08410 gene secA 942347 939528 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975807.1 protein_id gnl|my_center|LOCUS_08410 942599 943204 gene locus_tag LOCUS_08420 942599 943204 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028711.1 protein_id gnl|my_center|LOCUS_08420 943272 944447 gene locus_tag LOCUS_08430 943272 944447 CDS product crosslink repair DNA glycosylase YcaQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028712.1 protein_id gnl|my_center|LOCUS_08430 945213 944467 gene locus_tag LOCUS_08440 945213 944467 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975804.1 protein_id gnl|my_center|LOCUS_08440 946109 945417 gene locus_tag LOCUS_08450 gene raiA 946109 945417 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975803.1 protein_id gnl|my_center|LOCUS_08450 947518 946421 gene locus_tag LOCUS_08460 947518 946421 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028713.1 protein_id gnl|my_center|LOCUS_08460 949311 947530 gene locus_tag LOCUS_08470 949311 947530 CDS product LpqB family beta-propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028714.1 protein_id gnl|my_center|LOCUS_08470 951457 949349 gene locus_tag LOCUS_08480 gene mtrB 951457 949349 CDS product two-component system sensor histidine kinase MtrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028715.1 protein_id gnl|my_center|LOCUS_08480 952148 951459 gene locus_tag LOCUS_08490 gene mtrA 952148 951459 CDS product two-component system response regulator MtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975799.1 protein_id gnl|my_center|LOCUS_08490 953459 952317 gene locus_tag LOCUS_08500 gene mtnA 953459 952317 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028716.1 protein_id gnl|my_center|LOCUS_08500 953600 955036 gene locus_tag LOCUS_08510 953600 955036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 955059 955811 gene locus_tag LOCUS_08520 955059 955811 CDS product DUF4129 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046247888.1 protein_id gnl|my_center|LOCUS_08520 955808 957049 gene locus_tag LOCUS_08530 955808 957049 CDS product DUF4350 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484831.1 protein_id gnl|my_center|LOCUS_08530 957046 958038 gene locus_tag LOCUS_08540 957046 958038 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037897409.1 protein_id gnl|my_center|LOCUS_08540 958038 959348 gene locus_tag LOCUS_08550 958038 959348 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028719.1 protein_id gnl|my_center|LOCUS_08550 959565 959455 gene locus_tag LOCUS_r00010 959565 959455 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence02 1176 367 gene locus_tag LOCUS_08560 gene proC 1176 367 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975496.1 protein_id gnl|my_center|LOCUS_08560 2096 1296 gene locus_tag LOCUS_08570 2096 1296 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028920.1 protein_id gnl|my_center|LOCUS_08570 2756 2247 gene locus_tag LOCUS_08580 2756 2247 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028921.1 protein_id gnl|my_center|LOCUS_08580 3117 2800 gene locus_tag LOCUS_08590 3117 2800 CDS product SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326518.1 protein_id gnl|my_center|LOCUS_08590 3333 5525 gene locus_tag LOCUS_08600 3333 5525 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028924.1 protein_id gnl|my_center|LOCUS_08600 7467 5614 gene locus_tag LOCUS_08610 gene ilvD 7467 5614 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028925.1 protein_id gnl|my_center|LOCUS_08610 8480 7656 gene locus_tag LOCUS_08620 8480 7656 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975487.1 protein_id gnl|my_center|LOCUS_08620 9584 8652 gene locus_tag LOCUS_08630 9584 8652 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028926.1 protein_id gnl|my_center|LOCUS_08630 9647 10534 gene locus_tag LOCUS_08640 9647 10534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975485.1 protein_id gnl|my_center|LOCUS_08640 12328 10586 gene locus_tag LOCUS_08650 12328 10586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172595308.1 protein_id gnl|my_center|LOCUS_08650 12583 13992 gene locus_tag LOCUS_08660 gene radA 12583 13992 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028928.1 protein_id gnl|my_center|LOCUS_08660 14074 15198 gene locus_tag LOCUS_08670 gene disA 14074 15198 CDS product DNA integrity scanning diadenylate cyclase DisA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975482.1 protein_id gnl|my_center|LOCUS_08670 16054 15278 gene locus_tag LOCUS_08680 16054 15278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191851224.1 protein_id gnl|my_center|LOCUS_08680 16305 16958 gene locus_tag LOCUS_08690 16305 16958 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152894621.1 protein_id gnl|my_center|LOCUS_08690 17632 16964 gene locus_tag LOCUS_08700 17632 16964 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223180.1 protein_id gnl|my_center|LOCUS_08700 19209 17629 gene locus_tag LOCUS_08710 19209 17629 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223179.1 protein_id gnl|my_center|LOCUS_08710 19405 20583 gene locus_tag LOCUS_08720 19405 20583 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975480.1 protein_id gnl|my_center|LOCUS_08720 20827 21369 gene locus_tag LOCUS_08730 20827 21369 CDS product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975479.1 protein_id gnl|my_center|LOCUS_08730 21357 22082 gene locus_tag LOCUS_08740 21357 22082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173943984.1 protein_id gnl|my_center|LOCUS_08740 22229 22924 gene locus_tag LOCUS_08750 gene cseB 22229 22924 CDS product two-component system response regulator CseB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975477.1 protein_id gnl|my_center|LOCUS_08750 22932 24293 gene locus_tag LOCUS_08760 22932 24293 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028932.1 protein_id gnl|my_center|LOCUS_08760 26068 24494 gene locus_tag LOCUS_08770 26068 24494 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028938.1 protein_id gnl|my_center|LOCUS_08770 26212 26799 gene locus_tag LOCUS_08780 26212 26799 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975467.1 protein_id gnl|my_center|LOCUS_08780 27481 26822 gene locus_tag LOCUS_08790 27481 26822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 27918 27733 gene locus_tag LOCUS_08800 27918 27733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 27924 28556 gene locus_tag LOCUS_08810 27924 28556 CDS product HAD family acid phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975463.1 protein_id gnl|my_center|LOCUS_08810 31087 28625 gene locus_tag LOCUS_08820 31087 28625 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975461.1 protein_id gnl|my_center|LOCUS_08820 31581 32198 gene locus_tag LOCUS_08830 31581 32198 CDS product SCO3374 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028943.1 protein_id gnl|my_center|LOCUS_08830 32569 32231 gene locus_tag LOCUS_08840 32569 32231 CDS product Lsr2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975458.1 protein_id gnl|my_center|LOCUS_08840 33301 32768 gene locus_tag LOCUS_08850 33301 32768 CDS product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975457.1 protein_id gnl|my_center|LOCUS_08850 33688 33311 gene locus_tag LOCUS_08860 33688 33311 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975456.1 protein_id gnl|my_center|LOCUS_08860 34034 33852 gene locus_tag LOCUS_08870 34034 33852 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028944.1 protein_id gnl|my_center|LOCUS_08870 34822 34061 gene locus_tag LOCUS_08880 34822 34061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028945.1 protein_id gnl|my_center|LOCUS_08880 35729 34932 gene locus_tag LOCUS_08890 35729 34932 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975453.1 protein_id gnl|my_center|LOCUS_08890 36712 35741 gene locus_tag LOCUS_08900 gene nadC 36712 35741 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975452.1 protein_id gnl|my_center|LOCUS_08900 38442 36718 gene locus_tag LOCUS_08910 38442 36718 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028946.1 protein_id gnl|my_center|LOCUS_08910 39428 38439 gene locus_tag LOCUS_08920 gene panC 39428 38439 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975450.1 protein_id gnl|my_center|LOCUS_08920 40345 39425 gene locus_tag LOCUS_08930 40345 39425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08930 40709 41905 gene locus_tag LOCUS_08940 40709 41905 CDS product beta-eliminating lyase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028948.1 protein_id gnl|my_center|LOCUS_08940 42180 41941 gene locus_tag LOCUS_08950 42180 41941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 42336 43442 gene locus_tag LOCUS_08960 42336 43442 CDS product DUF5937 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028949.1 protein_id gnl|my_center|LOCUS_08960 44147 43515 gene locus_tag LOCUS_08970 44147 43515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975445.1 protein_id gnl|my_center|LOCUS_08970 44862 44188 gene locus_tag LOCUS_08980 44862 44188 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975444.1 protein_id gnl|my_center|LOCUS_08980 46145 44943 gene locus_tag LOCUS_08990 46145 44943 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975443.1 protein_id gnl|my_center|LOCUS_08990 46274 47395 gene locus_tag LOCUS_09000 46274 47395 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028950.1 protein_id gnl|my_center|LOCUS_09000 48490 47360 gene locus_tag LOCUS_09010 48490 47360 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975441.1 protein_id gnl|my_center|LOCUS_09010 48543 49109 gene locus_tag LOCUS_09020 48543 49109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 49106 50515 gene locus_tag LOCUS_09030 49106 50515 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013786.1 protein_id gnl|my_center|LOCUS_09030 51739 50546 gene locus_tag LOCUS_09040 51739 50546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051815095.1 protein_id gnl|my_center|LOCUS_09040 52271 53278 gene locus_tag LOCUS_09050 52271 53278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 53275 54381 gene locus_tag LOCUS_09060 gene folP 53275 54381 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975435.1 protein_id gnl|my_center|LOCUS_09060 54378 54881 gene locus_tag LOCUS_09070 54378 54881 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975434.1 protein_id gnl|my_center|LOCUS_09070 55025 55384 gene locus_tag LOCUS_09080 gene folB 55025 55384 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028954.1 protein_id gnl|my_center|LOCUS_09080 55381 55992 gene locus_tag LOCUS_09090 gene folK 55381 55992 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975432.1 protein_id gnl|my_center|LOCUS_09090 56056 56541 gene locus_tag LOCUS_09100 56056 56541 CDS product DUF3180 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975431.1 protein_id gnl|my_center|LOCUS_09100 57176 56571 gene locus_tag LOCUS_09110 gene folE 57176 56571 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975430.1 protein_id gnl|my_center|LOCUS_09110 59345 57300 gene locus_tag LOCUS_09120 gene ftsH 59345 57300 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030867756.1 protein_id gnl|my_center|LOCUS_09120 60086 59526 gene locus_tag LOCUS_09130 gene hpt 60086 59526 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007452004.1 protein_id gnl|my_center|LOCUS_09130 61457 60165 gene locus_tag LOCUS_09140 61457 60165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 62751 61651 gene locus_tag LOCUS_09150 62751 61651 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975426.1 protein_id gnl|my_center|LOCUS_09150 64424 62850 gene locus_tag LOCUS_09160 gene dacB 64424 62850 CDS product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485148.1 protein_id gnl|my_center|LOCUS_09160 64480 64995 gene locus_tag LOCUS_09170 64480 64995 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975424.1 protein_id gnl|my_center|LOCUS_09170 65111 66820 gene locus_tag LOCUS_09180 65111 66820 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975423.1 protein_id gnl|my_center|LOCUS_09180 67740 66934 gene locus_tag LOCUS_09190 67740 66934 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028958.1 protein_id gnl|my_center|LOCUS_09190 68740 67901 gene locus_tag LOCUS_09200 68740 67901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 69062 68880 gene locus_tag LOCUS_09210 69062 68880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 69805 69224 gene locus_tag LOCUS_09220 69805 69224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 70818 69802 gene locus_tag LOCUS_09230 70818 69802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 71249 70902 gene locus_tag LOCUS_09240 71249 70902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 72049 71291 gene locus_tag LOCUS_09250 72049 71291 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229188.1 protein_id gnl|my_center|LOCUS_09250 73764 72250 gene locus_tag LOCUS_09260 73764 72250 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775793.1 protein_id gnl|my_center|LOCUS_09260 75650 73764 gene locus_tag LOCUS_09270 75650 73764 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028846.1 protein_id gnl|my_center|LOCUS_09270 76564 75803 gene locus_tag LOCUS_09280 76564 75803 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975420.1 protein_id gnl|my_center|LOCUS_09280 77388 76627 gene locus_tag LOCUS_09290 77388 76627 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975416.1 protein_id gnl|my_center|LOCUS_09290 78386 77385 gene locus_tag LOCUS_09300 78386 77385 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028963.1 protein_id gnl|my_center|LOCUS_09300 79107 78466 gene locus_tag LOCUS_09310 79107 78466 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028964.1 protein_id gnl|my_center|LOCUS_09310 79663 79118 gene locus_tag LOCUS_09320 79663 79118 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223116.1 protein_id gnl|my_center|LOCUS_09320 81225 79765 gene locus_tag LOCUS_09330 81225 79765 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028965.1 protein_id gnl|my_center|LOCUS_09330 82114 81290 gene locus_tag LOCUS_09340 82114 81290 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975412.1 protein_id gnl|my_center|LOCUS_09340 82480 82962 gene locus_tag LOCUS_09350 82480 82962 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028967.1 protein_id gnl|my_center|LOCUS_09350 83366 83097 gene locus_tag LOCUS_09360 83366 83097 CDS product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028968.1 protein_id gnl|my_center|LOCUS_09360 84738 83584 gene locus_tag LOCUS_09370 84738 83584 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093456408.1 protein_id gnl|my_center|LOCUS_09370 84986 84738 gene locus_tag LOCUS_09380 84986 84738 CDS product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975406.1 protein_id gnl|my_center|LOCUS_09380 85159 84995 gene locus_tag LOCUS_09390 gene rpmG 85159 84995 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975405.1 protein_id gnl|my_center|LOCUS_09390 85221 85457 gene locus_tag LOCUS_09400 gene rpmB 85221 85457 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028971.1 protein_id gnl|my_center|LOCUS_09400 85457 85762 gene locus_tag LOCUS_09410 gene rpsN 85457 85762 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975403.1 protein_id gnl|my_center|LOCUS_09410 85955 85797 gene locus_tag LOCUS_09420 85955 85797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 85899 86531 gene locus_tag LOCUS_09430 85899 86531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 86612 87115 gene locus_tag LOCUS_09440 86612 87115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 88338 87208 gene locus_tag LOCUS_09450 88338 87208 CDS product DUF2786 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028973.1 protein_id gnl|my_center|LOCUS_09450 88432 89211 gene locus_tag LOCUS_09460 88432 89211 CDS product Clp protease N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028974.1 protein_id gnl|my_center|LOCUS_09460 89336 91024 gene locus_tag LOCUS_09470 89336 91024 CDS product bifunctional 3'-5' exonuclease/DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228747.1 protein_id gnl|my_center|LOCUS_09470 91160 91086 gene locus_tag LOCUS_t00210 91160 91086 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 92856 91282 gene locus_tag LOCUS_09480 92856 91282 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975395.1 protein_id gnl|my_center|LOCUS_09480 94172 92967 gene locus_tag LOCUS_09490 94172 92967 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975394.1 protein_id gnl|my_center|LOCUS_09490 97711 94286 gene locus_tag LOCUS_09500 97711 94286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 100773 97954 gene locus_tag LOCUS_09510 gene topA 100773 97954 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029075.1 protein_id gnl|my_center|LOCUS_09510 101243 101046 gene locus_tag LOCUS_09520 101243 101046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485159.1 protein_id gnl|my_center|LOCUS_09520 103124 101604 gene locus_tag LOCUS_09530 103124 101604 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975390.1 protein_id gnl|my_center|LOCUS_09530 103764 103171 gene locus_tag LOCUS_09540 103764 103171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975389.1 protein_id gnl|my_center|LOCUS_09540 106377 103972 gene locus_tag LOCUS_09550 106377 103972 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029076.1 protein_id gnl|my_center|LOCUS_09550 106460 106666 gene locus_tag LOCUS_09560 106460 106666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 107124 106693 gene locus_tag LOCUS_09570 107124 106693 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975387.1 protein_id gnl|my_center|LOCUS_09570 107581 107240 gene locus_tag LOCUS_09580 gene bldG 107581 107240 CDS product anti-sigma factor antagonist BldG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975386.1 protein_id gnl|my_center|LOCUS_09580 107936 110302 gene locus_tag LOCUS_09590 107936 110302 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485160.1 protein_id gnl|my_center|LOCUS_09590 111104 110727 gene locus_tag LOCUS_09600 111104 110727 CDS product TadE family type IV pilus minor pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485162.1 protein_id gnl|my_center|LOCUS_09600 111297 111091 gene locus_tag LOCUS_09610 111297 111091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 112162 111368 gene locus_tag LOCUS_09620 112162 111368 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029081.1 protein_id gnl|my_center|LOCUS_09620 113031 112159 gene locus_tag LOCUS_09630 113031 112159 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030867821.1 protein_id gnl|my_center|LOCUS_09630 114431 113028 gene locus_tag LOCUS_09640 114431 113028 CDS product TadA family conjugal transfer-associated ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037897599.1 protein_id gnl|my_center|LOCUS_09640 115531 114428 gene locus_tag LOCUS_09650 115531 114428 CDS product septum formation initiator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029084.1 protein_id gnl|my_center|LOCUS_09650 116120 116953 gene locus_tag LOCUS_09660 116120 116953 CDS product HAD-IB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270110.1 protein_id gnl|my_center|LOCUS_09660 118211 117372 gene locus_tag LOCUS_09670 118211 117372 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975377.1 protein_id gnl|my_center|LOCUS_09670 118313 119305 gene locus_tag LOCUS_09680 118313 119305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326561.1 protein_id gnl|my_center|LOCUS_09680 120659 119391 gene locus_tag LOCUS_09690 120659 119391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029086.1 protein_id gnl|my_center|LOCUS_09690 120993 123326 gene locus_tag LOCUS_09700 120993 123326 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029087.1 protein_id gnl|my_center|LOCUS_09700 123408 123707 gene locus_tag LOCUS_09710 123408 123707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 123704 125659 gene locus_tag LOCUS_09720 gene acs 123704 125659 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975373.1 protein_id gnl|my_center|LOCUS_09720 125918 127342 gene locus_tag LOCUS_09730 gene nhaA 125918 127342 CDS product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029088.1 protein_id gnl|my_center|LOCUS_09730 127629 128117 gene locus_tag LOCUS_09740 127629 128117 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975371.1 protein_id gnl|my_center|LOCUS_09740 128114 129064 gene locus_tag LOCUS_09750 128114 129064 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029089.1 protein_id gnl|my_center|LOCUS_09750 129213 129395 gene locus_tag LOCUS_09760 129213 129395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 130604 129405 gene locus_tag LOCUS_09770 130604 129405 CDS product MarP family serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136209493.1 protein_id gnl|my_center|LOCUS_09770 131393 130698 gene locus_tag LOCUS_09780 131393 130698 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029090.1 protein_id gnl|my_center|LOCUS_09780 132435 131440 gene locus_tag LOCUS_09790 132435 131440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 132889 133563 gene locus_tag LOCUS_09800 132889 133563 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975365.1 protein_id gnl|my_center|LOCUS_09800 134425 133595 gene locus_tag LOCUS_09810 134425 133595 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975364.1 protein_id gnl|my_center|LOCUS_09810 135378 134422 gene locus_tag LOCUS_09820 135378 134422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975363.1 protein_id gnl|my_center|LOCUS_09820 136527 135532 gene locus_tag LOCUS_09830 136527 135532 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029094.1 protein_id gnl|my_center|LOCUS_09830 137262 136879 gene locus_tag LOCUS_09840 137262 136879 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975361.1 protein_id gnl|my_center|LOCUS_09840 137501 137343 gene locus_tag LOCUS_09850 137501 137343 CDS product DUF4177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975360.1 protein_id gnl|my_center|LOCUS_09850 137573 138550 gene locus_tag LOCUS_09860 137573 138550 CDS product ArsA-related P-loop ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029095.1 protein_id gnl|my_center|LOCUS_09860 138547 139974 gene locus_tag LOCUS_09870 138547 139974 CDS product ArsA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029096.1 protein_id gnl|my_center|LOCUS_09870 140478 140092 gene locus_tag LOCUS_09880 gene wblA 140478 140092 CDS product transcriptional regulator WblA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029097.1 protein_id gnl|my_center|LOCUS_09880 140887 143238 gene locus_tag LOCUS_09890 140887 143238 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930028.1 protein_id gnl|my_center|LOCUS_09890 143955 143491 gene locus_tag LOCUS_09900 143955 143491 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975355.1 protein_id gnl|my_center|LOCUS_09900 144099 145028 gene locus_tag LOCUS_09910 144099 145028 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975354.1 protein_id gnl|my_center|LOCUS_09910 145131 145874 gene locus_tag LOCUS_09920 145131 145874 CDS product Pr6Pr family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029099.1 protein_id gnl|my_center|LOCUS_09920 145941 146015 gene locus_tag LOCUS_t00220 145941 146015 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 147194 146529 gene locus_tag LOCUS_09930 147194 146529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 148198 147191 gene locus_tag LOCUS_09940 148198 147191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 149359 148328 gene locus_tag LOCUS_09950 149359 148328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 149975 150784 gene locus_tag LOCUS_09960 149975 150784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 150771 151940 gene locus_tag LOCUS_09970 150771 151940 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236073048.1 protein_id gnl|my_center|LOCUS_09970 153587 152067 gene locus_tag LOCUS_09980 153587 152067 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208613552.1 protein_id gnl|my_center|LOCUS_09980 154004 153627 gene locus_tag LOCUS_09990 154004 153627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 154267 154052 gene locus_tag LOCUS_10000 154267 154052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 154667 155728 gene locus_tag LOCUS_10010 154667 155728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 155680 156420 gene locus_tag LOCUS_10020 155680 156420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 156500 156697 gene locus_tag LOCUS_10030 156500 156697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 157310 157780 gene locus_tag LOCUS_10040 157310 157780 CDS product MobC family plasmid mobilization relaxosome protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_127180030.1 protein_id gnl|my_center|LOCUS_10040 158018 158680 gene locus_tag LOCUS_10050 158018 158680 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528551.1 protein_id gnl|my_center|LOCUS_10050 158787 159989 gene locus_tag LOCUS_10060 158787 159989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 160210 160650 gene locus_tag LOCUS_10070 160210 160650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 160617 160847 gene locus_tag LOCUS_10080 160617 160847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 160949 161836 gene locus_tag LOCUS_10090 160949 161836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 161965 162714 gene locus_tag LOCUS_10100 161965 162714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 162711 163442 gene locus_tag LOCUS_10110 162711 163442 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000141006.1 protein_id gnl|my_center|LOCUS_10110 163439 164335 gene locus_tag LOCUS_10120 163439 164335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 164332 164946 gene locus_tag LOCUS_10130 164332 164946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 164954 165988 gene locus_tag LOCUS_10140 164954 165988 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339559.1 protein_id gnl|my_center|LOCUS_10140 167052 165985 gene locus_tag LOCUS_10150 167052 165985 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109282207.1 protein_id gnl|my_center|LOCUS_10150 167467 167219 gene locus_tag LOCUS_10160 167467 167219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10160 167641 169377 gene locus_tag LOCUS_10170 167641 169377 CDS product Eco57I restriction-modification methylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089418476.1 protein_id gnl|my_center|LOCUS_10170 169390 170115 gene locus_tag LOCUS_10180 169390 170115 CDS product PaeR7I family type II restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211463095.1 protein_id gnl|my_center|LOCUS_10180 172083 170836 gene locus_tag LOCUS_10190 172083 170836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 173525 172080 gene locus_tag LOCUS_10200 173525 172080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 173779 173594 gene locus_tag LOCUS_10210 173779 173594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 177627 174037 gene locus_tag LOCUS_10220 177627 174037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 178174 177755 gene locus_tag LOCUS_10230 178174 177755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 180672 178171 gene locus_tag LOCUS_10240 180672 178171 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073950391.1 protein_id gnl|my_center|LOCUS_10240 181423 182307 gene locus_tag LOCUS_10250 181423 182307 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029807.1 protein_id gnl|my_center|LOCUS_10250 182405 183061 gene locus_tag LOCUS_10260 182405 183061 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223713.1 protein_id gnl|my_center|LOCUS_10260 183051 183440 gene locus_tag LOCUS_10270 183051 183440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 186757 183488 gene locus_tag LOCUS_10280 186757 183488 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257687.1 protein_id gnl|my_center|LOCUS_10280 187476 186754 gene locus_tag LOCUS_10290 187476 186754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 187561 187866 gene locus_tag LOCUS_10300 187561 187866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 189625 187985 gene locus_tag LOCUS_10310 189625 187985 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414057.1 protein_id gnl|my_center|LOCUS_10310 191809 189641 gene locus_tag LOCUS_10320 191809 189641 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028768.1 protein_id gnl|my_center|LOCUS_10320 192367 192561 gene locus_tag LOCUS_10330 192367 192561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 193009 192692 gene locus_tag LOCUS_10340 193009 192692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 193511 193092 gene locus_tag LOCUS_10350 193511 193092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 193657 194601 gene locus_tag LOCUS_10360 193657 194601 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029566.1 protein_id gnl|my_center|LOCUS_10360 195731 194658 gene locus_tag LOCUS_10370 195731 194658 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975333.1 protein_id gnl|my_center|LOCUS_10370 197289 195772 gene locus_tag LOCUS_10380 197289 195772 CDS product flotillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029117.1 protein_id gnl|my_center|LOCUS_10380 197865 197368 gene locus_tag LOCUS_10390 197865 197368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975331.1 protein_id gnl|my_center|LOCUS_10390 200172 198310 gene locus_tag LOCUS_10400 200172 198310 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975329.1 protein_id gnl|my_center|LOCUS_10400 200303 201124 gene locus_tag LOCUS_10410 200303 201124 CDS product SURF1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173943910.1 protein_id gnl|my_center|LOCUS_10410 202366 201158 gene locus_tag LOCUS_10420 202366 201158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029120.1 protein_id gnl|my_center|LOCUS_10420 202557 202363 gene locus_tag LOCUS_10430 202557 202363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10430 202727 203062 gene locus_tag LOCUS_10440 202727 203062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 204435 203359 gene locus_tag LOCUS_10450 204435 203359 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975325.1 protein_id gnl|my_center|LOCUS_10450 205712 204435 gene locus_tag LOCUS_10460 205712 204435 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975324.1 protein_id gnl|my_center|LOCUS_10460 206497 205919 gene locus_tag LOCUS_10470 206497 205919 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974892.1 protein_id gnl|my_center|LOCUS_10470 206968 206783 gene locus_tag LOCUS_10480 206968 206783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 207740 206961 gene locus_tag LOCUS_10490 207740 206961 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031055.1 protein_id gnl|my_center|LOCUS_10490 207658 207840 gene locus_tag LOCUS_10500 207658 207840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 207837 208235 gene locus_tag LOCUS_10510 207837 208235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 208887 208228 gene locus_tag LOCUS_10520 208887 208228 CDS product DUF5063 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975322.1 protein_id gnl|my_center|LOCUS_10520 209479 208880 gene locus_tag LOCUS_10530 gene recR 209479 208880 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975321.1 protein_id gnl|my_center|LOCUS_10530 209881 209537 gene locus_tag LOCUS_10540 209881 209537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 210084 210836 gene locus_tag LOCUS_10550 210084 210836 CDS product SLATT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029121.1 protein_id gnl|my_center|LOCUS_10550 212621 211089 gene locus_tag LOCUS_10560 212621 211089 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028346.1 protein_id gnl|my_center|LOCUS_10560 212858 214213 gene locus_tag LOCUS_10570 212858 214213 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029123.1 protein_id gnl|my_center|LOCUS_10570 214388 215083 gene locus_tag LOCUS_10580 214388 215083 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327688.1 protein_id gnl|my_center|LOCUS_10580 215285 215935 gene locus_tag LOCUS_10590 215285 215935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975315.1 protein_id gnl|my_center|LOCUS_10590 217301 216018 gene locus_tag LOCUS_10600 217301 216018 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975310.1 protein_id gnl|my_center|LOCUS_10600 217488 218366 gene locus_tag LOCUS_10610 217488 218366 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029127.1 protein_id gnl|my_center|LOCUS_10610 218813 218409 gene locus_tag LOCUS_10620 218813 218409 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030867895.1 protein_id gnl|my_center|LOCUS_10620 218971 219858 gene locus_tag LOCUS_10630 218971 219858 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029129.1 protein_id gnl|my_center|LOCUS_10630 219855 221459 gene locus_tag LOCUS_10640 219855 221459 CDS product ABC transporter membrane-spanning protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029130.1 protein_id gnl|my_center|LOCUS_10640 221521 221772 gene locus_tag LOCUS_10650 221521 221772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 222957 221755 gene locus_tag LOCUS_10660 222957 221755 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029132.1 protein_id gnl|my_center|LOCUS_10660 224325 223012 gene locus_tag LOCUS_10670 224325 223012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026864.1 protein_id gnl|my_center|LOCUS_10670 231844 224426 gene locus_tag LOCUS_10680 231844 224426 CDS product type I polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194140.1 protein_id gnl|my_center|LOCUS_10680 233073 231949 gene locus_tag LOCUS_10690 233073 231949 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484788.1 protein_id gnl|my_center|LOCUS_10690 233824 233159 gene locus_tag LOCUS_10700 233824 233159 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975300.1 protein_id gnl|my_center|LOCUS_10700 235161 233821 gene locus_tag LOCUS_10710 235161 233821 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029134.1 protein_id gnl|my_center|LOCUS_10710 235984 235310 gene locus_tag LOCUS_10720 235984 235310 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975298.1 protein_id gnl|my_center|LOCUS_10720 237291 235981 gene locus_tag LOCUS_10730 237291 235981 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029135.1 protein_id gnl|my_center|LOCUS_10730 238484 237291 gene locus_tag LOCUS_10740 238484 237291 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029136.1 protein_id gnl|my_center|LOCUS_10740 239418 238477 gene locus_tag LOCUS_10750 239418 238477 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029137.1 protein_id gnl|my_center|LOCUS_10750 240424 239567 gene locus_tag LOCUS_10760 240424 239567 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975294.1 protein_id gnl|my_center|LOCUS_10760 241736 240552 gene locus_tag LOCUS_10770 gene kynU 241736 240552 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029138.1 protein_id gnl|my_center|LOCUS_10770 242544 241729 gene locus_tag LOCUS_10780 242544 241729 CDS product tryptophan 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029139.1 protein_id gnl|my_center|LOCUS_10780 243096 242683 gene locus_tag LOCUS_10790 243096 242683 CDS product DUF3151 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975291.1 protein_id gnl|my_center|LOCUS_10790 244201 243170 gene locus_tag LOCUS_10800 gene fbaA 244201 243170 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029142.1 protein_id gnl|my_center|LOCUS_10800 244874 244326 gene locus_tag LOCUS_10810 gene pyrE 244874 244326 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029143.1 protein_id gnl|my_center|LOCUS_10810 245676 244885 gene locus_tag LOCUS_10820 245676 244885 CDS product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029144.1 protein_id gnl|my_center|LOCUS_10820 246450 245698 gene locus_tag LOCUS_10830 246450 245698 CDS product SRPBCC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109029331.1 protein_id gnl|my_center|LOCUS_10830 247403 246690 gene locus_tag LOCUS_10840 247403 246690 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029146.1 protein_id gnl|my_center|LOCUS_10840 248560 247400 gene locus_tag LOCUS_10850 248560 247400 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975284.1 protein_id gnl|my_center|LOCUS_10850 250514 248940 gene locus_tag LOCUS_10860 250514 248940 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029148.1 protein_id gnl|my_center|LOCUS_10860 251095 250550 gene locus_tag LOCUS_10870 251095 250550 CDS product DUF2617 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975282.1 protein_id gnl|my_center|LOCUS_10870 253117 251543 gene locus_tag LOCUS_10880 253117 251543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 253533 253114 gene locus_tag LOCUS_10890 253533 253114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 253534 253752 gene locus_tag LOCUS_10900 253534 253752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10900 253749 254414 gene locus_tag LOCUS_10910 253749 254414 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029778.1 protein_id gnl|my_center|LOCUS_10910 254631 254924 gene locus_tag LOCUS_10920 254631 254924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 255140 254979 gene locus_tag LOCUS_10930 255140 254979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 255214 255357 gene locus_tag LOCUS_10940 255214 255357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 255557 256732 gene locus_tag LOCUS_10950 255557 256732 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029150.1 protein_id gnl|my_center|LOCUS_10950 257315 256791 gene locus_tag LOCUS_10960 257315 256791 CDS product YbjN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975279.1 protein_id gnl|my_center|LOCUS_10960 260018 257421 gene locus_tag LOCUS_10970 gene clpB 260018 257421 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975278.1 protein_id gnl|my_center|LOCUS_10970 260195 260584 gene locus_tag LOCUS_10980 260195 260584 CDS product TIGR03618 family F420-dependent PPOX class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284874.1 protein_id gnl|my_center|LOCUS_10980 261087 260752 gene locus_tag LOCUS_10990 261087 260752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975277.1 protein_id gnl|my_center|LOCUS_10990 261294 261091 gene locus_tag LOCUS_11000 261294 261091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 261466 262416 gene locus_tag LOCUS_11010 261466 262416 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166680919.1 protein_id gnl|my_center|LOCUS_11010 262413 263402 gene locus_tag LOCUS_11020 262413 263402 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029154.1 protein_id gnl|my_center|LOCUS_11020 264459 263365 gene locus_tag LOCUS_11030 264459 263365 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164279310.1 protein_id gnl|my_center|LOCUS_11030 265582 264476 gene locus_tag LOCUS_11040 265582 264476 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975272.1 protein_id gnl|my_center|LOCUS_11040 266295 265843 gene locus_tag LOCUS_11050 266295 265843 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975271.1 protein_id gnl|my_center|LOCUS_11050 267478 266300 gene locus_tag LOCUS_11060 gene dnaJ 267478 266300 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975270.1 protein_id gnl|my_center|LOCUS_11060 268177 267512 gene locus_tag LOCUS_11070 gene grpE 268177 267512 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975269.1 protein_id gnl|my_center|LOCUS_11070 270027 268174 gene locus_tag LOCUS_11080 gene dnaK 270027 268174 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975268.1 protein_id gnl|my_center|LOCUS_11080 271222 270122 gene locus_tag LOCUS_11090 271222 270122 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029155.1 protein_id gnl|my_center|LOCUS_11090 271458 273740 gene locus_tag LOCUS_11100 271458 273740 CDS product heterodisulfide reductase-related iron-sulfur binding cluster inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029156.1 protein_id gnl|my_center|LOCUS_11100 273915 275258 gene locus_tag LOCUS_11110 273915 275258 CDS product FG-GAP repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168538635.1 protein_id gnl|my_center|LOCUS_11110 275403 276326 gene locus_tag LOCUS_11120 275403 276326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 276908 276411 gene locus_tag LOCUS_11130 276908 276411 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975262.1 protein_id gnl|my_center|LOCUS_11130 277486 276911 gene locus_tag LOCUS_11140 gene dcd 277486 276911 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975261.1 protein_id gnl|my_center|LOCUS_11140 277983 278056 gene locus_tag LOCUS_t00230 277983 278056 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 278330 278542 gene locus_tag LOCUS_11150 278330 278542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 280859 278457 gene locus_tag LOCUS_11160 280859 278457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 281162 281377 gene locus_tag LOCUS_11170 281162 281377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 281374 281796 gene locus_tag LOCUS_11180 281374 281796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 282307 282092 gene locus_tag LOCUS_11190 282307 282092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 282294 282542 gene locus_tag LOCUS_11200 282294 282542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 283497 282685 gene locus_tag LOCUS_11210 283497 282685 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035256476.1 protein_id gnl|my_center|LOCUS_11210 283743 284774 gene locus_tag LOCUS_11220 283743 284774 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227431.1 protein_id gnl|my_center|LOCUS_11220 285642 284968 gene locus_tag LOCUS_11230 285642 284968 CDS product lytic polysaccharide monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223308.1 protein_id gnl|my_center|LOCUS_11230 286048 285713 gene locus_tag LOCUS_11240 286048 285713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 286128 286898 gene locus_tag LOCUS_11250 286128 286898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 287128 287664 gene locus_tag LOCUS_11260 287128 287664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 290243 287718 gene locus_tag LOCUS_11270 290243 287718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 292054 290792 gene locus_tag LOCUS_11280 292054 290792 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229184.1 protein_id gnl|my_center|LOCUS_11280 292857 292054 gene locus_tag LOCUS_11290 292857 292054 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091316930.1 protein_id gnl|my_center|LOCUS_11290 293118 293426 gene locus_tag LOCUS_11300 293118 293426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 294137 293553 gene locus_tag LOCUS_11310 294137 293553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 294669 294307 gene locus_tag LOCUS_11320 294669 294307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 296384 294666 gene locus_tag LOCUS_11330 gene ctaD 296384 294666 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976660.1 protein_id gnl|my_center|LOCUS_11330 296709 297578 gene locus_tag LOCUS_11340 296709 297578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 297678 298160 gene locus_tag LOCUS_11350 297678 298160 CDS product DUF4396 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487417.1 protein_id gnl|my_center|LOCUS_11350 298394 298597 gene locus_tag LOCUS_11360 298394 298597 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973099.1 protein_id gnl|my_center|LOCUS_11360 298721 299002 gene locus_tag LOCUS_11370 298721 299002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 299573 299923 gene locus_tag LOCUS_11380 299573 299923 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974275.1 protein_id gnl|my_center|LOCUS_11380 301130 299952 gene locus_tag LOCUS_11390 301130 299952 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189740062.1 protein_id gnl|my_center|LOCUS_11390 302174 301233 gene locus_tag LOCUS_11400 gene sigJ 302174 301233 CDS product RNA polymerase sigma factor SigJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226028235.1 protein_id gnl|my_center|LOCUS_11400 302508 302185 gene locus_tag LOCUS_11410 302508 302185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 302456 302659 gene locus_tag LOCUS_11420 302456 302659 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973099.1 protein_id gnl|my_center|LOCUS_11420 302805 304274 gene locus_tag LOCUS_11430 302805 304274 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029195.1 protein_id gnl|my_center|LOCUS_11430 304338 304673 gene locus_tag LOCUS_11440 304338 304673 CDS product SCO5918 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975207.1 protein_id gnl|my_center|LOCUS_11440 306630 304663 gene locus_tag LOCUS_11450 306630 304663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 306807 309959 gene locus_tag LOCUS_11460 306807 309959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 310731 309937 gene locus_tag LOCUS_11470 310731 309937 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974578.1 protein_id gnl|my_center|LOCUS_11470 311789 310728 gene locus_tag LOCUS_11480 311789 310728 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029634.1 protein_id gnl|my_center|LOCUS_11480 312346 311828 gene locus_tag LOCUS_11490 312346 311828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975181.1 protein_id gnl|my_center|LOCUS_11490 313496 312477 gene locus_tag LOCUS_11500 313496 312477 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975178.1 protein_id gnl|my_center|LOCUS_11500 314878 313493 gene locus_tag LOCUS_11510 314878 313493 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029220.1 protein_id gnl|my_center|LOCUS_11510 315142 315597 gene locus_tag LOCUS_11520 315142 315597 CDS product tellurite resistance TerB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975175.1 protein_id gnl|my_center|LOCUS_11520 315623 315883 gene locus_tag LOCUS_11530 315623 315883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 315899 316312 gene locus_tag LOCUS_11540 315899 316312 CDS product DUF6479 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326645.1 protein_id gnl|my_center|LOCUS_11540 318032 316362 gene locus_tag LOCUS_11550 318032 316362 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975161.1 protein_id gnl|my_center|LOCUS_11550 318399 319349 gene locus_tag LOCUS_11560 318399 319349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 320377 319607 gene locus_tag LOCUS_11570 320377 319607 CDS product ANTAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076158225.1 protein_id gnl|my_center|LOCUS_11570 321821 320511 gene locus_tag LOCUS_11580 321821 320511 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975159.1 protein_id gnl|my_center|LOCUS_11580 322076 322234 gene locus_tag LOCUS_11590 322076 322234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 323623 322247 gene locus_tag LOCUS_11600 323623 322247 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222988.1 protein_id gnl|my_center|LOCUS_11600 326283 323623 gene locus_tag LOCUS_11610 326283 323623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 326653 326288 gene locus_tag LOCUS_11620 326653 326288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 328426 326831 gene locus_tag LOCUS_11630 328426 326831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 329617 328475 gene locus_tag LOCUS_11640 329617 328475 CDS product PP2C family protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975156.1 protein_id gnl|my_center|LOCUS_11640 329722 330150 gene locus_tag LOCUS_11650 329722 330150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029233.1 protein_id gnl|my_center|LOCUS_11650 330629 330198 gene locus_tag LOCUS_11660 330629 330198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 330793 331164 gene locus_tag LOCUS_11670 330793 331164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 331217 332224 gene locus_tag LOCUS_11680 331217 332224 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029236.1 protein_id gnl|my_center|LOCUS_11680 334383 332284 gene locus_tag LOCUS_11690 334383 332284 CDS product PhoX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029237.1 protein_id gnl|my_center|LOCUS_11690 334593 335996 gene locus_tag LOCUS_11700 334593 335996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 336007 337623 gene locus_tag LOCUS_11710 gene metG 336007 337623 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975149.1 protein_id gnl|my_center|LOCUS_11710 337729 338094 gene locus_tag LOCUS_11720 337729 338094 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975148.1 protein_id gnl|my_center|LOCUS_11720 338293 338084 gene locus_tag LOCUS_11730 338293 338084 CDS product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030069.1 protein_id gnl|my_center|LOCUS_11730 339165 338290 gene locus_tag LOCUS_11740 339165 338290 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029809.1 protein_id gnl|my_center|LOCUS_11740 339164 339808 gene locus_tag LOCUS_11750 339164 339808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 339871 340218 gene locus_tag LOCUS_11760 339871 340218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 340215 340472 gene locus_tag LOCUS_11770 340215 340472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 342320 340557 gene locus_tag LOCUS_11780 gene aspS 342320 340557 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029239.1 protein_id gnl|my_center|LOCUS_11780 342525 344672 gene locus_tag LOCUS_11790 342525 344672 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975145.1 protein_id gnl|my_center|LOCUS_11790 345688 344630 gene locus_tag LOCUS_11800 345688 344630 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975144.1 protein_id gnl|my_center|LOCUS_11800 346521 345754 gene locus_tag LOCUS_11810 346521 345754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 347054 346590 gene locus_tag LOCUS_11820 347054 346590 CDS product SseB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975142.1 protein_id gnl|my_center|LOCUS_11820 347205 349031 gene locus_tag LOCUS_11830 347205 349031 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908958.1 protein_id gnl|my_center|LOCUS_11830 349374 350744 gene locus_tag LOCUS_11840 349374 350744 CDS product M18 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975140.1 protein_id gnl|my_center|LOCUS_11840 350870 351118 gene locus_tag LOCUS_11850 350870 351118 CDS product DUF6458 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975139.1 protein_id gnl|my_center|LOCUS_11850 352960 351131 gene locus_tag LOCUS_11860 352960 351131 CDS product redoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026880.1 protein_id gnl|my_center|LOCUS_11860 353136 354008 gene locus_tag LOCUS_11870 353136 354008 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029241.1 protein_id gnl|my_center|LOCUS_11870 354005 354505 gene locus_tag LOCUS_11880 354005 354505 CDS product LURP-one-related/scramblase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975131.1 protein_id gnl|my_center|LOCUS_11880 355384 354581 gene locus_tag LOCUS_11890 355384 354581 CDS product carbon-nitrogen family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975129.1 protein_id gnl|my_center|LOCUS_11890 355614 356438 gene locus_tag LOCUS_11900 355614 356438 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029242.1 protein_id gnl|my_center|LOCUS_11900 357865 356567 gene locus_tag LOCUS_11910 357865 356567 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975127.1 protein_id gnl|my_center|LOCUS_11910 358512 357862 gene locus_tag LOCUS_11920 358512 357862 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975126.1 protein_id gnl|my_center|LOCUS_11920 358701 359600 gene locus_tag LOCUS_11930 358701 359600 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029243.1 protein_id gnl|my_center|LOCUS_11930 361241 359781 gene locus_tag LOCUS_11940 361241 359781 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029246.1 protein_id gnl|my_center|LOCUS_11940 362229 361252 gene locus_tag LOCUS_11950 362229 361252 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326663.1 protein_id gnl|my_center|LOCUS_11950 363442 362231 gene locus_tag LOCUS_11960 gene pdhA 363442 362231 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230923.1 protein_id gnl|my_center|LOCUS_11960 363830 364429 gene locus_tag LOCUS_11970 363830 364429 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029248.1 protein_id gnl|my_center|LOCUS_11970 364512 364913 gene locus_tag LOCUS_11980 364512 364913 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029249.1 protein_id gnl|my_center|LOCUS_11980 365157 366188 gene locus_tag LOCUS_11990 365157 366188 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109282207.1 protein_id gnl|my_center|LOCUS_11990 367935 366319 gene locus_tag LOCUS_12000 367935 366319 CDS product protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326665.1 protein_id gnl|my_center|LOCUS_12000 368297 369919 gene locus_tag LOCUS_12010 368297 369919 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029251.1 protein_id gnl|my_center|LOCUS_12010 370597 370043 gene locus_tag LOCUS_12020 370597 370043 CDS product bacterial proteasome activator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975113.1 protein_id gnl|my_center|LOCUS_12020 370709 371353 gene locus_tag LOCUS_12030 370709 371353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 372357 371377 gene locus_tag LOCUS_12040 372357 371377 CDS product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975111.1 protein_id gnl|my_center|LOCUS_12040 373525 372428 gene locus_tag LOCUS_12050 373525 372428 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975108.1 protein_id gnl|my_center|LOCUS_12050 374868 373522 gene locus_tag LOCUS_12060 374868 373522 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029253.1 protein_id gnl|my_center|LOCUS_12060 375851 374865 gene locus_tag LOCUS_12070 375851 374865 CDS product NTP transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173943903.1 protein_id gnl|my_center|LOCUS_12070 377562 376015 gene locus_tag LOCUS_12080 377562 376015 CDS product 2-oxo acid dehydrogenase subunit E2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029255.1 protein_id gnl|my_center|LOCUS_12080 378566 377562 gene locus_tag LOCUS_12090 378566 377562 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029256.1 protein_id gnl|my_center|LOCUS_12090 379699 378563 gene locus_tag LOCUS_12100 gene pdhA 379699 378563 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467649.1 protein_id gnl|my_center|LOCUS_12100 379889 380446 gene locus_tag LOCUS_12110 379889 380446 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109029198.1 protein_id gnl|my_center|LOCUS_12110 381128 380538 gene locus_tag LOCUS_12120 381128 380538 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975101.1 protein_id gnl|my_center|LOCUS_12120 382642 381125 gene locus_tag LOCUS_12130 382642 381125 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029259.1 protein_id gnl|my_center|LOCUS_12130 382803 384497 gene locus_tag LOCUS_12140 gene paaN 382803 384497 CDS product phenylacetic acid degradation protein PaaN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029260.1 protein_id gnl|my_center|LOCUS_12140 385276 384527 gene locus_tag LOCUS_12150 385276 384527 CDS product TrmH family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029261.1 protein_id gnl|my_center|LOCUS_12150 386586 385273 gene locus_tag LOCUS_12160 386586 385273 CDS product HTTM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029262.1 protein_id gnl|my_center|LOCUS_12160 387359 386583 gene locus_tag LOCUS_12170 387359 386583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 387862 387440 gene locus_tag LOCUS_12180 387862 387440 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975095.1 protein_id gnl|my_center|LOCUS_12180 388680 387877 gene locus_tag LOCUS_12190 388680 387877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975094.1 protein_id gnl|my_center|LOCUS_12190 390225 388807 gene locus_tag LOCUS_12200 390225 388807 CDS product DUF2252 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029264.1 protein_id gnl|my_center|LOCUS_12200 390483 390399 gene locus_tag LOCUS_t00240 390483 390399 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 390881 391753 gene locus_tag LOCUS_12210 gene fhaA 390881 391753 CDS product antibiotic biosynthesis regulator FhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975091.1 protein_id gnl|my_center|LOCUS_12210 391764 392279 gene locus_tag LOCUS_12220 gene fhaB 391764 392279 CDS product antibiotic biosynthesis regulator FhaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975090.1 protein_id gnl|my_center|LOCUS_12220 392372 393964 gene locus_tag LOCUS_12230 392372 393964 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029266.1 protein_id gnl|my_center|LOCUS_12230 393992 395425 gene locus_tag LOCUS_12240 393992 395425 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029267.1 protein_id gnl|my_center|LOCUS_12240 395422 396894 gene locus_tag LOCUS_12250 395422 396894 CDS product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029268.1 protein_id gnl|my_center|LOCUS_12250 397085 399106 gene locus_tag LOCUS_12260 gene pknB 397085 399106 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029269.1 protein_id gnl|my_center|LOCUS_12260 399963 399202 gene locus_tag LOCUS_12270 399963 399202 CDS product class E sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975085.1 protein_id gnl|my_center|LOCUS_12270 401047 399977 gene locus_tag LOCUS_12280 401047 399977 CDS product class E sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029270.1 protein_id gnl|my_center|LOCUS_12280 401682 401044 gene locus_tag LOCUS_12290 401682 401044 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029271.1 protein_id gnl|my_center|LOCUS_12290 401840 401679 gene locus_tag LOCUS_12300 401840 401679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174256084.1 protein_id gnl|my_center|LOCUS_12300 402889 402110 gene locus_tag LOCUS_12310 402889 402110 CDS product DUF881 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485254.1 protein_id gnl|my_center|LOCUS_12310 403031 403285 gene locus_tag LOCUS_12320 gene crgA 403031 403285 CDS product cell division protein CrgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975080.1 protein_id gnl|my_center|LOCUS_12320 404435 403545 gene locus_tag LOCUS_12330 404435 403545 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975079.1 protein_id gnl|my_center|LOCUS_12330 405087 404554 gene locus_tag LOCUS_12340 405087 404554 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975078.1 protein_id gnl|my_center|LOCUS_12340 405426 406127 gene locus_tag LOCUS_12350 405426 406127 CDS product DUF5324 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029273.1 protein_id gnl|my_center|LOCUS_12350 407002 406226 gene locus_tag LOCUS_12360 407002 406226 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029274.1 protein_id gnl|my_center|LOCUS_12360 407312 407238 gene locus_tag LOCUS_t00250 407312 407238 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 407495 408043 gene locus_tag LOCUS_12370 407495 408043 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029275.1 protein_id gnl|my_center|LOCUS_12370 408162 409718 gene locus_tag LOCUS_12380 408162 409718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_12380 411141 409726 gene locus_tag LOCUS_12390 411141 409726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029277.1 protein_id gnl|my_center|LOCUS_12390 411559 411431 gene locus_tag LOCUS_12400 411559 411431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 411899 412285 gene locus_tag LOCUS_12410 411899 412285 CDS product DUF6344 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975071.1 protein_id gnl|my_center|LOCUS_12410 412596 413399 gene locus_tag LOCUS_12420 412596 413399 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037897093.1 protein_id gnl|my_center|LOCUS_12420 413565 413389 gene locus_tag LOCUS_12430 413565 413389 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029281.1 protein_id gnl|my_center|LOCUS_12430 413730 414293 gene locus_tag LOCUS_12440 413730 414293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975066.1 protein_id gnl|my_center|LOCUS_12440 414605 418546 gene locus_tag LOCUS_12450 414605 418546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 418804 418728 gene locus_tag LOCUS_t00260 418804 418728 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 419489 418893 gene locus_tag LOCUS_12460 419489 418893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 422282 419688 gene locus_tag LOCUS_12470 gene gyrA 422282 419688 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326690.1 protein_id gnl|my_center|LOCUS_12470 424409 422325 gene locus_tag LOCUS_12480 gene gyrB 424409 422325 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029285.1 protein_id gnl|my_center|LOCUS_12480 425423 424821 gene locus_tag LOCUS_12490 425423 424821 CDS product DUF721 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975057.1 protein_id gnl|my_center|LOCUS_12490 426541 425420 gene locus_tag LOCUS_12500 gene recF 426541 425420 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975056.1 protein_id gnl|my_center|LOCUS_12500 427449 426574 gene locus_tag LOCUS_12510 gene gnd 427449 426574 CDS product decarboxylating 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029286.1 protein_id gnl|my_center|LOCUS_12510 428741 427611 gene locus_tag LOCUS_12520 gene dnaN 428741 427611 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975054.1 protein_id gnl|my_center|LOCUS_12520 431624 429660 gene locus_tag LOCUS_12530 gene dnaA 431624 429660 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029287.1 protein_id gnl|my_center|LOCUS_12530 432045 432182 gene locus_tag LOCUS_12540 gene rpmH 432045 432182 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975051.1 protein_id gnl|my_center|LOCUS_12540 432204 432575 gene locus_tag LOCUS_12550 gene rnpA 432204 432575 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029288.1 protein_id gnl|my_center|LOCUS_12550 432572 432946 gene locus_tag LOCUS_12560 gene yidD 432572 432946 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975049.1 protein_id gnl|my_center|LOCUS_12560 432950 434251 gene locus_tag LOCUS_12570 gene yidC 432950 434251 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029289.1 protein_id gnl|my_center|LOCUS_12570 434267 434779 gene locus_tag LOCUS_12580 434267 434779 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029290.1 protein_id gnl|my_center|LOCUS_12580 434858 435622 gene locus_tag LOCUS_12590 gene rsmG 434858 435622 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029291.1 protein_id gnl|my_center|LOCUS_12590 435695 437014 gene locus_tag LOCUS_12600 435695 437014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 437239 438108 gene locus_tag LOCUS_12610 437239 438108 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030863476.1 protein_id gnl|my_center|LOCUS_12610 438442 439059 gene locus_tag LOCUS_12620 438442 439059 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975043.1 protein_id gnl|my_center|LOCUS_12620 439470 439138 gene locus_tag LOCUS_12630 gene trxA 439470 439138 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975042.1 protein_id gnl|my_center|LOCUS_12630 440463 439513 gene locus_tag LOCUS_12640 gene trxB 440463 439513 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975041.1 protein_id gnl|my_center|LOCUS_12640 441521 440622 gene locus_tag LOCUS_12650 441521 440622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029294.1 protein_id gnl|my_center|LOCUS_12650 442345 441518 gene locus_tag LOCUS_12660 gene sigM 442345 441518 CDS product RNA polymerase sigma factor SigM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029295.1 protein_id gnl|my_center|LOCUS_12660 444069 442375 gene locus_tag LOCUS_12670 444069 442375 CDS product protein kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029296.1 protein_id gnl|my_center|LOCUS_12670 446621 444210 gene locus_tag LOCUS_12680 gene murJ 446621 444210 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029297.1 protein_id gnl|my_center|LOCUS_12680 449059 446666 gene locus_tag LOCUS_12690 449059 446666 CDS product DUF6049 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029298.1 protein_id gnl|my_center|LOCUS_12690 449320 450708 gene locus_tag LOCUS_12700 449320 450708 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975035.1 protein_id gnl|my_center|LOCUS_12700 451342 450800 gene locus_tag LOCUS_12710 451342 450800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 452728 451451 gene locus_tag LOCUS_12720 452728 451451 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029300.1 protein_id gnl|my_center|LOCUS_12720 453918 452836 gene locus_tag LOCUS_12730 453918 452836 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975032.1 protein_id gnl|my_center|LOCUS_12730 454640 453963 gene locus_tag LOCUS_12740 454640 453963 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975031.1 protein_id gnl|my_center|LOCUS_12740 455003 457681 gene locus_tag LOCUS_12750 455003 457681 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975030.1 protein_id gnl|my_center|LOCUS_12750 457811 459310 gene locus_tag LOCUS_12760 457811 459310 CDS product glycosyltransferase 87 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029301.1 protein_id gnl|my_center|LOCUS_12760 460524 459493 gene locus_tag LOCUS_12770 460524 459493 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975028.1 protein_id gnl|my_center|LOCUS_12770 461729 460608 gene locus_tag LOCUS_12780 gene femX 461729 460608 CDS product peptidoglycan bridge formation glycyltransferase FemX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029302.1 protein_id gnl|my_center|LOCUS_12780 462212 461895 gene locus_tag LOCUS_12790 462212 461895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975026.1 protein_id gnl|my_center|LOCUS_12790 462486 462776 gene locus_tag LOCUS_12800 gene rpsF 462486 462776 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975025.1 protein_id gnl|my_center|LOCUS_12800 462853 463443 gene locus_tag LOCUS_12810 462853 463443 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029303.1 protein_id gnl|my_center|LOCUS_12810 463489 463725 gene locus_tag LOCUS_12820 gene rpsR 463489 463725 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003949403.1 protein_id gnl|my_center|LOCUS_12820 463744 464190 gene locus_tag LOCUS_12830 gene rplI 463744 464190 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975023.1 protein_id gnl|my_center|LOCUS_12830 465704 464358 gene locus_tag LOCUS_12840 465704 464358 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485269.1 protein_id gnl|my_center|LOCUS_12840 466155 467633 gene locus_tag LOCUS_12850 gene dnaB 466155 467633 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975021.1 protein_id gnl|my_center|LOCUS_12850 467898 469190 gene locus_tag LOCUS_12860 467898 469190 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975020.1 protein_id gnl|my_center|LOCUS_12860 469745 469293 gene locus_tag LOCUS_12870 469745 469293 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029305.1 protein_id gnl|my_center|LOCUS_12870 470254 469790 gene locus_tag LOCUS_12880 470254 469790 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975018.1 protein_id gnl|my_center|LOCUS_12880 470394 471605 gene locus_tag LOCUS_12890 470394 471605 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029306.1 protein_id gnl|my_center|LOCUS_12890 471818 472243 gene locus_tag LOCUS_12900 471818 472243 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975016.1 protein_id gnl|my_center|LOCUS_12900 473158 472292 gene locus_tag LOCUS_12910 473158 472292 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029307.1 protein_id gnl|my_center|LOCUS_12910 473850 473368 gene locus_tag LOCUS_12920 473850 473368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 474861 473956 gene locus_tag LOCUS_12930 474861 473956 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029308.1 protein_id gnl|my_center|LOCUS_12930 476414 475155 gene locus_tag LOCUS_12940 476414 475155 CDS product cystathionine gamma-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029309.1 protein_id gnl|my_center|LOCUS_12940 476905 476411 gene locus_tag LOCUS_12950 476905 476411 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975011.1 protein_id gnl|my_center|LOCUS_12950 477284 476910 gene locus_tag LOCUS_12960 477284 476910 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975010.1 protein_id gnl|my_center|LOCUS_12960 477347 477664 gene locus_tag LOCUS_12970 477347 477664 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029310.1 protein_id gnl|my_center|LOCUS_12970 477843 478055 gene locus_tag LOCUS_12980 477843 478055 CDS product DUF5326 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029311.1 protein_id gnl|my_center|LOCUS_12980 478489 478151 gene locus_tag LOCUS_12990 478489 478151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 478524 479288 gene locus_tag LOCUS_13000 478524 479288 CDS product IclR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029312.1 protein_id gnl|my_center|LOCUS_13000 479388 479825 gene locus_tag LOCUS_13010 479388 479825 CDS product SsgA family sporulation/cell division regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975006.1 protein_id gnl|my_center|LOCUS_13010 481601 480054 gene locus_tag LOCUS_13020 481601 480054 CDS product YibE/F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029314.1 protein_id gnl|my_center|LOCUS_13020 481855 483645 gene locus_tag LOCUS_13030 gene thiC 481855 483645 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029315.1 protein_id gnl|my_center|LOCUS_13030 486897 483832 gene locus_tag LOCUS_13040 486897 483832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 487480 486995 gene locus_tag LOCUS_13050 487480 486995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 487861 488775 gene locus_tag LOCUS_13060 487861 488775 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230494.1 protein_id gnl|my_center|LOCUS_13060 490158 488779 gene locus_tag LOCUS_13070 490158 488779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026468787.1 protein_id gnl|my_center|LOCUS_13070 490370 490909 gene locus_tag LOCUS_13080 490370 490909 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029317.1 protein_id gnl|my_center|LOCUS_13080 491247 491546 gene locus_tag LOCUS_13090 491247 491546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108990666.1 protein_id gnl|my_center|LOCUS_13090 492736 491957 gene locus_tag LOCUS_13100 492736 491957 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029319.1 protein_id gnl|my_center|LOCUS_13100 492904 493254 gene locus_tag LOCUS_13110 492904 493254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029320.1 protein_id gnl|my_center|LOCUS_13110 493254 494555 gene locus_tag LOCUS_13120 493254 494555 CDS product FtsK/SpoIIIE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030188.1 protein_id gnl|my_center|LOCUS_13120 494552 494749 gene locus_tag LOCUS_13130 494552 494749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029322.1 protein_id gnl|my_center|LOCUS_13130 495689 494727 gene locus_tag LOCUS_13140 495689 494727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 495582 496415 gene locus_tag LOCUS_13150 495582 496415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 498119 496554 gene locus_tag LOCUS_13160 498119 496554 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029324.1 protein_id gnl|my_center|LOCUS_13160 498197 498325 gene locus_tag LOCUS_13170 498197 498325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 499282 498410 gene locus_tag LOCUS_13180 499282 498410 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029327.1 protein_id gnl|my_center|LOCUS_13180 500538 499465 gene locus_tag LOCUS_13190 gene sppA 500538 499465 CDS product Ser/Thr/Tyr protein phosphatase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029328.1 protein_id gnl|my_center|LOCUS_13190 501967 500879 gene locus_tag LOCUS_13200 501967 500879 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975000.1 protein_id gnl|my_center|LOCUS_13200 502392 503471 gene locus_tag LOCUS_13210 gene hisC 502392 503471 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029330.1 protein_id gnl|my_center|LOCUS_13210 503709 505214 gene locus_tag LOCUS_13220 503709 505214 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974998.1 protein_id gnl|my_center|LOCUS_13220 505236 506240 gene locus_tag LOCUS_13230 gene cydB 505236 506240 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029331.1 protein_id gnl|my_center|LOCUS_13230 506329 509826 gene locus_tag LOCUS_13240 gene cydD 506329 509826 CDS product thiol reductant ABC exporter subunit CydD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029332.1 protein_id gnl|my_center|LOCUS_13240 510100 509909 gene locus_tag LOCUS_13250 510100 509909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 510006 511580 gene locus_tag LOCUS_13260 510006 511580 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029333.1 protein_id gnl|my_center|LOCUS_13260 511679 512719 gene locus_tag LOCUS_13270 511679 512719 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029334.1 protein_id gnl|my_center|LOCUS_13270 513514 512726 gene locus_tag LOCUS_13280 513514 512726 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974993.1 protein_id gnl|my_center|LOCUS_13280 514689 513787 gene locus_tag LOCUS_13290 514689 513787 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326709.1 protein_id gnl|my_center|LOCUS_13290 516665 514917 gene locus_tag LOCUS_13300 516665 514917 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029339.1 protein_id gnl|my_center|LOCUS_13300 517069 516671 gene locus_tag LOCUS_13310 517069 516671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 517044 518006 gene locus_tag LOCUS_13320 517044 518006 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974987.1 protein_id gnl|my_center|LOCUS_13320 517996 518904 gene locus_tag LOCUS_13330 517996 518904 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974986.1 protein_id gnl|my_center|LOCUS_13330 518901 519812 gene locus_tag LOCUS_13340 518901 519812 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974985.1 protein_id gnl|my_center|LOCUS_13340 519824 520543 gene locus_tag LOCUS_13350 519824 520543 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974984.1 protein_id gnl|my_center|LOCUS_13350 521731 520907 gene locus_tag LOCUS_13360 521731 520907 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029342.1 protein_id gnl|my_center|LOCUS_13360 522966 521728 gene locus_tag LOCUS_13370 gene serS 522966 521728 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974982.1 protein_id gnl|my_center|LOCUS_13370 524535 523603 gene locus_tag LOCUS_13380 gene pheA 524535 523603 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974981.1 protein_id gnl|my_center|LOCUS_13380 525898 524588 gene locus_tag LOCUS_13390 gene efeB 525898 524588 CDS product iron uptake transporter deferrochelatase/peroxidase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029343.1 protein_id gnl|my_center|LOCUS_13390 527910 525907 gene locus_tag LOCUS_13400 527910 525907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 528396 527926 gene locus_tag LOCUS_13410 528396 527926 CDS product copper chaperone PCu(A)C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136208058.1 protein_id gnl|my_center|LOCUS_13410 529046 528393 gene locus_tag LOCUS_13420 529046 528393 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974978.1 protein_id gnl|my_center|LOCUS_13420 529876 529136 gene locus_tag LOCUS_13430 529876 529136 CDS product YcnI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974977.1 protein_id gnl|my_center|LOCUS_13430 530812 530006 gene locus_tag LOCUS_13440 530812 530006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029346.1 protein_id gnl|my_center|LOCUS_13440 531140 530823 gene locus_tag LOCUS_13450 531140 530823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 531034 531480 gene locus_tag LOCUS_13460 531034 531480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 532953 531496 gene locus_tag LOCUS_13470 532953 531496 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974973.1 protein_id gnl|my_center|LOCUS_13470 534448 533066 gene locus_tag LOCUS_13480 534448 533066 CDS product PP2C family protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029348.1 protein_id gnl|my_center|LOCUS_13480 535069 535731 gene locus_tag LOCUS_13490 535069 535731 CDS product bifunctional DNA primase/polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974971.1 protein_id gnl|my_center|LOCUS_13490 535787 536557 gene locus_tag LOCUS_13500 535787 536557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029349.1 protein_id gnl|my_center|LOCUS_13500 537766 536804 gene locus_tag LOCUS_13510 537766 536804 CDS product DUF5926 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974969.1 protein_id gnl|my_center|LOCUS_13510 538536 537985 gene locus_tag LOCUS_13520 538536 537985 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974968.1 protein_id gnl|my_center|LOCUS_13520 539520 538675 gene locus_tag LOCUS_13530 539520 538675 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974967.1 protein_id gnl|my_center|LOCUS_13530 540004 539633 gene locus_tag LOCUS_13540 540004 539633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 540189 541268 gene locus_tag LOCUS_13550 540189 541268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13550 541330 541417 gene locus_tag LOCUS_t00270 541330 541417 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 542014 541469 gene locus_tag LOCUS_13560 542014 541469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 542257 542901 gene locus_tag LOCUS_13570 542257 542901 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527805.1 protein_id gnl|my_center|LOCUS_13570 543829 542963 gene locus_tag LOCUS_13580 543829 542963 CDS product bifunctional DNA primase/polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029372.1 protein_id gnl|my_center|LOCUS_13580 544188 544511 gene locus_tag LOCUS_13590 544188 544511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974960.1 protein_id gnl|my_center|LOCUS_13590 545117 545674 gene locus_tag LOCUS_13600 545117 545674 CDS product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162495205.1 protein_id gnl|my_center|LOCUS_13600 545795 547471 gene locus_tag LOCUS_13610 545795 547471 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029376.1 protein_id gnl|my_center|LOCUS_13610 548821 547550 gene locus_tag LOCUS_13620 548821 547550 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029377.1 protein_id gnl|my_center|LOCUS_13620 548948 549526 gene locus_tag LOCUS_13630 548948 549526 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029378.1 protein_id gnl|my_center|LOCUS_13630 554151 549598 gene locus_tag LOCUS_13640 554151 549598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 554961 554464 gene locus_tag LOCUS_13650 554961 554464 CDS product SSI family serine proteinase inhibitor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029380.1 protein_id gnl|my_center|LOCUS_13650 555128 555219 gene locus_tag LOCUS_t00280 555128 555219 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 555395 555468 gene locus_tag LOCUS_t00290 555395 555468 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 556249 555899 gene locus_tag LOCUS_13660 556249 555899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 556815 556411 gene locus_tag LOCUS_13670 556815 556411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 557528 557064 gene locus_tag LOCUS_13680 557528 557064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 558788 557937 gene locus_tag LOCUS_13690 558788 557937 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977589.1 protein_id gnl|my_center|LOCUS_13690 559553 558801 gene locus_tag LOCUS_13700 559553 558801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 559728 559928 gene locus_tag LOCUS_13710 559728 559928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 560685 560257 gene locus_tag LOCUS_13720 560685 560257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 560827 561279 gene locus_tag LOCUS_13730 560827 561279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 561434 562231 gene locus_tag LOCUS_13740 561434 562231 CDS product DUF2797 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063628631.1 protein_id gnl|my_center|LOCUS_13740 562446 563186 gene locus_tag LOCUS_13750 562446 563186 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030863629.1 protein_id gnl|my_center|LOCUS_13750 563264 564796 gene locus_tag LOCUS_13760 563264 564796 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029388.1 protein_id gnl|my_center|LOCUS_13760 564895 566271 gene locus_tag LOCUS_13770 564895 566271 CDS product bifunctional glycosyltransferase family 2/GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029389.1 protein_id gnl|my_center|LOCUS_13770 565555 565636 gene locus_tag LOCUS_t00300 565555 565636 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 566268 568400 gene locus_tag LOCUS_13780 566268 568400 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029390.1 protein_id gnl|my_center|LOCUS_13780 568954 568487 gene locus_tag LOCUS_13790 568954 568487 CDS product TIGR03618 family F420-dependent PPOX class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974936.1 protein_id gnl|my_center|LOCUS_13790 569396 569034 gene locus_tag LOCUS_13800 569396 569034 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974935.1 protein_id gnl|my_center|LOCUS_13800 569635 570399 gene locus_tag LOCUS_13810 569635 570399 CDS product ANTAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168715398.1 protein_id gnl|my_center|LOCUS_13810 570418 571194 gene locus_tag LOCUS_13820 570418 571194 CDS product GAF and ANTAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029394.1 protein_id gnl|my_center|LOCUS_13820 571998 571174 gene locus_tag LOCUS_13830 571998 571174 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029395.1 protein_id gnl|my_center|LOCUS_13830 574664 572163 gene locus_tag LOCUS_13840 574664 572163 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029396.1 protein_id gnl|my_center|LOCUS_13840 575250 574750 gene locus_tag LOCUS_13850 575250 574750 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029397.1 protein_id gnl|my_center|LOCUS_13850 575457 575657 gene locus_tag LOCUS_13860 575457 575657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 576656 575757 gene locus_tag LOCUS_13870 576656 575757 CDS product RNA polymerase sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974928.1 protein_id gnl|my_center|LOCUS_13870 577782 576952 gene locus_tag LOCUS_13880 577782 576952 CDS product RNA polymerase sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029398.1 protein_id gnl|my_center|LOCUS_13880 578276 577983 gene locus_tag LOCUS_13890 578276 577983 CDS product Dabb family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974926.1 protein_id gnl|my_center|LOCUS_13890 578452 578276 gene locus_tag LOCUS_13900 578452 578276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052836888.1 protein_id gnl|my_center|LOCUS_13900 578665 578580 gene locus_tag LOCUS_t00310 578665 578580 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 579142 578711 gene locus_tag LOCUS_13910 gene tadA 579142 578711 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974924.1 protein_id gnl|my_center|LOCUS_13910 579747 579202 gene locus_tag LOCUS_13920 579747 579202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974923.1 protein_id gnl|my_center|LOCUS_13920 580410 580015 gene locus_tag LOCUS_13930 580410 580015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 580372 581007 gene locus_tag LOCUS_13940 gene upp 580372 581007 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974921.1 protein_id gnl|my_center|LOCUS_13940 581821 581183 gene locus_tag LOCUS_13950 581821 581183 CDS product LytR C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974920.1 protein_id gnl|my_center|LOCUS_13950 582249 581953 gene locus_tag LOCUS_13960 582249 581953 CDS product type II toxin-antitoxin system VapB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003999914.1 protein_id gnl|my_center|LOCUS_13960 582528 582394 gene locus_tag LOCUS_13970 582528 582394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 582955 582584 gene locus_tag LOCUS_13980 582955 582584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 583726 583124 gene locus_tag LOCUS_13990 583726 583124 CDS product HhH-GPD-type base excision DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974916.1 protein_id gnl|my_center|LOCUS_13990 584473 583751 gene locus_tag LOCUS_14000 584473 583751 CDS product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029404.1 protein_id gnl|my_center|LOCUS_14000 584559 586625 gene locus_tag LOCUS_14010 584559 586625 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029405.1 protein_id gnl|my_center|LOCUS_14010 586618 587223 gene locus_tag LOCUS_14020 586618 587223 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974913.1 protein_id gnl|my_center|LOCUS_14020 587234 587722 gene locus_tag LOCUS_14030 587234 587722 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974912.1 protein_id gnl|my_center|LOCUS_14030 587719 588483 gene locus_tag LOCUS_14040 587719 588483 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974911.1 protein_id gnl|my_center|LOCUS_14040 588734 590464 gene locus_tag LOCUS_14050 588734 590464 CDS product copper resistance protein CopC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029406.1 protein_id gnl|my_center|LOCUS_14050 591042 590476 gene locus_tag LOCUS_14060 591042 590476 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027252.1 protein_id gnl|my_center|LOCUS_14060 591967 591119 gene locus_tag LOCUS_14070 591967 591119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 592491 591967 gene locus_tag LOCUS_14080 592491 591967 CDS product DUF2243 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878720.1 protein_id gnl|my_center|LOCUS_14080 593124 592654 gene locus_tag LOCUS_14090 593124 592654 CDS product ArsI/CadI family heavy metal resistance metalloenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031198.1 protein_id gnl|my_center|LOCUS_14090 593224 593610 gene locus_tag LOCUS_14100 593224 593610 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112737.1 protein_id gnl|my_center|LOCUS_14100 593634 594695 gene locus_tag LOCUS_14110 gene arsB 593634 594695 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222674.1 protein_id gnl|my_center|LOCUS_14110 594974 594887 gene locus_tag LOCUS_t00320 594974 594887 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 595169 597586 gene locus_tag LOCUS_14120 595169 597586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 597694 598947 gene locus_tag LOCUS_14130 gene purD 597694 598947 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029417.1 protein_id gnl|my_center|LOCUS_14130 598783 598689 gene locus_tag LOCUS_t00330 598783 598689 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 599336 601171 gene locus_tag LOCUS_14140 599336 601171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029418.1 protein_id gnl|my_center|LOCUS_14140 601465 602985 gene locus_tag LOCUS_14150 601465 602985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974902.1 protein_id gnl|my_center|LOCUS_14150 603054 603953 gene locus_tag LOCUS_14160 603054 603953 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974901.1 protein_id gnl|my_center|LOCUS_14160 604086 604011 gene locus_tag LOCUS_t00340 604086 604011 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 604725 604111 gene locus_tag LOCUS_14170 604725 604111 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326755.1 protein_id gnl|my_center|LOCUS_14170 605897 604722 gene locus_tag LOCUS_14180 605897 604722 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029419.1 protein_id gnl|my_center|LOCUS_14180 606769 605996 gene locus_tag LOCUS_14190 606769 605996 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974898.1 protein_id gnl|my_center|LOCUS_14190 607878 606766 gene locus_tag LOCUS_14200 607878 606766 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974897.1 protein_id gnl|my_center|LOCUS_14200 608131 608058 gene locus_tag LOCUS_t00350 608131 608058 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 608284 608211 gene locus_tag LOCUS_t00360 608284 608211 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 608718 608401 gene locus_tag LOCUS_14210 608718 608401 CDS product Lsr2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974896.1 protein_id gnl|my_center|LOCUS_14210 609093 609341 gene locus_tag LOCUS_14220 gene purS 609093 609341 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974895.1 protein_id gnl|my_center|LOCUS_14220 609338 610018 gene locus_tag LOCUS_14230 gene purQ 609338 610018 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974894.1 protein_id gnl|my_center|LOCUS_14230 610015 612273 gene locus_tag LOCUS_14240 gene purL 610015 612273 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974893.1 protein_id gnl|my_center|LOCUS_14240 612600 613397 gene locus_tag LOCUS_14250 612600 613397 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974888.1 protein_id gnl|my_center|LOCUS_14250 613450 613920 gene locus_tag LOCUS_14260 613450 613920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 614178 615707 gene locus_tag LOCUS_14270 gene purF 614178 615707 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030872463.1 protein_id gnl|my_center|LOCUS_14270 615755 616822 gene locus_tag LOCUS_14280 gene purM 615755 616822 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974885.1 protein_id gnl|my_center|LOCUS_14280 617159 616902 gene locus_tag LOCUS_14290 617159 616902 CDS product DUF3073 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974884.1 protein_id gnl|my_center|LOCUS_14290 618485 617469 gene locus_tag LOCUS_14300 618485 617469 CDS product Glu/Leu/Phe/Val dehydrogenase dimerization domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029424.1 protein_id gnl|my_center|LOCUS_14300 618785 619636 gene locus_tag LOCUS_14310 618785 619636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974882.1 protein_id gnl|my_center|LOCUS_14310 620140 620346 gene locus_tag LOCUS_14320 gene bldC 620140 620346 CDS product developmental transcriptional regulator BldC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003949541.1 protein_id gnl|my_center|LOCUS_14320 621126 621051 gene locus_tag LOCUS_t00370 621126 621051 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 625165 621221 gene locus_tag LOCUS_14330 gene hrpA 625165 621221 CDS product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029425.1 protein_id gnl|my_center|LOCUS_14330 625354 625280 gene locus_tag LOCUS_t00380 625354 625280 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 625453 625378 gene locus_tag LOCUS_t00390 625453 625378 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 625562 625489 gene locus_tag LOCUS_t00400 625562 625489 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 627229 625643 gene locus_tag LOCUS_14340 627229 625643 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974879.1 protein_id gnl|my_center|LOCUS_14340 627316 627666 gene locus_tag LOCUS_14350 627316 627666 CDS product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029427.1 protein_id gnl|my_center|LOCUS_14350 627739 628284 gene locus_tag LOCUS_14360 627739 628284 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029428.1 protein_id gnl|my_center|LOCUS_14360 628746 630911 gene locus_tag LOCUS_14370 628746 630911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 631019 632575 gene locus_tag LOCUS_14380 631019 632575 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230797.1 protein_id gnl|my_center|LOCUS_14380 632664 632737 gene locus_tag LOCUS_t00410 632664 632737 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 632991 632815 gene locus_tag LOCUS_14390 632991 632815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 633161 632988 gene locus_tag LOCUS_14400 633161 632988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 633388 633648 gene locus_tag LOCUS_14410 633388 633648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153524579.1 protein_id gnl|my_center|LOCUS_14410 633707 634147 gene locus_tag LOCUS_14420 633707 634147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143647548.1 protein_id gnl|my_center|LOCUS_14420 634171 635022 gene locus_tag LOCUS_14430 634171 635022 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_199889868.1 protein_id gnl|my_center|LOCUS_14430 635889 635062 gene locus_tag LOCUS_14440 635889 635062 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529955.1 protein_id gnl|my_center|LOCUS_14440 636517 636041 gene locus_tag LOCUS_14450 636517 636041 CDS product DUF3515 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029126.1 protein_id gnl|my_center|LOCUS_14450 636647 637207 gene locus_tag LOCUS_14460 636647 637207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14460 637313 638443 gene locus_tag LOCUS_14470 637313 638443 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029438.1 protein_id gnl|my_center|LOCUS_14470 638680 639894 gene locus_tag LOCUS_14480 638680 639894 CDS product alginate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031686.1 protein_id gnl|my_center|LOCUS_14480 639946 640020 gene locus_tag LOCUS_t00420 639946 640020 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 640221 641417 gene locus_tag LOCUS_14490 640221 641417 CDS product PP2C family protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326766.1 protein_id gnl|my_center|LOCUS_14490 641821 642885 gene locus_tag LOCUS_14500 641821 642885 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029440.1 protein_id gnl|my_center|LOCUS_14500 644215 642893 gene locus_tag LOCUS_14510 644215 642893 CDS product PrsW family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029441.1 protein_id gnl|my_center|LOCUS_14510 645144 644254 gene locus_tag LOCUS_14520 gene trmB 645144 644254 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974862.1 protein_id gnl|my_center|LOCUS_14520 646462 645158 gene locus_tag LOCUS_14530 gene lhgO 646462 645158 CDS product L-2-hydroxyglutarate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974860.1 protein_id gnl|my_center|LOCUS_14530 647961 646537 gene locus_tag LOCUS_14540 647961 646537 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974859.1 protein_id gnl|my_center|LOCUS_14540 648641 650749 gene locus_tag LOCUS_14550 648641 650749 CDS product lasso peptide isopeptide bond-forming cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228688.1 protein_id gnl|my_center|LOCUS_14550 651002 654235 gene locus_tag LOCUS_14560 651002 654235 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485318.1 protein_id gnl|my_center|LOCUS_14560 656119 654251 gene locus_tag LOCUS_14570 656119 654251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14570 657401 656718 gene locus_tag LOCUS_14580 657401 656718 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029446.1 protein_id gnl|my_center|LOCUS_14580 657856 659268 gene locus_tag LOCUS_14590 657856 659268 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974853.1 protein_id gnl|my_center|LOCUS_14590 659441 661090 gene locus_tag LOCUS_14600 659441 661090 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029448.1 protein_id gnl|my_center|LOCUS_14600 662417 661128 gene locus_tag LOCUS_14610 662417 661128 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029449.1 protein_id gnl|my_center|LOCUS_14610 662528 663076 gene locus_tag LOCUS_14620 662528 663076 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974850.1 protein_id gnl|my_center|LOCUS_14620 >Feature sequence03 7623 7429 gene locus_tag LOCUS_14630 7623 7429 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971465.1 protein_id gnl|my_center|LOCUS_14630 8819 7632 gene locus_tag LOCUS_14640 8819 7632 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221980.1 protein_id gnl|my_center|LOCUS_14640 9241 8852 gene locus_tag LOCUS_14650 9241 8852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 9790 12516 gene locus_tag LOCUS_14660 9790 12516 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156089687.1 protein_id gnl|my_center|LOCUS_14660 14219 12621 gene locus_tag LOCUS_14670 14219 12621 CDS product exporter of polyketide antibiotics inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222247.1 protein_id gnl|my_center|LOCUS_14670 15112 14216 gene locus_tag LOCUS_14680 15112 14216 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222248.1 protein_id gnl|my_center|LOCUS_14680 15280 15708 gene locus_tag LOCUS_14690 15280 15708 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222249.1 protein_id gnl|my_center|LOCUS_14690 16184 15816 gene locus_tag LOCUS_14700 16184 15816 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229185.1 protein_id gnl|my_center|LOCUS_14700 17578 16181 gene locus_tag LOCUS_14710 17578 16181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 25350 17794 gene locus_tag LOCUS_14720 25350 17794 CDS product type I polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194140.1 protein_id gnl|my_center|LOCUS_14720 25700 26104 gene locus_tag LOCUS_14730 25700 26104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 26995 26282 gene locus_tag LOCUS_14740 26995 26282 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026963.1 protein_id gnl|my_center|LOCUS_14740 27537 27166 gene locus_tag LOCUS_14750 27537 27166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027668.1 protein_id gnl|my_center|LOCUS_14750 27815 27534 gene locus_tag LOCUS_14760 27815 27534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 27894 28721 gene locus_tag LOCUS_14770 27894 28721 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891968.1 protein_id gnl|my_center|LOCUS_14770 28851 31535 gene locus_tag LOCUS_14780 28851 31535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 32245 31667 gene locus_tag LOCUS_14790 32245 31667 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530706.1 protein_id gnl|my_center|LOCUS_14790 32324 33097 gene locus_tag LOCUS_14800 32324 33097 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227420.1 protein_id gnl|my_center|LOCUS_14800 33131 33499 gene locus_tag LOCUS_14810 33131 33499 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228109.1 protein_id gnl|my_center|LOCUS_14810 33738 36650 gene locus_tag LOCUS_14820 33738 36650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 36969 38063 gene locus_tag LOCUS_14830 36969 38063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 38217 40415 gene locus_tag LOCUS_14840 38217 40415 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031868.1 protein_id gnl|my_center|LOCUS_14840 40428 40985 gene locus_tag LOCUS_14850 40428 40985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971403.1 protein_id gnl|my_center|LOCUS_14850 41199 42656 gene locus_tag LOCUS_14860 41199 42656 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102149.1 protein_id gnl|my_center|LOCUS_14860 42722 43528 gene locus_tag LOCUS_14870 42722 43528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 43419 46178 gene locus_tag LOCUS_14880 43419 46178 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228256.1 protein_id gnl|my_center|LOCUS_14880 46339 47163 gene locus_tag LOCUS_14890 46339 47163 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529999.1 protein_id gnl|my_center|LOCUS_14890 47219 47542 gene locus_tag LOCUS_14900 47219 47542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 48400 47639 gene locus_tag LOCUS_14910 48400 47639 CDS product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973517.1 protein_id gnl|my_center|LOCUS_14910 48672 49079 gene locus_tag LOCUS_14920 48672 49079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031939.1 protein_id gnl|my_center|LOCUS_14920 50611 49241 gene locus_tag LOCUS_14930 50611 49241 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227115.1 protein_id gnl|my_center|LOCUS_14930 50586 50828 gene locus_tag LOCUS_14940 50586 50828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 51748 50711 gene locus_tag LOCUS_14950 51748 50711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 52723 51845 gene locus_tag LOCUS_14960 52723 51845 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140485.1 protein_id gnl|my_center|LOCUS_14960 52907 53806 gene locus_tag LOCUS_14970 52907 53806 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230083.1 protein_id gnl|my_center|LOCUS_14970 54905 54036 gene locus_tag LOCUS_14980 54905 54036 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031041.1 protein_id gnl|my_center|LOCUS_14980 54962 55378 gene locus_tag LOCUS_14990 54962 55378 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972365.1 protein_id gnl|my_center|LOCUS_14990 55552 56547 gene locus_tag LOCUS_15000 55552 56547 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729524.1 protein_id gnl|my_center|LOCUS_15000 56624 57175 gene locus_tag LOCUS_15010 56624 57175 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729526.1 protein_id gnl|my_center|LOCUS_15010 58219 57296 gene locus_tag LOCUS_15020 58219 57296 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031174.1 protein_id gnl|my_center|LOCUS_15020 59000 58332 gene locus_tag LOCUS_15030 59000 58332 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031175.1 protein_id gnl|my_center|LOCUS_15030 59308 59955 gene locus_tag LOCUS_15040 59308 59955 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967875.1 protein_id gnl|my_center|LOCUS_15040 60113 60535 gene locus_tag LOCUS_15050 60113 60535 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868971.1 protein_id gnl|my_center|LOCUS_15050 60454 60774 gene locus_tag LOCUS_15060 60454 60774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 60790 61737 gene locus_tag LOCUS_15070 60790 61737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027166.1 protein_id gnl|my_center|LOCUS_15070 61978 65271 gene locus_tag LOCUS_15080 61978 65271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 66649 65282 gene locus_tag LOCUS_15090 66649 65282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 68142 66706 gene locus_tag LOCUS_15100 68142 66706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 68441 68292 gene locus_tag LOCUS_15110 68441 68292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 68386 70008 gene locus_tag LOCUS_15120 68386 70008 CDS product carboxylesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727668.1 protein_id gnl|my_center|LOCUS_15120 70179 70820 gene locus_tag LOCUS_15130 70179 70820 CDS product peptidase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026982.1 protein_id gnl|my_center|LOCUS_15130 70949 71743 gene locus_tag LOCUS_15140 70949 71743 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_067360532.1 protein_id gnl|my_center|LOCUS_15140 72035 72244 gene locus_tag LOCUS_15150 72035 72244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 72276 74588 gene locus_tag LOCUS_15160 72276 74588 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225837.1 protein_id gnl|my_center|LOCUS_15160 75195 74704 gene locus_tag LOCUS_15170 75195 74704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 75297 75794 gene locus_tag LOCUS_15180 75297 75794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 76070 77413 gene locus_tag LOCUS_15190 76070 77413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 77667 77335 gene locus_tag LOCUS_15200 77667 77335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 77576 78103 gene locus_tag LOCUS_15210 77576 78103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 78100 79182 gene locus_tag LOCUS_15220 78100 79182 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487139.1 protein_id gnl|my_center|LOCUS_15220 79492 79136 gene locus_tag LOCUS_15230 79492 79136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 79693 80388 gene locus_tag LOCUS_15240 79693 80388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 80663 81712 gene locus_tag LOCUS_15250 80663 81712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 81702 84269 gene locus_tag LOCUS_15260 81702 84269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 84266 85147 gene locus_tag LOCUS_15270 84266 85147 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228298.1 protein_id gnl|my_center|LOCUS_15270 85656 89315 gene locus_tag LOCUS_15280 85656 89315 CDS product nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487114.1 protein_id gnl|my_center|LOCUS_15280 89317 90948 gene locus_tag LOCUS_15290 gene narH 89317 90948 CDS product nitrate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487116.1 protein_id gnl|my_center|LOCUS_15290 90945 91553 gene locus_tag LOCUS_15300 gene narJ 90945 91553 CDS product nitrate reductase molybdenum cofactor assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029970.1 protein_id gnl|my_center|LOCUS_15300 91550 92287 gene locus_tag LOCUS_15310 gene narI 91550 92287 CDS product respiratory nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029971.1 protein_id gnl|my_center|LOCUS_15310 92284 93336 gene locus_tag LOCUS_15320 92284 93336 CDS product tellurite resistance/C4-dicarboxylate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776255.1 protein_id gnl|my_center|LOCUS_15320 93846 93391 gene locus_tag LOCUS_15330 93846 93391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 96435 93850 gene locus_tag LOCUS_15340 96435 93850 CDS product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728610.1 protein_id gnl|my_center|LOCUS_15340 96857 97675 gene locus_tag LOCUS_15350 96857 97675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 98456 97587 gene locus_tag LOCUS_15360 98456 97587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 99087 98491 gene locus_tag LOCUS_15370 99087 98491 CDS product DUF4291 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974022.1 protein_id gnl|my_center|LOCUS_15370 99365 100660 gene locus_tag LOCUS_15380 99365 100660 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929725.1 protein_id gnl|my_center|LOCUS_15380 100644 101705 gene locus_tag LOCUS_15390 100644 101705 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972532.1 protein_id gnl|my_center|LOCUS_15390 102190 101828 gene locus_tag LOCUS_15400 102190 101828 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028376.1 protein_id gnl|my_center|LOCUS_15400 102288 103169 gene locus_tag LOCUS_15410 102288 103169 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028377.1 protein_id gnl|my_center|LOCUS_15410 103420 104037 gene locus_tag LOCUS_15420 103420 104037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 104503 105789 gene locus_tag LOCUS_15430 gene dacB 104503 105789 CDS product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972790.1 protein_id gnl|my_center|LOCUS_15430 105935 106735 gene locus_tag LOCUS_15440 105935 106735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 107625 106954 gene locus_tag LOCUS_15450 107625 106954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 108672 107737 gene locus_tag LOCUS_15460 108672 107737 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974578.1 protein_id gnl|my_center|LOCUS_15460 108566 108859 gene locus_tag LOCUS_15470 108566 108859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 108856 109740 gene locus_tag LOCUS_15480 108856 109740 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226009.1 protein_id gnl|my_center|LOCUS_15480 109946 110125 gene locus_tag LOCUS_15490 109946 110125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 110118 110876 gene locus_tag LOCUS_15500 110118 110876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 111785 111042 gene locus_tag LOCUS_15510 111785 111042 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326902.1 protein_id gnl|my_center|LOCUS_15510 112324 111818 gene locus_tag LOCUS_15520 112324 111818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 112650 113189 gene locus_tag LOCUS_15530 112650 113189 CDS product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777029.1 protein_id gnl|my_center|LOCUS_15530 113515 113288 gene locus_tag LOCUS_15540 113515 113288 CDS product DUF5133 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971826.1 protein_id gnl|my_center|LOCUS_15540 114088 113672 gene locus_tag LOCUS_15550 114088 113672 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227025.1 protein_id gnl|my_center|LOCUS_15550 114736 114395 gene locus_tag LOCUS_15560 114736 114395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004993226.1 protein_id gnl|my_center|LOCUS_15560 116000 115152 gene locus_tag LOCUS_15570 116000 115152 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228496.1 protein_id gnl|my_center|LOCUS_15570 116258 116013 gene locus_tag LOCUS_15580 116258 116013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 116151 116891 gene locus_tag LOCUS_15590 116151 116891 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027476.1 protein_id gnl|my_center|LOCUS_15590 116957 117460 gene locus_tag LOCUS_15600 116957 117460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 118563 117655 gene locus_tag LOCUS_15610 118563 117655 CDS product NmrA/HSCARG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142276.1 protein_id gnl|my_center|LOCUS_15610 118669 119232 gene locus_tag LOCUS_15620 118669 119232 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030034.1 protein_id gnl|my_center|LOCUS_15620 119438 119614 gene locus_tag LOCUS_15630 119438 119614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 120312 119839 gene locus_tag LOCUS_15640 120312 119839 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230087.1 protein_id gnl|my_center|LOCUS_15640 120376 120756 gene locus_tag LOCUS_15650 120376 120756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 121305 120895 gene locus_tag LOCUS_15660 121305 120895 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028904.1 protein_id gnl|my_center|LOCUS_15660 122534 121512 gene locus_tag LOCUS_15670 122534 121512 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225577.1 protein_id gnl|my_center|LOCUS_15670 122710 122567 gene locus_tag LOCUS_15680 122710 122567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 123052 124425 gene locus_tag LOCUS_15690 123052 124425 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467055.1 protein_id gnl|my_center|LOCUS_15690 124422 125798 gene locus_tag LOCUS_15700 124422 125798 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225907.1 protein_id gnl|my_center|LOCUS_15700 126680 125838 gene locus_tag LOCUS_15710 126680 125838 CDS product PaaX family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225909.1 protein_id gnl|my_center|LOCUS_15710 127638 126718 gene locus_tag LOCUS_15720 127638 126718 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098193.1 protein_id gnl|my_center|LOCUS_15720 127810 128394 gene locus_tag LOCUS_15730 127810 128394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 128423 129901 gene locus_tag LOCUS_15740 128423 129901 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029659.1 protein_id gnl|my_center|LOCUS_15740 129945 131195 gene locus_tag LOCUS_15750 129945 131195 CDS product DUF3500 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123797.1 protein_id gnl|my_center|LOCUS_15750 132116 131451 gene locus_tag LOCUS_15760 132116 131451 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031175.1 protein_id gnl|my_center|LOCUS_15760 132281 133477 gene locus_tag LOCUS_15770 132281 133477 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030555.1 protein_id gnl|my_center|LOCUS_15770 134649 133522 gene locus_tag LOCUS_15780 134649 133522 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026832.1 protein_id gnl|my_center|LOCUS_15780 134823 135794 gene locus_tag LOCUS_15790 134823 135794 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_123743405.1 protein_id gnl|my_center|LOCUS_15790 135791 136150 gene locus_tag LOCUS_15800 135791 136150 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066878203.1 protein_id gnl|my_center|LOCUS_15800 136991 136230 gene locus_tag LOCUS_15810 136991 136230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 137330 138688 gene locus_tag LOCUS_15820 gene gdhA 137330 138688 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974280.1 protein_id gnl|my_center|LOCUS_15820 139821 138859 gene locus_tag LOCUS_15830 139821 138859 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225335.1 protein_id gnl|my_center|LOCUS_15830 140455 139904 gene locus_tag LOCUS_15840 140455 139904 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975539.1 protein_id gnl|my_center|LOCUS_15840 140837 141340 gene locus_tag LOCUS_15850 140837 141340 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225564.1 protein_id gnl|my_center|LOCUS_15850 142336 141353 gene locus_tag LOCUS_15860 142336 141353 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031906.1 protein_id gnl|my_center|LOCUS_15860 142578 143078 gene locus_tag LOCUS_15870 142578 143078 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086845735.1 protein_id gnl|my_center|LOCUS_15870 143206 145260 gene locus_tag LOCUS_15880 143206 145260 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143126.1 protein_id gnl|my_center|LOCUS_15880 145562 146131 gene locus_tag LOCUS_15890 145562 146131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 146930 146190 gene locus_tag LOCUS_15900 146930 146190 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225465.1 protein_id gnl|my_center|LOCUS_15900 147046 147588 gene locus_tag LOCUS_15910 147046 147588 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225464.1 protein_id gnl|my_center|LOCUS_15910 147923 148774 gene locus_tag LOCUS_15920 147923 148774 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804543.1 protein_id gnl|my_center|LOCUS_15920 149837 148800 gene locus_tag LOCUS_15930 149837 148800 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742140.1 protein_id gnl|my_center|LOCUS_15930 150895 149963 gene locus_tag LOCUS_15940 150895 149963 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978333.1 protein_id gnl|my_center|LOCUS_15940 151206 152459 gene locus_tag LOCUS_15950 151206 152459 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027184.1 protein_id gnl|my_center|LOCUS_15950 152523 153503 gene locus_tag LOCUS_15960 152523 153503 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978331.1 protein_id gnl|my_center|LOCUS_15960 153500 154369 gene locus_tag LOCUS_15970 153500 154369 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027186.1 protein_id gnl|my_center|LOCUS_15970 154435 156027 gene locus_tag LOCUS_15980 154435 156027 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027187.1 protein_id gnl|my_center|LOCUS_15980 156062 157498 gene locus_tag LOCUS_15990 156062 157498 CDS product cellulose binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027188.1 protein_id gnl|my_center|LOCUS_15990 158351 157566 gene locus_tag LOCUS_16000 158351 157566 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938071.1 protein_id gnl|my_center|LOCUS_16000 158535 159440 gene locus_tag LOCUS_16010 158535 159440 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898125.1 protein_id gnl|my_center|LOCUS_16010 160203 159463 gene locus_tag LOCUS_16020 160203 159463 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027093.1 protein_id gnl|my_center|LOCUS_16020 161273 160314 gene locus_tag LOCUS_16030 161273 160314 CDS product anti-sigma factor RsbA family regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027235.1 protein_id gnl|my_center|LOCUS_16030 162145 161270 gene locus_tag LOCUS_16040 162145 161270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 162529 162242 gene locus_tag LOCUS_16050 162529 162242 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227689.1 protein_id gnl|my_center|LOCUS_16050 166635 162529 gene locus_tag LOCUS_16060 166635 162529 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227688.1 protein_id gnl|my_center|LOCUS_16060 166523 166951 gene locus_tag LOCUS_16070 166523 166951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 166948 168264 gene locus_tag LOCUS_16080 166948 168264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 168261 168617 gene locus_tag LOCUS_16090 168261 168617 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029168.1 protein_id gnl|my_center|LOCUS_16090 169428 168655 gene locus_tag LOCUS_16100 169428 168655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 170020 169703 gene locus_tag LOCUS_16110 170020 169703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038535289.1 protein_id gnl|my_center|LOCUS_16110 170176 170349 gene locus_tag LOCUS_16120 170176 170349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 170489 171058 gene locus_tag LOCUS_16130 170489 171058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 171128 171889 gene locus_tag LOCUS_16140 171128 171889 CDS product ZIP family zinc transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487390.1 protein_id gnl|my_center|LOCUS_16140 172084 173358 gene locus_tag LOCUS_16150 172084 173358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 173792 174604 gene locus_tag LOCUS_16160 173792 174604 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892869.1 protein_id gnl|my_center|LOCUS_16160 174645 177329 gene locus_tag LOCUS_16170 174645 177329 CDS product non-ribosomal peptide synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205348.1 protein_id gnl|my_center|LOCUS_16170 178928 177372 gene locus_tag LOCUS_16180 178928 177372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 179503 180876 gene locus_tag LOCUS_16190 179503 180876 CDS product cellulase family glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971507.1 protein_id gnl|my_center|LOCUS_16190 181778 181038 gene locus_tag LOCUS_16200 181778 181038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 182378 181950 gene locus_tag LOCUS_16210 182378 181950 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029470.1 protein_id gnl|my_center|LOCUS_16210 182480 182863 gene locus_tag LOCUS_16220 182480 182863 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029469.1 protein_id gnl|my_center|LOCUS_16220 184133 182898 gene locus_tag LOCUS_16230 184133 182898 CDS product PP2C family protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031624.1 protein_id gnl|my_center|LOCUS_16230 184548 184234 gene locus_tag LOCUS_16240 184548 184234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 184958 184521 gene locus_tag LOCUS_16250 184958 184521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 186754 185333 gene locus_tag LOCUS_16260 186754 185333 CDS product non-reducing end alpha-L-arabinofuranosidase family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030541.1 protein_id gnl|my_center|LOCUS_16260 188467 186818 gene locus_tag LOCUS_16270 188467 186818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 189074 188823 gene locus_tag LOCUS_16280 189074 188823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 189037 190500 gene locus_tag LOCUS_16290 189037 190500 CDS product ricin-type beta-trefoil lectin domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229143.1 protein_id gnl|my_center|LOCUS_16290 191443 190544 gene locus_tag LOCUS_16300 191443 190544 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031675.1 protein_id gnl|my_center|LOCUS_16300 192570 191596 gene locus_tag LOCUS_16310 192570 191596 CDS product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027138.1 protein_id gnl|my_center|LOCUS_16310 192637 193344 gene locus_tag LOCUS_16320 192637 193344 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030862601.1 protein_id gnl|my_center|LOCUS_16320 193385 194305 gene locus_tag LOCUS_16330 193385 194305 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729840.1 protein_id gnl|my_center|LOCUS_16330 194977 194330 gene locus_tag LOCUS_16340 194977 194330 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729106.1 protein_id gnl|my_center|LOCUS_16340 195553 195170 gene locus_tag LOCUS_16350 195553 195170 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225660.1 protein_id gnl|my_center|LOCUS_16350 195676 196512 gene locus_tag LOCUS_16360 195676 196512 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225659.1 protein_id gnl|my_center|LOCUS_16360 196609 197157 gene locus_tag LOCUS_16370 196609 197157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229320.1 protein_id gnl|my_center|LOCUS_16370 197718 197269 gene locus_tag LOCUS_16380 197718 197269 CDS product spore-associated protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978456.1 protein_id gnl|my_center|LOCUS_16380 198225 197827 gene locus_tag LOCUS_16390 198225 197827 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974464.1 protein_id gnl|my_center|LOCUS_16390 198321 199295 gene locus_tag LOCUS_16400 198321 199295 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029688.1 protein_id gnl|my_center|LOCUS_16400 200451 199345 gene locus_tag LOCUS_16410 200451 199345 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038534186.1 protein_id gnl|my_center|LOCUS_16410 200405 201049 gene locus_tag LOCUS_16420 200405 201049 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971593.1 protein_id gnl|my_center|LOCUS_16420 201167 202354 gene locus_tag LOCUS_16430 201167 202354 CDS product winged helix DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031727.1 protein_id gnl|my_center|LOCUS_16430 202365 203168 gene locus_tag LOCUS_16440 202365 203168 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031850.1 protein_id gnl|my_center|LOCUS_16440 204928 203201 gene locus_tag LOCUS_16450 204928 203201 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031586.1 protein_id gnl|my_center|LOCUS_16450 205959 204925 gene locus_tag LOCUS_16460 205959 204925 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031587.1 protein_id gnl|my_center|LOCUS_16460 206402 205959 gene locus_tag LOCUS_16470 206402 205959 CDS product anti-sigma regulatory factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036370.1 protein_id gnl|my_center|LOCUS_16470 206776 206402 gene locus_tag LOCUS_16480 206776 206402 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971818.1 protein_id gnl|my_center|LOCUS_16480 207708 206809 gene locus_tag LOCUS_16490 207708 206809 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971817.1 protein_id gnl|my_center|LOCUS_16490 208967 207861 gene locus_tag LOCUS_16500 208967 207861 CDS product PP2C family protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031879.1 protein_id gnl|my_center|LOCUS_16500 209223 209657 gene locus_tag LOCUS_16510 209223 209657 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224919.1 protein_id gnl|my_center|LOCUS_16510 210163 211203 gene locus_tag LOCUS_16520 210163 211203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 211323 211757 gene locus_tag LOCUS_16530 211323 211757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223403.1 protein_id gnl|my_center|LOCUS_16530 211760 213925 gene locus_tag LOCUS_16540 211760 213925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 213989 214762 gene locus_tag LOCUS_16550 213989 214762 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224232.1 protein_id gnl|my_center|LOCUS_16550 214832 215572 gene locus_tag LOCUS_16560 214832 215572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 215653 216318 gene locus_tag LOCUS_16570 215653 216318 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467764.1 protein_id gnl|my_center|LOCUS_16570 216364 217224 gene locus_tag LOCUS_16580 216364 217224 CDS product glycoside hydrolase family 16 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971569.1 protein_id gnl|my_center|LOCUS_16580 217972 217289 gene locus_tag LOCUS_16590 217972 217289 CDS product pyridoxal 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974564.1 protein_id gnl|my_center|LOCUS_16590 218200 219435 gene locus_tag LOCUS_16600 218200 219435 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975925.1 protein_id gnl|my_center|LOCUS_16600 220368 219445 gene locus_tag LOCUS_16610 220368 219445 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223554.1 protein_id gnl|my_center|LOCUS_16610 220533 221828 gene locus_tag LOCUS_16620 220533 221828 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223555.1 protein_id gnl|my_center|LOCUS_16620 223035 221935 gene locus_tag LOCUS_16630 223035 221935 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730678.1 protein_id gnl|my_center|LOCUS_16630 225327 223183 gene locus_tag LOCUS_16640 225327 223183 CDS product glycogen debranching N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730677.1 protein_id gnl|my_center|LOCUS_16640 227025 225454 gene locus_tag LOCUS_16650 227025 225454 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257624.1 protein_id gnl|my_center|LOCUS_16650 228561 227056 gene locus_tag LOCUS_16660 228561 227056 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112317.1 protein_id gnl|my_center|LOCUS_16660 228701 229327 gene locus_tag LOCUS_16670 228701 229327 CDS product TetR/AcrR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891760.1 protein_id gnl|my_center|LOCUS_16670 229913 229374 gene locus_tag LOCUS_16680 229913 229374 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226185.1 protein_id gnl|my_center|LOCUS_16680 230076 230990 gene locus_tag LOCUS_16690 gene sigJ 230076 230990 CDS product RNA polymerase sigma factor SigJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229999.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16690 232428 230953 gene locus_tag LOCUS_16700 232428 230953 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804864.1 protein_id gnl|my_center|LOCUS_16700 232525 233412 gene locus_tag LOCUS_16710 232525 233412 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484806.1 protein_id gnl|my_center|LOCUS_16710 234127 233381 gene locus_tag LOCUS_16720 234127 233381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 234211 235200 gene locus_tag LOCUS_16730 234211 235200 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868968.1 protein_id gnl|my_center|LOCUS_16730 235479 236942 gene locus_tag LOCUS_16740 235479 236942 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257106.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16740 239165 236952 gene locus_tag LOCUS_16750 239165 236952 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730364.1 protein_id gnl|my_center|LOCUS_16750 239336 240013 gene locus_tag LOCUS_16760 239336 240013 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971514.1 protein_id gnl|my_center|LOCUS_16760 240846 240145 gene locus_tag LOCUS_16770 240846 240145 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977603.1 protein_id gnl|my_center|LOCUS_16770 242075 240816 gene locus_tag LOCUS_16780 242075 240816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026864.1 protein_id gnl|my_center|LOCUS_16780 243130 242108 gene locus_tag LOCUS_16790 243130 242108 CDS product beta-ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_078864641.1 protein_id gnl|my_center|LOCUS_16790 243363 243127 gene locus_tag LOCUS_16800 243363 243127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 243799 244965 gene locus_tag LOCUS_16810 243799 244965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 244962 245732 gene locus_tag LOCUS_16820 244962 245732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 245732 246991 gene locus_tag LOCUS_16830 245732 246991 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081274.1 protein_id gnl|my_center|LOCUS_16830 246995 248164 gene locus_tag LOCUS_16840 gene wecB 246995 248164 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871027.1 protein_id gnl|my_center|LOCUS_16840 248216 249061 gene locus_tag LOCUS_16850 248216 249061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 249033 250577 gene locus_tag LOCUS_16860 249033 250577 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086845897.1 protein_id gnl|my_center|LOCUS_16860 250583 251686 gene locus_tag LOCUS_16870 250583 251686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 251683 252486 gene locus_tag LOCUS_16880 251683 252486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 252530 253204 gene locus_tag LOCUS_16890 252530 253204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878513.1 protein_id gnl|my_center|LOCUS_16890 254111 253212 gene locus_tag LOCUS_16900 254111 253212 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061716.1 protein_id gnl|my_center|LOCUS_16900 256147 254108 gene locus_tag LOCUS_16910 256147 254108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 256273 256944 gene locus_tag LOCUS_16920 256273 256944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 258008 256962 gene locus_tag LOCUS_16930 258008 256962 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061727.1 protein_id gnl|my_center|LOCUS_16930 261624 258022 gene locus_tag LOCUS_16940 261624 258022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 262847 261729 gene locus_tag LOCUS_16950 262847 261729 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061731.1 protein_id gnl|my_center|LOCUS_16950 263542 262844 gene locus_tag LOCUS_16960 263542 262844 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256835.1 protein_id gnl|my_center|LOCUS_16960 264681 263539 gene locus_tag LOCUS_16970 264681 263539 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061734.1 protein_id gnl|my_center|LOCUS_16970 265652 264678 gene locus_tag LOCUS_16980 265652 264678 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061733.1 protein_id gnl|my_center|LOCUS_16980 266776 265703 gene locus_tag LOCUS_16990 266776 265703 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061730.1 protein_id gnl|my_center|LOCUS_16990 268227 266776 gene locus_tag LOCUS_17000 268227 266776 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467238.1 protein_id gnl|my_center|LOCUS_17000 268571 269407 gene locus_tag LOCUS_17010 268571 269407 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043607342.1 protein_id gnl|my_center|LOCUS_17010 269435 270712 gene locus_tag LOCUS_17020 269435 270712 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223772.1 protein_id gnl|my_center|LOCUS_17020 270742 271764 gene locus_tag LOCUS_17030 270742 271764 CDS product PD40 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227740.1 protein_id gnl|my_center|LOCUS_17030 273194 271887 gene locus_tag LOCUS_17040 273194 271887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 274628 273279 gene locus_tag LOCUS_17050 274628 273279 CDS product glycoside-pentoside-hexuronide family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703825.1 protein_id gnl|my_center|LOCUS_17050 276183 274912 gene locus_tag LOCUS_17060 276183 274912 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225823.1 protein_id gnl|my_center|LOCUS_17060 276319 277386 gene locus_tag LOCUS_17070 276319 277386 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097689.1 protein_id gnl|my_center|LOCUS_17070 277383 278303 gene locus_tag LOCUS_17080 277383 278303 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615746.1 protein_id gnl|my_center|LOCUS_17080 278326 279825 gene locus_tag LOCUS_17090 278326 279825 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227212.1 protein_id gnl|my_center|LOCUS_17090 280588 279842 gene locus_tag LOCUS_17100 280588 279842 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325987.1 protein_id gnl|my_center|LOCUS_17100 281998 280670 gene locus_tag LOCUS_17110 gene mrx(A) 281998 280670 CDS product macrolide resistance MFS transporter Mrx(A) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004159.1 protein_id gnl|my_center|LOCUS_17110 282312 281995 gene locus_tag LOCUS_17120 282312 281995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 282522 283364 gene locus_tag LOCUS_17130 282522 283364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 283724 283930 gene locus_tag LOCUS_17140 283724 283930 CDS product MbtH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975599.1 protein_id gnl|my_center|LOCUS_17140 283930 284097 gene locus_tag LOCUS_17150 283930 284097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 285174 284401 gene locus_tag LOCUS_17160 285174 284401 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977171.1 protein_id gnl|my_center|LOCUS_17160 286060 285308 gene locus_tag LOCUS_17170 286060 285308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 288190 286217 gene locus_tag LOCUS_17180 288190 286217 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230344.1 protein_id gnl|my_center|LOCUS_17180 289258 288245 gene locus_tag LOCUS_17190 gene tgmB 289258 288245 CDS product ATP-grasp ribosomal peptide maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028637.1 protein_id gnl|my_center|LOCUS_17190 289700 289428 gene locus_tag LOCUS_17200 289700 289428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 291271 290114 gene locus_tag LOCUS_17210 291271 290114 CDS product YcaO-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898850.1 protein_id gnl|my_center|LOCUS_17210 292587 291268 gene locus_tag LOCUS_17220 292587 291268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 294020 293379 gene locus_tag LOCUS_17230 294020 293379 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000416612.1 protein_id gnl|my_center|LOCUS_17230 295501 294017 gene locus_tag LOCUS_17240 295501 294017 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879446.1 protein_id gnl|my_center|LOCUS_17240 295864 296031 gene locus_tag LOCUS_17250 295864 296031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 296206 296565 gene locus_tag LOCUS_17260 296206 296565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 299282 297105 gene locus_tag LOCUS_17270 299282 297105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 300938 299553 gene locus_tag LOCUS_17280 300938 299553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 302917 301091 gene locus_tag LOCUS_17290 302917 301091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 303710 302919 gene locus_tag LOCUS_17300 303710 302919 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972638.1 protein_id gnl|my_center|LOCUS_17300 303974 306010 gene locus_tag LOCUS_17310 303974 306010 CDS product fatty acyl-AMP ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928895.1 protein_id gnl|my_center|LOCUS_17310 306013 312039 gene locus_tag LOCUS_17320 306013 312039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 312040 313818 gene locus_tag LOCUS_17330 312040 313818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 313936 314919 gene locus_tag LOCUS_17340 313936 314919 CDS product beta-ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_078864641.1 protein_id gnl|my_center|LOCUS_17340 314936 315172 gene locus_tag LOCUS_17350 314936 315172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 315682 315840 gene locus_tag LOCUS_17360 315682 315840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 316883 316020 gene locus_tag LOCUS_17370 316883 316020 CDS product lasso peptide biosynthesis B2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228687.1 protein_id gnl|my_center|LOCUS_17370 318775 316880 gene locus_tag LOCUS_17380 318775 316880 CDS product lasso peptide isopeptide bond-forming cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228688.1 protein_id gnl|my_center|LOCUS_17380 318984 318784 gene locus_tag LOCUS_17390 318984 318784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 320558 319356 gene locus_tag LOCUS_17400 320558 319356 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228689.1 protein_id gnl|my_center|LOCUS_17400 320932 322920 gene locus_tag LOCUS_17410 320932 322920 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230344.1 protein_id gnl|my_center|LOCUS_17410 323933 322962 gene locus_tag LOCUS_17420 323933 322962 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027140.1 protein_id gnl|my_center|LOCUS_17420 324027 324524 gene locus_tag LOCUS_17430 324027 324524 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027141.1 protein_id gnl|my_center|LOCUS_17430 324585 325835 gene locus_tag LOCUS_17440 324585 325835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 326891 325872 gene locus_tag LOCUS_17450 326891 325872 CDS product NADPH:quinone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226304.1 protein_id gnl|my_center|LOCUS_17450 327918 327025 gene locus_tag LOCUS_17460 327918 327025 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027108.1 protein_id gnl|my_center|LOCUS_17460 328535 327915 gene locus_tag LOCUS_17470 328535 327915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 330083 328635 gene locus_tag LOCUS_17480 gene rox 330083 328635 CDS product rifampin monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877344.1 protein_id gnl|my_center|LOCUS_17480 330314 331111 gene locus_tag LOCUS_17490 330314 331111 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978600.1 protein_id gnl|my_center|LOCUS_17490 331304 331816 gene locus_tag LOCUS_17500 331304 331816 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971620.1 protein_id gnl|my_center|LOCUS_17500 331909 334224 gene locus_tag LOCUS_17510 331909 334224 CDS product FdhF/YdeP family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028088.1 protein_id gnl|my_center|LOCUS_17510 334407 335282 gene locus_tag LOCUS_17520 334407 335282 CDS product endo alpha-1,4 polygalactosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027189.1 protein_id gnl|my_center|LOCUS_17520 336352 335387 gene locus_tag LOCUS_17530 336352 335387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 337606 336446 gene locus_tag LOCUS_17540 337606 336446 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973365.1 protein_id gnl|my_center|LOCUS_17540 338489 339757 gene locus_tag LOCUS_17550 338489 339757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 340457 339861 gene locus_tag LOCUS_17560 340457 339861 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224876.1 protein_id gnl|my_center|LOCUS_17560 340568 341404 gene locus_tag LOCUS_17570 340568 341404 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227678.1 protein_id gnl|my_center|LOCUS_17570 342373 341444 gene locus_tag LOCUS_17580 342373 341444 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030816.1 protein_id gnl|my_center|LOCUS_17580 342501 343499 gene locus_tag LOCUS_17590 342501 343499 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030815.1 protein_id gnl|my_center|LOCUS_17590 343496 344458 gene locus_tag LOCUS_17600 343496 344458 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030814.1 protein_id gnl|my_center|LOCUS_17600 344483 345613 gene locus_tag LOCUS_17610 344483 345613 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030813.1 protein_id gnl|my_center|LOCUS_17610 345610 346608 gene locus_tag LOCUS_17620 345610 346608 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487479.1 protein_id gnl|my_center|LOCUS_17620 346613 347545 gene locus_tag LOCUS_17630 346613 347545 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030811.1 protein_id gnl|my_center|LOCUS_17630 347627 348598 gene locus_tag LOCUS_17640 347627 348598 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030810.1 protein_id gnl|my_center|LOCUS_17640 348595 349347 gene locus_tag LOCUS_17650 348595 349347 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093950626.1 protein_id gnl|my_center|LOCUS_17650 349344 350147 gene locus_tag LOCUS_17660 349344 350147 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257740.1 protein_id gnl|my_center|LOCUS_17660 350144 350926 gene locus_tag LOCUS_17670 350144 350926 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031119.1 protein_id gnl|my_center|LOCUS_17670 350926 351558 gene locus_tag LOCUS_17680 350926 351558 CDS product CoA transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031118.1 protein_id gnl|my_center|LOCUS_17680 352542 351625 gene locus_tag LOCUS_17690 352542 351625 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031765.1 protein_id gnl|my_center|LOCUS_17690 352640 353206 gene locus_tag LOCUS_17700 352640 353206 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729092.1 protein_id gnl|my_center|LOCUS_17700 354850 353297 gene locus_tag LOCUS_17710 354850 353297 CDS product polysaccharide lyase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975979.1 protein_id gnl|my_center|LOCUS_17710 357830 355293 gene locus_tag LOCUS_17720 357830 355293 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029212.1 protein_id gnl|my_center|LOCUS_17720 358699 357947 gene locus_tag LOCUS_17730 358699 357947 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029211.1 protein_id gnl|my_center|LOCUS_17730 358932 358696 gene locus_tag LOCUS_17740 358932 358696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029210.1 protein_id gnl|my_center|LOCUS_17740 359115 360389 gene locus_tag LOCUS_17750 359115 360389 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029209.1 protein_id gnl|my_center|LOCUS_17750 360377 361036 gene locus_tag LOCUS_17760 360377 361036 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030189071.1 protein_id gnl|my_center|LOCUS_17760 361110 361040 gene locus_tag LOCUS_t00430 361110 361040 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 361979 361203 gene locus_tag LOCUS_17770 361979 361203 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225424.1 protein_id gnl|my_center|LOCUS_17770 362212 361976 gene locus_tag LOCUS_17780 362212 361976 CDS product 4-oxalocrotonate tautomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974281.1 protein_id gnl|my_center|LOCUS_17780 362339 363187 gene locus_tag LOCUS_17790 362339 363187 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029811.1 protein_id gnl|my_center|LOCUS_17790 363226 364368 gene locus_tag LOCUS_17800 363226 364368 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978350.1 protein_id gnl|my_center|LOCUS_17800 364623 364393 gene locus_tag LOCUS_17810 364623 364393 CDS product DUF2945 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978014.1 protein_id gnl|my_center|LOCUS_17810 365919 364711 gene locus_tag LOCUS_17820 365919 364711 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224092.1 protein_id gnl|my_center|LOCUS_17820 366723 366106 gene locus_tag LOCUS_17830 366723 366106 CDS product DUF998 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027098.1 protein_id gnl|my_center|LOCUS_17830 366886 367131 gene locus_tag LOCUS_17840 366886 367131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 368440 367148 gene locus_tag LOCUS_17850 368440 367148 CDS product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031716.1 protein_id gnl|my_center|LOCUS_17850 369820 368891 gene locus_tag LOCUS_17860 369820 368891 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804410.1 protein_id gnl|my_center|LOCUS_17860 371463 369904 gene locus_tag LOCUS_17870 371463 369904 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727782.1 protein_id gnl|my_center|LOCUS_17870 371740 372324 gene locus_tag LOCUS_17880 371740 372324 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031718.1 protein_id gnl|my_center|LOCUS_17880 372347 372931 gene locus_tag LOCUS_17890 372347 372931 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031717.1 protein_id gnl|my_center|LOCUS_17890 373232 372990 gene locus_tag LOCUS_17900 373232 372990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027204.1 protein_id gnl|my_center|LOCUS_17900 373380 373709 gene locus_tag LOCUS_17910 gene mhuD 373380 373709 CDS product mycobilin-forming heme oxygenase MhuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419501.1 protein_id gnl|my_center|LOCUS_17910 374481 373825 gene locus_tag LOCUS_17920 374481 373825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972873.1 protein_id gnl|my_center|LOCUS_17920 375359 374478 gene locus_tag LOCUS_17930 375359 374478 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222000.1 protein_id gnl|my_center|LOCUS_17930 376021 375635 gene locus_tag LOCUS_17940 376021 375635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 375956 376765 gene locus_tag LOCUS_17950 375956 376765 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028430.1 protein_id gnl|my_center|LOCUS_17950 377672 376791 gene locus_tag LOCUS_17960 377672 376791 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031087.1 protein_id gnl|my_center|LOCUS_17960 377802 378398 gene locus_tag LOCUS_17970 377802 378398 CDS product non-oxidative hydroxyarylic acid decarboxylases subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098488.1 protein_id gnl|my_center|LOCUS_17970 378463 379887 gene locus_tag LOCUS_17980 378463 379887 CDS product non-oxidative hydroxyarylic acid decarboxylases subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369995.1 protein_id gnl|my_center|LOCUS_17980 379918 380163 gene locus_tag LOCUS_17990 379918 380163 CDS product non-oxidative hydroxyarylic acid decarboxylases subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098486.1 protein_id gnl|my_center|LOCUS_17990 381159 380179 gene locus_tag LOCUS_18000 381159 380179 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168715389.1 protein_id gnl|my_center|LOCUS_18000 381532 382470 gene locus_tag LOCUS_18010 381532 382470 CDS product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031711.1 protein_id gnl|my_center|LOCUS_18010 383652 382486 gene locus_tag LOCUS_18020 383652 382486 CDS product alanine--tRNA ligase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031771.1 protein_id gnl|my_center|LOCUS_18020 384180 383977 gene locus_tag LOCUS_18030 384180 383977 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978336.1 protein_id gnl|my_center|LOCUS_18030 385332 384364 gene locus_tag LOCUS_18040 385332 384364 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027374.1 protein_id gnl|my_center|LOCUS_18040 385561 385343 gene locus_tag LOCUS_18050 385561 385343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 385848 385576 gene locus_tag LOCUS_18060 385848 385576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 386948 385944 gene locus_tag LOCUS_18070 386948 385944 CDS product MASE1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027126.1 protein_id gnl|my_center|LOCUS_18070 387837 387001 gene locus_tag LOCUS_18080 387837 387001 CDS product PP2C family protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978415.1 protein_id gnl|my_center|LOCUS_18080 388371 387922 gene locus_tag LOCUS_18090 388371 387922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106517563.1 protein_id gnl|my_center|LOCUS_18090 388923 389798 gene locus_tag LOCUS_18100 388923 389798 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971565.1 protein_id gnl|my_center|LOCUS_18100 389889 390704 gene locus_tag LOCUS_18110 389889 390704 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031761.1 protein_id gnl|my_center|LOCUS_18110 391584 390727 gene locus_tag LOCUS_18120 391584 390727 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731143.1 protein_id gnl|my_center|LOCUS_18120 391861 392700 gene locus_tag LOCUS_18130 391861 392700 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031095.1 protein_id gnl|my_center|LOCUS_18130 392840 394690 gene locus_tag LOCUS_18140 392840 394690 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031789.1 protein_id gnl|my_center|LOCUS_18140 394815 395108 gene locus_tag LOCUS_18150 394815 395108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 395168 396058 gene locus_tag LOCUS_18160 395168 396058 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031688.1 protein_id gnl|my_center|LOCUS_18160 396590 396087 gene locus_tag LOCUS_18170 396590 396087 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971698.1 protein_id gnl|my_center|LOCUS_18170 396935 398551 gene locus_tag LOCUS_18180 396935 398551 CDS product cellulase family glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027200.1 protein_id gnl|my_center|LOCUS_18180 398694 399572 gene locus_tag LOCUS_18190 398694 399572 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036279.1 protein_id gnl|my_center|LOCUS_18190 399588 400247 gene locus_tag LOCUS_18200 399588 400247 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522757.1 protein_id gnl|my_center|LOCUS_18200 400260 401033 gene locus_tag LOCUS_18210 400260 401033 CDS product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978258.1 protein_id gnl|my_center|LOCUS_18210 401050 401856 gene locus_tag LOCUS_18220 401050 401856 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222729.1 protein_id gnl|my_center|LOCUS_18220 403330 401840 gene locus_tag LOCUS_18230 gene nanT 403330 401840 CDS product sialic acid transporter NanT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000108474.1 protein_id gnl|my_center|LOCUS_18230 404311 403382 gene locus_tag LOCUS_18240 404311 403382 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804461.1 protein_id gnl|my_center|LOCUS_18240 405298 404456 gene locus_tag LOCUS_18250 405298 404456 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229514.1 protein_id gnl|my_center|LOCUS_18250 405720 405295 gene locus_tag LOCUS_18260 405720 405295 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229515.1 protein_id gnl|my_center|LOCUS_18260 405827 406408 gene locus_tag LOCUS_18270 405827 406408 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226699.1 protein_id gnl|my_center|LOCUS_18270 406527 407405 gene locus_tag LOCUS_18280 406527 407405 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259194.1 protein_id gnl|my_center|LOCUS_18280 408049 407489 gene locus_tag LOCUS_18290 408049 407489 CDS product snapalysin family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971509.1 protein_id gnl|my_center|LOCUS_18290 408807 408256 gene locus_tag LOCUS_18300 408807 408256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 408761 409030 gene locus_tag LOCUS_18310 408761 409030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 409488 409117 gene locus_tag LOCUS_18320 gene rpfE 409488 409117 CDS product resuscitation-promoting factor protein RpfE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971684.1 protein_id gnl|my_center|LOCUS_18320 409707 410474 gene locus_tag LOCUS_18330 409707 410474 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173943926.1 protein_id gnl|my_center|LOCUS_18330 410542 411729 gene locus_tag LOCUS_18340 410542 411729 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479765.1 protein_id gnl|my_center|LOCUS_18340 412621 411752 gene locus_tag LOCUS_18350 412621 411752 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868402.1 protein_id gnl|my_center|LOCUS_18350 414613 412973 gene locus_tag LOCUS_18360 gene pgm 414613 412973 CDS product phosphoglucomutase (alpha-D-glucose-1,6-bisphosphate-dependent) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971701.1 protein_id gnl|my_center|LOCUS_18360 415253 414780 gene locus_tag LOCUS_18370 415253 414780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485933.1 protein_id gnl|my_center|LOCUS_18370 415428 416132 gene locus_tag LOCUS_18380 415428 416132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 416865 416158 gene locus_tag LOCUS_18390 416865 416158 CDS product adenosylcobinamide amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031658.1 protein_id gnl|my_center|LOCUS_18390 416969 417292 gene locus_tag LOCUS_18400 416969 417292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 417412 418158 gene locus_tag LOCUS_18410 417412 418158 CDS product DUF5131 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899455.1 protein_id gnl|my_center|LOCUS_18410 419364 418183 gene locus_tag LOCUS_18420 419364 418183 CDS product three-Cys-motif partner protein TcmP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113887.1 protein_id gnl|my_center|LOCUS_18420 420539 419850 gene locus_tag LOCUS_18430 420539 419850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_18430 421104 421580 gene locus_tag LOCUS_18440 421104 421580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 421663 423249 gene locus_tag LOCUS_18450 421663 423249 CDS product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122985.1 protein_id gnl|my_center|LOCUS_18450 424090 423230 gene locus_tag LOCUS_18460 424090 423230 CDS product carbon-nitrogen family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940707.1 protein_id gnl|my_center|LOCUS_18460 426199 425228 gene locus_tag LOCUS_18470 426199 425228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18470 426424 427278 gene locus_tag LOCUS_18480 426424 427278 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031676.1 protein_id gnl|my_center|LOCUS_18480 428521 427319 gene locus_tag LOCUS_18490 428521 427319 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971715.1 protein_id gnl|my_center|LOCUS_18490 429039 428593 gene locus_tag LOCUS_18500 gene nsrR 429039 428593 CDS product nitric oxide-sensing transcriptional repressor NsrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031657.1 protein_id gnl|my_center|LOCUS_18500 429157 429594 gene locus_tag LOCUS_18510 429157 429594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031656.1 protein_id gnl|my_center|LOCUS_18510 430828 429629 gene locus_tag LOCUS_18520 430828 429629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 433139 430914 gene locus_tag LOCUS_18530 433139 430914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 433427 433272 gene locus_tag LOCUS_18540 433427 433272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 433812 434924 gene locus_tag LOCUS_18550 433812 434924 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028459.1 protein_id gnl|my_center|LOCUS_18550 435028 435855 gene locus_tag LOCUS_18560 435028 435855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031647.1 protein_id gnl|my_center|LOCUS_18560 435998 436789 gene locus_tag LOCUS_18570 435998 436789 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971739.1 protein_id gnl|my_center|LOCUS_18570 437006 436830 gene locus_tag LOCUS_18580 437006 436830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971740.1 protein_id gnl|my_center|LOCUS_18580 437160 438326 gene locus_tag LOCUS_18590 437160 438326 CDS product spore photoproduct lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971741.1 protein_id gnl|my_center|LOCUS_18590 438411 438962 gene locus_tag LOCUS_18600 438411 438962 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031637.1 protein_id gnl|my_center|LOCUS_18600 439120 439914 gene locus_tag LOCUS_18610 gene cdtA 439120 439914 CDS product siderophore ABC transporter ATP-binding protein CdtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971743.1 protein_id gnl|my_center|LOCUS_18610 439911 440894 gene locus_tag LOCUS_18620 gene cdtB 439911 440894 CDS product siderophore ABC transporter substrate-binding protein CdtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971744.1 protein_id gnl|my_center|LOCUS_18620 440902 442971 gene locus_tag LOCUS_18630 gene cdtC 440902 442971 CDS product siderophore ABC transporter permease CdtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031636.1 protein_id gnl|my_center|LOCUS_18630 443107 444435 gene locus_tag LOCUS_18640 443107 444435 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031634.1 protein_id gnl|my_center|LOCUS_18640 445299 444448 gene locus_tag LOCUS_18650 445299 444448 CDS product RNA polymerase sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978261.1 protein_id gnl|my_center|LOCUS_18650 445495 446535 gene locus_tag LOCUS_18660 445495 446535 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971643.1 protein_id gnl|my_center|LOCUS_18660 446732 448270 gene locus_tag LOCUS_18670 gene proP 446732 448270 CDS product glycine betaine/L-proline transporter ProP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046247708.1 protein_id gnl|my_center|LOCUS_18670 449169 448234 gene locus_tag LOCUS_18680 449169 448234 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031632.1 protein_id gnl|my_center|LOCUS_18680 449727 449248 gene locus_tag LOCUS_18690 449727 449248 CDS product MSMEG_6728 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971750.1 protein_id gnl|my_center|LOCUS_18690 450746 449745 gene locus_tag LOCUS_18700 450746 449745 CDS product DUF5914 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026912.1 protein_id gnl|my_center|LOCUS_18700 451710 450736 gene locus_tag LOCUS_18710 451710 450736 CDS product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026911.1 protein_id gnl|my_center|LOCUS_18710 453203 451707 gene locus_tag LOCUS_18720 gene crtI 453203 451707 CDS product phytoene desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026910.1 protein_id gnl|my_center|LOCUS_18720 453459 454646 gene locus_tag LOCUS_18730 453459 454646 CDS product lycopene cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026915.1 protein_id gnl|my_center|LOCUS_18730 454663 456264 gene locus_tag LOCUS_18740 454663 456264 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225919.1 protein_id gnl|my_center|LOCUS_18740 457144 456269 gene locus_tag LOCUS_18750 457144 456269 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971753.1 protein_id gnl|my_center|LOCUS_18750 458783 457155 gene locus_tag LOCUS_18760 458783 457155 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031630.1 protein_id gnl|my_center|LOCUS_18760 459213 458776 gene locus_tag LOCUS_18770 459213 458776 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031629.1 protein_id gnl|my_center|LOCUS_18770 459662 460561 gene locus_tag LOCUS_18780 459662 460561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 460734 461882 gene locus_tag LOCUS_18790 460734 461882 CDS product S1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031628.1 protein_id gnl|my_center|LOCUS_18790 462436 462005 gene locus_tag LOCUS_18800 462436 462005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 463815 462565 gene locus_tag LOCUS_18810 463815 462565 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031626.1 protein_id gnl|my_center|LOCUS_18810 465327 464287 gene locus_tag LOCUS_18820 465327 464287 CDS product family 2 encapsulin nanocompartment cargo protein polyprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_134732678.1 protein_id gnl|my_center|LOCUS_18820 465926 465732 gene locus_tag LOCUS_18830 465926 465732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029392867.1 protein_id gnl|my_center|LOCUS_18830 467417 466146 gene locus_tag LOCUS_18840 gene cypC 467417 466146 CDS product fatty-acid peroxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246284.1 protein_id gnl|my_center|LOCUS_18840 467880 467479 gene locus_tag LOCUS_18850 467880 467479 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971761.1 protein_id gnl|my_center|LOCUS_18850 468052 469233 gene locus_tag LOCUS_18860 468052 469233 CDS product PP2C family protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031624.1 protein_id gnl|my_center|LOCUS_18860 469551 469252 gene locus_tag LOCUS_18870 469551 469252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031623.1 protein_id gnl|my_center|LOCUS_18870 469683 470366 gene locus_tag LOCUS_18880 469683 470366 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031622.1 protein_id gnl|my_center|LOCUS_18880 470363 470638 gene locus_tag LOCUS_18890 470363 470638 CDS product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971765.1 protein_id gnl|my_center|LOCUS_18890 470641 471366 gene locus_tag LOCUS_18900 470641 471366 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031621.1 protein_id gnl|my_center|LOCUS_18900 472014 471382 gene locus_tag LOCUS_18910 472014 471382 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971767.1 protein_id gnl|my_center|LOCUS_18910 472247 472780 gene locus_tag LOCUS_18920 472247 472780 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031617.1 protein_id gnl|my_center|LOCUS_18920 474197 472824 gene locus_tag LOCUS_18930 474197 472824 CDS product trehalase family glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031701.1 protein_id gnl|my_center|LOCUS_18930 474560 475123 gene locus_tag LOCUS_18940 474560 475123 CDS product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971771.1 protein_id gnl|my_center|LOCUS_18940 476206 475247 gene locus_tag LOCUS_18950 476206 475247 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030719.1 protein_id gnl|my_center|LOCUS_18950 477219 476203 gene locus_tag LOCUS_18960 477219 476203 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031616.1 protein_id gnl|my_center|LOCUS_18960 477858 477355 gene locus_tag LOCUS_18970 477858 477355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485905.1 protein_id gnl|my_center|LOCUS_18970 478192 479436 gene locus_tag LOCUS_18980 478192 479436 CDS product arsenic transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031613.1 protein_id gnl|my_center|LOCUS_18980 479832 479509 gene locus_tag LOCUS_18990 479832 479509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971778.1 protein_id gnl|my_center|LOCUS_18990 479940 480284 gene locus_tag LOCUS_19000 479940 480284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 480250 480600 gene locus_tag LOCUS_19010 480250 480600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 481064 480864 gene locus_tag LOCUS_19020 481064 480864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 482174 481662 gene locus_tag LOCUS_19030 482174 481662 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107559.1 protein_id gnl|my_center|LOCUS_19030 482522 482265 gene locus_tag LOCUS_19040 482522 482265 CDS product MbtH family NRPS accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226625.1 protein_id gnl|my_center|LOCUS_19040 502500 482572 gene locus_tag LOCUS_19050 502500 482572 CDS product non-ribosomal peptide synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224968.1 protein_id gnl|my_center|LOCUS_19050 521425 502514 gene locus_tag LOCUS_19060 521425 502514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 522963 521608 gene locus_tag LOCUS_19070 522963 521608 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191314712.1 protein_id gnl|my_center|LOCUS_19070 524175 523051 gene locus_tag LOCUS_19080 524175 523051 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224970.1 protein_id gnl|my_center|LOCUS_19080 525982 525410 gene locus_tag LOCUS_19090 525982 525410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 526416 525991 gene locus_tag LOCUS_19100 526416 525991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 526955 527095 gene locus_tag LOCUS_19110 526955 527095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 528755 527097 gene locus_tag LOCUS_19120 528755 527097 CDS product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731142.1 protein_id gnl|my_center|LOCUS_19120 529311 529078 gene locus_tag LOCUS_19130 529311 529078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228349.1 protein_id gnl|my_center|LOCUS_19130 529515 530180 gene locus_tag LOCUS_19140 529515 530180 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971779.1 protein_id gnl|my_center|LOCUS_19140 530188 530964 gene locus_tag LOCUS_19150 530188 530964 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971780.1 protein_id gnl|my_center|LOCUS_19150 531002 532042 gene locus_tag LOCUS_19160 531002 532042 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031610.1 protein_id gnl|my_center|LOCUS_19160 532158 532778 gene locus_tag LOCUS_19170 532158 532778 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016328048.1 protein_id gnl|my_center|LOCUS_19170 532893 533648 gene locus_tag LOCUS_19180 532893 533648 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971784.1 protein_id gnl|my_center|LOCUS_19180 533787 534620 gene locus_tag LOCUS_19190 533787 534620 CDS product MHYT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028070.1 protein_id gnl|my_center|LOCUS_19190 535602 534637 gene locus_tag LOCUS_19200 535602 534637 CDS product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031608.1 protein_id gnl|my_center|LOCUS_19200 535776 536609 gene locus_tag LOCUS_19210 535776 536609 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971787.1 protein_id gnl|my_center|LOCUS_19210 539076 536626 gene locus_tag LOCUS_19220 539076 536626 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162495298.1 protein_id gnl|my_center|LOCUS_19220 539366 540346 gene locus_tag LOCUS_19230 539366 540346 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971796.1 protein_id gnl|my_center|LOCUS_19230 539883 539794 gene locus_tag LOCUS_t00440 539883 539794 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 540478 541254 gene locus_tag LOCUS_19240 540478 541254 CDS product NPP1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031599.1 protein_id gnl|my_center|LOCUS_19240 541279 542214 gene locus_tag LOCUS_19250 gene hemC 541279 542214 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971798.1 protein_id gnl|my_center|LOCUS_19250 542745 542224 gene locus_tag LOCUS_19260 542745 542224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971799.1 protein_id gnl|my_center|LOCUS_19260 543056 543850 gene locus_tag LOCUS_19270 543056 543850 CDS product SigB/SigF/SigG family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031598.1 protein_id gnl|my_center|LOCUS_19270 544288 543896 gene locus_tag LOCUS_19280 544288 543896 CDS product ANTAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168715530.1 protein_id gnl|my_center|LOCUS_19280 544442 545245 gene locus_tag LOCUS_19290 544442 545245 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868693.1 protein_id gnl|my_center|LOCUS_19290 547413 545257 gene locus_tag LOCUS_19300 gene glgX 547413 545257 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971803.1 protein_id gnl|my_center|LOCUS_19300 547925 547410 gene locus_tag LOCUS_19310 547925 547410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971804.1 protein_id gnl|my_center|LOCUS_19310 548195 548635 gene locus_tag LOCUS_19320 548195 548635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 >Feature sequence04 <1 1108 gene locus_tag LOCUS_19330 <1 1108 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_051754043.1:polymorphic toxin-type HINT domain-containing protein 1141 1749 gene locus_tag LOCUS_19340 1141 1749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 1835 2812 gene locus_tag LOCUS_19350 1835 2812 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031568.1 protein_id gnl|my_center|LOCUS_19350 4028 2823 gene locus_tag LOCUS_19360 4028 2823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 4158 5132 gene locus_tag LOCUS_19370 4158 5132 CDS product iron-siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973253.1 protein_id gnl|my_center|LOCUS_19370 5129 6310 gene locus_tag LOCUS_19380 5129 6310 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180970221.1 protein_id gnl|my_center|LOCUS_19380 6307 7314 gene locus_tag LOCUS_19390 6307 7314 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180970221.1 protein_id gnl|my_center|LOCUS_19390 7334 8158 gene locus_tag LOCUS_19400 7334 8158 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243882.1 protein_id gnl|my_center|LOCUS_19400 8155 8346 gene locus_tag LOCUS_19410 8155 8346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 8447 9286 gene locus_tag LOCUS_19420 8447 9286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 9283 10761 gene locus_tag LOCUS_19430 9283 10761 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226611.1 protein_id gnl|my_center|LOCUS_19430 10758 12137 gene locus_tag LOCUS_19440 10758 12137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19440 12155 13426 gene locus_tag LOCUS_19450 12155 13426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 13526 15265 gene locus_tag LOCUS_19460 13526 15265 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141300.1 protein_id gnl|my_center|LOCUS_19460 15262 17004 gene locus_tag LOCUS_19470 15262 17004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 17158 18189 gene locus_tag LOCUS_19480 17158 18189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 18194 20833 gene locus_tag LOCUS_19490 18194 20833 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027192.1 protein_id gnl|my_center|LOCUS_19490 22024 20864 gene locus_tag LOCUS_19500 22024 20864 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091304720.1 protein_id gnl|my_center|LOCUS_19500 22097 22657 gene locus_tag LOCUS_19510 22097 22657 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143060529.1 protein_id gnl|my_center|LOCUS_19510 23178 22654 gene locus_tag LOCUS_19520 23178 22654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 23720 23187 gene locus_tag LOCUS_19530 23720 23187 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974945.1 protein_id gnl|my_center|LOCUS_19530 23872 24573 gene locus_tag LOCUS_19540 23872 24573 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029386.1 protein_id gnl|my_center|LOCUS_19540 25045 24584 gene locus_tag LOCUS_19550 25045 24584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 25087 25815 gene locus_tag LOCUS_19560 25087 25815 CDS product TioE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230388.1 protein_id gnl|my_center|LOCUS_19560 26864 25812 gene locus_tag LOCUS_19570 26864 25812 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229667.1 protein_id gnl|my_center|LOCUS_19570 28315 26954 gene locus_tag LOCUS_19580 28315 26954 CDS product bifunctional o-acetylhomoserine/o-acetylserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229668.1 protein_id gnl|my_center|LOCUS_19580 29682 28663 gene locus_tag LOCUS_19590 29682 28663 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284494.1 protein_id gnl|my_center|LOCUS_19590 32872 29858 gene locus_tag LOCUS_19600 32872 29858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 33924 33019 gene locus_tag LOCUS_19610 33924 33019 CDS product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027127.1 protein_id gnl|my_center|LOCUS_19610 35133 33970 gene locus_tag LOCUS_19620 35133 33970 CDS product oxygenase MpaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978298.1 protein_id gnl|my_center|LOCUS_19620 36317 35265 gene locus_tag LOCUS_19630 36317 35265 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978297.1 protein_id gnl|my_center|LOCUS_19630 36594 36310 gene locus_tag LOCUS_19640 36594 36310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027208.1 protein_id gnl|my_center|LOCUS_19640 36833 37918 gene locus_tag LOCUS_19650 36833 37918 CDS product class I mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257709.1 protein_id gnl|my_center|LOCUS_19650 38132 37887 gene locus_tag LOCUS_19660 38132 37887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 38138 38803 gene locus_tag LOCUS_19670 38138 38803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 39998 38793 gene locus_tag LOCUS_19680 39998 38793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 40115 40273 gene locus_tag LOCUS_19690 40115 40273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 40283 40654 gene locus_tag LOCUS_19700 40283 40654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111477.1 protein_id gnl|my_center|LOCUS_19700 41217 40651 gene locus_tag LOCUS_19710 41217 40651 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031671.1 protein_id gnl|my_center|LOCUS_19710 42860 41244 gene locus_tag LOCUS_19720 42860 41244 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900733.1 protein_id gnl|my_center|LOCUS_19720 43771 42857 gene locus_tag LOCUS_19730 43771 42857 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538163.1 protein_id gnl|my_center|LOCUS_19730 44721 43768 gene locus_tag LOCUS_19740 44721 43768 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015119.1 protein_id gnl|my_center|LOCUS_19740 46380 44755 gene locus_tag LOCUS_19750 46380 44755 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538164.1 protein_id gnl|my_center|LOCUS_19750 46841 47326 gene locus_tag LOCUS_19760 46841 47326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 47933 49207 gene locus_tag LOCUS_19770 47933 49207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 49420 49932 gene locus_tag LOCUS_19780 49420 49932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 49944 50369 gene locus_tag LOCUS_19790 49944 50369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 50420 51604 gene locus_tag LOCUS_19800 50420 51604 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228619.1 protein_id gnl|my_center|LOCUS_19800 51628 53091 gene locus_tag LOCUS_19810 51628 53091 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189229593.1 protein_id gnl|my_center|LOCUS_19810 53122 53448 gene locus_tag LOCUS_19820 53122 53448 CDS product TcmI family type II polyketide cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227257.1 protein_id gnl|my_center|LOCUS_19820 53445 54725 gene locus_tag LOCUS_19830 53445 54725 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973891.1 protein_id gnl|my_center|LOCUS_19830 54722 55945 gene locus_tag LOCUS_19840 54722 55945 CDS product ketosynthase chain-length factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030048.1 protein_id gnl|my_center|LOCUS_19840 55960 56235 gene locus_tag LOCUS_19850 55960 56235 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973889.1 protein_id gnl|my_center|LOCUS_19850 56265 57047 gene locus_tag LOCUS_19860 56265 57047 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973892.1 protein_id gnl|my_center|LOCUS_19860 57083 58021 gene locus_tag LOCUS_19870 57083 58021 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030049.1 protein_id gnl|my_center|LOCUS_19870 58018 59970 gene locus_tag LOCUS_19880 58018 59970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 60007 60168 gene locus_tag LOCUS_19890 60007 60168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 60171 61187 gene locus_tag LOCUS_19900 60171 61187 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225667.1 protein_id gnl|my_center|LOCUS_19900 61180 62385 gene locus_tag LOCUS_19910 61180 62385 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227868.1 protein_id gnl|my_center|LOCUS_19910 62385 62996 gene locus_tag LOCUS_19920 62385 62996 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080770.1 protein_id gnl|my_center|LOCUS_19920 63032 63913 gene locus_tag LOCUS_19930 63032 63913 CDS product TIGR03621 family F420-dependent LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831427.1 protein_id gnl|my_center|LOCUS_19930 63910 64140 gene locus_tag LOCUS_19940 63910 64140 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228904.1 protein_id gnl|my_center|LOCUS_19940 64137 65363 gene locus_tag LOCUS_19950 64137 65363 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165781113.1 protein_id gnl|my_center|LOCUS_19950 65360 66556 gene locus_tag LOCUS_19960 65360 66556 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727175.1 protein_id gnl|my_center|LOCUS_19960 67009 66614 gene locus_tag LOCUS_19970 67009 66614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 68525 67044 gene locus_tag LOCUS_19980 68525 67044 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027644.1 protein_id gnl|my_center|LOCUS_19980 68678 69325 gene locus_tag LOCUS_19990 68678 69325 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024504795.1 protein_id gnl|my_center|LOCUS_19990 69450 70778 gene locus_tag LOCUS_20000 69450 70778 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027167.1 protein_id gnl|my_center|LOCUS_20000 72096 70852 gene locus_tag LOCUS_20010 72096 70852 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027428.1 protein_id gnl|my_center|LOCUS_20010 72222 73157 gene locus_tag LOCUS_20020 72222 73157 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971541.1 protein_id gnl|my_center|LOCUS_20020 74162 73206 gene locus_tag LOCUS_20030 74162 73206 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226531.1 protein_id gnl|my_center|LOCUS_20030 76791 74260 gene locus_tag LOCUS_20040 76791 74260 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104583.1 protein_id gnl|my_center|LOCUS_20040 78847 76970 gene locus_tag LOCUS_20050 gene phzE 78847 76970 CDS product phenazine biosynthesis protein PhzE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118954.1 protein_id gnl|my_center|LOCUS_20050 79530 78844 gene locus_tag LOCUS_20060 gene phzD 79530 78844 CDS product phenazine biosynthesis protein PhzD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093625.1 protein_id gnl|my_center|LOCUS_20060 80741 79569 gene locus_tag LOCUS_20070 gene phzC 80741 79569 CDS product phenazine biosynthesis protein PhzC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093621.1 protein_id gnl|my_center|LOCUS_20070 82006 80801 gene locus_tag LOCUS_20080 82006 80801 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229700.1 protein_id gnl|my_center|LOCUS_20080 82282 83625 gene locus_tag LOCUS_20090 82282 83625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 83610 84854 gene locus_tag LOCUS_20100 83610 84854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 85096 86322 gene locus_tag LOCUS_20110 85096 86322 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186009688.1 protein_id gnl|my_center|LOCUS_20110 86319 86993 gene locus_tag LOCUS_20120 86319 86993 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975186.1 protein_id gnl|my_center|LOCUS_20120 87117 87944 gene locus_tag LOCUS_20130 87117 87944 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975187.1 protein_id gnl|my_center|LOCUS_20130 87941 90469 gene locus_tag LOCUS_20140 87941 90469 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029213.1 protein_id gnl|my_center|LOCUS_20140 90544 91935 gene locus_tag LOCUS_20150 90544 91935 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973075.1 protein_id gnl|my_center|LOCUS_20150 91932 93119 gene locus_tag LOCUS_20160 91932 93119 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030555.1 protein_id gnl|my_center|LOCUS_20160 93163 93651 gene locus_tag LOCUS_20170 93163 93651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 93648 93998 gene locus_tag LOCUS_20180 93648 93998 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920067.1 protein_id gnl|my_center|LOCUS_20180 93995 94885 gene locus_tag LOCUS_20190 93995 94885 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228828.1 protein_id gnl|my_center|LOCUS_20190 94897 95754 gene locus_tag LOCUS_20200 94897 95754 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228829.1 protein_id gnl|my_center|LOCUS_20200 96956 95778 gene locus_tag LOCUS_20210 96956 95778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 97910 97101 gene locus_tag LOCUS_20220 97910 97101 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226458.1 protein_id gnl|my_center|LOCUS_20220 97979 98875 gene locus_tag LOCUS_20230 97979 98875 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031766.1 protein_id gnl|my_center|LOCUS_20230 99683 98958 gene locus_tag LOCUS_20240 99683 98958 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225350.1 protein_id gnl|my_center|LOCUS_20240 99934 100251 gene locus_tag LOCUS_20250 99934 100251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 100616 100281 gene locus_tag LOCUS_20260 100616 100281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 100516 100734 gene locus_tag LOCUS_20270 100516 100734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 100759 101130 gene locus_tag LOCUS_20280 100759 101130 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975243.1 protein_id gnl|my_center|LOCUS_20280 102029 101322 gene locus_tag LOCUS_20290 102029 101322 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971514.1 protein_id gnl|my_center|LOCUS_20290 102880 102044 gene locus_tag LOCUS_20300 102880 102044 CDS product aminoglycoside adenylyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029599.1 protein_id gnl|my_center|LOCUS_20300 103545 102877 gene locus_tag LOCUS_20310 103545 102877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 103694 103542 gene locus_tag LOCUS_20320 103694 103542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 104938 103799 gene locus_tag LOCUS_20330 104938 103799 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031785.1 protein_id gnl|my_center|LOCUS_20330 108192 104950 gene locus_tag LOCUS_20340 108192 104950 CDS product glycosyl hydrolase 115 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226354.1 protein_id gnl|my_center|LOCUS_20340 109565 108315 gene locus_tag LOCUS_20350 109565 108315 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191309483.1 protein_id gnl|my_center|LOCUS_20350 110935 110057 gene locus_tag LOCUS_20360 110935 110057 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729508.1 protein_id gnl|my_center|LOCUS_20360 111194 111934 gene locus_tag LOCUS_20370 111194 111934 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028520.1 protein_id gnl|my_center|LOCUS_20370 112399 111962 gene locus_tag LOCUS_20380 112399 111962 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226716.1 protein_id gnl|my_center|LOCUS_20380 112521 113411 gene locus_tag LOCUS_20390 112521 113411 CDS product aldo/keto reductase family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978567.1 protein_id gnl|my_center|LOCUS_20390 114015 113440 gene locus_tag LOCUS_20400 114015 113440 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977517.1 protein_id gnl|my_center|LOCUS_20400 114182 115018 gene locus_tag LOCUS_20410 114182 115018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 115151 116326 gene locus_tag LOCUS_20420 115151 116326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 117286 116411 gene locus_tag LOCUS_20430 117286 116411 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972431.1 protein_id gnl|my_center|LOCUS_20430 117993 117400 gene locus_tag LOCUS_20440 117993 117400 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027066.1 protein_id gnl|my_center|LOCUS_20440 118162 119748 gene locus_tag LOCUS_20450 118162 119748 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135359439.1 protein_id gnl|my_center|LOCUS_20450 120923 119745 gene locus_tag LOCUS_20460 120923 119745 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031604.1 protein_id gnl|my_center|LOCUS_20460 121026 121742 gene locus_tag LOCUS_20470 121026 121742 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486023.1 protein_id gnl|my_center|LOCUS_20470 123325 121817 gene locus_tag LOCUS_20480 123325 121817 CDS product carboxylesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030033.1 protein_id gnl|my_center|LOCUS_20480 124262 123348 gene locus_tag LOCUS_20490 124262 123348 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030032.1 protein_id gnl|my_center|LOCUS_20490 124444 127554 gene locus_tag LOCUS_20500 124444 127554 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487609.1 protein_id gnl|my_center|LOCUS_20500 128025 127579 gene locus_tag LOCUS_20510 128025 127579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978001.1 protein_id gnl|my_center|LOCUS_20510 128149 128589 gene locus_tag LOCUS_20520 128149 128589 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971523.1 protein_id gnl|my_center|LOCUS_20520 129212 128712 gene locus_tag LOCUS_20530 129212 128712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 129094 129474 gene locus_tag LOCUS_20540 129094 129474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 130554 129541 gene locus_tag LOCUS_20550 130554 129541 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971590.1 protein_id gnl|my_center|LOCUS_20550 130853 132157 gene locus_tag LOCUS_20560 130853 132157 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971589.1 protein_id gnl|my_center|LOCUS_20560 132246 133244 gene locus_tag LOCUS_20570 132246 133244 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971588.1 protein_id gnl|my_center|LOCUS_20570 133257 134183 gene locus_tag LOCUS_20580 133257 134183 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971587.1 protein_id gnl|my_center|LOCUS_20580 134278 135717 gene locus_tag LOCUS_20590 134278 135717 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031744.1 protein_id gnl|my_center|LOCUS_20590 135932 136369 gene locus_tag LOCUS_20600 135932 136369 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978004.1 protein_id gnl|my_center|LOCUS_20600 137332 136448 gene locus_tag LOCUS_20610 137332 136448 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153505920.1 protein_id gnl|my_center|LOCUS_20610 138660 137329 gene locus_tag LOCUS_20620 138660 137329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 139406 138657 gene locus_tag LOCUS_20630 139406 138657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 140877 139393 gene locus_tag LOCUS_20640 140877 139393 CDS product mannitol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730628.1 protein_id gnl|my_center|LOCUS_20640 141250 142710 gene locus_tag LOCUS_20650 141250 142710 CDS product ornithine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226148.1 protein_id gnl|my_center|LOCUS_20650 143269 142763 gene locus_tag LOCUS_20660 143269 142763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203084.1 protein_id gnl|my_center|LOCUS_20660 143850 145256 gene locus_tag LOCUS_20670 143850 145256 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031044.1 protein_id gnl|my_center|LOCUS_20670 145844 145323 gene locus_tag LOCUS_20680 145844 145323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 147188 146067 gene locus_tag LOCUS_20690 gene vanS-Sc 147188 146067 CDS product VanSc-type vancomycin resistance histidine kinase VanS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975349.1 protein_id gnl|my_center|LOCUS_20690 147314 148429 gene locus_tag LOCUS_20700 147314 148429 CDS product peptidoglycan bridge formation peptidyltransferase VanK-Sc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029108.1 protein_id gnl|my_center|LOCUS_20700 148636 149634 gene locus_tag LOCUS_20710 gene dhaK 148636 149634 CDS product dihydroxyacetone kinase subunit DhaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259135.1 protein_id gnl|my_center|LOCUS_20710 149701 150441 gene locus_tag LOCUS_20720 149701 150441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20720 151243 150476 gene locus_tag LOCUS_20730 151243 150476 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030825.1 protein_id gnl|my_center|LOCUS_20730 151761 152876 gene locus_tag LOCUS_20740 151761 152876 CDS product D-isomer specific 2-hydroxyacid dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230019.1 protein_id gnl|my_center|LOCUS_20740 152869 153909 gene locus_tag LOCUS_20750 gene vanA-Sc 152869 153909 CDS product D-alanine--(R)-lactate ligase VanA-Sc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029110.1 protein_id gnl|my_center|LOCUS_20750 153906 154532 gene locus_tag LOCUS_20760 gene vanX 153906 154532 CDS product D-Ala-D-Ala dipeptidase VanX-Sc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029111.1 protein_id gnl|my_center|LOCUS_20760 154772 156802 gene locus_tag LOCUS_20770 154772 156802 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027382.1 protein_id gnl|my_center|LOCUS_20770 156830 157276 gene locus_tag LOCUS_20780 156830 157276 CDS product DUF4383 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466936.1 protein_id gnl|my_center|LOCUS_20780 157812 158570 gene locus_tag LOCUS_20790 157812 158570 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229866.1 protein_id gnl|my_center|LOCUS_20790 158843 159487 gene locus_tag LOCUS_20800 158843 159487 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978125.1 protein_id gnl|my_center|LOCUS_20800 159622 161166 gene locus_tag LOCUS_20810 159622 161166 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191312152.1 protein_id gnl|my_center|LOCUS_20810 161159 162613 gene locus_tag LOCUS_20820 161159 162613 CDS product fatty acid--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224111.1 protein_id gnl|my_center|LOCUS_20820 163930 162653 gene locus_tag LOCUS_20830 163930 162653 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222807.1 protein_id gnl|my_center|LOCUS_20830 165294 163927 gene locus_tag LOCUS_20840 165294 163927 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222806.1 protein_id gnl|my_center|LOCUS_20840 166358 165288 gene locus_tag LOCUS_20850 166358 165288 CDS product alpha-hydroxy acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222805.1 protein_id gnl|my_center|LOCUS_20850 167929 166355 gene locus_tag LOCUS_20860 167929 166355 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191312152.1 protein_id gnl|my_center|LOCUS_20860 167992 169497 gene locus_tag LOCUS_20870 167992 169497 CDS product aromatic amino acid ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403486.1 protein_id gnl|my_center|LOCUS_20870 170734 169478 gene locus_tag LOCUS_20880 170734 169478 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222809.1 protein_id gnl|my_center|LOCUS_20880 171411 170731 gene locus_tag LOCUS_20890 171411 170731 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222808.1 protein_id gnl|my_center|LOCUS_20890 171713 172600 gene locus_tag LOCUS_20900 171713 172600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 173366 172647 gene locus_tag LOCUS_20910 173366 172647 CDS product GAF and ANTAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228330.1 protein_id gnl|my_center|LOCUS_20910 173693 174337 gene locus_tag LOCUS_20920 173693 174337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 177007 174383 gene locus_tag LOCUS_20930 gene ppsA 177007 174383 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201372230.1 protein_id gnl|my_center|LOCUS_20930 177510 177331 gene locus_tag LOCUS_20940 177510 177331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 177980 177567 gene locus_tag LOCUS_20950 177980 177567 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227629.1 protein_id gnl|my_center|LOCUS_20950 178116 178613 gene locus_tag LOCUS_20960 178116 178613 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028365.1 protein_id gnl|my_center|LOCUS_20960 179517 178696 gene locus_tag LOCUS_20970 179517 178696 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227632.1 protein_id gnl|my_center|LOCUS_20970 180900 179596 gene locus_tag LOCUS_20980 180900 179596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 182157 180934 gene locus_tag LOCUS_20990 182157 180934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 182293 182117 gene locus_tag LOCUS_21000 182293 182117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 182861 182334 gene locus_tag LOCUS_21010 182861 182334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 183153 183947 gene locus_tag LOCUS_21020 183153 183947 CDS product aminoglycoside 6-adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261931.1 protein_id gnl|my_center|LOCUS_21020 185492 183960 gene locus_tag LOCUS_21030 185492 183960 CDS product alpha/beta hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742093.1 protein_id gnl|my_center|LOCUS_21030 185738 188128 gene locus_tag LOCUS_21040 185738 188128 CDS product Orn/Lys/Arg decarboxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229207.1 protein_id gnl|my_center|LOCUS_21040 188555 188145 gene locus_tag LOCUS_21050 188555 188145 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191850179.1 protein_id gnl|my_center|LOCUS_21050 188692 189024 gene locus_tag LOCUS_21060 188692 189024 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191850181.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21060 189282 189097 gene locus_tag LOCUS_21070 189282 189097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 189405 190079 gene locus_tag LOCUS_21080 189405 190079 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227393.1 protein_id gnl|my_center|LOCUS_21080 190136 190861 gene locus_tag LOCUS_21090 190136 190861 CDS product GAF and ANTAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227392.1 protein_id gnl|my_center|LOCUS_21090 191004 192203 gene locus_tag LOCUS_21100 191004 192203 CDS product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972063.1 protein_id gnl|my_center|LOCUS_21100 192649 192227 gene locus_tag LOCUS_21110 192649 192227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 193617 192646 gene locus_tag LOCUS_21120 gene ppk2 193617 192646 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005062218.1 protein_id gnl|my_center|LOCUS_21120 193887 193648 gene locus_tag LOCUS_21130 193887 193648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 194523 194032 gene locus_tag LOCUS_21140 194523 194032 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926470.1 protein_id gnl|my_center|LOCUS_21140 194610 195770 gene locus_tag LOCUS_21150 194610 195770 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968029.1 protein_id gnl|my_center|LOCUS_21150 196866 195838 gene locus_tag LOCUS_21160 196866 195838 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026991.1 protein_id gnl|my_center|LOCUS_21160 197161 198471 gene locus_tag LOCUS_21170 197161 198471 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026992.1 protein_id gnl|my_center|LOCUS_21170 198468 199370 gene locus_tag LOCUS_21180 198468 199370 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026993.1 protein_id gnl|my_center|LOCUS_21180 199372 200268 gene locus_tag LOCUS_21190 199372 200268 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896545.1 protein_id gnl|my_center|LOCUS_21190 200354 202723 gene locus_tag LOCUS_21200 200354 202723 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026995.1 protein_id gnl|my_center|LOCUS_21200 203965 202778 gene locus_tag LOCUS_21210 203965 202778 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172901056.1 protein_id gnl|my_center|LOCUS_21210 205685 204015 gene locus_tag LOCUS_21220 205685 204015 CDS product IlvD/Edd family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027630.1 protein_id gnl|my_center|LOCUS_21220 205855 206598 gene locus_tag LOCUS_21230 205855 206598 CDS product FCD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484679.1 protein_id gnl|my_center|LOCUS_21230 207321 206641 gene locus_tag LOCUS_21240 207321 206641 CDS product NAD(P)H oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030926.1 protein_id gnl|my_center|LOCUS_21240 207436 208416 gene locus_tag LOCUS_21250 207436 208416 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030927.1 protein_id gnl|my_center|LOCUS_21250 209806 208616 gene locus_tag LOCUS_21260 209806 208616 CDS product cellulose-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030452.1 protein_id gnl|my_center|LOCUS_21260 210155 210400 gene locus_tag LOCUS_21270 210155 210400 CDS product DUF5133 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971382.1 protein_id gnl|my_center|LOCUS_21270 212155 210425 gene locus_tag LOCUS_21280 212155 210425 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486025.1 protein_id gnl|my_center|LOCUS_21280 213868 212609 gene locus_tag LOCUS_21290 213868 212609 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230103.1 protein_id gnl|my_center|LOCUS_21290 214059 214721 gene locus_tag LOCUS_21300 214059 214721 CDS product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803815.1 protein_id gnl|my_center|LOCUS_21300 214706 215866 gene locus_tag LOCUS_21310 214706 215866 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803814.1 protein_id gnl|my_center|LOCUS_21310 216859 215897 gene locus_tag LOCUS_21320 216859 215897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 217364 217086 gene locus_tag LOCUS_21330 217364 217086 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225295.1 protein_id gnl|my_center|LOCUS_21330 218846 217503 gene locus_tag LOCUS_21340 218846 217503 CDS product PP2C family protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031624.1 protein_id gnl|my_center|LOCUS_21340 218815 221508 gene locus_tag LOCUS_21350 218815 221508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 221591 222019 gene locus_tag LOCUS_21360 221591 222019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 222964 222125 gene locus_tag LOCUS_21370 222964 222125 CDS product RNA polymerase sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978261.1 protein_id gnl|my_center|LOCUS_21370 223117 223986 gene locus_tag LOCUS_21380 gene larE 223117 223986 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921897.1 protein_id gnl|my_center|LOCUS_21380 223983 224684 gene locus_tag LOCUS_21390 gene larB 223983 224684 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224946.1 protein_id gnl|my_center|LOCUS_21390 224681 225820 gene locus_tag LOCUS_21400 gene larC 224681 225820 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122655.1 protein_id gnl|my_center|LOCUS_21400 226049 227209 gene locus_tag LOCUS_21410 226049 227209 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408274.1 protein_id gnl|my_center|LOCUS_21410 227211 229244 gene locus_tag LOCUS_21420 227211 229244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 229619 229251 gene locus_tag LOCUS_21430 229619 229251 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029168.1 protein_id gnl|my_center|LOCUS_21430 229802 230374 gene locus_tag LOCUS_21440 229802 230374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 230516 231763 gene locus_tag LOCUS_21450 gene manA 230516 231763 CDS product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111913.1 protein_id gnl|my_center|LOCUS_21450 231797 232765 gene locus_tag LOCUS_21460 231797 232765 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027561.1 protein_id gnl|my_center|LOCUS_21460 233969 232935 gene locus_tag LOCUS_21470 233969 232935 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972694.1 protein_id gnl|my_center|LOCUS_21470 236422 233966 gene locus_tag LOCUS_21480 236422 233966 CDS product glycoside hydrolase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030755.1 protein_id gnl|my_center|LOCUS_21480 236689 238011 gene locus_tag LOCUS_21490 236689 238011 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030754.1 protein_id gnl|my_center|LOCUS_21490 238107 239081 gene locus_tag LOCUS_21500 238107 239081 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030753.1 protein_id gnl|my_center|LOCUS_21500 239078 239947 gene locus_tag LOCUS_21510 239078 239947 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030752.1 protein_id gnl|my_center|LOCUS_21510 240659 240054 gene locus_tag LOCUS_21520 240659 240054 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162495312.1 protein_id gnl|my_center|LOCUS_21520 241631 240777 gene locus_tag LOCUS_21530 241631 240777 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092776.1 protein_id gnl|my_center|LOCUS_21530 241773 242621 gene locus_tag LOCUS_21540 241773 242621 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026945.1 protein_id gnl|my_center|LOCUS_21540 242713 243912 gene locus_tag LOCUS_21550 242713 243912 CDS product pyridoxal phosphate-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583069.1 protein_id gnl|my_center|LOCUS_21550 244759 244034 gene locus_tag LOCUS_21560 244759 244034 CDS product glycoside hydrolase family 11 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978772.1 protein_id gnl|my_center|LOCUS_21560 246142 245246 gene locus_tag LOCUS_21570 246142 245246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 246464 247198 gene locus_tag LOCUS_21580 246464 247198 CDS product D-Ala-D-Ala carboxypeptidase family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091388998.1 protein_id gnl|my_center|LOCUS_21580 247906 247301 gene locus_tag LOCUS_21590 gene wrbA 247906 247301 CDS product NAD(P)H:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228078.1 protein_id gnl|my_center|LOCUS_21590 248522 248139 gene locus_tag LOCUS_21600 248522 248139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978453.1 protein_id gnl|my_center|LOCUS_21600 248761 248522 gene locus_tag LOCUS_21610 248761 248522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978454.1 protein_id gnl|my_center|LOCUS_21610 248976 251105 gene locus_tag LOCUS_21620 248976 251105 CDS product cellulose binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003060585.1 protein_id gnl|my_center|LOCUS_21620 252681 251155 gene locus_tag LOCUS_21630 252681 251155 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225330.1 protein_id gnl|my_center|LOCUS_21630 253735 252794 gene locus_tag LOCUS_21640 253735 252794 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031174.1 protein_id gnl|my_center|LOCUS_21640 253661 253849 gene locus_tag LOCUS_21650 253661 253849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 253837 254775 gene locus_tag LOCUS_21660 253837 254775 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225603.1 protein_id gnl|my_center|LOCUS_21660 255059 256714 gene locus_tag LOCUS_21670 255059 256714 CDS product PP2C family protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191850187.1 protein_id gnl|my_center|LOCUS_21670 256711 257802 gene locus_tag LOCUS_21680 256711 257802 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031881.1 protein_id gnl|my_center|LOCUS_21680 257799 258134 gene locus_tag LOCUS_21690 257799 258134 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971387.1 protein_id gnl|my_center|LOCUS_21690 261005 258234 gene locus_tag LOCUS_21700 261005 258234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031530.1 protein_id gnl|my_center|LOCUS_21700 261830 261186 gene locus_tag LOCUS_21710 261830 261186 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228133.1 protein_id gnl|my_center|LOCUS_21710 263220 261835 gene locus_tag LOCUS_21720 263220 261835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 264536 263313 gene locus_tag LOCUS_21730 264536 263313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 264770 265159 gene locus_tag LOCUS_21740 264770 265159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 265293 265802 gene locus_tag LOCUS_21750 265293 265802 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225996.1 protein_id gnl|my_center|LOCUS_21750 266289 265879 gene locus_tag LOCUS_21760 266289 265879 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031693.1 protein_id gnl|my_center|LOCUS_21760 266366 266740 gene locus_tag LOCUS_21770 266366 266740 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390276.1 protein_id gnl|my_center|LOCUS_21770 266921 267187 gene locus_tag LOCUS_21780 266921 267187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 267516 268463 gene locus_tag LOCUS_21790 267516 268463 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229868.1 protein_id gnl|my_center|LOCUS_21790 268501 269358 gene locus_tag LOCUS_21800 268501 269358 CDS product dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229867.1 protein_id gnl|my_center|LOCUS_21800 269566 270423 gene locus_tag LOCUS_21810 269566 270423 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031934.1 protein_id gnl|my_center|LOCUS_21810 271028 270435 gene locus_tag LOCUS_21820 271028 270435 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027252.1 protein_id gnl|my_center|LOCUS_21820 271105 271386 gene locus_tag LOCUS_21830 271105 271386 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978241.1 protein_id gnl|my_center|LOCUS_21830 272247 271426 gene locus_tag LOCUS_21840 272247 271426 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027251.1 protein_id gnl|my_center|LOCUS_21840 272489 272244 gene locus_tag LOCUS_21850 272489 272244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 273905 272529 gene locus_tag LOCUS_21860 273905 272529 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027250.1 protein_id gnl|my_center|LOCUS_21860 274100 274486 gene locus_tag LOCUS_21870 274100 274486 CDS product DUF302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026896.1 protein_id gnl|my_center|LOCUS_21870 275023 274583 gene locus_tag LOCUS_21880 275023 274583 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229490.1 protein_id gnl|my_center|LOCUS_21880 275832 275020 gene locus_tag LOCUS_21890 275832 275020 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229489.1 protein_id gnl|my_center|LOCUS_21890 275926 276375 gene locus_tag LOCUS_21900 275926 276375 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229488.1 protein_id gnl|my_center|LOCUS_21900 278713 276425 gene locus_tag LOCUS_21910 278713 276425 CDS product glycoside hydrolase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225782.1 protein_id gnl|my_center|LOCUS_21910 278640 278951 gene locus_tag LOCUS_21920 278640 278951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 280507 279200 gene locus_tag LOCUS_21930 280507 279200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 280898 281272 gene locus_tag LOCUS_21940 280898 281272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 281321 281731 gene locus_tag LOCUS_21950 281321 281731 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891553.1 protein_id gnl|my_center|LOCUS_21950 281870 282388 gene locus_tag LOCUS_21960 281870 282388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 282426 283388 gene locus_tag LOCUS_21970 282426 283388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 284480 283455 gene locus_tag LOCUS_21980 284480 283455 CDS product aldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088575.1 protein_id gnl|my_center|LOCUS_21980 285094 284477 gene locus_tag LOCUS_21990 285094 284477 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000113603.1 protein_id gnl|my_center|LOCUS_21990 285318 285121 gene locus_tag LOCUS_22000 285318 285121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 285350 286321 gene locus_tag LOCUS_22010 285350 286321 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224988.1 protein_id gnl|my_center|LOCUS_22010 289554 286456 gene locus_tag LOCUS_22020 289554 286456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 289463 289711 gene locus_tag LOCUS_22030 289463 289711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 290660 290085 gene locus_tag LOCUS_22040 290660 290085 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005067348.1 protein_id gnl|my_center|LOCUS_22040 290864 291934 gene locus_tag LOCUS_22050 290864 291934 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727584.1 protein_id gnl|my_center|LOCUS_22050 292004 292750 gene locus_tag LOCUS_22060 292004 292750 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028373.1 protein_id gnl|my_center|LOCUS_22060 293055 296807 gene locus_tag LOCUS_22070 293055 296807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_221460661.1 protein_id gnl|my_center|LOCUS_22070 295385 295295 gene locus_tag LOCUS_t00450 295385 295295 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 297745 296816 gene locus_tag LOCUS_22080 297745 296816 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971552.1 protein_id gnl|my_center|LOCUS_22080 297770 298090 gene locus_tag LOCUS_22090 297770 298090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 298077 299267 gene locus_tag LOCUS_22100 298077 299267 CDS product YncE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112356.1 protein_id gnl|my_center|LOCUS_22100 300690 299818 gene locus_tag LOCUS_22110 300690 299818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 301302 300991 gene locus_tag LOCUS_22120 301302 300991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 302805 301309 gene locus_tag LOCUS_22130 302805 301309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 304073 302802 gene locus_tag LOCUS_22140 304073 302802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 305281 304070 gene locus_tag LOCUS_22150 305281 304070 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228024.1 protein_id gnl|my_center|LOCUS_22150 305598 305278 gene locus_tag LOCUS_22160 305598 305278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 305946 306128 gene locus_tag LOCUS_22170 305946 306128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 306215 309373 gene locus_tag LOCUS_22180 306215 309373 CDS product lantibiotic dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026974.1 protein_id gnl|my_center|LOCUS_22180 309460 310695 gene locus_tag LOCUS_22190 309460 310695 CDS product lanthionine synthetase C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026975.1 protein_id gnl|my_center|LOCUS_22190 310814 310996 gene locus_tag LOCUS_22200 310814 310996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 311069 311335 gene locus_tag LOCUS_22210 311069 311335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 311571 311792 gene locus_tag LOCUS_22220 311571 311792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 312798 311809 gene locus_tag LOCUS_22230 312798 311809 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888889.1 protein_id gnl|my_center|LOCUS_22230 313175 315157 gene locus_tag LOCUS_22240 313175 315157 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225976.1 protein_id gnl|my_center|LOCUS_22240 315522 316574 gene locus_tag LOCUS_22250 315522 316574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 316571 317836 gene locus_tag LOCUS_22260 316571 317836 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105034.1 protein_id gnl|my_center|LOCUS_22260 317906 318979 gene locus_tag LOCUS_22270 317906 318979 CDS product ornithine cyclodeaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228012.1 protein_id gnl|my_center|LOCUS_22270 318991 319806 gene locus_tag LOCUS_22280 318991 319806 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907790.1 protein_id gnl|my_center|LOCUS_22280 319803 323135 gene locus_tag LOCUS_22290 319803 323135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 323132 324886 gene locus_tag LOCUS_22300 323132 324886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 324883 327168 gene locus_tag LOCUS_22310 324883 327168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 327319 329121 gene locus_tag LOCUS_22320 327319 329121 CDS product glycoside hydrolase family 18 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191851194.1 protein_id gnl|my_center|LOCUS_22320 329260 329586 gene locus_tag LOCUS_22330 329260 329586 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000429484.1 protein_id gnl|my_center|LOCUS_22330 329583 329939 gene locus_tag LOCUS_22340 329583 329939 CDS product DUF1048 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000891986.1 protein_id gnl|my_center|LOCUS_22340 329941 330267 gene locus_tag LOCUS_22350 329941 330267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 330684 330295 gene locus_tag LOCUS_22360 330684 330295 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028376.1 protein_id gnl|my_center|LOCUS_22360 330770 331666 gene locus_tag LOCUS_22370 330770 331666 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086848494.1 protein_id gnl|my_center|LOCUS_22370 331735 332268 gene locus_tag LOCUS_22380 331735 332268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 333226 332336 gene locus_tag LOCUS_22390 333226 332336 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223330.1 protein_id gnl|my_center|LOCUS_22390 333357 334262 gene locus_tag LOCUS_22400 333357 334262 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899798.1 protein_id gnl|my_center|LOCUS_22400 335004 334378 gene locus_tag LOCUS_22410 335004 334378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 336638 335001 gene locus_tag LOCUS_22420 336638 335001 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971914.1 protein_id gnl|my_center|LOCUS_22420 337321 336635 gene locus_tag LOCUS_22430 337321 336635 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971915.1 protein_id gnl|my_center|LOCUS_22430 337485 338390 gene locus_tag LOCUS_22440 337485 338390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 339676 338441 gene locus_tag LOCUS_22450 gene thrS 339676 338441 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485230.1 protein_id gnl|my_center|LOCUS_22450 340151 342466 gene locus_tag LOCUS_22460 340151 342466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 343564 342674 gene locus_tag LOCUS_22470 343564 342674 CDS product NmrA family NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031893.1 protein_id gnl|my_center|LOCUS_22470 344088 343648 gene locus_tag LOCUS_22480 344088 343648 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031892.1 protein_id gnl|my_center|LOCUS_22480 344594 345409 gene locus_tag LOCUS_22490 344594 345409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 345649 347091 gene locus_tag LOCUS_22500 345649 347091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 347106 347498 gene locus_tag LOCUS_22510 347106 347498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 347501 347689 gene locus_tag LOCUS_22520 347501 347689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 347686 348186 gene locus_tag LOCUS_22530 347686 348186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 348233 348616 gene locus_tag LOCUS_22540 348233 348616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 348613 350292 gene locus_tag LOCUS_22550 348613 350292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 350292 350630 gene locus_tag LOCUS_22560 350292 350630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 350627 351094 gene locus_tag LOCUS_22570 350627 351094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22570 351098 352414 gene locus_tag LOCUS_22580 351098 352414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 352411 355482 gene locus_tag LOCUS_22590 352411 355482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 355479 355964 gene locus_tag LOCUS_22600 355479 355964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 355992 357419 gene locus_tag LOCUS_22610 355992 357419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 357424 358044 gene locus_tag LOCUS_22620 357424 358044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 358058 361957 gene locus_tag LOCUS_22630 358058 361957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 363029 362106 gene locus_tag LOCUS_22640 363029 362106 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143114.1 protein_id gnl|my_center|LOCUS_22640 364114 363026 gene locus_tag LOCUS_22650 364114 363026 CDS product N-acetylmannosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703465.1 protein_id gnl|my_center|LOCUS_22650 364469 364095 gene locus_tag LOCUS_22660 364469 364095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 365632 364466 gene locus_tag LOCUS_22670 gene aroB 365632 364466 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420740.1 protein_id gnl|my_center|LOCUS_22670 367706 365613 gene locus_tag LOCUS_22680 gene malQ 367706 365613 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028481.1 protein_id gnl|my_center|LOCUS_22680 370924 367703 gene locus_tag LOCUS_22690 370924 367703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 371861 370938 gene locus_tag LOCUS_22700 371861 370938 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_218916599.1 protein_id gnl|my_center|LOCUS_22700 372991 371858 gene locus_tag LOCUS_22710 gene glgC 372991 371858 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855005.1 protein_id gnl|my_center|LOCUS_22710 375077 372984 gene locus_tag LOCUS_22720 375077 372984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 376549 375080 gene locus_tag LOCUS_22730 376549 375080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 377357 376557 gene locus_tag LOCUS_22740 377357 376557 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921987.1 protein_id gnl|my_center|LOCUS_22740 378163 377354 gene locus_tag LOCUS_22750 378163 377354 CDS product ABC-2 family transporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000521519.1 protein_id gnl|my_center|LOCUS_22750 379206 378160 gene locus_tag LOCUS_22760 379206 378160 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837478.1 protein_id gnl|my_center|LOCUS_22760 380495 379203 gene locus_tag LOCUS_22770 380495 379203 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867786.1 protein_id gnl|my_center|LOCUS_22770 380755 381822 gene locus_tag LOCUS_22780 380755 381822 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257837.1 protein_id gnl|my_center|LOCUS_22780 381819 382796 gene locus_tag LOCUS_22790 gene rfbB 381819 382796 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978112.1 protein_id gnl|my_center|LOCUS_22790 383896 382862 gene locus_tag LOCUS_22800 383896 382862 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976582.1 protein_id gnl|my_center|LOCUS_22800 384141 385415 gene locus_tag LOCUS_22810 384141 385415 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976583.1 protein_id gnl|my_center|LOCUS_22810 385442 386464 gene locus_tag LOCUS_22820 385442 386464 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976584.1 protein_id gnl|my_center|LOCUS_22820 386461 387345 gene locus_tag LOCUS_22830 386461 387345 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976585.1 protein_id gnl|my_center|LOCUS_22830 387373 389058 gene locus_tag LOCUS_22840 387373 389058 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028213.1 protein_id gnl|my_center|LOCUS_22840 389055 390104 gene locus_tag LOCUS_22850 389055 390104 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976582.1 protein_id gnl|my_center|LOCUS_22850 390517 392223 gene locus_tag LOCUS_22860 390517 392223 CDS product carbohydrate-binding module family 20 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486988.1 protein_id gnl|my_center|LOCUS_22860 392374 395514 gene locus_tag LOCUS_22870 392374 395514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 395511 398693 gene locus_tag LOCUS_22880 395511 398693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 398715 398921 gene locus_tag LOCUS_22890 398715 398921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 399343 399672 gene locus_tag LOCUS_22900 399343 399672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 399872 400570 gene locus_tag LOCUS_22910 399872 400570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 401480 400773 gene locus_tag LOCUS_22920 401480 400773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 402042 401740 gene locus_tag LOCUS_22930 402042 401740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 402539 402165 gene locus_tag LOCUS_22940 402539 402165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 402520 402672 gene locus_tag LOCUS_22950 402520 402672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 403686 403027 gene locus_tag LOCUS_22960 403686 403027 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978722.1 protein_id gnl|my_center|LOCUS_22960 403792 404886 gene locus_tag LOCUS_22970 403792 404886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 405087 405287 gene locus_tag LOCUS_22980 405087 405287 CDS product type II toxin-antitoxin system VapB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973256.1 protein_id gnl|my_center|LOCUS_22980 405561 406160 gene locus_tag LOCUS_22990 405561 406160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 406486 406755 gene locus_tag LOCUS_23000 406486 406755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 413898 406945 gene locus_tag LOCUS_23010 413898 406945 CDS product type I polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005096246.1 protein_id gnl|my_center|LOCUS_23010 414237 414061 gene locus_tag LOCUS_23020 414237 414061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 414396 414935 gene locus_tag LOCUS_23030 414396 414935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 415028 416287 gene locus_tag LOCUS_23040 415028 416287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 418092 416350 gene locus_tag LOCUS_23050 418092 416350 CDS product endo-1,4-beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226890.1 protein_id gnl|my_center|LOCUS_23050 418947 418159 gene locus_tag LOCUS_23060 418947 418159 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227110.1 protein_id gnl|my_center|LOCUS_23060 418858 419223 gene locus_tag LOCUS_23070 418858 419223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 419322 420308 gene locus_tag LOCUS_23080 419322 420308 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027388.1 protein_id gnl|my_center|LOCUS_23080 421207 422235 gene locus_tag LOCUS_23090 421207 422235 CDS product ParB N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173142140.1 protein_id gnl|my_center|LOCUS_23090 422319 424295 gene locus_tag LOCUS_23100 gene phzE 422319 424295 CDS product phenazine biosynthesis protein PhzE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118954.1 protein_id gnl|my_center|LOCUS_23100 424292 425494 gene locus_tag LOCUS_23110 424292 425494 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083700.1 protein_id gnl|my_center|LOCUS_23110 425579 426367 gene locus_tag LOCUS_23120 425579 426367 CDS product 2,3-dihydro-2,3-dihydroxybenzoate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244476.1 protein_id gnl|my_center|LOCUS_23120 426376 427035 gene locus_tag LOCUS_23130 426376 427035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 427032 427571 gene locus_tag LOCUS_23140 427032 427571 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083718.1 protein_id gnl|my_center|LOCUS_23140 427644 429224 gene locus_tag LOCUS_23150 427644 429224 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112961.1 protein_id gnl|my_center|LOCUS_23150 429238 430917 gene locus_tag LOCUS_23160 429238 430917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 430914 432140 gene locus_tag LOCUS_23170 gene mbtN 430914 432140 CDS product acyl-ACP dehydrogenase MbtN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406953.1 protein_id gnl|my_center|LOCUS_23170 432137 433255 gene locus_tag LOCUS_23180 432137 433255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 433252 434235 gene locus_tag LOCUS_23190 433252 434235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 434232 435836 gene locus_tag LOCUS_23200 434232 435836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 435823 436116 gene locus_tag LOCUS_23210 435823 436116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23210 436164 436790 gene locus_tag LOCUS_23220 436164 436790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 436787 437848 gene locus_tag LOCUS_23230 436787 437848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23230 437845 438597 gene locus_tag LOCUS_23240 437845 438597 CDS product TIGR03084 family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270155.1 protein_id gnl|my_center|LOCUS_23240 438620 439090 gene locus_tag LOCUS_23250 438620 439090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 439134 440636 gene locus_tag LOCUS_23260 439134 440636 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206178.1 protein_id gnl|my_center|LOCUS_23260 440637 441314 gene locus_tag LOCUS_23270 440637 441314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 441341 442885 gene locus_tag LOCUS_23280 441341 442885 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112961.1 protein_id gnl|my_center|LOCUS_23280 442899 443849 gene locus_tag LOCUS_23290 442899 443849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 443923 444483 gene locus_tag LOCUS_23300 443923 444483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 446807 444606 gene locus_tag LOCUS_23310 446807 444606 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028362.1 protein_id gnl|my_center|LOCUS_23310 448248 446812 gene locus_tag LOCUS_23320 448248 446812 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730801.1 protein_id gnl|my_center|LOCUS_23320 448658 449104 gene locus_tag LOCUS_23330 448658 449104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 449929 449198 gene locus_tag LOCUS_23340 449929 449198 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227429.1 protein_id gnl|my_center|LOCUS_23340 450000 450857 gene locus_tag LOCUS_23350 450000 450857 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227428.1 protein_id gnl|my_center|LOCUS_23350 451234 450959 gene locus_tag LOCUS_23360 451234 450959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 452218 451289 gene locus_tag LOCUS_23370 452218 451289 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223327.1 protein_id gnl|my_center|LOCUS_23370 452892 452323 gene locus_tag LOCUS_23380 452892 452323 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222840.1 protein_id gnl|my_center|LOCUS_23380 453348 457124 gene locus_tag LOCUS_23390 gene fxsT 453348 457124 CDS product FxSxx-COOH system tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030145.1 protein_id gnl|my_center|LOCUS_23390 458452 457373 gene locus_tag LOCUS_23400 458452 457373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 458702 458445 gene locus_tag LOCUS_23410 458702 458445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 460324 459224 gene locus_tag LOCUS_23420 460324 459224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 461040 460321 gene locus_tag LOCUS_23430 461040 460321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23430 461622 461458 gene locus_tag LOCUS_23440 461622 461458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 462562 461903 gene locus_tag LOCUS_23450 462562 461903 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230978.1 protein_id gnl|my_center|LOCUS_23450 463764 462559 gene locus_tag LOCUS_23460 463764 462559 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_199888163.1 protein_id gnl|my_center|LOCUS_23460 463920 464483 gene locus_tag LOCUS_23470 463920 464483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23470 464948 465907 gene locus_tag LOCUS_23480 464948 465907 CDS product STM4015 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001042080.1 protein_id gnl|my_center|LOCUS_23480 465913 467037 gene locus_tag LOCUS_23490 465913 467037 CDS product STM4014 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000631310.1 protein_id gnl|my_center|LOCUS_23490 467155 468078 gene locus_tag LOCUS_23500 467155 468078 CDS product STM4013/SEN3800 family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202626.1 protein_id gnl|my_center|LOCUS_23500 468075 469433 gene locus_tag LOCUS_23510 468075 469433 CDS product STM4012 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202627.1 protein_id gnl|my_center|LOCUS_23510 469443 470357 gene locus_tag LOCUS_23520 469443 470357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 470523 471383 gene locus_tag LOCUS_23530 470523 471383 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228169.1 protein_id gnl|my_center|LOCUS_23530 471380 471982 gene locus_tag LOCUS_23540 471380 471982 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228168.1 protein_id gnl|my_center|LOCUS_23540 473456 472428 gene locus_tag LOCUS_23550 473456 472428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484522.1 protein_id gnl|my_center|LOCUS_23550 473572 474195 gene locus_tag LOCUS_23560 473572 474195 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226802.1 protein_id gnl|my_center|LOCUS_23560 475302 474469 gene locus_tag LOCUS_23570 475302 474469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 475338 475814 gene locus_tag LOCUS_23580 475338 475814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 475938 476360 gene locus_tag LOCUS_23590 475938 476360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_23590 476360 476899 gene locus_tag LOCUS_23600 476360 476899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 476791 477537 gene locus_tag LOCUS_23610 476791 477537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23610 477876 478316 gene locus_tag LOCUS_23620 477876 478316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23620 479717 479280 gene locus_tag LOCUS_23630 479717 479280 CDS product glutaredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975822.1 protein_id gnl|my_center|LOCUS_23630 481261 482823 gene locus_tag LOCUS_23640 481261 482823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 482955 483368 gene locus_tag LOCUS_23650 482955 483368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23650 483393 483755 gene locus_tag LOCUS_23660 483393 483755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 483652 483909 gene locus_tag LOCUS_23670 483652 483909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23670 484004 485407 gene locus_tag LOCUS_23680 484004 485407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 485675 485400 gene locus_tag LOCUS_23690 485675 485400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 487422 486256 gene locus_tag LOCUS_23700 487422 486256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 489083 487419 gene locus_tag LOCUS_23710 489083 487419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 490070 489150 gene locus_tag LOCUS_23720 490070 489150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 491156 492289 gene locus_tag LOCUS_23730 491156 492289 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224198.1 protein_id gnl|my_center|LOCUS_23730 492789 492490 gene locus_tag LOCUS_23740 492789 492490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 492922 494271 gene locus_tag LOCUS_23750 492922 494271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 494689 495486 gene locus_tag LOCUS_23760 494689 495486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 495791 496054 gene locus_tag LOCUS_23770 495791 496054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 496188 496529 gene locus_tag LOCUS_23780 496188 496529 CDS product DUF5713 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105459.1 protein_id gnl|my_center|LOCUS_23780 496963 496559 gene locus_tag LOCUS_23790 496963 496559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 497289 496957 gene locus_tag LOCUS_23800 497289 496957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23800 497703 497515 gene locus_tag LOCUS_23810 497703 497515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 497908 499293 gene locus_tag LOCUS_23820 497908 499293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030863065.1 protein_id gnl|my_center|LOCUS_23820 499290 501020 gene locus_tag LOCUS_23830 499290 501020 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030911.1 protein_id gnl|my_center|LOCUS_23830 501145 504633 gene locus_tag LOCUS_23840 501145 504633 CDS product non-ribosomal peptide synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030912.1 protein_id gnl|my_center|LOCUS_23840 504718 505911 gene locus_tag LOCUS_23850 504718 505911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23850 505821 508922 gene locus_tag LOCUS_23860 505821 508922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23860 508919 509326 gene locus_tag LOCUS_23870 508919 509326 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030914.1 protein_id gnl|my_center|LOCUS_23870 509346 510707 gene locus_tag LOCUS_23880 509346 510707 CDS product lysine N(6)-hydroxylase/L-ornithine N(5)-oxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004554397.1 protein_id gnl|my_center|LOCUS_23880 510704 511090 gene locus_tag LOCUS_23890 510704 511090 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030916.1 protein_id gnl|my_center|LOCUS_23890 511087 512607 gene locus_tag LOCUS_23900 511087 512607 CDS product class I tRNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030917.1 protein_id gnl|my_center|LOCUS_23900 512668 513942 gene locus_tag LOCUS_23910 512668 513942 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030918.1 protein_id gnl|my_center|LOCUS_23910 513945 515291 gene locus_tag LOCUS_23920 gene lysA 513945 515291 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030919.1 protein_id gnl|my_center|LOCUS_23920 515565 515747 gene locus_tag LOCUS_23930 515565 515747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 515895 517301 gene locus_tag LOCUS_23940 515895 517301 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027658.1 protein_id gnl|my_center|LOCUS_23940 517540 520743 gene locus_tag LOCUS_23950 517540 520743 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027657.1 protein_id gnl|my_center|LOCUS_23950 522080 521031 gene locus_tag LOCUS_23960 gene mer 522080 521031 CDS product 5,10-methylenetetrahydromethanopterin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871058.1 protein_id gnl|my_center|LOCUS_23960 522540 523049 gene locus_tag LOCUS_23970 522540 523049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084748217.1 protein_id gnl|my_center|LOCUS_23970 523521 523201 gene locus_tag LOCUS_23980 523521 523201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 524104 523709 gene locus_tag LOCUS_23990 524104 523709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23990 524935 524438 gene locus_tag LOCUS_24000 524935 524438 CDS product DUF402 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027944.1 protein_id gnl|my_center|LOCUS_24000 525203 524952 gene locus_tag LOCUS_24010 525203 524952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 525091 525417 gene locus_tag LOCUS_24020 525091 525417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 526611 525874 gene locus_tag LOCUS_24030 526611 525874 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028483.1 protein_id gnl|my_center|LOCUS_24030 526696 527337 gene locus_tag LOCUS_24040 526696 527337 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223996.1 protein_id gnl|my_center|LOCUS_24040 527538 527987 gene locus_tag LOCUS_24050 527538 527987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 528152 527868 gene locus_tag LOCUS_24060 528152 527868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 528359 529366 gene locus_tag LOCUS_24070 528359 529366 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486635.1 protein_id gnl|my_center|LOCUS_24070 529561 529845 gene locus_tag LOCUS_24080 529561 529845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 529976 530731 gene locus_tag LOCUS_24090 529976 530731 CDS product (5-formylfuran-3-yl)methyl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972538.1 protein_id gnl|my_center|LOCUS_24090 530740 531531 gene locus_tag LOCUS_24100 530740 531531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 531528 532634 gene locus_tag LOCUS_24110 531528 532634 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030922.1 protein_id gnl|my_center|LOCUS_24110 532699 533604 gene locus_tag LOCUS_24120 532699 533604 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030923.1 protein_id gnl|my_center|LOCUS_24120 534286 533753 gene locus_tag LOCUS_24130 534286 533753 CDS product EF-hand domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031802.1 protein_id gnl|my_center|LOCUS_24130 536663 535173 gene locus_tag LOCUS_24140 536663 535173 CDS product FG-GAP repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168538635.1 protein_id gnl|my_center|LOCUS_24140 537667 536972 gene locus_tag LOCUS_24150 537667 536972 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193589527.1 protein_id gnl|my_center|LOCUS_24150 538238 537678 gene locus_tag LOCUS_24160 538238 537678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24160 538737 539000 gene locus_tag LOCUS_24170 538737 539000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 539456 539800 gene locus_tag LOCUS_24180 539456 539800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 540115 539810 gene locus_tag LOCUS_24190 540115 539810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 541558 541130 gene locus_tag LOCUS_24200 541558 541130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028319.1 protein_id gnl|my_center|LOCUS_24200 <542395 541551 gene locus_tag LOCUS_24210 <542395 541551 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_127442025.1:RICIN domain-containing protein >Feature sequence05 410 2680 gene locus_tag LOCUS_24220 gene yicI 410 2680 CDS product alpha-xylosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027547.1 protein_id gnl|my_center|LOCUS_24220 3599 2736 gene locus_tag LOCUS_24230 3599 2736 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225309.1 protein_id gnl|my_center|LOCUS_24230 3712 4404 gene locus_tag LOCUS_24240 3712 4404 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226429.1 protein_id gnl|my_center|LOCUS_24240 4900 4412 gene locus_tag LOCUS_24250 4900 4412 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228370.1 protein_id gnl|my_center|LOCUS_24250 6202 5117 gene locus_tag LOCUS_24260 6202 5117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977778.1 protein_id gnl|my_center|LOCUS_24260 6830 6234 gene locus_tag LOCUS_24270 6830 6234 CDS product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977779.1 protein_id gnl|my_center|LOCUS_24270 7113 8228 gene locus_tag LOCUS_24280 7113 8228 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027544.1 protein_id gnl|my_center|LOCUS_24280 8225 9151 gene locus_tag LOCUS_24290 8225 9151 CDS product PmoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223574.1 protein_id gnl|my_center|LOCUS_24290 9145 9888 gene locus_tag LOCUS_24300 9145 9888 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223575.1 protein_id gnl|my_center|LOCUS_24300 10030 10482 gene locus_tag LOCUS_24310 10030 10482 CDS product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977781.1 protein_id gnl|my_center|LOCUS_24310 11093 10455 gene locus_tag LOCUS_24320 11093 10455 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027543.1 protein_id gnl|my_center|LOCUS_24320 13744 11483 gene locus_tag LOCUS_24330 13744 11483 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027542.1 protein_id gnl|my_center|LOCUS_24330 14097 13819 gene locus_tag LOCUS_24340 14097 13819 CDS product heavy-metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027541.1 protein_id gnl|my_center|LOCUS_24340 14304 15263 gene locus_tag LOCUS_24350 14304 15263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027540.1 protein_id gnl|my_center|LOCUS_24350 16118 15339 gene locus_tag LOCUS_24360 16118 15339 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027539.1 protein_id gnl|my_center|LOCUS_24360 16244 17125 gene locus_tag LOCUS_24370 16244 17125 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007446839.1 protein_id gnl|my_center|LOCUS_24370 17145 18005 gene locus_tag LOCUS_24380 17145 18005 CDS product class II fructose-bisphosphate aldolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030498.1 protein_id gnl|my_center|LOCUS_24380 19195 18053 gene locus_tag LOCUS_24390 19195 18053 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270458.1 protein_id gnl|my_center|LOCUS_24390 19252 19968 gene locus_tag LOCUS_24400 19252 19968 CDS product alpha-ketoglutarate-dependent dioxygenase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027536.1 protein_id gnl|my_center|LOCUS_24400 20005 21243 gene locus_tag LOCUS_24410 20005 21243 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027535.1 protein_id gnl|my_center|LOCUS_24410 21940 21437 gene locus_tag LOCUS_24420 21940 21437 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173668703.1 protein_id gnl|my_center|LOCUS_24420 22175 22399 gene locus_tag LOCUS_24430 22175 22399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 22802 23935 gene locus_tag LOCUS_24440 22802 23935 CDS product PLP-dependent cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977801.1 protein_id gnl|my_center|LOCUS_24440 24920 24063 gene locus_tag LOCUS_24450 24920 24063 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977803.1 protein_id gnl|my_center|LOCUS_24450 25189 27597 gene locus_tag LOCUS_24460 25189 27597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027528.1 protein_id gnl|my_center|LOCUS_24460 30005 27567 gene locus_tag LOCUS_24470 30005 27567 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037666873.1 protein_id gnl|my_center|LOCUS_24470 30775 30161 gene locus_tag LOCUS_24480 30775 30161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027527.1 protein_id gnl|my_center|LOCUS_24480 31809 30982 gene locus_tag LOCUS_24490 31809 30982 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027526.1 protein_id gnl|my_center|LOCUS_24490 32292 31852 gene locus_tag LOCUS_24500 32292 31852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977808.1 protein_id gnl|my_center|LOCUS_24500 32544 33866 gene locus_tag LOCUS_24510 32544 33866 CDS product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027524.1 protein_id gnl|my_center|LOCUS_24510 35055 33880 gene locus_tag LOCUS_24520 35055 33880 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484591.1 protein_id gnl|my_center|LOCUS_24520 35056 35898 gene locus_tag LOCUS_24530 35056 35898 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030873288.1 protein_id gnl|my_center|LOCUS_24530 35985 36530 gene locus_tag LOCUS_24540 35985 36530 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977812.1 protein_id gnl|my_center|LOCUS_24540 37588 36602 gene locus_tag LOCUS_24550 37588 36602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 37851 39464 gene locus_tag LOCUS_24560 gene lnt 37851 39464 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027519.1 protein_id gnl|my_center|LOCUS_24560 39533 40012 gene locus_tag LOCUS_24570 39533 40012 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977815.1 protein_id gnl|my_center|LOCUS_24570 40068 40868 gene locus_tag LOCUS_24580 40068 40868 CDS product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027518.1 protein_id gnl|my_center|LOCUS_24580 41016 43040 gene locus_tag LOCUS_24590 41016 43040 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027517.1 protein_id gnl|my_center|LOCUS_24590 44508 43132 gene locus_tag LOCUS_24600 44508 43132 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484585.1 protein_id gnl|my_center|LOCUS_24600 46133 47617 gene locus_tag LOCUS_24610 46133 47617 CDS product DUF3375 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892661.1 protein_id gnl|my_center|LOCUS_24610 47614 48237 gene locus_tag LOCUS_24620 47614 48237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_24620 48234 51650 gene locus_tag LOCUS_24630 48234 51650 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039227.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24630 51652 52836 gene locus_tag LOCUS_24640 51652 52836 CDS product DUF3322 and DUF2220 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727563.1 protein_id gnl|my_center|LOCUS_24640 53520 52804 gene locus_tag LOCUS_24650 53520 52804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 53806 53955 gene locus_tag LOCUS_24660 53806 53955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 54603 54539 gene locus_tag LOCUS_t00460 54603 54539 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 54962 54756 gene locus_tag LOCUS_24670 54962 54756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24670 55079 55432 gene locus_tag LOCUS_24680 55079 55432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24680 57081 55915 gene locus_tag LOCUS_24690 57081 55915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 57729 57932 gene locus_tag LOCUS_24700 57729 57932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 57954 58103 gene locus_tag LOCUS_24710 57954 58103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24710 58653 58477 gene locus_tag LOCUS_24720 58653 58477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 58894 59268 gene locus_tag LOCUS_24730 58894 59268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 59237 59512 gene locus_tag LOCUS_24740 59237 59512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 59721 59527 gene locus_tag LOCUS_24750 59721 59527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 60398 65710 gene locus_tag LOCUS_24760 60398 65710 CDS product DUF3883 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227606.1 protein_id gnl|my_center|LOCUS_24760 68179 65930 gene locus_tag LOCUS_24770 68179 65930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 69033 68179 gene locus_tag LOCUS_24780 69033 68179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 69878 69036 gene locus_tag LOCUS_24790 69878 69036 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838432.1 protein_id gnl|my_center|LOCUS_24790 70869 70162 gene locus_tag LOCUS_24800 70869 70162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 73438 71105 gene locus_tag LOCUS_24810 73438 71105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 73937 73545 gene locus_tag LOCUS_24820 73937 73545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 74210 74602 gene locus_tag LOCUS_24830 74210 74602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24830 74647 74931 gene locus_tag LOCUS_24840 74647 74931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 75336 75061 gene locus_tag LOCUS_24850 75336 75061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24850 76201 77450 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cggctcacctccgctcgcgcggagaggac 78781 77468 gene locus_tag LOCUS_24860 78781 77468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24860 79362 78778 gene locus_tag LOCUS_24870 gene cas6e 79362 78778 CDS product type I-E CRISPR-associated protein Cas6/Cse3/CasE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227610.1 protein_id gnl|my_center|LOCUS_24870 79664 79455 gene locus_tag LOCUS_24880 79664 79455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24880 80792 83533 gene locus_tag LOCUS_24890 80792 83533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24890 83597 85180 gene locus_tag LOCUS_24900 gene casA 83597 85180 CDS product type I-E CRISPR-associated protein Cse1/CasA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229116.1 protein_id gnl|my_center|LOCUS_24900 85235 85912 gene locus_tag LOCUS_24910 85235 85912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 85938 87113 gene locus_tag LOCUS_24920 gene cas7e 85938 87113 CDS product type I-E CRISPR-associated protein Cas7/Cse4/CasC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229114.1 protein_id gnl|my_center|LOCUS_24920 87110 87946 gene locus_tag LOCUS_24930 87110 87946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 88270 88917 gene locus_tag LOCUS_24940 gene cas6e 88270 88917 CDS product type I-E CRISPR-associated protein Cas6/Cse3/CasE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227610.1 protein_id gnl|my_center|LOCUS_24940 88914 89123 gene locus_tag LOCUS_24950 88914 89123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 89345 89521 gene locus_tag LOCUS_24960 89345 89521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24960 89561 89782 gene locus_tag LOCUS_24970 89561 89782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 90546 90361 gene locus_tag LOCUS_24980 90546 90361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 91549 90902 gene locus_tag LOCUS_24990 91549 90902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24990 93033 91537 gene locus_tag LOCUS_25000 93033 91537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25000 93952 93716 gene locus_tag LOCUS_25010 93952 93716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 94323 95328 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cggaacacccccgcgtcggcgggacggac 95362 96737 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtccttcccgccgacgcgggggtggtccg 98150 96780 gene locus_tag LOCUS_25020 98150 96780 CDS product DUF317 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031227.1 protein_id gnl|my_center|LOCUS_25020 99161 98214 gene locus_tag LOCUS_25030 99161 98214 CDS product DnaB-like helicase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031228.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25030 100612 99341 gene locus_tag LOCUS_25040 100612 99341 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031229.1 protein_id gnl|my_center|LOCUS_25040 101484 100609 gene locus_tag LOCUS_25050 101484 100609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 102406 101573 gene locus_tag LOCUS_25060 102406 101573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25060 102820 102491 gene locus_tag LOCUS_25070 102820 102491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25070 103001 103225 gene locus_tag LOCUS_25080 103001 103225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 105626 103452 gene locus_tag LOCUS_25090 105626 103452 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224133.1 protein_id gnl|my_center|LOCUS_25090 105945 106661 gene locus_tag LOCUS_25100 105945 106661 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053191.1 protein_id gnl|my_center|LOCUS_25100 106658 108166 gene locus_tag LOCUS_25110 106658 108166 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228517.1 protein_id gnl|my_center|LOCUS_25110 108385 109080 gene locus_tag LOCUS_25120 108385 109080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25120 110950 109115 gene locus_tag LOCUS_25130 110950 109115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25130 111270 111734 gene locus_tag LOCUS_25140 111270 111734 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227509.1 protein_id gnl|my_center|LOCUS_25140 113263 112343 gene locus_tag LOCUS_25150 113263 112343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25150 113165 113584 gene locus_tag LOCUS_25160 113165 113584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 113997 113650 gene locus_tag LOCUS_25170 113997 113650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 114120 115118 gene locus_tag LOCUS_25180 114120 115118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 115550 116242 gene locus_tag LOCUS_25190 115550 116242 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972069.1 protein_id gnl|my_center|LOCUS_25190 116239 117690 gene locus_tag LOCUS_25200 116239 117690 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031417.1 protein_id gnl|my_center|LOCUS_25200 119972 117894 gene locus_tag LOCUS_25210 119972 117894 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031418.1 protein_id gnl|my_center|LOCUS_25210 120149 120502 gene locus_tag LOCUS_25220 120149 120502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25220 122420 121107 gene locus_tag LOCUS_25230 122420 121107 CDS product aromatic acid/H+ symport family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230802.1 protein_id gnl|my_center|LOCUS_25230 123644 122691 gene locus_tag LOCUS_25240 123644 122691 CDS product catechol 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086600.1 protein_id gnl|my_center|LOCUS_25240 124723 123641 gene locus_tag LOCUS_25250 124723 123641 CDS product 4-oxalomesaconate tautomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039102.1 protein_id gnl|my_center|LOCUS_25250 125415 124720 gene locus_tag LOCUS_25260 125415 124720 CDS product 4-carboxy-4-hydroxy-2-oxoadipate aldolase/oxaloacetate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969451.1 protein_id gnl|my_center|LOCUS_25260 126173 125415 gene locus_tag LOCUS_25270 126173 125415 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208961.1 protein_id gnl|my_center|LOCUS_25270 126875 126222 gene locus_tag LOCUS_25280 126875 126222 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536888.1 protein_id gnl|my_center|LOCUS_25280 128717 127080 gene locus_tag LOCUS_25290 128717 127080 CDS product subtype B tannase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898589.1 protein_id gnl|my_center|LOCUS_25290 128862 130064 gene locus_tag LOCUS_25300 128862 130064 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027551.1 protein_id gnl|my_center|LOCUS_25300 129979 130311 gene locus_tag LOCUS_25310 129979 130311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25310 130416 132185 gene locus_tag LOCUS_25320 130416 132185 CDS product subtype B tannase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101979.1 protein_id gnl|my_center|LOCUS_25320 132460 134151 gene locus_tag LOCUS_25330 132460 134151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25330 134449 134129 gene locus_tag LOCUS_25340 134449 134129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25340 135154 134567 gene locus_tag LOCUS_25350 135154 134567 CDS product CGNR zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_213089165.1 protein_id gnl|my_center|LOCUS_25350 136352 135129 gene locus_tag LOCUS_25360 136352 135129 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230022.1 protein_id gnl|my_center|LOCUS_25360 136816 136349 gene locus_tag LOCUS_25370 136816 136349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 137114 137446 gene locus_tag LOCUS_25380 137114 137446 CDS product DUF3140 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978015.1 protein_id gnl|my_center|LOCUS_25380 137623 138117 gene locus_tag LOCUS_25390 137623 138117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25390 138758 138147 gene locus_tag LOCUS_25400 138758 138147 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029378.1 protein_id gnl|my_center|LOCUS_25400 138862 139692 gene locus_tag LOCUS_25410 138862 139692 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941468.1 protein_id gnl|my_center|LOCUS_25410 140536 139697 gene locus_tag LOCUS_25420 140536 139697 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727009.1 protein_id gnl|my_center|LOCUS_25420 141316 140705 gene locus_tag LOCUS_25430 141316 140705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030751.1 protein_id gnl|my_center|LOCUS_25430 141996 141370 gene locus_tag LOCUS_25440 141996 141370 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730455.1 protein_id gnl|my_center|LOCUS_25440 142163 142909 gene locus_tag LOCUS_25450 142163 142909 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896700.1 protein_id gnl|my_center|LOCUS_25450 144047 142971 gene locus_tag LOCUS_25460 144047 142971 CDS product NADH:flavin oxidoreductase/NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977723.1 protein_id gnl|my_center|LOCUS_25460 144297 145304 gene locus_tag LOCUS_25470 144297 145304 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027205.1 protein_id gnl|my_center|LOCUS_25470 145506 146141 gene locus_tag LOCUS_25480 145506 146141 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978024.1 protein_id gnl|my_center|LOCUS_25480 146214 147893 gene locus_tag LOCUS_25490 146214 147893 CDS product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226038.1 protein_id gnl|my_center|LOCUS_25490 149208 147898 gene locus_tag LOCUS_25500 149208 147898 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086838527.1 protein_id gnl|my_center|LOCUS_25500 149352 149540 gene locus_tag LOCUS_25510 149352 149540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978025.1 protein_id gnl|my_center|LOCUS_25510 149563 150255 gene locus_tag LOCUS_25520 149563 150255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027379.1 protein_id gnl|my_center|LOCUS_25520 150252 151172 gene locus_tag LOCUS_25530 150252 151172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027378.1 protein_id gnl|my_center|LOCUS_25530 151169 152089 gene locus_tag LOCUS_25540 151169 152089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978028.1 protein_id gnl|my_center|LOCUS_25540 152086 153162 gene locus_tag LOCUS_25550 152086 153162 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978029.1 protein_id gnl|my_center|LOCUS_25550 154593 153214 gene locus_tag LOCUS_25560 154593 153214 CDS product alpha-lytic protease prodomain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027377.1 protein_id gnl|my_center|LOCUS_25560 156392 154731 gene locus_tag LOCUS_25570 156392 154731 CDS product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978031.1 protein_id gnl|my_center|LOCUS_25570 156365 156694 gene locus_tag LOCUS_25580 156365 156694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25580 157554 156598 gene locus_tag LOCUS_25590 157554 156598 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027375.1 protein_id gnl|my_center|LOCUS_25590 158447 157551 gene locus_tag LOCUS_25600 158447 157551 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978035.1 protein_id gnl|my_center|LOCUS_25600 158923 158444 gene locus_tag LOCUS_25610 158923 158444 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978036.1 protein_id gnl|my_center|LOCUS_25610 158969 160717 gene locus_tag LOCUS_25620 158969 160717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 162079 160769 gene locus_tag LOCUS_25630 162079 160769 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978040.1 protein_id gnl|my_center|LOCUS_25630 162868 162083 gene locus_tag LOCUS_25640 162868 162083 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978041.1 protein_id gnl|my_center|LOCUS_25640 163642 162995 gene locus_tag LOCUS_25650 163642 162995 CDS product LUD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978042.1 protein_id gnl|my_center|LOCUS_25650 165117 163639 gene locus_tag LOCUS_25660 165117 163639 CDS product LutB/LldF family L-lactate oxidation iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027372.1 protein_id gnl|my_center|LOCUS_25660 165869 165114 gene locus_tag LOCUS_25670 165869 165114 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027371.1 protein_id gnl|my_center|LOCUS_25670 167386 165944 gene locus_tag LOCUS_25680 167386 165944 CDS product rhamnulokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978046.1 protein_id gnl|my_center|LOCUS_25680 169422 167383 gene locus_tag LOCUS_25690 169422 167383 CDS product bifunctional rhamnulose-1-phosphate aldolase/short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027370.1 protein_id gnl|my_center|LOCUS_25690 170699 169539 gene locus_tag LOCUS_25700 gene rhaI 170699 169539 CDS product L-rhamnose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027369.1 protein_id gnl|my_center|LOCUS_25700 170973 172490 gene locus_tag LOCUS_25710 170973 172490 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978049.1 protein_id gnl|my_center|LOCUS_25710 172487 173527 gene locus_tag LOCUS_25720 172487 173527 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978050.1 protein_id gnl|my_center|LOCUS_25720 173520 174539 gene locus_tag LOCUS_25730 173520 174539 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978051.1 protein_id gnl|my_center|LOCUS_25730 174576 175658 gene locus_tag LOCUS_25740 gene rhaS 174576 175658 CDS product rhamnose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978052.1 protein_id gnl|my_center|LOCUS_25740 175693 176013 gene locus_tag LOCUS_25750 175693 176013 CDS product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978053.1 protein_id gnl|my_center|LOCUS_25750 176151 177176 gene locus_tag LOCUS_25760 176151 177176 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978054.1 protein_id gnl|my_center|LOCUS_25760 177272 178576 gene locus_tag LOCUS_25770 177272 178576 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027368.1 protein_id gnl|my_center|LOCUS_25770 178618 179538 gene locus_tag LOCUS_25780 gene sigJ 178618 179538 CDS product RNA polymerase sigma factor SigJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027367.1 protein_id gnl|my_center|LOCUS_25780 179574 180404 gene locus_tag LOCUS_25790 179574 180404 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027366.1 protein_id gnl|my_center|LOCUS_25790 182000 180366 gene locus_tag LOCUS_25800 182000 180366 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027365.1 protein_id gnl|my_center|LOCUS_25800 182120 182728 gene locus_tag LOCUS_25810 182120 182728 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164275233.1 protein_id gnl|my_center|LOCUS_25810 182815 183540 gene locus_tag LOCUS_25820 182815 183540 CDS product DUF2470 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027363.1 protein_id gnl|my_center|LOCUS_25820 184561 183572 gene locus_tag LOCUS_25830 184561 183572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027361.1 protein_id gnl|my_center|LOCUS_25830 185873 184620 gene locus_tag LOCUS_25840 185873 184620 CDS product aromatic acid exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030869305.1 protein_id gnl|my_center|LOCUS_25840 186466 185972 gene locus_tag LOCUS_25850 186466 185972 CDS product FBP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978065.1 protein_id gnl|my_center|LOCUS_25850 186661 187953 gene locus_tag LOCUS_25860 186661 187953 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027360.1 protein_id gnl|my_center|LOCUS_25860 188044 188304 gene locus_tag LOCUS_25870 188044 188304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027359.1 protein_id gnl|my_center|LOCUS_25870 189370 188333 gene locus_tag LOCUS_25880 189370 188333 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027358.1 protein_id gnl|my_center|LOCUS_25880 190890 189652 gene locus_tag LOCUS_25890 190890 189652 CDS product aromatic acid exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484495.1 protein_id gnl|my_center|LOCUS_25890 191692 191036 gene locus_tag LOCUS_25900 191692 191036 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225121.1 protein_id gnl|my_center|LOCUS_25900 192775 191738 gene locus_tag LOCUS_25910 192775 191738 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030869314.1 protein_id gnl|my_center|LOCUS_25910 192920 193717 gene locus_tag LOCUS_25920 192920 193717 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226107.1 protein_id gnl|my_center|LOCUS_25920 193744 194760 gene locus_tag LOCUS_25930 193744 194760 CDS product DNA topoisomerase IB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226137.1 protein_id gnl|my_center|LOCUS_25930 194803 195039 gene locus_tag LOCUS_25940 194803 195039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978072.1 protein_id gnl|my_center|LOCUS_25940 195636 195058 gene locus_tag LOCUS_25950 195636 195058 CDS product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978074.1 protein_id gnl|my_center|LOCUS_25950 196365 195703 gene locus_tag LOCUS_25960 196365 195703 CDS product DUF4230 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027353.1 protein_id gnl|my_center|LOCUS_25960 196837 196457 gene locus_tag LOCUS_25970 196837 196457 CDS product anti-sigma factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978079.1 protein_id gnl|my_center|LOCUS_25970 197977 197027 gene locus_tag LOCUS_25980 197977 197027 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978080.1 protein_id gnl|my_center|LOCUS_25980 198028 199026 gene locus_tag LOCUS_25990 198028 199026 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_213089171.1 protein_id gnl|my_center|LOCUS_25990 199138 199530 gene locus_tag LOCUS_26000 199138 199530 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978082.1 protein_id gnl|my_center|LOCUS_26000 199871 199572 gene locus_tag LOCUS_26010 199871 199572 CDS product DUF4235 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978083.1 protein_id gnl|my_center|LOCUS_26010 200960 199935 gene locus_tag LOCUS_26020 200960 199935 CDS product glutathione S-transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978084.1 protein_id gnl|my_center|LOCUS_26020 201083 202210 gene locus_tag LOCUS_26030 201083 202210 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325249.1 protein_id gnl|my_center|LOCUS_26030 202726 202277 gene locus_tag LOCUS_26040 202726 202277 CDS product nitroreductase family deazaflavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978086.1 protein_id gnl|my_center|LOCUS_26040 203031 204272 gene locus_tag LOCUS_26050 203031 204272 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027348.1 protein_id gnl|my_center|LOCUS_26050 204285 204473 gene locus_tag LOCUS_26060 204285 204473 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027347.1 protein_id gnl|my_center|LOCUS_26060 205352 204495 gene locus_tag LOCUS_26070 205352 204495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26070 205540 206508 gene locus_tag LOCUS_26080 205540 206508 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930069.1 protein_id gnl|my_center|LOCUS_26080 207202 206519 gene locus_tag LOCUS_26090 207202 206519 CDS product DUF4232 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027343.1 protein_id gnl|my_center|LOCUS_26090 209691 207313 gene locus_tag LOCUS_26100 209691 207313 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484486.1 protein_id gnl|my_center|LOCUS_26100 209950 213039 gene locus_tag LOCUS_26110 209950 213039 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027341.1 protein_id gnl|my_center|LOCUS_26110 213193 215436 gene locus_tag LOCUS_26120 213193 215436 CDS product cellulase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027340.1 protein_id gnl|my_center|LOCUS_26120 215531 215776 gene locus_tag LOCUS_26130 215531 215776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26130 215780 216157 gene locus_tag LOCUS_26140 215780 216157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978453.1 protein_id gnl|my_center|LOCUS_26140 216378 217985 gene locus_tag LOCUS_26150 216378 217985 CDS product RICIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027339.1 protein_id gnl|my_center|LOCUS_26150 219212 218037 gene locus_tag LOCUS_26160 219212 218037 CDS product lactate 2-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978098.1 protein_id gnl|my_center|LOCUS_26160 219735 219532 gene locus_tag LOCUS_26170 219735 219532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26170 220360 219716 gene locus_tag LOCUS_26180 220360 219716 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325244.1 protein_id gnl|my_center|LOCUS_26180 221404 220391 gene locus_tag LOCUS_26190 221404 220391 CDS product iron-containing redox enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027336.1 protein_id gnl|my_center|LOCUS_26190 221691 221491 gene locus_tag LOCUS_26200 221691 221491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978103.1 protein_id gnl|my_center|LOCUS_26200 222815 221805 gene locus_tag LOCUS_26210 222815 221805 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027335.1 protein_id gnl|my_center|LOCUS_26210 222959 224122 gene locus_tag LOCUS_26220 222959 224122 CDS product S1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027331.1 protein_id gnl|my_center|LOCUS_26220 226285 224141 gene locus_tag LOCUS_26230 226285 224141 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031735.1 protein_id gnl|my_center|LOCUS_26230 226470 228908 gene locus_tag LOCUS_26240 226470 228908 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027330.1 protein_id gnl|my_center|LOCUS_26240 229051 230118 gene locus_tag LOCUS_26250 229051 230118 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257837.1 protein_id gnl|my_center|LOCUS_26250 230115 231095 gene locus_tag LOCUS_26260 gene rfbB 230115 231095 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978112.1 protein_id gnl|my_center|LOCUS_26260 231092 231964 gene locus_tag LOCUS_26270 gene rfbD 231092 231964 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417101.1 protein_id gnl|my_center|LOCUS_26270 231961 232764 gene locus_tag LOCUS_26280 231961 232764 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532723.1 protein_id gnl|my_center|LOCUS_26280 233383 232784 gene locus_tag LOCUS_26290 233383 232784 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727714.1 protein_id gnl|my_center|LOCUS_26290 235320 233386 gene locus_tag LOCUS_26300 235320 233386 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776624.1 protein_id gnl|my_center|LOCUS_26300 235492 235992 gene locus_tag LOCUS_26310 235492 235992 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027329.1 protein_id gnl|my_center|LOCUS_26310 237769 236009 gene locus_tag LOCUS_26320 237769 236009 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978119.1 protein_id gnl|my_center|LOCUS_26320 237890 238978 gene locus_tag LOCUS_26330 237890 238978 CDS product S-(hydroxymethyl)mycothiol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027326.1 protein_id gnl|my_center|LOCUS_26330 238978 239607 gene locus_tag LOCUS_26340 238978 239607 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978121.1 protein_id gnl|my_center|LOCUS_26340 239707 240621 gene locus_tag LOCUS_26350 239707 240621 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027325.1 protein_id gnl|my_center|LOCUS_26350 241144 240605 gene locus_tag LOCUS_26360 241144 240605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978123.1 protein_id gnl|my_center|LOCUS_26360 241333 241506 gene locus_tag LOCUS_26370 241333 241506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978128.1 protein_id gnl|my_center|LOCUS_26370 241467 241706 gene locus_tag LOCUS_26380 241467 241706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26380 243013 241673 gene locus_tag LOCUS_26390 243013 241673 CDS product S1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027321.1 protein_id gnl|my_center|LOCUS_26390 243140 244276 gene locus_tag LOCUS_26400 243140 244276 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027320.1 protein_id gnl|my_center|LOCUS_26400 244302 244733 gene locus_tag LOCUS_26410 244302 244733 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978131.1 protein_id gnl|my_center|LOCUS_26410 245157 244741 gene locus_tag LOCUS_26420 245157 244741 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978132.1 protein_id gnl|my_center|LOCUS_26420 246057 245320 gene locus_tag LOCUS_26430 246057 245320 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027318.1 protein_id gnl|my_center|LOCUS_26430 246162 247004 gene locus_tag LOCUS_26440 246162 247004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325235.1 protein_id gnl|my_center|LOCUS_26440 247062 247550 gene locus_tag LOCUS_26450 247062 247550 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978135.1 protein_id gnl|my_center|LOCUS_26450 249998 247569 gene locus_tag LOCUS_26460 249998 247569 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031588.1 protein_id gnl|my_center|LOCUS_26460 250455 250078 gene locus_tag LOCUS_26470 250455 250078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325234.1 protein_id gnl|my_center|LOCUS_26470 251467 250550 gene locus_tag LOCUS_26480 251467 250550 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978137.1 protein_id gnl|my_center|LOCUS_26480 251584 251763 gene locus_tag LOCUS_26490 251584 251763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26490 251815 252219 gene locus_tag LOCUS_26500 251815 252219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26500 252986 252333 gene locus_tag LOCUS_26510 252986 252333 CDS product nucleoside/nucleotide kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230842.1 protein_id gnl|my_center|LOCUS_26510 253062 253802 gene locus_tag LOCUS_26520 253062 253802 CDS product beta-phosphoglucomutase family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978139.1 protein_id gnl|my_center|LOCUS_26520 253799 256153 gene locus_tag LOCUS_26530 253799 256153 CDS product glycosyl hydrolase family 65 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027316.1 protein_id gnl|my_center|LOCUS_26530 256264 257733 gene locus_tag LOCUS_26540 256264 257733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027315.1 protein_id gnl|my_center|LOCUS_26540 257797 258651 gene locus_tag LOCUS_26550 gene prcB 257797 258651 CDS product proteasome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977182.1 protein_id gnl|my_center|LOCUS_26550 258771 259247 gene locus_tag LOCUS_26560 258771 259247 CDS product DUF5709 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027314.1 protein_id gnl|my_center|LOCUS_26560 259539 259318 gene locus_tag LOCUS_26570 259539 259318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978144.1 protein_id gnl|my_center|LOCUS_26570 260857 259655 gene locus_tag LOCUS_26580 260857 259655 CDS product glycoside hydrolase family 64 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027312.1 protein_id gnl|my_center|LOCUS_26580 260856 261026 gene locus_tag LOCUS_26590 260856 261026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26590 261200 262102 gene locus_tag LOCUS_26600 261200 262102 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230336.1 protein_id gnl|my_center|LOCUS_26600 262764 262099 gene locus_tag LOCUS_26610 262764 262099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26610 263709 262810 gene locus_tag LOCUS_26620 263709 262810 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027311.1 protein_id gnl|my_center|LOCUS_26620 263953 264987 gene locus_tag LOCUS_26630 263953 264987 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978149.1 protein_id gnl|my_center|LOCUS_26630 265278 268043 gene locus_tag LOCUS_26640 265278 268043 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027310.1 protein_id gnl|my_center|LOCUS_26640 268341 269525 gene locus_tag LOCUS_26650 268341 269525 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027309.1 protein_id gnl|my_center|LOCUS_26650 269757 270539 gene locus_tag LOCUS_26660 269757 270539 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978152.1 protein_id gnl|my_center|LOCUS_26660 270536 271336 gene locus_tag LOCUS_26670 270536 271336 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978153.1 protein_id gnl|my_center|LOCUS_26670 271333 272229 gene locus_tag LOCUS_26680 271333 272229 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027308.1 protein_id gnl|my_center|LOCUS_26680 272222 273346 gene locus_tag LOCUS_26690 272222 273346 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027307.1 protein_id gnl|my_center|LOCUS_26690 273343 274620 gene locus_tag LOCUS_26700 273343 274620 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978156.1 protein_id gnl|my_center|LOCUS_26700 274778 275599 gene locus_tag LOCUS_26710 274778 275599 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978157.1 protein_id gnl|my_center|LOCUS_26710 276598 275675 gene locus_tag LOCUS_26720 276598 275675 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230746.1 protein_id gnl|my_center|LOCUS_26720 276975 276748 gene locus_tag LOCUS_26730 276975 276748 CDS product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978159.1 protein_id gnl|my_center|LOCUS_26730 277234 277770 gene locus_tag LOCUS_26740 277234 277770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325223.1 protein_id gnl|my_center|LOCUS_26740 277919 279688 gene locus_tag LOCUS_26750 277919 279688 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027306.1 protein_id gnl|my_center|LOCUS_26750 280073 279729 gene locus_tag LOCUS_26760 280073 279729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26760 280231 280557 gene locus_tag LOCUS_26770 280231 280557 CDS product DUF5133 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189282707.1 protein_id gnl|my_center|LOCUS_26770 280886 281335 gene locus_tag LOCUS_26780 280886 281335 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027303.1 protein_id gnl|my_center|LOCUS_26780 281443 281646 gene locus_tag LOCUS_26790 281443 281646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26790 282647 281664 gene locus_tag LOCUS_26800 gene tgmB 282647 281664 CDS product ATP-grasp ribosomal peptide maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027302.1 protein_id gnl|my_center|LOCUS_26800 282855 282664 gene locus_tag LOCUS_26810 gene tgmA 282855 282664 CDS product putative ATP-grasp-modified RiPP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978169.1 protein_id gnl|my_center|LOCUS_26810 283298 282987 gene locus_tag LOCUS_26820 283298 282987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26820 283520 284875 gene locus_tag LOCUS_26830 283520 284875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26830 287069 284931 gene locus_tag LOCUS_26840 287069 284931 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727118.1 protein_id gnl|my_center|LOCUS_26840 288088 287096 gene locus_tag LOCUS_26850 288088 287096 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027298.1 protein_id gnl|my_center|LOCUS_26850 288637 288089 gene locus_tag LOCUS_26860 288637 288089 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978174.1 protein_id gnl|my_center|LOCUS_26860 288755 289441 gene locus_tag LOCUS_26870 288755 289441 CDS product maleylpyruvate isomerase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027175.1 protein_id gnl|my_center|LOCUS_26870 290854 289457 gene locus_tag LOCUS_26880 290854 289457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027296.1 protein_id gnl|my_center|LOCUS_26880 291084 291878 gene locus_tag LOCUS_26890 291084 291878 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027295.1 protein_id gnl|my_center|LOCUS_26890 292268 291933 gene locus_tag LOCUS_26900 292268 291933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26900 293373 292306 gene locus_tag LOCUS_26910 293373 292306 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189282703.1 protein_id gnl|my_center|LOCUS_26910 294900 293536 gene locus_tag LOCUS_26920 294900 293536 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978182.1 protein_id gnl|my_center|LOCUS_26920 295091 296542 gene locus_tag LOCUS_26930 295091 296542 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224038.1 protein_id gnl|my_center|LOCUS_26930 296696 296550 gene locus_tag LOCUS_26940 296696 296550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325212.1 protein_id gnl|my_center|LOCUS_26940 296856 297029 gene locus_tag LOCUS_26950 296856 297029 CDS product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027290.1 protein_id gnl|my_center|LOCUS_26950 299670 297088 gene locus_tag LOCUS_26960 299670 297088 CDS product SpoIIE family protein phosphatase/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186009676.1 protein_id gnl|my_center|LOCUS_26960 300045 301394 gene locus_tag LOCUS_26970 300045 301394 CDS product endo-1,4-beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027286.1 protein_id gnl|my_center|LOCUS_26970 302648 301446 gene locus_tag LOCUS_26980 302648 301446 CDS product glycoside hydrolase family 64 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031745.1 protein_id gnl|my_center|LOCUS_26980 302948 303376 gene locus_tag LOCUS_26990 302948 303376 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325209.1 protein_id gnl|my_center|LOCUS_26990 303743 303378 gene locus_tag LOCUS_27000 303743 303378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_27000 303881 304147 gene locus_tag LOCUS_27010 303881 304147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978191.1 protein_id gnl|my_center|LOCUS_27010 305703 304144 gene locus_tag LOCUS_27020 305703 304144 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027283.1 protein_id gnl|my_center|LOCUS_27020 306317 305700 gene locus_tag LOCUS_27030 306317 305700 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978194.1 protein_id gnl|my_center|LOCUS_27030 306407 308005 gene locus_tag LOCUS_27040 306407 308005 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484466.1 protein_id gnl|my_center|LOCUS_27040 308159 309040 gene locus_tag LOCUS_27050 308159 309040 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027281.1 protein_id gnl|my_center|LOCUS_27050 311338 309074 gene locus_tag LOCUS_27060 gene catB 311338 309074 CDS product catalase CatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978196.1 protein_id gnl|my_center|LOCUS_27060 311684 311478 gene locus_tag LOCUS_27070 311684 311478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27070 312908 311877 gene locus_tag LOCUS_27080 312908 311877 CDS product hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027278.1 protein_id gnl|my_center|LOCUS_27080 313654 313016 gene locus_tag LOCUS_27090 313654 313016 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027271.1 protein_id gnl|my_center|LOCUS_27090 314573 313773 gene locus_tag LOCUS_27100 314573 313773 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027270.1 protein_id gnl|my_center|LOCUS_27100 315235 314696 gene locus_tag LOCUS_27110 315235 314696 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027269.1 protein_id gnl|my_center|LOCUS_27110 315427 316440 gene locus_tag LOCUS_27120 315427 316440 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978217.1 protein_id gnl|my_center|LOCUS_27120 316651 317340 gene locus_tag LOCUS_27130 316651 317340 CDS product lytic polysaccharide monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027267.1 protein_id gnl|my_center|LOCUS_27130 318725 317430 gene locus_tag LOCUS_27140 318725 317430 CDS product phytase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031837.1 protein_id gnl|my_center|LOCUS_27140 318960 319352 gene locus_tag LOCUS_27150 318960 319352 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027265.1 protein_id gnl|my_center|LOCUS_27150 319359 320291 gene locus_tag LOCUS_27160 319359 320291 CDS product M56 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978223.1 protein_id gnl|my_center|LOCUS_27160 320715 321227 gene locus_tag LOCUS_27170 320715 321227 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027260.1 protein_id gnl|my_center|LOCUS_27170 322911 321295 gene locus_tag LOCUS_27180 322911 321295 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978239.1 protein_id gnl|my_center|LOCUS_27180 323746 323048 gene locus_tag LOCUS_27190 323746 323048 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027253.1 protein_id gnl|my_center|LOCUS_27190 324252 326633 gene locus_tag LOCUS_27200 324252 326633 CDS product phosphoketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161269956.1 protein_id gnl|my_center|LOCUS_27200 326668 329067 gene locus_tag LOCUS_27210 326668 329067 CDS product glycosyl hydrolase family 65 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027248.1 protein_id gnl|my_center|LOCUS_27210 329504 329049 gene locus_tag LOCUS_27220 329504 329049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978246.1 protein_id gnl|my_center|LOCUS_27220 330509 329646 gene locus_tag LOCUS_27230 330509 329646 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027243.1 protein_id gnl|my_center|LOCUS_27230 331796 330549 gene locus_tag LOCUS_27240 331796 330549 CDS product aromatic acid/H+ symport family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031662.1 protein_id gnl|my_center|LOCUS_27240 333285 331831 gene locus_tag LOCUS_27250 333285 331831 CDS product benzaldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031663.1 protein_id gnl|my_center|LOCUS_27250 334921 333338 gene locus_tag LOCUS_27260 gene mdlC 334921 333338 CDS product benzoylformate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031664.1 protein_id gnl|my_center|LOCUS_27260 335019 335966 gene locus_tag LOCUS_27270 335019 335966 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031665.1 protein_id gnl|my_center|LOCUS_27270 336131 336853 gene locus_tag LOCUS_27280 336131 336853 CDS product FAD binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027228.1 protein_id gnl|my_center|LOCUS_27280 337824 336886 gene locus_tag LOCUS_27290 337824 336886 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027239.1 protein_id gnl|my_center|LOCUS_27290 337967 338137 gene locus_tag LOCUS_27300 337967 338137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27300 338134 338556 gene locus_tag LOCUS_27310 338134 338556 CDS product DUF6010 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029381.1 protein_id gnl|my_center|LOCUS_27310 339607 338570 gene locus_tag LOCUS_27320 339607 338570 CDS product medium chain dehydrogenase/reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226261.1 protein_id gnl|my_center|LOCUS_27320 340350 339766 gene locus_tag LOCUS_27330 340350 339766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27330 341621 340413 gene locus_tag LOCUS_27340 341621 340413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27340 341923 343188 gene locus_tag LOCUS_27350 341923 343188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27350 343185 344018 gene locus_tag LOCUS_27360 343185 344018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027957.1 protein_id gnl|my_center|LOCUS_27360 344095 345054 gene locus_tag LOCUS_27370 344095 345054 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226301.1 protein_id gnl|my_center|LOCUS_27370 345348 345058 gene locus_tag LOCUS_27380 345348 345058 CDS product zinc-ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029116.1 protein_id gnl|my_center|LOCUS_27380 345871 345449 gene locus_tag LOCUS_27390 345871 345449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27390 346028 346465 gene locus_tag LOCUS_27400 346028 346465 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978301.1 protein_id gnl|my_center|LOCUS_27400 346495 348720 gene locus_tag LOCUS_27410 gene katG 346495 348720 CDS product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027206.1 protein_id gnl|my_center|LOCUS_27410 348857 349972 gene locus_tag LOCUS_27420 348857 349972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27420 351105 350116 gene locus_tag LOCUS_27430 351105 350116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27430 351249 352091 gene locus_tag LOCUS_27440 351249 352091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27440 353534 352035 gene locus_tag LOCUS_27450 353534 352035 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027202.1 protein_id gnl|my_center|LOCUS_27450 353630 354586 gene locus_tag LOCUS_27460 353630 354586 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027203.1 protein_id gnl|my_center|LOCUS_27460 355396 354587 gene locus_tag LOCUS_27470 355396 354587 CDS product CAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027196.1 protein_id gnl|my_center|LOCUS_27470 356026 355526 gene locus_tag LOCUS_27480 356026 355526 CDS product lamin tail domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109036335.1 protein_id gnl|my_center|LOCUS_27480 356787 356212 gene locus_tag LOCUS_27490 356787 356212 CDS product TerB family tellurite resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031691.1 protein_id gnl|my_center|LOCUS_27490 356952 357926 gene locus_tag LOCUS_27500 356952 357926 CDS product sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484222.1 protein_id gnl|my_center|LOCUS_27500 358099 358974 gene locus_tag LOCUS_27510 358099 358974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_27510 358981 361164 gene locus_tag LOCUS_27520 358981 361164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27520 361214 363319 gene locus_tag LOCUS_27530 361214 363319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27530 362408 362319 gene locus_tag LOCUS_t00470 362408 362319 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 363542 363820 gene locus_tag LOCUS_27540 363542 363820 CDS product phosphopantetheine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978314.1 protein_id gnl|my_center|LOCUS_27540 363817 365100 gene locus_tag LOCUS_27550 363817 365100 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027195.1 protein_id gnl|my_center|LOCUS_27550 365117 366142 gene locus_tag LOCUS_27560 365117 366142 CDS product acyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978316.1 protein_id gnl|my_center|LOCUS_27560 366403 367440 gene locus_tag LOCUS_27570 366403 367440 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729924.1 protein_id gnl|my_center|LOCUS_27570 367458 368453 gene locus_tag LOCUS_27580 367458 368453 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042510662.1 protein_id gnl|my_center|LOCUS_27580 368450 369256 gene locus_tag LOCUS_27590 368450 369256 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729922.1 protein_id gnl|my_center|LOCUS_27590 370812 369310 gene locus_tag LOCUS_27600 370812 369310 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030606.1 protein_id gnl|my_center|LOCUS_27600 371195 372262 gene locus_tag LOCUS_27610 371195 372262 CDS product DUF1479 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030607.1 protein_id gnl|my_center|LOCUS_27610 372244 373563 gene locus_tag LOCUS_27620 372244 373563 CDS product DUF6271 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030608.1 protein_id gnl|my_center|LOCUS_27620 373560 374744 gene locus_tag LOCUS_27630 373560 374744 CDS product type III PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030609.1 protein_id gnl|my_center|LOCUS_27630 374737 375288 gene locus_tag LOCUS_27640 374737 375288 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030610.1 protein_id gnl|my_center|LOCUS_27640 375288 376487 gene locus_tag LOCUS_27650 375288 376487 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972885.1 protein_id gnl|my_center|LOCUS_27650 377223 376495 gene locus_tag LOCUS_27660 377223 376495 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978335.1 protein_id gnl|my_center|LOCUS_27660 377446 378759 gene locus_tag LOCUS_27670 377446 378759 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971674.1 protein_id gnl|my_center|LOCUS_27670 379954 378815 gene locus_tag LOCUS_27680 379954 378815 CDS product DMATS family aromatic prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031680.1 protein_id gnl|my_center|LOCUS_27680 381507 380164 gene locus_tag LOCUS_27690 381507 380164 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972616.1 protein_id gnl|my_center|LOCUS_27690 382120 381527 gene locus_tag LOCUS_27700 382120 381527 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971676.1 protein_id gnl|my_center|LOCUS_27700 382472 382095 gene locus_tag LOCUS_27710 382472 382095 CDS product DUF742 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971677.1 protein_id gnl|my_center|LOCUS_27710 382870 382469 gene locus_tag LOCUS_27720 382870 382469 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971678.1 protein_id gnl|my_center|LOCUS_27720 384036 382867 gene locus_tag LOCUS_27730 384036 382867 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031678.1 protein_id gnl|my_center|LOCUS_27730 384332 384829 gene locus_tag LOCUS_27740 384332 384829 CDS product DUF2975 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026883.1 protein_id gnl|my_center|LOCUS_27740 384829 385113 gene locus_tag LOCUS_27750 384829 385113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27750 386553 385201 gene locus_tag LOCUS_27760 gene paaF 386553 385201 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031681.1 protein_id gnl|my_center|LOCUS_27760 386747 387730 gene locus_tag LOCUS_27770 gene paaA 386747 387730 CDS product 1,2-phenylacetyl-CoA epoxidase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031683.1 protein_id gnl|my_center|LOCUS_27770 387727 388017 gene locus_tag LOCUS_27780 gene paaB 387727 388017 CDS product 1,2-phenylacetyl-CoA epoxidase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971670.1 protein_id gnl|my_center|LOCUS_27780 388027 388854 gene locus_tag LOCUS_27790 gene paaC 388027 388854 CDS product phenylacetate-CoA oxygenase subunit PaaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031684.1 protein_id gnl|my_center|LOCUS_27790 388848 389363 gene locus_tag LOCUS_27800 gene paaJ 388848 389363 CDS product phenylacetate-CoA oxygenase subunit PaaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868899.1 protein_id gnl|my_center|LOCUS_27800 389363 390472 gene locus_tag LOCUS_27810 gene paaK 389363 390472 CDS product phenylacetate-CoA oxygenase/reductase subunit PaaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971667.1 protein_id gnl|my_center|LOCUS_27810 390604 391947 gene locus_tag LOCUS_27820 390604 391947 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031044.1 protein_id gnl|my_center|LOCUS_27820 392605 394260 gene locus_tag LOCUS_27830 392605 394260 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027225.1 protein_id gnl|my_center|LOCUS_27830 394345 394803 gene locus_tag LOCUS_27840 394345 394803 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_078495246.1 protein_id gnl|my_center|LOCUS_27840 394803 395156 gene locus_tag LOCUS_27850 394803 395156 CDS product DUF742 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978275.1 protein_id gnl|my_center|LOCUS_27850 395137 395754 gene locus_tag LOCUS_27860 395137 395754 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030862774.1 protein_id gnl|my_center|LOCUS_27860 395751 397016 gene locus_tag LOCUS_27870 395751 397016 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027221.1 protein_id gnl|my_center|LOCUS_27870 398289 397063 gene locus_tag LOCUS_27880 398289 397063 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027220.1 protein_id gnl|my_center|LOCUS_27880 398533 399603 gene locus_tag LOCUS_27890 398533 399603 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204071685.1 protein_id gnl|my_center|LOCUS_27890 399645 400073 gene locus_tag LOCUS_27900 399645 400073 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226817.1 protein_id gnl|my_center|LOCUS_27900 400914 400051 gene locus_tag LOCUS_27910 400914 400051 CDS product lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027227.1 protein_id gnl|my_center|LOCUS_27910 401634 400969 gene locus_tag LOCUS_27920 401634 400969 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031734.1 protein_id gnl|my_center|LOCUS_27920 402785 401727 gene locus_tag LOCUS_27930 402785 401727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27930 403465 402818 gene locus_tag LOCUS_27940 403465 402818 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973635.1 protein_id gnl|my_center|LOCUS_27940 404194 403544 gene locus_tag LOCUS_27950 404194 403544 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975219.1 protein_id gnl|my_center|LOCUS_27950 404398 405225 gene locus_tag LOCUS_27960 404398 405225 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029457.1 protein_id gnl|my_center|LOCUS_27960 406215 405265 gene locus_tag LOCUS_27970 gene gap 406215 405265 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971634.1 protein_id gnl|my_center|LOCUS_27970 407381 406425 gene locus_tag LOCUS_27980 407381 406425 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031713.1 protein_id gnl|my_center|LOCUS_27980 407699 407977 gene locus_tag LOCUS_27990 407699 407977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27990 408156 409274 gene locus_tag LOCUS_28000 408156 409274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28000 409271 409807 gene locus_tag LOCUS_28010 409271 409807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28010 409795 409886 gene locus_tag LOCUS_t00480 409795 409886 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 410021 410704 gene locus_tag LOCUS_28020 410021 410704 CDS product ScbR family autoregulator-binding transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972660.1 protein_id gnl|my_center|LOCUS_28020 410743 411285 gene locus_tag LOCUS_28030 410743 411285 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064289.1 protein_id gnl|my_center|LOCUS_28030 411356 411571 gene locus_tag LOCUS_28040 411356 411571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28040 412377 411649 gene locus_tag LOCUS_28050 gene slbR 412377 411649 CDS product gamma-butyrolactone-binding regulator SlbR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027242.1 protein_id gnl|my_center|LOCUS_28050 413830 412547 gene locus_tag LOCUS_28060 413830 412547 CDS product sulfite oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889484.1 protein_id gnl|my_center|LOCUS_28060 415839 413863 gene locus_tag LOCUS_28070 415839 413863 CDS product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230810.1 protein_id gnl|my_center|LOCUS_28070 416852 415836 gene locus_tag LOCUS_28080 416852 415836 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085761.1 protein_id gnl|my_center|LOCUS_28080 417398 417051 gene locus_tag LOCUS_28090 417398 417051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28090 417528 418655 gene locus_tag LOCUS_28100 417528 418655 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103708.1 protein_id gnl|my_center|LOCUS_28100 418652 419212 gene locus_tag LOCUS_28110 418652 419212 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973023.1 protein_id gnl|my_center|LOCUS_28110 419209 420168 gene locus_tag LOCUS_28120 419209 420168 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113500.1 protein_id gnl|my_center|LOCUS_28120 420189 421202 gene locus_tag LOCUS_28130 420189 421202 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085761.1 protein_id gnl|my_center|LOCUS_28130 421199 421963 gene locus_tag LOCUS_28140 421199 421963 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803880.1 protein_id gnl|my_center|LOCUS_28140 422023 423006 gene locus_tag LOCUS_28150 422023 423006 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086423.1 protein_id gnl|my_center|LOCUS_28150 423406 424644 gene locus_tag LOCUS_28160 423406 424644 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188478.1 protein_id gnl|my_center|LOCUS_28160 424826 425695 gene locus_tag LOCUS_28170 424826 425695 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388127.1 protein_id gnl|my_center|LOCUS_28170 426666 425764 gene locus_tag LOCUS_28180 426666 425764 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030651.1 protein_id gnl|my_center|LOCUS_28180 427450 426653 gene locus_tag LOCUS_28190 427450 426653 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972825.1 protein_id gnl|my_center|LOCUS_28190 428442 427492 gene locus_tag LOCUS_28200 428442 427492 CDS product aliphatic sulfonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030652.1 protein_id gnl|my_center|LOCUS_28200 428552 428965 gene locus_tag LOCUS_28210 428552 428965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28210 429451 428993 gene locus_tag LOCUS_28220 429451 428993 CDS product RrF2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730224.1 protein_id gnl|my_center|LOCUS_28220 430202 429510 gene locus_tag LOCUS_28230 430202 429510 CDS product maleylpyruvate isomerase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027175.1 protein_id gnl|my_center|LOCUS_28230 431451 430210 gene locus_tag LOCUS_28240 431451 430210 CDS product PP2C family protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_079030578.1 protein_id gnl|my_center|LOCUS_28240 432511 431639 gene locus_tag LOCUS_28250 432511 431639 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031714.1 protein_id gnl|my_center|LOCUS_28250 433180 434124 gene locus_tag LOCUS_28260 433180 434124 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230820.1 protein_id gnl|my_center|LOCUS_28260 434173 434832 gene locus_tag LOCUS_28270 434173 434832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975214.1 protein_id gnl|my_center|LOCUS_28270 434945 434811 gene locus_tag LOCUS_28280 434945 434811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28280 435028 435642 gene locus_tag LOCUS_28290 435028 435642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28290 436664 435765 gene locus_tag LOCUS_28300 436664 435765 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227678.1 protein_id gnl|my_center|LOCUS_28300 437108 436707 gene locus_tag LOCUS_28310 437108 436707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28310 437276 438331 gene locus_tag LOCUS_28320 437276 438331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28320 439867 438422 gene locus_tag LOCUS_28330 gene argG 439867 438422 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972108.1 protein_id gnl|my_center|LOCUS_28330 440119 440487 gene locus_tag LOCUS_28340 440119 440487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28340 441271 440492 gene locus_tag LOCUS_28350 441271 440492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28350 442965 441367 gene locus_tag LOCUS_28360 442965 441367 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969966.1 protein_id gnl|my_center|LOCUS_28360 443969 442962 gene locus_tag LOCUS_28370 443969 442962 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973520.1 protein_id gnl|my_center|LOCUS_28370 444964 443966 gene locus_tag LOCUS_28380 444964 443966 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973522.1 protein_id gnl|my_center|LOCUS_28380 446693 444969 gene locus_tag LOCUS_28390 446693 444969 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803733.1 protein_id gnl|my_center|LOCUS_28390 446596 447120 gene locus_tag LOCUS_28400 446596 447120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28400 447440 447084 gene locus_tag LOCUS_28410 447440 447084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28410 447378 448580 gene locus_tag LOCUS_28420 447378 448580 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728201.1 protein_id gnl|my_center|LOCUS_28420 448601 449974 gene locus_tag LOCUS_28430 448601 449974 CDS product NtaA/DmoA family FMN-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728200.1 protein_id gnl|my_center|LOCUS_28430 451504 450701 gene locus_tag LOCUS_28440 451504 450701 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226940.1 protein_id gnl|my_center|LOCUS_28440 452143 451610 gene locus_tag LOCUS_28450 452143 451610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28450 452904 452176 gene locus_tag LOCUS_28460 452904 452176 CDS product GAF and ANTAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029394.1 protein_id gnl|my_center|LOCUS_28460 453203 453367 gene locus_tag LOCUS_28470 gene rpmG 453203 453367 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978292.1 protein_id gnl|my_center|LOCUS_28470 454000 453422 gene locus_tag LOCUS_28480 454000 453422 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027107.1 protein_id gnl|my_center|LOCUS_28480 454829 453993 gene locus_tag LOCUS_28490 454829 453993 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027106.1 protein_id gnl|my_center|LOCUS_28490 456126 454876 gene locus_tag LOCUS_28500 456126 454876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28500 456747 457436 gene locus_tag LOCUS_28510 456747 457436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28510 458025 457507 gene locus_tag LOCUS_28520 458025 457507 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086804.1 protein_id gnl|my_center|LOCUS_28520 459386 458088 gene locus_tag LOCUS_28530 459386 458088 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_078328724.1 protein_id gnl|my_center|LOCUS_28530 459837 468437 gene locus_tag LOCUS_28540 459837 468437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28540 468430 472287 gene locus_tag LOCUS_28550 468430 472287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28550 472365 472559 gene locus_tag LOCUS_28560 472365 472559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28560 474115 472631 gene locus_tag LOCUS_28570 474115 472631 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228885.1 protein_id gnl|my_center|LOCUS_28570 474363 474115 gene locus_tag LOCUS_28580 474363 474115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28580 474658 475695 gene locus_tag LOCUS_28590 gene paaA 474658 475695 CDS product 1,2-phenylacetyl-CoA epoxidase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223463.1 protein_id gnl|my_center|LOCUS_28590 475692 476003 gene locus_tag LOCUS_28600 gene paaB 475692 476003 CDS product 1,2-phenylacetyl-CoA epoxidase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167454960.1 protein_id gnl|my_center|LOCUS_28600 475987 476775 gene locus_tag LOCUS_28610 gene paaC 475987 476775 CDS product phenylacetate-CoA oxygenase subunit PaaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965788.1 protein_id gnl|my_center|LOCUS_28610 476772 477272 gene locus_tag LOCUS_28620 gene paaJ 476772 477272 CDS product phenylacetate-CoA oxygenase subunit PaaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868899.1 protein_id gnl|my_center|LOCUS_28620 477269 478555 gene locus_tag LOCUS_28630 gene paaK 477269 478555 CDS product phenylacetate-CoA oxygenase/reductase subunit PaaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971667.1 protein_id gnl|my_center|LOCUS_28630 478606 479385 gene locus_tag LOCUS_28640 478606 479385 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972643.1 protein_id gnl|my_center|LOCUS_28640 479411 480247 gene locus_tag LOCUS_28650 479411 480247 CDS product tryptophan 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029139.1 protein_id gnl|my_center|LOCUS_28650 480237 481073 gene locus_tag LOCUS_28660 480237 481073 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975294.1 protein_id gnl|my_center|LOCUS_28660 481070 482314 gene locus_tag LOCUS_28670 gene kynU 481070 482314 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029138.1 protein_id gnl|my_center|LOCUS_28670 482707 482330 gene locus_tag LOCUS_28680 482707 482330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28680 483182 482691 gene locus_tag LOCUS_28690 483182 482691 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975205.1 protein_id gnl|my_center|LOCUS_28690 483814 483179 gene locus_tag LOCUS_28700 483814 483179 CDS product class F sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029197.1 protein_id gnl|my_center|LOCUS_28700 484179 483811 gene locus_tag LOCUS_28710 484179 483811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28710 485154 484297 gene locus_tag LOCUS_28720 485154 484297 CDS product biotin-dependent carboxyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027120.1 protein_id gnl|my_center|LOCUS_28720 485882 485151 gene locus_tag LOCUS_28730 485882 485151 CDS product allophanate hydrolase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027119.1 protein_id gnl|my_center|LOCUS_28730 486631 485879 gene locus_tag LOCUS_28740 486631 485879 CDS product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027118.1 protein_id gnl|my_center|LOCUS_28740 486894 487613 gene locus_tag LOCUS_28750 486894 487613 CDS product DUF969 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027117.1 protein_id gnl|my_center|LOCUS_28750 487610 488584 gene locus_tag LOCUS_28760 487610 488584 CDS product DUF979 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978427.1 protein_id gnl|my_center|LOCUS_28760 488623 489267 gene locus_tag LOCUS_28770 gene pcp 488623 489267 CDS product pyroglutamyl-peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027116.1 protein_id gnl|my_center|LOCUS_28770 489267 490271 gene locus_tag LOCUS_28780 489267 490271 CDS product DUF2891 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027115.1 protein_id gnl|my_center|LOCUS_28780 491276 490284 gene locus_tag LOCUS_28790 491276 490284 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270028.1 protein_id gnl|my_center|LOCUS_28790 491432 492016 gene locus_tag LOCUS_28800 491432 492016 CDS product cysteine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028285.1 protein_id gnl|my_center|LOCUS_28800 492060 493391 gene locus_tag LOCUS_28810 492060 493391 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777141.1 protein_id gnl|my_center|LOCUS_28810 493843 493412 gene locus_tag LOCUS_28820 493843 493412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28820 493950 495416 gene locus_tag LOCUS_28830 493950 495416 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000644775.1 protein_id gnl|my_center|LOCUS_28830 495590 497491 gene locus_tag LOCUS_28840 gene htpG 495590 497491 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971629.1 protein_id gnl|my_center|LOCUS_28840 497919 497590 gene locus_tag LOCUS_28850 497919 497590 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031863.1 protein_id gnl|my_center|LOCUS_28850 499756 498011 gene locus_tag LOCUS_28860 499756 498011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28860 500286 499894 gene locus_tag LOCUS_28870 500286 499894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28870 500441 501334 gene locus_tag LOCUS_28880 500441 501334 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230083.1 protein_id gnl|my_center|LOCUS_28880 502087 501350 gene locus_tag LOCUS_28890 502087 501350 CDS product triacylglycerol lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888709.1 protein_id gnl|my_center|LOCUS_28890 502290 502829 gene locus_tag LOCUS_28900 502290 502829 CDS product phenolic acid decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099178.1 protein_id gnl|my_center|LOCUS_28900 503253 502822 gene locus_tag LOCUS_28910 503253 502822 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031467.1 protein_id gnl|my_center|LOCUS_28910 503143 503364 gene locus_tag LOCUS_28920 503143 503364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28920 503432 503761 gene locus_tag LOCUS_28930 503432 503761 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_199864957.1 protein_id gnl|my_center|LOCUS_28930 503758 504147 gene locus_tag LOCUS_28940 503758 504147 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730705.1 protein_id gnl|my_center|LOCUS_28940 507339 504205 gene locus_tag LOCUS_28950 507339 504205 CDS product VCBS repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109036420.1 protein_id gnl|my_center|LOCUS_28950 >Feature sequence06 827 156 gene locus_tag LOCUS_28960 827 156 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029450.1 protein_id gnl|my_center|LOCUS_28960 2062 824 gene locus_tag LOCUS_28970 2062 824 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487607.1 protein_id gnl|my_center|LOCUS_28970 2196 2744 gene locus_tag LOCUS_28980 2196 2744 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974845.1 protein_id gnl|my_center|LOCUS_28980 4340 2733 gene locus_tag LOCUS_28990 4340 2733 CDS product type IV secretory system conjugative DNA transfer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029453.1 protein_id gnl|my_center|LOCUS_28990 5774 4362 gene locus_tag LOCUS_29000 5774 4362 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974843.1 protein_id gnl|my_center|LOCUS_29000 7346 5787 gene locus_tag LOCUS_29010 7346 5787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326782.1 protein_id gnl|my_center|LOCUS_29010 8689 7343 gene locus_tag LOCUS_29020 8689 7343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173668748.1 protein_id gnl|my_center|LOCUS_29020 9452 8679 gene locus_tag LOCUS_29030 9452 8679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029454.1 protein_id gnl|my_center|LOCUS_29030 9950 9642 gene locus_tag LOCUS_29040 9950 9642 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974839.1 protein_id gnl|my_center|LOCUS_29040 10379 11383 gene locus_tag LOCUS_29050 gene tgdA 10379 11383 CDS product transglycosylase TgdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029455.1 protein_id gnl|my_center|LOCUS_29050 11608 12324 gene locus_tag LOCUS_29060 11608 12324 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974837.1 protein_id gnl|my_center|LOCUS_29060 13908 12355 gene locus_tag LOCUS_29070 13908 12355 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222690.1 protein_id gnl|my_center|LOCUS_29070 14698 15519 gene locus_tag LOCUS_29080 14698 15519 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029457.1 protein_id gnl|my_center|LOCUS_29080 15597 15773 gene locus_tag LOCUS_29090 15597 15773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29090 16155 15787 gene locus_tag LOCUS_29100 16155 15787 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029458.1 protein_id gnl|my_center|LOCUS_29100 16395 17015 gene locus_tag LOCUS_29110 16395 17015 CDS product DUF47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974832.1 protein_id gnl|my_center|LOCUS_29110 17025 18023 gene locus_tag LOCUS_29120 gene pitH 17025 18023 CDS product low-affinity phosphate transporter PitH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029459.1 protein_id gnl|my_center|LOCUS_29120 18939 18163 gene locus_tag LOCUS_29130 gene pstB 18939 18163 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974830.1 protein_id gnl|my_center|LOCUS_29130 20042 18975 gene locus_tag LOCUS_29140 gene pstA 20042 18975 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974829.1 protein_id gnl|my_center|LOCUS_29140 21040 20039 gene locus_tag LOCUS_29150 gene pstC 21040 20039 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029460.1 protein_id gnl|my_center|LOCUS_29150 22301 21171 gene locus_tag LOCUS_29160 gene pstS 22301 21171 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974827.1 protein_id gnl|my_center|LOCUS_29160 23001 22552 gene locus_tag LOCUS_29170 23001 22552 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029461.1 protein_id gnl|my_center|LOCUS_29170 24095 23046 gene locus_tag LOCUS_29180 24095 23046 CDS product CHAD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487611.1 protein_id gnl|my_center|LOCUS_29180 26316 24076 gene locus_tag LOCUS_29190 26316 24076 CDS product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270140.1 protein_id gnl|my_center|LOCUS_29190 26640 27182 gene locus_tag LOCUS_29200 26640 27182 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029464.1 protein_id gnl|my_center|LOCUS_29200 27179 28027 gene locus_tag LOCUS_29210 27179 28027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974822.1 protein_id gnl|my_center|LOCUS_29210 28028 28888 gene locus_tag LOCUS_29220 28028 28888 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029465.1 protein_id gnl|my_center|LOCUS_29220 28885 30402 gene locus_tag LOCUS_29230 28885 30402 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029466.1 protein_id gnl|my_center|LOCUS_29230 30393 31019 gene locus_tag LOCUS_29240 30393 31019 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168715281.1 protein_id gnl|my_center|LOCUS_29240 32044 31118 gene locus_tag LOCUS_29250 gene mshD 32044 31118 CDS product mycothiol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974818.1 protein_id gnl|my_center|LOCUS_29250 32264 34024 gene locus_tag LOCUS_29260 32264 34024 CDS product bifunctional metallophosphatase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029468.1 protein_id gnl|my_center|LOCUS_29260 35174 34098 gene locus_tag LOCUS_29270 35174 34098 CDS product pectinesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226281.1 protein_id gnl|my_center|LOCUS_29270 35527 35258 gene locus_tag LOCUS_29280 35527 35258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108989336.1 protein_id gnl|my_center|LOCUS_29280 35646 36473 gene locus_tag LOCUS_29290 35646 36473 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974794.1 protein_id gnl|my_center|LOCUS_29290 36470 36661 gene locus_tag LOCUS_29300 36470 36661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29300 38124 36652 gene locus_tag LOCUS_29310 38124 36652 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029471.1 protein_id gnl|my_center|LOCUS_29310 38957 38121 gene locus_tag LOCUS_29320 38957 38121 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029472.1 protein_id gnl|my_center|LOCUS_29320 40131 39019 gene locus_tag LOCUS_29330 40131 39019 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186009689.1 protein_id gnl|my_center|LOCUS_29330 41239 40217 gene locus_tag LOCUS_29340 41239 40217 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974813.1 protein_id gnl|my_center|LOCUS_29340 42181 41399 gene locus_tag LOCUS_29350 gene glnR 42181 41399 CDS product two-component system response regulator GlnR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029474.1 protein_id gnl|my_center|LOCUS_29350 42426 43187 gene locus_tag LOCUS_29360 42426 43187 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974811.1 protein_id gnl|my_center|LOCUS_29360 43226 43480 gene locus_tag LOCUS_29370 43226 43480 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974810.1 protein_id gnl|my_center|LOCUS_29370 43484 44740 gene locus_tag LOCUS_29380 43484 44740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29380 44843 45580 gene locus_tag LOCUS_29390 44843 45580 CDS product DUF2993 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974808.1 protein_id gnl|my_center|LOCUS_29390 46001 46840 gene locus_tag LOCUS_29400 46001 46840 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974806.1 protein_id gnl|my_center|LOCUS_29400 46868 47155 gene locus_tag LOCUS_29410 46868 47155 CDS product DUF1416 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974805.1 protein_id gnl|my_center|LOCUS_29410 47262 47513 gene locus_tag LOCUS_29420 47262 47513 CDS product DUF3099 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326801.1 protein_id gnl|my_center|LOCUS_29420 47914 47552 gene locus_tag LOCUS_29430 47914 47552 CDS product DsrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974797.1 protein_id gnl|my_center|LOCUS_29430 47995 48129 gene locus_tag LOCUS_29440 47995 48129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29440 48170 48745 gene locus_tag LOCUS_29450 48170 48745 CDS product FABP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974791.1 protein_id gnl|my_center|LOCUS_29450 48777 49214 gene locus_tag LOCUS_29460 48777 49214 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974790.1 protein_id gnl|my_center|LOCUS_29460 49225 50190 gene locus_tag LOCUS_29470 49225 50190 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974789.1 protein_id gnl|my_center|LOCUS_29470 50623 50198 gene locus_tag LOCUS_29480 gene dtd 50623 50198 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029487.1 protein_id gnl|my_center|LOCUS_29480 50793 51401 gene locus_tag LOCUS_29490 50793 51401 CDS product aerial mycelium formation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029488.1 protein_id gnl|my_center|LOCUS_29490 51469 52722 gene locus_tag LOCUS_29500 51469 52722 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974785.1 protein_id gnl|my_center|LOCUS_29500 53050 52865 gene locus_tag LOCUS_29510 53050 52865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029490.1 protein_id gnl|my_center|LOCUS_29510 53245 54156 gene locus_tag LOCUS_29520 53245 54156 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029489.1 protein_id gnl|my_center|LOCUS_29520 54382 54194 gene locus_tag LOCUS_29530 54382 54194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29530 54547 55410 gene locus_tag LOCUS_29540 54547 55410 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974781.1 protein_id gnl|my_center|LOCUS_29540 55410 56138 gene locus_tag LOCUS_29550 55410 56138 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974780.1 protein_id gnl|my_center|LOCUS_29550 56325 56143 gene locus_tag LOCUS_29560 56325 56143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29560 56474 57316 gene locus_tag LOCUS_29570 56474 57316 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974781.1 protein_id gnl|my_center|LOCUS_29570 58056 57220 gene locus_tag LOCUS_29580 58056 57220 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974780.1 protein_id gnl|my_center|LOCUS_29580 58128 59264 gene locus_tag LOCUS_29590 58128 59264 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029491.1 protein_id gnl|my_center|LOCUS_29590 59395 60582 gene locus_tag LOCUS_29600 59395 60582 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029491.1 protein_id gnl|my_center|LOCUS_29600 60592 61197 gene locus_tag LOCUS_29610 60592 61197 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974777.1 protein_id gnl|my_center|LOCUS_29610 61249 63276 gene locus_tag LOCUS_29620 61249 63276 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029494.1 protein_id gnl|my_center|LOCUS_29620 64456 63284 gene locus_tag LOCUS_29630 64456 63284 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027238.1 protein_id gnl|my_center|LOCUS_29630 65376 64792 gene locus_tag LOCUS_29640 65376 64792 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031763.1 protein_id gnl|my_center|LOCUS_29640 65601 67811 gene locus_tag LOCUS_29650 gene helR 65601 67811 CDS product RNA polymerase recycling motor ATPase HelR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728199.1 protein_id gnl|my_center|LOCUS_29650 68335 67769 gene locus_tag LOCUS_29660 68335 67769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29660 68529 69053 gene locus_tag LOCUS_29670 68529 69053 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029496.1 protein_id gnl|my_center|LOCUS_29670 69130 69732 gene locus_tag LOCUS_29680 69130 69732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29680 69832 70173 gene locus_tag LOCUS_29690 69832 70173 CDS product DUF2516 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868443.1 protein_id gnl|my_center|LOCUS_29690 71574 70246 gene locus_tag LOCUS_29700 71574 70246 CDS product fused response regulator/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487464.1 protein_id gnl|my_center|LOCUS_29700 72971 71874 gene locus_tag LOCUS_29710 72971 71874 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029498.1 protein_id gnl|my_center|LOCUS_29710 73941 73204 gene locus_tag LOCUS_29720 73941 73204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974768.1 protein_id gnl|my_center|LOCUS_29720 74207 75544 gene locus_tag LOCUS_29730 gene mshA 74207 75544 CDS product D-inositol-3-phosphate glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326818.1 protein_id gnl|my_center|LOCUS_29730 75537 76043 gene locus_tag LOCUS_29740 75537 76043 CDS product YbjN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974766.1 protein_id gnl|my_center|LOCUS_29740 76104 76907 gene locus_tag LOCUS_29750 76104 76907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29750 77695 76889 gene locus_tag LOCUS_29760 77695 76889 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029500.1 protein_id gnl|my_center|LOCUS_29760 77746 78186 gene locus_tag LOCUS_29770 77746 78186 CDS product DUF2000 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974764.1 protein_id gnl|my_center|LOCUS_29770 78602 78291 gene locus_tag LOCUS_29780 78602 78291 CDS product MazG-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028253.1 protein_id gnl|my_center|LOCUS_29780 80095 78863 gene locus_tag LOCUS_29790 80095 78863 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029501.1 protein_id gnl|my_center|LOCUS_29790 80274 81035 gene locus_tag LOCUS_29800 80274 81035 CDS product phosphoglyceromutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974762.1 protein_id gnl|my_center|LOCUS_29800 81312 81124 gene locus_tag LOCUS_29810 81312 81124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29810 82488 81850 gene locus_tag LOCUS_29820 82488 81850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29820 83098 82628 gene locus_tag LOCUS_29830 83098 82628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29830 83253 83098 gene locus_tag LOCUS_29840 83253 83098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29840 83572 84003 gene locus_tag LOCUS_29850 83572 84003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29850 84778 84281 gene locus_tag LOCUS_29860 84778 84281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975542.1 protein_id gnl|my_center|LOCUS_29860 86251 84797 gene locus_tag LOCUS_29870 86251 84797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29870 86649 86341 gene locus_tag LOCUS_29880 86649 86341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29880 86584 87258 gene locus_tag LOCUS_29890 86584 87258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29890 88535 87675 gene locus_tag LOCUS_29900 88535 87675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29900 88967 88725 gene locus_tag LOCUS_29910 88967 88725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29910 89233 88982 gene locus_tag LOCUS_29920 89233 88982 CDS product DUF1653 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380890.1 protein_id gnl|my_center|LOCUS_29920 89691 89461 gene locus_tag LOCUS_29930 89691 89461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29930 89748 90122 gene locus_tag LOCUS_29940 89748 90122 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971536.1 protein_id gnl|my_center|LOCUS_29940 90184 90729 gene locus_tag LOCUS_29950 90184 90729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29950 90981 90748 gene locus_tag LOCUS_29960 90981 90748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29960 91917 91084 gene locus_tag LOCUS_29970 91917 91084 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028635.1 protein_id gnl|my_center|LOCUS_29970 92429 91914 gene locus_tag LOCUS_29980 92429 91914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030180053.1 protein_id gnl|my_center|LOCUS_29980 92625 92413 gene locus_tag LOCUS_29990 92625 92413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29990 93218 92871 gene locus_tag LOCUS_30000 93218 92871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30000 93559 93404 gene locus_tag LOCUS_30010 93559 93404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30010 94404 93715 gene locus_tag LOCUS_30020 gene phoU 94404 93715 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974747.1 protein_id gnl|my_center|LOCUS_30020 94617 95885 gene locus_tag LOCUS_30030 94617 95885 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974746.1 protein_id gnl|my_center|LOCUS_30030 95882 96562 gene locus_tag LOCUS_30040 95882 96562 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974745.1 protein_id gnl|my_center|LOCUS_30040 97422 96718 gene locus_tag LOCUS_30050 97422 96718 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029520.1 protein_id gnl|my_center|LOCUS_30050 98079 98561 gene locus_tag LOCUS_30060 98079 98561 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003953493.1 protein_id gnl|my_center|LOCUS_30060 98858 99634 gene locus_tag LOCUS_30070 gene ispD 98858 99634 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029521.1 protein_id gnl|my_center|LOCUS_30070 99624 100139 gene locus_tag LOCUS_30080 gene ispF 99624 100139 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029522.1 protein_id gnl|my_center|LOCUS_30080 100246 101664 gene locus_tag LOCUS_30090 gene cysS 100246 101664 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868385.1 protein_id gnl|my_center|LOCUS_30090 101766 102707 gene locus_tag LOCUS_30100 gene rlmB 101766 102707 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029524.1 protein_id gnl|my_center|LOCUS_30100 102808 104538 gene locus_tag LOCUS_30110 102808 104538 CDS product DoxX family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063739108.1 protein_id gnl|my_center|LOCUS_30110 105434 104700 gene locus_tag LOCUS_30120 105434 104700 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974737.1 protein_id gnl|my_center|LOCUS_30120 105935 105468 gene locus_tag LOCUS_30130 105935 105468 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029526.1 protein_id gnl|my_center|LOCUS_30130 107280 106144 gene locus_tag LOCUS_30140 gene msiK 107280 106144 CDS product diacetylchitobiose ABC transporter ATP-binding protein MsiK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029527.1 protein_id gnl|my_center|LOCUS_30140 107562 107637 gene locus_tag LOCUS_t00490 107562 107637 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 108368 107715 gene locus_tag LOCUS_30150 108368 107715 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029539.1 protein_id gnl|my_center|LOCUS_30150 108556 111330 gene locus_tag LOCUS_30160 108556 111330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_30160 112536 111631 gene locus_tag LOCUS_30170 112536 111631 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030867073.1 protein_id gnl|my_center|LOCUS_30170 114279 112723 gene locus_tag LOCUS_30180 114279 112723 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029543.1 protein_id gnl|my_center|LOCUS_30180 115256 114276 gene locus_tag LOCUS_30190 115256 114276 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974709.1 protein_id gnl|my_center|LOCUS_30190 116459 115299 gene locus_tag LOCUS_30200 116459 115299 CDS product NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974708.1 protein_id gnl|my_center|LOCUS_30200 116627 117301 gene locus_tag LOCUS_30210 116627 117301 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326845.1 protein_id gnl|my_center|LOCUS_30210 117844 117344 gene locus_tag LOCUS_30220 117844 117344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974706.1 protein_id gnl|my_center|LOCUS_30220 119277 117874 gene locus_tag LOCUS_30230 119277 117874 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029546.1 protein_id gnl|my_center|LOCUS_30230 119933 119367 gene locus_tag LOCUS_30240 119933 119367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30240 120149 121504 gene locus_tag LOCUS_30250 120149 121504 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029547.1 protein_id gnl|my_center|LOCUS_30250 121501 122157 gene locus_tag LOCUS_30260 121501 122157 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029548.1 protein_id gnl|my_center|LOCUS_30260 122897 122322 gene locus_tag LOCUS_30270 122897 122322 CDS product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974698.1 protein_id gnl|my_center|LOCUS_30270 123062 123499 gene locus_tag LOCUS_30280 gene arfB 123062 123499 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974697.1 protein_id gnl|my_center|LOCUS_30280 124028 123537 gene locus_tag LOCUS_30290 124028 123537 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109035270.1 protein_id gnl|my_center|LOCUS_30290 123913 124140 gene locus_tag LOCUS_30300 123913 124140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30300 124401 126062 gene locus_tag LOCUS_30310 gene cdgB 124401 126062 CDS product diguanylate cyclase CdgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029551.1 protein_id gnl|my_center|LOCUS_30310 126182 127132 gene locus_tag LOCUS_30320 126182 127132 CDS product CBM35 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029552.1 protein_id gnl|my_center|LOCUS_30320 128075 127146 gene locus_tag LOCUS_30330 128075 127146 CDS product 1-phosphofructokinase family hexose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029553.1 protein_id gnl|my_center|LOCUS_30330 129384 128197 gene locus_tag LOCUS_30340 gene nagA 129384 128197 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029554.1 protein_id gnl|my_center|LOCUS_30340 130325 129381 gene locus_tag LOCUS_30350 130325 129381 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029555.1 protein_id gnl|my_center|LOCUS_30350 130471 131706 gene locus_tag LOCUS_30360 130471 131706 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136207383.1 protein_id gnl|my_center|LOCUS_30360 131703 132002 gene locus_tag LOCUS_30370 131703 132002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30370 132086 132952 gene locus_tag LOCUS_30380 gene otsB 132086 132952 CDS product trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029558.1 protein_id gnl|my_center|LOCUS_30380 134673 133312 gene locus_tag LOCUS_30390 134673 133312 CDS product trehalose-6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029560.1 protein_id gnl|my_center|LOCUS_30390 135708 134764 gene locus_tag LOCUS_30400 135708 134764 CDS product glucosyl-3-phosphoglycerate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974682.1 protein_id gnl|my_center|LOCUS_30400 136028 137320 gene locus_tag LOCUS_30410 gene thrC 136028 137320 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270150.1 protein_id gnl|my_center|LOCUS_30410 137364 137639 gene locus_tag LOCUS_30420 137364 137639 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974680.1 protein_id gnl|my_center|LOCUS_30420 138053 138256 gene locus_tag LOCUS_30430 138053 138256 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004929928.1 protein_id gnl|my_center|LOCUS_30430 138571 140193 gene locus_tag LOCUS_30440 gene groL 138571 140193 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974678.1 protein_id gnl|my_center|LOCUS_30440 140404 141534 gene locus_tag LOCUS_30450 140404 141534 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974677.1 protein_id gnl|my_center|LOCUS_30450 141614 143152 gene locus_tag LOCUS_30460 141614 143152 CDS product carboxylesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029563.1 protein_id gnl|my_center|LOCUS_30460 142820 142901 gene locus_tag LOCUS_t00500 142820 142901 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 143732 143166 gene locus_tag LOCUS_30470 143732 143166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029569.1 protein_id gnl|my_center|LOCUS_30470 145174 143774 gene locus_tag LOCUS_30480 145174 143774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30480 146126 145191 gene locus_tag LOCUS_30490 gene murQ 146126 145191 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029570.1 protein_id gnl|my_center|LOCUS_30490 147125 146196 gene locus_tag LOCUS_30500 147125 146196 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974666.1 protein_id gnl|my_center|LOCUS_30500 147181 147561 gene locus_tag LOCUS_30510 147181 147561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974665.1 protein_id gnl|my_center|LOCUS_30510 147558 147848 gene locus_tag LOCUS_30520 147558 147848 CDS product DUF4031 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974664.1 protein_id gnl|my_center|LOCUS_30520 149016 147946 gene locus_tag LOCUS_30530 149016 147946 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029571.1 protein_id gnl|my_center|LOCUS_30530 149683 149027 gene locus_tag LOCUS_30540 149683 149027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974662.1 protein_id gnl|my_center|LOCUS_30540 149749 150414 gene locus_tag LOCUS_30550 149749 150414 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029573.1 protein_id gnl|my_center|LOCUS_30550 150489 151178 gene locus_tag LOCUS_30560 150489 151178 CDS product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029574.1 protein_id gnl|my_center|LOCUS_30560 153260 151206 gene locus_tag LOCUS_30570 153260 151206 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029575.1 protein_id gnl|my_center|LOCUS_30570 155116 153473 gene locus_tag LOCUS_30580 155116 153473 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005063651.1 protein_id gnl|my_center|LOCUS_30580 157867 155306 gene locus_tag LOCUS_30590 157867 155306 CDS product helicase-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029578.1 protein_id gnl|my_center|LOCUS_30590 157969 159030 gene locus_tag LOCUS_30600 157969 159030 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029579.1 protein_id gnl|my_center|LOCUS_30600 159140 159787 gene locus_tag LOCUS_30610 159140 159787 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029580.1 protein_id gnl|my_center|LOCUS_30610 160014 159757 gene locus_tag LOCUS_30620 160014 159757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974651.1 protein_id gnl|my_center|LOCUS_30620 160165 160548 gene locus_tag LOCUS_30630 160165 160548 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974650.1 protein_id gnl|my_center|LOCUS_30630 161462 160575 gene locus_tag LOCUS_30640 161462 160575 CDS product 1,4-dihydroxy-6-naphthoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974649.1 protein_id gnl|my_center|LOCUS_30640 162144 161416 gene locus_tag LOCUS_30650 162144 161416 CDS product futalosine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326870.1 protein_id gnl|my_center|LOCUS_30650 162638 162168 gene locus_tag LOCUS_30660 162638 162168 CDS product DUF2771 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173668749.1 protein_id gnl|my_center|LOCUS_30660 164108 162744 gene locus_tag LOCUS_30670 164108 162744 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029582.1 protein_id gnl|my_center|LOCUS_30670 164462 165388 gene locus_tag LOCUS_30680 164462 165388 CDS product DUF3027 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974645.1 protein_id gnl|my_center|LOCUS_30680 165778 168903 gene locus_tag LOCUS_30690 165778 168903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029583.1 protein_id gnl|my_center|LOCUS_30690 169061 169933 gene locus_tag LOCUS_30700 169061 169933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30700 169959 170735 gene locus_tag LOCUS_30710 169959 170735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30710 173142 170740 gene locus_tag LOCUS_30720 173142 170740 CDS product HAD-IC family P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029584.1 protein_id gnl|my_center|LOCUS_30720 173573 173286 gene locus_tag LOCUS_30730 173573 173286 CDS product DUF2530 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029585.1 protein_id gnl|my_center|LOCUS_30730 173738 175153 gene locus_tag LOCUS_30740 173738 175153 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029586.1 protein_id gnl|my_center|LOCUS_30740 175361 175798 gene locus_tag LOCUS_30750 175361 175798 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974639.1 protein_id gnl|my_center|LOCUS_30750 175905 177179 gene locus_tag LOCUS_30760 175905 177179 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974638.1 protein_id gnl|my_center|LOCUS_30760 177382 177936 gene locus_tag LOCUS_30770 gene thpR 177382 177936 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029587.1 protein_id gnl|my_center|LOCUS_30770 179066 178074 gene locus_tag LOCUS_30780 179066 178074 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030673054.1 protein_id gnl|my_center|LOCUS_30780 179702 179115 gene locus_tag LOCUS_30790 179702 179115 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030867169.1 protein_id gnl|my_center|LOCUS_30790 180469 179786 gene locus_tag LOCUS_30800 180469 179786 CDS product GDSL-type esterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974625.1 protein_id gnl|my_center|LOCUS_30800 180558 181517 gene locus_tag LOCUS_30810 180558 181517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030867176.1 protein_id gnl|my_center|LOCUS_30810 181910 181461 gene locus_tag LOCUS_30820 181910 181461 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326908.1 protein_id gnl|my_center|LOCUS_30820 182037 182909 gene locus_tag LOCUS_30830 182037 182909 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977589.1 protein_id gnl|my_center|LOCUS_30830 182902 183084 gene locus_tag LOCUS_30840 182902 183084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30840 184258 183140 gene locus_tag LOCUS_30850 gene serC 184258 183140 CDS product phosphoserine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029607.1 protein_id gnl|my_center|LOCUS_30850 184349 187240 gene locus_tag LOCUS_30860 184349 187240 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029608.1 protein_id gnl|my_center|LOCUS_30860 187724 187272 gene locus_tag LOCUS_30870 187724 187272 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326890.1 protein_id gnl|my_center|LOCUS_30870 187871 188848 gene locus_tag LOCUS_30880 187871 188848 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974609.1 protein_id gnl|my_center|LOCUS_30880 189016 189954 gene locus_tag LOCUS_30890 189016 189954 CDS product TIGR03084 family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270155.1 protein_id gnl|my_center|LOCUS_30890 189951 191621 gene locus_tag LOCUS_30900 189951 191621 CDS product DUF1446 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029617.1 protein_id gnl|my_center|LOCUS_30900 191618 193216 gene locus_tag LOCUS_30910 191618 193216 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974603.1 protein_id gnl|my_center|LOCUS_30910 193225 195066 gene locus_tag LOCUS_30920 193225 195066 CDS product biotin carboxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029618.1 protein_id gnl|my_center|LOCUS_30920 195126 196265 gene locus_tag LOCUS_30930 195126 196265 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029619.1 protein_id gnl|my_center|LOCUS_30930 196305 197873 gene locus_tag LOCUS_30940 196305 197873 CDS product 4-coumarate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029620.1 protein_id gnl|my_center|LOCUS_30940 197870 198607 gene locus_tag LOCUS_30950 197870 198607 CDS product enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974599.1 protein_id gnl|my_center|LOCUS_30950 198595 199254 gene locus_tag LOCUS_30960 198595 199254 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030867225.1 protein_id gnl|my_center|LOCUS_30960 199944 199276 gene locus_tag LOCUS_30970 gene pdxH 199944 199276 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029623.1 protein_id gnl|my_center|LOCUS_30970 200119 201219 gene locus_tag LOCUS_30980 200119 201219 CDS product citrate synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029624.1 protein_id gnl|my_center|LOCUS_30980 201624 203039 gene locus_tag LOCUS_30990 201624 203039 CDS product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051815090.1 protein_id gnl|my_center|LOCUS_30990 203842 203087 gene locus_tag LOCUS_31000 203842 203087 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974589.1 protein_id gnl|my_center|LOCUS_31000 204126 204752 gene locus_tag LOCUS_31010 204126 204752 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974588.1 protein_id gnl|my_center|LOCUS_31010 205434 206315 gene locus_tag LOCUS_31020 205434 206315 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326902.1 protein_id gnl|my_center|LOCUS_31020 207053 206400 gene locus_tag LOCUS_31030 207053 206400 CDS product bifunctional DNA primase/polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974584.1 protein_id gnl|my_center|LOCUS_31030 207389 208774 gene locus_tag LOCUS_31040 207389 208774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029632.1 protein_id gnl|my_center|LOCUS_31040 208913 210454 gene locus_tag LOCUS_31050 208913 210454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030867240.1 protein_id gnl|my_center|LOCUS_31050 211778 210471 gene locus_tag LOCUS_31060 211778 210471 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974581.1 protein_id gnl|my_center|LOCUS_31060 211950 212396 gene locus_tag LOCUS_31070 211950 212396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974580.1 protein_id gnl|my_center|LOCUS_31070 212444 213325 gene locus_tag LOCUS_31080 gene purU 212444 213325 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974579.1 protein_id gnl|my_center|LOCUS_31080 214612 213446 gene locus_tag LOCUS_31090 214612 213446 CDS product zf-HC2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029636.1 protein_id gnl|my_center|LOCUS_31090 215190 214609 gene locus_tag LOCUS_31100 215190 214609 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974573.1 protein_id gnl|my_center|LOCUS_31100 215440 215820 gene locus_tag LOCUS_31110 215440 215820 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974572.1 protein_id gnl|my_center|LOCUS_31110 215957 216469 gene locus_tag LOCUS_31120 gene calD 215957 216469 CDS product calcium binding protein CalD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974571.1 protein_id gnl|my_center|LOCUS_31120 216801 217262 gene locus_tag LOCUS_31130 216801 217262 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326908.1 protein_id gnl|my_center|LOCUS_31130 218560 217502 gene locus_tag LOCUS_31140 218560 217502 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974569.1 protein_id gnl|my_center|LOCUS_31140 218633 219946 gene locus_tag LOCUS_31150 218633 219946 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029637.1 protein_id gnl|my_center|LOCUS_31150 221156 219966 gene locus_tag LOCUS_31160 221156 219966 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029639.1 protein_id gnl|my_center|LOCUS_31160 221309 221905 gene locus_tag LOCUS_31170 221309 221905 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029640.1 protein_id gnl|my_center|LOCUS_31170 222627 221959 gene locus_tag LOCUS_31180 222627 221959 CDS product pyridoxal 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974564.1 protein_id gnl|my_center|LOCUS_31180 223083 222655 gene locus_tag LOCUS_31190 223083 222655 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974563.1 protein_id gnl|my_center|LOCUS_31190 223884 223249 gene locus_tag LOCUS_31200 223884 223249 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974562.1 protein_id gnl|my_center|LOCUS_31200 224067 224756 gene locus_tag LOCUS_31210 224067 224756 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029642.1 protein_id gnl|my_center|LOCUS_31210 224938 227301 gene locus_tag LOCUS_31220 224938 227301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31220 227577 227389 gene locus_tag LOCUS_31230 227577 227389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974557.1 protein_id gnl|my_center|LOCUS_31230 230735 227787 gene locus_tag LOCUS_31240 gene afsR 230735 227787 CDS product transcriptional regulator AfsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029645.1 protein_id gnl|my_center|LOCUS_31240 231277 230885 gene locus_tag LOCUS_31250 231277 230885 CDS product nitroreductase family deazaflavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029646.1 protein_id gnl|my_center|LOCUS_31250 231390 232193 gene locus_tag LOCUS_31260 231390 232193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31260 233628 232162 gene locus_tag LOCUS_31270 233628 232162 CDS product CehA/McbA family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029647.1 protein_id gnl|my_center|LOCUS_31270 233850 236435 gene locus_tag LOCUS_31280 233850 236435 CDS product bifunctional FO biosynthesis protein CofGH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029648.1 protein_id gnl|my_center|LOCUS_31280 237141 236455 gene locus_tag LOCUS_31290 237141 236455 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227393.1 protein_id gnl|my_center|LOCUS_31290 237885 237157 gene locus_tag LOCUS_31300 237885 237157 CDS product GAF and ANTAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227392.1 protein_id gnl|my_center|LOCUS_31300 238619 237882 gene locus_tag LOCUS_31310 238619 237882 CDS product ANTAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076158225.1 protein_id gnl|my_center|LOCUS_31310 238904 239650 gene locus_tag LOCUS_31320 238904 239650 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227393.1 protein_id gnl|my_center|LOCUS_31320 239709 240284 gene locus_tag LOCUS_31330 239709 240284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189284288.1 protein_id gnl|my_center|LOCUS_31330 240774 240268 gene locus_tag LOCUS_31340 240774 240268 CDS product DUF2165 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974551.1 protein_id gnl|my_center|LOCUS_31340 241093 240791 gene locus_tag LOCUS_31350 241093 240791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31350 241272 241090 gene locus_tag LOCUS_31360 241272 241090 CDS product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029810.1 protein_id gnl|my_center|LOCUS_31360 242081 241269 gene locus_tag LOCUS_31370 242081 241269 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973852.1 protein_id gnl|my_center|LOCUS_31370 242194 242598 gene locus_tag LOCUS_31380 242194 242598 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029808.1 protein_id gnl|my_center|LOCUS_31380 242762 243877 gene locus_tag LOCUS_31390 242762 243877 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974547.1 protein_id gnl|my_center|LOCUS_31390 243950 244495 gene locus_tag LOCUS_31400 243950 244495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31400 244488 244871 gene locus_tag LOCUS_31410 244488 244871 CDS product DUF2752 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728907.1 protein_id gnl|my_center|LOCUS_31410 245080 245343 gene locus_tag LOCUS_31420 245080 245343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31420 247008 245425 gene locus_tag LOCUS_31430 247008 245425 CDS product Na+:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029652.1 protein_id gnl|my_center|LOCUS_31430 249017 247161 gene locus_tag LOCUS_31440 249017 247161 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029653.1 protein_id gnl|my_center|LOCUS_31440 251172 249196 gene locus_tag LOCUS_31450 251172 249196 CDS product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189284555.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31450 251081 251509 gene locus_tag LOCUS_31460 251081 251509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31460 251695 252462 gene locus_tag LOCUS_31470 251695 252462 CDS product GPP34 family phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974541.1 protein_id gnl|my_center|LOCUS_31470 252819 253676 gene locus_tag LOCUS_31480 252819 253676 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029655.1 protein_id gnl|my_center|LOCUS_31480 253881 254072 gene locus_tag LOCUS_31490 253881 254072 CDS product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974539.1 protein_id gnl|my_center|LOCUS_31490 254759 254193 gene locus_tag LOCUS_31500 254759 254193 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224296754.1 protein_id gnl|my_center|LOCUS_31500 255809 254823 gene locus_tag LOCUS_31510 255809 254823 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028254.1 protein_id gnl|my_center|LOCUS_31510 256869 255844 gene locus_tag LOCUS_31520 256869 255844 CDS product glycoside hydrolase family 11 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028255.1 protein_id gnl|my_center|LOCUS_31520 257391 257167 gene locus_tag LOCUS_31530 257391 257167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31530 257929 257564 gene locus_tag LOCUS_31540 257929 257564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31540 258515 257976 gene locus_tag LOCUS_31550 258515 257976 CDS product flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027345.1 protein_id gnl|my_center|LOCUS_31550 258649 259833 gene locus_tag LOCUS_31560 258649 259833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31560 259934 260557 gene locus_tag LOCUS_31570 259934 260557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31570 260646 261266 gene locus_tag LOCUS_31580 260646 261266 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030831.1 protein_id gnl|my_center|LOCUS_31580 261895 261356 gene locus_tag LOCUS_31590 261895 261356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31590 262524 261892 gene locus_tag LOCUS_31600 262524 261892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31600 263153 264016 gene locus_tag LOCUS_31610 263153 264016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31610 264488 264057 gene locus_tag LOCUS_31620 264488 264057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31620 265105 264491 gene locus_tag LOCUS_31630 265105 264491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31630 265851 265348 gene locus_tag LOCUS_31640 265851 265348 CDS product TIR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970310.1 protein_id gnl|my_center|LOCUS_31640 266829 266434 gene locus_tag LOCUS_31650 266829 266434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028878.1 protein_id gnl|my_center|LOCUS_31650 267143 266877 gene locus_tag LOCUS_31660 267143 266877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975561.1 protein_id gnl|my_center|LOCUS_31660 267725 267501 gene locus_tag LOCUS_31670 267725 267501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31670 268346 267945 gene locus_tag LOCUS_31680 268346 267945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31680 268530 268457 gene locus_tag LOCUS_t00510 268530 268457 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 270147 268561 gene locus_tag LOCUS_31690 270147 268561 CDS product IclR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028828.1 protein_id gnl|my_center|LOCUS_31690 271683 270442 gene locus_tag LOCUS_31700 271683 270442 CDS product M6 family metalloprotease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975609.1 protein_id gnl|my_center|LOCUS_31700 272062 272712 gene locus_tag LOCUS_31710 272062 272712 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222789.1 protein_id gnl|my_center|LOCUS_31710 272913 274442 gene locus_tag LOCUS_31720 272913 274442 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975611.1 protein_id gnl|my_center|LOCUS_31720 275058 274540 gene locus_tag LOCUS_31730 275058 274540 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028826.1 protein_id gnl|my_center|LOCUS_31730 275221 276024 gene locus_tag LOCUS_31740 275221 276024 CDS product class III extradiol ring-cleavage dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975613.1 protein_id gnl|my_center|LOCUS_31740 276568 276050 gene locus_tag LOCUS_31750 276568 276050 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975614.1 protein_id gnl|my_center|LOCUS_31750 276767 277765 gene locus_tag LOCUS_31760 276767 277765 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975615.1 protein_id gnl|my_center|LOCUS_31760 278525 278268 gene locus_tag LOCUS_31770 278525 278268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31770 278437 279051 gene locus_tag LOCUS_31780 278437 279051 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028825.1 protein_id gnl|my_center|LOCUS_31780 280045 279074 gene locus_tag LOCUS_31790 280045 279074 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028824.1 protein_id gnl|my_center|LOCUS_31790 280120 281697 gene locus_tag LOCUS_31800 280120 281697 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975618.1 protein_id gnl|my_center|LOCUS_31800 281857 282618 gene locus_tag LOCUS_31810 281857 282618 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975619.1 protein_id gnl|my_center|LOCUS_31810 282615 283562 gene locus_tag LOCUS_31820 gene pfkB 282615 283562 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028823.1 protein_id gnl|my_center|LOCUS_31820 283660 285777 gene locus_tag LOCUS_31830 283660 285777 CDS product fructose-specific PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028822.1 protein_id gnl|my_center|LOCUS_31830 286116 286040 gene locus_tag LOCUS_t00520 286116 286040 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 288211 286820 gene locus_tag LOCUS_31840 288211 286820 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_079062058.1 protein_id gnl|my_center|LOCUS_31840 288298 289470 gene locus_tag LOCUS_31850 288298 289470 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082015379.1 protein_id gnl|my_center|LOCUS_31850 290598 289570 gene locus_tag LOCUS_31860 290598 289570 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028819.1 protein_id gnl|my_center|LOCUS_31860 290687 290869 gene locus_tag LOCUS_31870 290687 290869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975626.1 protein_id gnl|my_center|LOCUS_31870 291356 290883 gene locus_tag LOCUS_31880 gene mscL 291356 290883 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975627.1 protein_id gnl|my_center|LOCUS_31880 292061 291477 gene locus_tag LOCUS_31890 292061 291477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028817.1 protein_id gnl|my_center|LOCUS_31890 293088 292246 gene locus_tag LOCUS_31900 293088 292246 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975629.1 protein_id gnl|my_center|LOCUS_31900 293492 293187 gene locus_tag LOCUS_31910 293492 293187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31910 294858 293560 gene locus_tag LOCUS_31920 294858 293560 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975631.1 protein_id gnl|my_center|LOCUS_31920 296733 295165 gene locus_tag LOCUS_31930 296733 295165 CDS product potassium/proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975632.1 protein_id gnl|my_center|LOCUS_31930 296932 299805 gene locus_tag LOCUS_31940 296932 299805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31940 300547 299927 gene locus_tag LOCUS_31950 300547 299927 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028815.1 protein_id gnl|my_center|LOCUS_31950 300622 301545 gene locus_tag LOCUS_31960 gene galU 300622 301545 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975635.1 protein_id gnl|my_center|LOCUS_31960 301542 302876 gene locus_tag LOCUS_31970 301542 302876 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486735.1 protein_id gnl|my_center|LOCUS_31970 302980 303459 gene locus_tag LOCUS_31980 gene moaC 302980 303459 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028813.1 protein_id gnl|my_center|LOCUS_31980 303456 303956 gene locus_tag LOCUS_31990 303456 303956 CDS product MogA/MoaB family molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028812.1 protein_id gnl|my_center|LOCUS_31990 303983 304585 gene locus_tag LOCUS_32000 303983 304585 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804925.1 protein_id gnl|my_center|LOCUS_32000 304710 305909 gene locus_tag LOCUS_32010 304710 305909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975639.1 protein_id gnl|my_center|LOCUS_32010 305980 306054 gene locus_tag LOCUS_t00530 305980 306054 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 306821 306183 gene locus_tag LOCUS_32020 306821 306183 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222937.1 protein_id gnl|my_center|LOCUS_32020 306913 308088 gene locus_tag LOCUS_32030 306913 308088 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228864.1 protein_id gnl|my_center|LOCUS_32030 308111 308308 gene locus_tag LOCUS_32040 308111 308308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031911.1 protein_id gnl|my_center|LOCUS_32040 310811 308388 gene locus_tag LOCUS_32050 310811 308388 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167469742.1 protein_id gnl|my_center|LOCUS_32050 311605 310805 gene locus_tag LOCUS_32060 311605 310805 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029799.1 protein_id gnl|my_center|LOCUS_32060 311766 313031 gene locus_tag LOCUS_32070 311766 313031 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029800.1 protein_id gnl|my_center|LOCUS_32070 313004 313663 gene locus_tag LOCUS_32080 313004 313663 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029801.1 protein_id gnl|my_center|LOCUS_32080 314313 313837 gene locus_tag LOCUS_32090 314313 313837 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975641.1 protein_id gnl|my_center|LOCUS_32090 314378 315181 gene locus_tag LOCUS_32100 314378 315181 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093456342.1 protein_id gnl|my_center|LOCUS_32100 315831 315178 gene locus_tag LOCUS_32110 315831 315178 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975643.1 protein_id gnl|my_center|LOCUS_32110 315965 317479 gene locus_tag LOCUS_32120 315965 317479 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028809.1 protein_id gnl|my_center|LOCUS_32120 317535 318419 gene locus_tag LOCUS_32130 317535 318419 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028807.1 protein_id gnl|my_center|LOCUS_32130 318509 318682 gene locus_tag LOCUS_32140 318509 318682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32140 322067 318804 gene locus_tag LOCUS_32150 322067 318804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32150 322239 322838 gene locus_tag LOCUS_32160 322239 322838 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975649.1 protein_id gnl|my_center|LOCUS_32160 322941 325145 gene locus_tag LOCUS_32170 322941 325145 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028805.1 protein_id gnl|my_center|LOCUS_32170 325298 325792 gene locus_tag LOCUS_32180 325298 325792 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975651.1 protein_id gnl|my_center|LOCUS_32180 326978 325800 gene locus_tag LOCUS_32190 326978 325800 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486733.1 protein_id gnl|my_center|LOCUS_32190 326260 326340 gene locus_tag LOCUS_t00540 326260 326340 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 327795 327046 gene locus_tag LOCUS_32200 327795 327046 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028802.1 protein_id gnl|my_center|LOCUS_32200 328553 327792 gene locus_tag LOCUS_32210 gene cbiQ 328553 327792 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975656.1 protein_id gnl|my_center|LOCUS_32210 329604 328555 gene locus_tag LOCUS_32220 329604 328555 CDS product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028801.1 protein_id gnl|my_center|LOCUS_32220 329769 330146 gene locus_tag LOCUS_32230 329769 330146 CDS product SsgA family sporulation/cell division regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975658.1 protein_id gnl|my_center|LOCUS_32230 331815 330151 gene locus_tag LOCUS_32240 331815 330151 CDS product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_134111963.1 protein_id gnl|my_center|LOCUS_32240 333510 331894 gene locus_tag LOCUS_32250 333510 331894 CDS product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975660.1 protein_id gnl|my_center|LOCUS_32250 335335 333635 gene locus_tag LOCUS_32260 335335 333635 CDS product phospholipid carrier-dependent glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486701.1 protein_id gnl|my_center|LOCUS_32260 335448 336305 gene locus_tag LOCUS_32270 gene rsmI 335448 336305 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975663.1 protein_id gnl|my_center|LOCUS_32270 336512 336919 gene locus_tag LOCUS_32280 336512 336919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028797.1 protein_id gnl|my_center|LOCUS_32280 336945 337859 gene locus_tag LOCUS_32290 336945 337859 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028796.1 protein_id gnl|my_center|LOCUS_32290 337962 339383 gene locus_tag LOCUS_32300 337962 339383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32300 339472 340335 gene locus_tag LOCUS_32310 gene rsmA 339472 340335 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975667.1 protein_id gnl|my_center|LOCUS_32310 340332 341246 gene locus_tag LOCUS_32320 340332 341246 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028794.1 protein_id gnl|my_center|LOCUS_32320 341843 341250 gene locus_tag LOCUS_32330 341843 341250 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029739.1 protein_id gnl|my_center|LOCUS_32330 342000 343814 gene locus_tag LOCUS_32340 342000 343814 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975669.1 protein_id gnl|my_center|LOCUS_32340 344038 345885 gene locus_tag LOCUS_32350 344038 345885 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093456319.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_32350 344425 344332 gene locus_tag LOCUS_t00550 344425 344332 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 346542 346144 gene locus_tag LOCUS_32360 346542 346144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32360 346893 346660 gene locus_tag LOCUS_32370 346893 346660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32370 347082 347684 gene locus_tag LOCUS_32380 347082 347684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32380 347854 348528 gene locus_tag LOCUS_32390 347854 348528 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028791.1 protein_id gnl|my_center|LOCUS_32390 348904 348599 gene locus_tag LOCUS_32400 348904 348599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975673.1 protein_id gnl|my_center|LOCUS_32400 350605 348926 gene locus_tag LOCUS_32410 350605 348926 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975674.1 protein_id gnl|my_center|LOCUS_32410 350786 351847 gene locus_tag LOCUS_32420 gene galT 350786 351847 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028787.1 protein_id gnl|my_center|LOCUS_32420 351844 352812 gene locus_tag LOCUS_32430 gene galE 351844 352812 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975676.1 protein_id gnl|my_center|LOCUS_32430 352824 353975 gene locus_tag LOCUS_32440 gene galK 352824 353975 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028786.1 protein_id gnl|my_center|LOCUS_32440 354429 353986 gene locus_tag LOCUS_32450 354429 353986 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975678.1 protein_id gnl|my_center|LOCUS_32450 354736 355509 gene locus_tag LOCUS_32460 354736 355509 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326434.1 protein_id gnl|my_center|LOCUS_32460 356168 355671 gene locus_tag LOCUS_32470 gene tamR 356168 355671 CDS product MarR family transcriptional regulator TamR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975680.1 protein_id gnl|my_center|LOCUS_32470 356271 357077 gene locus_tag LOCUS_32480 356271 357077 CDS product trans-aconitate 2-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028784.1 protein_id gnl|my_center|LOCUS_32480 357327 357079 gene locus_tag LOCUS_32490 357327 357079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32490 357593 357324 gene locus_tag LOCUS_32500 357593 357324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32500 358295 357618 gene locus_tag LOCUS_32510 358295 357618 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975684.1 protein_id gnl|my_center|LOCUS_32510 359359 358292 gene locus_tag LOCUS_32520 359359 358292 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975685.1 protein_id gnl|my_center|LOCUS_32520 359596 362328 gene locus_tag LOCUS_32530 gene ppc 359596 362328 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975687.1 protein_id gnl|my_center|LOCUS_32530 362848 362387 gene locus_tag LOCUS_32540 362848 362387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028783.1 protein_id gnl|my_center|LOCUS_32540 363509 362913 gene locus_tag LOCUS_32550 gene pth 363509 362913 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975689.1 protein_id gnl|my_center|LOCUS_32550 364183 363587 gene locus_tag LOCUS_32560 364183 363587 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975690.1 protein_id gnl|my_center|LOCUS_32560 365334 364360 gene locus_tag LOCUS_32570 365334 364360 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975691.1 protein_id gnl|my_center|LOCUS_32570 366960 365446 gene locus_tag LOCUS_32580 gene glmU 366960 365446 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975692.1 protein_id gnl|my_center|LOCUS_32580 367085 367014 gene locus_tag LOCUS_t00560 367085 367014 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 367796 367092 gene locus_tag LOCUS_32590 367796 367092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32590 368038 369285 gene locus_tag LOCUS_32600 368038 369285 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975694.1 protein_id gnl|my_center|LOCUS_32600 370009 369512 gene locus_tag LOCUS_32610 370009 369512 CDS product SUKH-3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975695.1 protein_id gnl|my_center|LOCUS_32610 370598 370062 gene locus_tag LOCUS_32620 370598 370062 CDS product YwqJ-related putative deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028780.1 protein_id gnl|my_center|LOCUS_32620 370872 371855 gene locus_tag LOCUS_32630 370872 371855 CDS product SMI1/KNR4 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028779.1 protein_id gnl|my_center|LOCUS_32630 371864 374284 gene locus_tag LOCUS_32640 371864 374284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_32640 374485 375369 gene locus_tag LOCUS_32650 374485 375369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028777.1 protein_id gnl|my_center|LOCUS_32650 377059 375452 gene locus_tag LOCUS_32660 377059 375452 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977000.1 protein_id gnl|my_center|LOCUS_32660 377505 377056 gene locus_tag LOCUS_32670 377505 377056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32670 379191 377692 gene locus_tag LOCUS_32680 379191 377692 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225993.1 protein_id gnl|my_center|LOCUS_32680 379073 379321 gene locus_tag LOCUS_32690 379073 379321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32690 379631 380419 gene locus_tag LOCUS_32700 379631 380419 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028774.1 protein_id gnl|my_center|LOCUS_32700 380437 382980 gene locus_tag LOCUS_32710 380437 382980 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028773.1 protein_id gnl|my_center|LOCUS_32710 383225 384184 gene locus_tag LOCUS_32720 383225 384184 CDS product D-2-hydroxyacid dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028521.1 protein_id gnl|my_center|LOCUS_32720 384330 387881 gene locus_tag LOCUS_32730 gene mfd 384330 387881 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028772.1 protein_id gnl|my_center|LOCUS_32730 388203 388003 gene locus_tag LOCUS_32740 388203 388003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32740 388342 389109 gene locus_tag LOCUS_32750 388342 389109 CDS product HNH endonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028771.1 protein_id gnl|my_center|LOCUS_32750 389240 389881 gene locus_tag LOCUS_32760 389240 389881 CDS product SurA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975710.1 protein_id gnl|my_center|LOCUS_32760 389912 390889 gene locus_tag LOCUS_32770 389912 390889 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975711.1 protein_id gnl|my_center|LOCUS_32770 390952 392232 gene locus_tag LOCUS_32780 390952 392232 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975712.1 protein_id gnl|my_center|LOCUS_32780 392380 393414 gene locus_tag LOCUS_32790 gene rpfC 392380 393414 CDS product resuscitation-promoting factor protein RpfC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028765.1 protein_id gnl|my_center|LOCUS_32790 393767 394513 gene locus_tag LOCUS_32800 gene rpfA 393767 394513 CDS product resuscitation-promoting factor protein RpfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028764.1 protein_id gnl|my_center|LOCUS_32800 394765 396051 gene locus_tag LOCUS_32810 gene eno 394765 396051 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975715.1 protein_id gnl|my_center|LOCUS_32810 396144 396620 gene locus_tag LOCUS_32820 gene divIC 396144 396620 CDS product cell division protein DivIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975716.1 protein_id gnl|my_center|LOCUS_32820 396650 397192 gene locus_tag LOCUS_32830 396650 397192 CDS product DUF501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028762.1 protein_id gnl|my_center|LOCUS_32830 397189 398157 gene locus_tag LOCUS_32840 397189 398157 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975718.1 protein_id gnl|my_center|LOCUS_32840 399105 399980 gene locus_tag LOCUS_32850 399105 399980 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978631.1 protein_id gnl|my_center|LOCUS_32850 401246 400050 gene locus_tag LOCUS_32860 401246 400050 CDS product PP2C family protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189102039.1 protein_id gnl|my_center|LOCUS_32860 401875 401372 gene locus_tag LOCUS_32870 401875 401372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32870 401771 403069 gene locus_tag LOCUS_32880 401771 403069 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486678.1 protein_id gnl|my_center|LOCUS_32880 403269 404570 gene locus_tag LOCUS_32890 403269 404570 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028761.1 protein_id gnl|my_center|LOCUS_32890 407337 404809 gene locus_tag LOCUS_32900 407337 404809 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975721.1 protein_id gnl|my_center|LOCUS_32900 407228 407557 gene locus_tag LOCUS_32910 407228 407557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32910 408449 407679 gene locus_tag LOCUS_32920 408449 407679 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975722.1 protein_id gnl|my_center|LOCUS_32920 408844 408929 gene locus_tag LOCUS_t00570 408844 408929 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 409144 410319 gene locus_tag LOCUS_32930 409144 410319 CDS product 4-hydroxybenzoate 3-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028757.1 protein_id gnl|my_center|LOCUS_32930 410453 411343 gene locus_tag LOCUS_32940 410453 411343 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975728.1 protein_id gnl|my_center|LOCUS_32940 411654 411424 gene locus_tag LOCUS_32950 411654 411424 CDS product DUF4287 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975729.1 protein_id gnl|my_center|LOCUS_32950 411757 412068 gene locus_tag LOCUS_32960 411757 412068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975730.1 protein_id gnl|my_center|LOCUS_32960 412893 412123 gene locus_tag LOCUS_32970 412893 412123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028756.1 protein_id gnl|my_center|LOCUS_32970 414393 413173 gene locus_tag LOCUS_32980 414393 413173 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975732.1 protein_id gnl|my_center|LOCUS_32980 415599 414433 gene locus_tag LOCUS_32990 415599 414433 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775782.1 protein_id gnl|my_center|LOCUS_32990 416876 415878 gene locus_tag LOCUS_33000 416876 415878 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975733.1 protein_id gnl|my_center|LOCUS_33000 417074 418462 gene locus_tag LOCUS_33010 417074 418462 CDS product cystathionine beta-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028755.1 protein_id gnl|my_center|LOCUS_33010 419397 418978 gene locus_tag LOCUS_33020 419397 418978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167469765.1 protein_id gnl|my_center|LOCUS_33020 419552 420397 gene locus_tag LOCUS_33030 419552 420397 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028753.1 protein_id gnl|my_center|LOCUS_33030 420543 421097 gene locus_tag LOCUS_33040 420543 421097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028752.1 protein_id gnl|my_center|LOCUS_33040 422653 421241 gene locus_tag LOCUS_33050 422653 421241 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027010.1 protein_id gnl|my_center|LOCUS_33050 422783 424453 gene locus_tag LOCUS_33060 422783 424453 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028751.1 protein_id gnl|my_center|LOCUS_33060 424450 425673 gene locus_tag LOCUS_33070 424450 425673 CDS product allantoate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028750.1 protein_id gnl|my_center|LOCUS_33070 425670 427013 gene locus_tag LOCUS_33080 425670 427013 CDS product formimidoylglutamate deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028749.1 protein_id gnl|my_center|LOCUS_33080 427031 428206 gene locus_tag LOCUS_33090 gene hutI 427031 428206 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028748.1 protein_id gnl|my_center|LOCUS_33090 429121 428207 gene locus_tag LOCUS_33100 429121 428207 CDS product RNA polymerase sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975743.1 protein_id gnl|my_center|LOCUS_33100 429373 429750 gene locus_tag LOCUS_33110 429373 429750 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975744.1 protein_id gnl|my_center|LOCUS_33110 430001 430573 gene locus_tag LOCUS_33120 430001 430573 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028746.1 protein_id gnl|my_center|LOCUS_33120 432168 430672 gene locus_tag LOCUS_33130 432168 430672 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975747.1 protein_id gnl|my_center|LOCUS_33130 432668 433345 gene locus_tag LOCUS_33140 432668 433345 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975748.1 protein_id gnl|my_center|LOCUS_33140 433377 434648 gene locus_tag LOCUS_33150 gene draK 433377 434648 CDS product two-component system sensor histidine kinase DraK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028744.1 protein_id gnl|my_center|LOCUS_33150 435462 434890 gene locus_tag LOCUS_33160 435462 434890 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028743.1 protein_id gnl|my_center|LOCUS_33160 435639 436757 gene locus_tag LOCUS_33170 435639 436757 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975751.1 protein_id gnl|my_center|LOCUS_33170 436754 437275 gene locus_tag LOCUS_33180 gene purE 436754 437275 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975752.1 protein_id gnl|my_center|LOCUS_33180 437278 438456 gene locus_tag LOCUS_33190 437278 438456 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028742.1 protein_id gnl|my_center|LOCUS_33190 439547 438405 gene locus_tag LOCUS_33200 439547 438405 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971557.1 protein_id gnl|my_center|LOCUS_33200 439615 439974 gene locus_tag LOCUS_33210 439615 439974 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728052.1 protein_id gnl|my_center|LOCUS_33210 440077 441207 gene locus_tag LOCUS_33220 440077 441207 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028741.1 protein_id gnl|my_center|LOCUS_33220 441609 441217 gene locus_tag LOCUS_33230 441609 441217 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975755.1 protein_id gnl|my_center|LOCUS_33230 441986 441627 gene locus_tag LOCUS_33240 441986 441627 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028740.1 protein_id gnl|my_center|LOCUS_33240 442080 442586 gene locus_tag LOCUS_33250 442080 442586 CDS product CGNR zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028739.1 protein_id gnl|my_center|LOCUS_33250 444225 442882 gene locus_tag LOCUS_33260 444225 442882 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975759.1 protein_id gnl|my_center|LOCUS_33260 444402 445559 gene locus_tag LOCUS_33270 444402 445559 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975760.1 protein_id gnl|my_center|LOCUS_33270 445620 446180 gene locus_tag LOCUS_33280 445620 446180 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225996.1 protein_id gnl|my_center|LOCUS_33280 446760 446203 gene locus_tag LOCUS_33290 446760 446203 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030873063.1 protein_id gnl|my_center|LOCUS_33290 446881 448152 gene locus_tag LOCUS_33300 446881 448152 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189284299.1 protein_id gnl|my_center|LOCUS_33300 449521 448157 gene locus_tag LOCUS_33310 449521 448157 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326400.1 protein_id gnl|my_center|LOCUS_33310 449445 449783 gene locus_tag LOCUS_33320 449445 449783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33320 449795 450823 gene locus_tag LOCUS_33330 449795 450823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33330 451881 450934 gene locus_tag LOCUS_33340 451881 450934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33340 452301 451897 gene locus_tag LOCUS_33350 452301 451897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33350 452553 453902 gene locus_tag LOCUS_33360 452553 453902 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393804.1 protein_id gnl|my_center|LOCUS_33360 453899 454600 gene locus_tag LOCUS_33370 453899 454600 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242701.1 protein_id gnl|my_center|LOCUS_33370 454597 455865 gene locus_tag LOCUS_33380 454597 455865 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225403.1 protein_id gnl|my_center|LOCUS_33380 457348 455909 gene locus_tag LOCUS_33390 457348 455909 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486662.1 protein_id gnl|my_center|LOCUS_33390 459219 457816 gene locus_tag LOCUS_33400 459219 457816 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486660.1 protein_id gnl|my_center|LOCUS_33400 460956 459787 gene locus_tag LOCUS_33410 460956 459787 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028731.1 protein_id gnl|my_center|LOCUS_33410 462021 461260 gene locus_tag LOCUS_33420 462021 461260 CDS product TIGR03089 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975771.1 protein_id gnl|my_center|LOCUS_33420 462172 463476 gene locus_tag LOCUS_33430 462172 463476 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028730.1 protein_id gnl|my_center|LOCUS_33430 463576 464658 gene locus_tag LOCUS_33440 463576 464658 CDS product NDP-sugar synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028729.1 protein_id gnl|my_center|LOCUS_33440 466030 465038 gene locus_tag LOCUS_33450 466030 465038 CDS product 3-methyladenine DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028728.1 protein_id gnl|my_center|LOCUS_33450 467399 466098 gene locus_tag LOCUS_33460 467399 466098 CDS product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028727.1 protein_id gnl|my_center|LOCUS_33460 468355 467396 gene locus_tag LOCUS_33470 gene cofD 468355 467396 CDS product 2-phospho-L-lactate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975775.1 protein_id gnl|my_center|LOCUS_33470 468945 468454 gene locus_tag LOCUS_33480 468945 468454 CDS product cysteine dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028726.1 protein_id gnl|my_center|LOCUS_33480 469620 469883 gene locus_tag LOCUS_33490 469620 469883 CDS product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975777.1 protein_id gnl|my_center|LOCUS_33490 470202 473822 gene locus_tag LOCUS_33500 470202 473822 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028725.1 protein_id gnl|my_center|LOCUS_33500 473819 475288 gene locus_tag LOCUS_33510 473819 475288 CDS product DUF5719 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028724.1 protein_id gnl|my_center|LOCUS_33510 475850 475401 gene locus_tag LOCUS_33520 475850 475401 CDS product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063628643.1 protein_id gnl|my_center|LOCUS_33520 476113 476568 gene locus_tag LOCUS_33530 476113 476568 CDS product DUF3499 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975781.1 protein_id gnl|my_center|LOCUS_33530 476704 478320 gene locus_tag LOCUS_33540 476704 478320 CDS product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028722.1 protein_id gnl|my_center|LOCUS_33540 478388 479752 gene locus_tag LOCUS_33550 478388 479752 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028721.1 protein_id gnl|my_center|LOCUS_33550 480053 479805 gene locus_tag LOCUS_33560 480053 479805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33560 480131 480301 gene locus_tag LOCUS_33570 480131 480301 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975784.1 protein_id gnl|my_center|LOCUS_33570 480355 481482 gene locus_tag LOCUS_33580 480355 481482 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975785.1 protein_id gnl|my_center|LOCUS_33580 481552 482703 gene locus_tag LOCUS_33590 gene manA 481552 482703 CDS product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975786.1 protein_id gnl|my_center|LOCUS_33590 482846 483814 gene locus_tag LOCUS_33600 482846 483814 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028720.1 protein_id gnl|my_center|LOCUS_33600 484184 483834 gene locus_tag LOCUS_33610 484184 483834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33610 484095 485552 gene locus_tag LOCUS_33620 gene ahcY 484095 485552 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975788.1 protein_id gnl|my_center|LOCUS_33620 485706 486320 gene locus_tag LOCUS_33630 485706 486320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975789.1 protein_id gnl|my_center|LOCUS_33630 487327 486353 gene locus_tag LOCUS_33640 487327 486353 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975790.1 protein_id gnl|my_center|LOCUS_33640 487456 488463 gene locus_tag LOCUS_33650 487456 488463 CDS product stage II sporulation protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975791.1 protein_id gnl|my_center|LOCUS_33650 >Feature sequence07 1676 741 gene locus_tag LOCUS_33660 gene opcA 1676 741 CDS product glucose-6-phosphate dehydrogenase assembly protein OpcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972335.1 protein_id gnl|my_center|LOCUS_33660 3421 1673 gene locus_tag LOCUS_33670 gene zwf 3421 1673 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031084.1 protein_id gnl|my_center|LOCUS_33670 4563 3418 gene locus_tag LOCUS_33680 gene tal 4563 3418 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031085.1 protein_id gnl|my_center|LOCUS_33680 6661 4586 gene locus_tag LOCUS_33690 gene tkt 6661 4586 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031086.1 protein_id gnl|my_center|LOCUS_33690 6278 6201 gene locus_tag LOCUS_t00580 6278 6201 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 6819 7721 gene locus_tag LOCUS_33700 6819 7721 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031087.1 protein_id gnl|my_center|LOCUS_33700 9163 7775 gene locus_tag LOCUS_33710 9163 7775 CDS product glycoside hydrolase family 16 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031088.1 protein_id gnl|my_center|LOCUS_33710 10327 9371 gene locus_tag LOCUS_33720 10327 9371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33720 11328 10555 gene locus_tag LOCUS_33730 11328 10555 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031092.1 protein_id gnl|my_center|LOCUS_33730 11639 12976 gene locus_tag LOCUS_33740 11639 12976 CDS product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031093.1 protein_id gnl|my_center|LOCUS_33740 14138 12990 gene locus_tag LOCUS_33750 14138 12990 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031094.1 protein_id gnl|my_center|LOCUS_33750 14407 15093 gene locus_tag LOCUS_33760 14407 15093 CDS product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031096.1 protein_id gnl|my_center|LOCUS_33760 15455 15183 gene locus_tag LOCUS_33770 15455 15183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972321.1 protein_id gnl|my_center|LOCUS_33770 16139 15591 gene locus_tag LOCUS_33780 16139 15591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028350.1 protein_id gnl|my_center|LOCUS_33780 16811 16155 gene locus_tag LOCUS_33790 16811 16155 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972320.1 protein_id gnl|my_center|LOCUS_33790 17049 17708 gene locus_tag LOCUS_33800 17049 17708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327825.1 protein_id gnl|my_center|LOCUS_33800 17885 18859 gene locus_tag LOCUS_33810 17885 18859 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031380.1 protein_id gnl|my_center|LOCUS_33810 19132 18893 gene locus_tag LOCUS_33820 19132 18893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33820 19017 20330 gene locus_tag LOCUS_33830 19017 20330 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228682.1 protein_id gnl|my_center|LOCUS_33830 20337 21290 gene locus_tag LOCUS_33840 20337 21290 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228683.1 protein_id gnl|my_center|LOCUS_33840 21287 22150 gene locus_tag LOCUS_33850 21287 22150 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228684.1 protein_id gnl|my_center|LOCUS_33850 22231 23817 gene locus_tag LOCUS_33860 22231 23817 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972134.1 protein_id gnl|my_center|LOCUS_33860 23932 26085 gene locus_tag LOCUS_33870 23932 26085 CDS product discoidin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228677.1 protein_id gnl|my_center|LOCUS_33870 27045 26110 gene locus_tag LOCUS_33880 27045 26110 CDS product PDR/VanB family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972317.1 protein_id gnl|my_center|LOCUS_33880 27209 27042 gene locus_tag LOCUS_33890 27209 27042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031098.1 protein_id gnl|my_center|LOCUS_33890 28276 27206 gene locus_tag LOCUS_33900 28276 27206 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031099.1 protein_id gnl|my_center|LOCUS_33900 28805 28425 gene locus_tag LOCUS_33910 28805 28425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33910 30175 29129 gene locus_tag LOCUS_33920 30175 29129 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971690.1 protein_id gnl|my_center|LOCUS_33920 30373 30693 gene locus_tag LOCUS_33930 30373 30693 CDS product TcmI family type II polyketide cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030169.1 protein_id gnl|my_center|LOCUS_33930 30693 31133 gene locus_tag LOCUS_33940 30693 31133 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973653.1 protein_id gnl|my_center|LOCUS_33940 31123 32394 gene locus_tag LOCUS_33950 31123 32394 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227255.1 protein_id gnl|my_center|LOCUS_33950 32391 33602 gene locus_tag LOCUS_33960 32391 33602 CDS product ketosynthase chain-length factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_182663097.1 protein_id gnl|my_center|LOCUS_33960 33649 33948 gene locus_tag LOCUS_33970 33649 33948 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977559.1 protein_id gnl|my_center|LOCUS_33970 33950 34783 gene locus_tag LOCUS_33980 33950 34783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33980 34780 35124 gene locus_tag LOCUS_33990 34780 35124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33990 35294 36316 gene locus_tag LOCUS_34000 35294 36316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34000 36741 38717 gene locus_tag LOCUS_34010 36741 38717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34010 39580 38831 gene locus_tag LOCUS_34020 39580 38831 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227250.1 protein_id gnl|my_center|LOCUS_34020 40736 39723 gene locus_tag LOCUS_34030 40736 39723 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_067528888.1 protein_id gnl|my_center|LOCUS_34030 43111 40901 gene locus_tag LOCUS_34040 43111 40901 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030282.1 protein_id gnl|my_center|LOCUS_34040 43239 43886 gene locus_tag LOCUS_34050 43239 43886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34050 44093 45301 gene locus_tag LOCUS_34060 gene metK 44093 45301 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977350.1 protein_id gnl|my_center|LOCUS_34060 45331 45627 gene locus_tag LOCUS_34070 45331 45627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34070 46190 45813 gene locus_tag LOCUS_34080 46190 45813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34080 46375 46187 gene locus_tag LOCUS_34090 46375 46187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34090 46489 48543 gene locus_tag LOCUS_34100 46489 48543 CDS product phospholipase C, phosphocholine-specific inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225090.1 protein_id gnl|my_center|LOCUS_34100 49693 48554 gene locus_tag LOCUS_34110 49693 48554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34110 50508 49690 gene locus_tag LOCUS_34120 50508 49690 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972302.1 protein_id gnl|my_center|LOCUS_34120 50702 51322 gene locus_tag LOCUS_34130 50702 51322 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975649.1 protein_id gnl|my_center|LOCUS_34130 51549 52793 gene locus_tag LOCUS_34140 51549 52793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34140 52925 53560 gene locus_tag LOCUS_34150 52925 53560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34150 55034 53616 gene locus_tag LOCUS_34160 55034 53616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34160 55319 56938 gene locus_tag LOCUS_34170 55319 56938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34170 56826 58004 gene locus_tag LOCUS_34180 56826 58004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34180 58098 58949 gene locus_tag LOCUS_34190 58098 58949 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028933.1 protein_id gnl|my_center|LOCUS_34190 60292 59177 gene locus_tag LOCUS_34200 gene pcaD 60292 59177 CDS product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189284957.1 protein_id gnl|my_center|LOCUS_34200 61620 60289 gene locus_tag LOCUS_34210 gene pcaB 61620 60289 CDS product 3-carboxy-cis,cis-muconate cycloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031114.1 protein_id gnl|my_center|LOCUS_34210 62222 61617 gene locus_tag LOCUS_34220 gene pcaG 62222 61617 CDS product protocatechuate 3,4-dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031115.1 protein_id gnl|my_center|LOCUS_34220 63002 62229 gene locus_tag LOCUS_34230 gene pcaH 63002 62229 CDS product protocatechuate 3,4-dioxygenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031116.1 protein_id gnl|my_center|LOCUS_34230 64221 63019 gene locus_tag LOCUS_34240 64221 63019 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031117.1 protein_id gnl|my_center|LOCUS_34240 64865 64218 gene locus_tag LOCUS_34250 64865 64218 CDS product CoA transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031118.1 protein_id gnl|my_center|LOCUS_34250 65647 64865 gene locus_tag LOCUS_34260 65647 64865 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031119.1 protein_id gnl|my_center|LOCUS_34260 65917 65690 gene locus_tag LOCUS_34270 65917 65690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34270 65855 66319 gene locus_tag LOCUS_34280 65855 66319 CDS product winged helix DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972291.1 protein_id gnl|my_center|LOCUS_34280 67324 66362 gene locus_tag LOCUS_34290 67324 66362 CDS product DUF3048 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031120.1 protein_id gnl|my_center|LOCUS_34290 67539 68729 gene locus_tag LOCUS_34300 67539 68729 CDS product zinc-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031121.1 protein_id gnl|my_center|LOCUS_34300 69801 68731 gene locus_tag LOCUS_34310 69801 68731 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031122.1 protein_id gnl|my_center|LOCUS_34310 69888 70901 gene locus_tag LOCUS_34320 gene ligD 69888 70901 CDS product non-homologous end-joining DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972287.1 protein_id gnl|my_center|LOCUS_34320 73083 70888 gene locus_tag LOCUS_34330 73083 70888 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031124.1 protein_id gnl|my_center|LOCUS_34330 75584 73080 gene locus_tag LOCUS_34340 75584 73080 CDS product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031125.1 protein_id gnl|my_center|LOCUS_34340 75807 76766 gene locus_tag LOCUS_34350 75807 76766 CDS product multicopper oxidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972284.1 protein_id gnl|my_center|LOCUS_34350 76838 77983 gene locus_tag LOCUS_34360 76838 77983 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031126.1 protein_id gnl|my_center|LOCUS_34360 78810 78025 gene locus_tag LOCUS_34370 78810 78025 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031127.1 protein_id gnl|my_center|LOCUS_34370 79003 79257 gene locus_tag LOCUS_34380 79003 79257 CDS product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031128.1 protein_id gnl|my_center|LOCUS_34380 80266 79292 gene locus_tag LOCUS_34390 80266 79292 CDS product acyl-ACP desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031130.1 protein_id gnl|my_center|LOCUS_34390 82149 80524 gene locus_tag LOCUS_34400 82149 80524 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031132.1 protein_id gnl|my_center|LOCUS_34400 82475 83104 gene locus_tag LOCUS_34410 82475 83104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34410 83544 83128 gene locus_tag LOCUS_34420 83544 83128 CDS product SsgA family sporulation/cell division regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972274.1 protein_id gnl|my_center|LOCUS_34420 83531 83797 gene locus_tag LOCUS_34430 83531 83797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34430 83889 84584 gene locus_tag LOCUS_34440 83889 84584 CDS product endonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031135.1 protein_id gnl|my_center|LOCUS_34440 84634 84777 gene locus_tag LOCUS_34450 84634 84777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34450 85022 86200 gene locus_tag LOCUS_34460 85022 86200 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031139.1 protein_id gnl|my_center|LOCUS_34460 86197 87411 gene locus_tag LOCUS_34470 86197 87411 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031140.1 protein_id gnl|my_center|LOCUS_34470 87473 89653 gene locus_tag LOCUS_34480 87473 89653 CDS product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031141.1 protein_id gnl|my_center|LOCUS_34480 90367 89660 gene locus_tag LOCUS_34490 90367 89660 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031142.1 protein_id gnl|my_center|LOCUS_34490 90600 92042 gene locus_tag LOCUS_34500 90600 92042 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031143.1 protein_id gnl|my_center|LOCUS_34500 93280 92327 gene locus_tag LOCUS_34510 93280 92327 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031147.1 protein_id gnl|my_center|LOCUS_34510 93380 95020 gene locus_tag LOCUS_34520 93380 95020 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972254.1 protein_id gnl|my_center|LOCUS_34520 97364 95034 gene locus_tag LOCUS_34530 97364 95034 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031148.1 protein_id gnl|my_center|LOCUS_34530 97588 97457 gene locus_tag LOCUS_34540 97588 97457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34540 98564 97686 gene locus_tag LOCUS_34550 98564 97686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972252.1 protein_id gnl|my_center|LOCUS_34550 99355 98606 gene locus_tag LOCUS_34560 99355 98606 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972249.1 protein_id gnl|my_center|LOCUS_34560 99472 100110 gene locus_tag LOCUS_34570 99472 100110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34570 100202 100837 gene locus_tag LOCUS_34580 100202 100837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34580 101363 100770 gene locus_tag LOCUS_34590 gene idi 101363 100770 CDS product isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972247.1 protein_id gnl|my_center|LOCUS_34590 102490 101552 gene locus_tag LOCUS_34600 102490 101552 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972246.1 protein_id gnl|my_center|LOCUS_34600 102984 104792 gene locus_tag LOCUS_34610 102984 104792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34610 104789 105544 gene locus_tag LOCUS_34620 104789 105544 CDS product phosphocholine cytidylyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031156.1 protein_id gnl|my_center|LOCUS_34620 105532 106593 gene locus_tag LOCUS_34630 105532 106593 CDS product iron-containing alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972242.1 protein_id gnl|my_center|LOCUS_34630 106607 107350 gene locus_tag LOCUS_34640 106607 107350 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270333.1 protein_id gnl|my_center|LOCUS_34640 107347 108231 gene locus_tag LOCUS_34650 107347 108231 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031159.1 protein_id gnl|my_center|LOCUS_34650 108332 109267 gene locus_tag LOCUS_34660 108332 109267 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972239.1 protein_id gnl|my_center|LOCUS_34660 109260 110054 gene locus_tag LOCUS_34670 109260 110054 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972238.1 protein_id gnl|my_center|LOCUS_34670 110374 111276 gene locus_tag LOCUS_34680 gene hpnC 110374 111276 CDS product squalene synthase HpnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031161.1 protein_id gnl|my_center|LOCUS_34680 111273 112220 gene locus_tag LOCUS_34690 gene hpnD 111273 112220 CDS product presqualene diphosphate synthase HpnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162483877.1 protein_id gnl|my_center|LOCUS_34690 112357 113790 gene locus_tag LOCUS_34700 gene hpnE 112357 113790 CDS product hydroxysqualene dehydroxylase HpnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031164.1 protein_id gnl|my_center|LOCUS_34700 113787 114920 gene locus_tag LOCUS_34710 113787 114920 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107420324.1 protein_id gnl|my_center|LOCUS_34710 115024 117051 gene locus_tag LOCUS_34720 gene shc 115024 117051 CDS product squalene--hopene cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031166.1 protein_id gnl|my_center|LOCUS_34720 117051 117692 gene locus_tag LOCUS_34730 117051 117692 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972232.1 protein_id gnl|my_center|LOCUS_34730 117698 118720 gene locus_tag LOCUS_34740 gene hpnH 117698 118720 CDS product adenosyl-hopene transferase HpnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972231.1 protein_id gnl|my_center|LOCUS_34740 118725 119879 gene locus_tag LOCUS_34750 gene ispG 118725 119879 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031167.1 protein_id gnl|my_center|LOCUS_34750 119906 121825 gene locus_tag LOCUS_34760 gene dxs 119906 121825 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031168.1 protein_id gnl|my_center|LOCUS_34760 121826 123211 gene locus_tag LOCUS_34770 121826 123211 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031169.1 protein_id gnl|my_center|LOCUS_34770 123273 123896 gene locus_tag LOCUS_34780 123273 123896 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031170.1 protein_id gnl|my_center|LOCUS_34780 123893 124012 gene locus_tag LOCUS_34790 123893 124012 CDS product DUF6126 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031171.1 protein_id gnl|my_center|LOCUS_34790 124832 124035 gene locus_tag LOCUS_34800 124832 124035 CDS product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972225.1 protein_id gnl|my_center|LOCUS_34800 125419 126378 gene locus_tag LOCUS_34810 125419 126378 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031172.1 protein_id gnl|my_center|LOCUS_34810 126601 127386 gene locus_tag LOCUS_34820 126601 127386 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972223.1 protein_id gnl|my_center|LOCUS_34820 127518 128702 gene locus_tag LOCUS_34830 127518 128702 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030873148.1 protein_id gnl|my_center|LOCUS_34830 128827 130710 gene locus_tag LOCUS_34840 128827 130710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34840 130701 131345 gene locus_tag LOCUS_34850 130701 131345 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974351.1 protein_id gnl|my_center|LOCUS_34850 131489 131875 gene locus_tag LOCUS_34860 131489 131875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34860 132059 134035 gene locus_tag LOCUS_34870 132059 134035 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031188.1 protein_id gnl|my_center|LOCUS_34870 134128 134589 gene locus_tag LOCUS_34880 134128 134589 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972203.1 protein_id gnl|my_center|LOCUS_34880 134592 134966 gene locus_tag LOCUS_34890 134592 134966 CDS product DUF742 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031189.1 protein_id gnl|my_center|LOCUS_34890 134944 135561 gene locus_tag LOCUS_34900 134944 135561 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327875.1 protein_id gnl|my_center|LOCUS_34900 135625 136200 gene locus_tag LOCUS_34910 135625 136200 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972200.1 protein_id gnl|my_center|LOCUS_34910 136368 137396 gene locus_tag LOCUS_34920 gene tdh 136368 137396 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031190.1 protein_id gnl|my_center|LOCUS_34920 137415 138656 gene locus_tag LOCUS_34930 137415 138656 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972198.1 protein_id gnl|my_center|LOCUS_34930 138678 139580 gene locus_tag LOCUS_34940 138678 139580 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972197.1 protein_id gnl|my_center|LOCUS_34940 139738 140286 gene locus_tag LOCUS_34950 139738 140286 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972196.1 protein_id gnl|my_center|LOCUS_34950 140283 140840 gene locus_tag LOCUS_34960 140283 140840 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031191.1 protein_id gnl|my_center|LOCUS_34960 140837 141274 gene locus_tag LOCUS_34970 140837 141274 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037666054.1 protein_id gnl|my_center|LOCUS_34970 141401 142750 gene locus_tag LOCUS_34980 141401 142750 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031193.1 protein_id gnl|my_center|LOCUS_34980 143759 142848 gene locus_tag LOCUS_34990 143759 142848 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224138.1 protein_id gnl|my_center|LOCUS_34990 144494 143787 gene locus_tag LOCUS_35000 144494 143787 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030391327.1 protein_id gnl|my_center|LOCUS_35000 144631 144705 gene locus_tag LOCUS_t00590 144631 144705 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 145360 144815 gene locus_tag LOCUS_35010 145360 144815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35010 145983 146402 gene locus_tag LOCUS_35020 145983 146402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35020 146507 146926 gene locus_tag LOCUS_35030 146507 146926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35030 146976 147170 gene locus_tag LOCUS_35040 146976 147170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35040 147367 147077 gene locus_tag LOCUS_35050 147367 147077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35050 147424 147741 gene locus_tag LOCUS_35060 147424 147741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35060 148426 147809 gene locus_tag LOCUS_35070 148426 147809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35070 149137 148655 gene locus_tag LOCUS_35080 149137 148655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35080 149622 150446 gene locus_tag LOCUS_35090 149622 150446 CDS product sugar nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031499.1 protein_id gnl|my_center|LOCUS_35090 150758 151879 gene locus_tag LOCUS_35100 150758 151879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35100 153534 152011 gene locus_tag LOCUS_35110 153534 152011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35110 154358 153543 gene locus_tag LOCUS_35120 154358 153543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35120 155606 154398 gene locus_tag LOCUS_35130 155606 154398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35130 156058 156729 gene locus_tag LOCUS_35140 156058 156729 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026862.1 protein_id gnl|my_center|LOCUS_35140 156726 157406 gene locus_tag LOCUS_35150 156726 157406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35150 157972 158796 gene locus_tag LOCUS_35160 157972 158796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35160 158793 159623 gene locus_tag LOCUS_35170 158793 159623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35170 161256 159664 gene locus_tag LOCUS_35180 161256 159664 CDS product carbamoyltransferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226120.1 protein_id gnl|my_center|LOCUS_35180 162530 161256 gene locus_tag LOCUS_35190 162530 161256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35190 164094 162580 gene locus_tag LOCUS_35200 164094 162580 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877386.1 protein_id gnl|my_center|LOCUS_35200 165711 164170 gene locus_tag LOCUS_35210 165711 164170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35210 166916 165708 gene locus_tag LOCUS_35220 166916 165708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35220 168873 166924 gene locus_tag LOCUS_35230 gene asnB 168873 166924 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940273.1 protein_id gnl|my_center|LOCUS_35230 169652 168879 gene locus_tag LOCUS_35240 169652 168879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35240 169831 170136 gene locus_tag LOCUS_35250 169831 170136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35250 170268 171989 gene locus_tag LOCUS_35260 170268 171989 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929086.1 protein_id gnl|my_center|LOCUS_35260 172010 173803 gene locus_tag LOCUS_35270 172010 173803 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142714.1 protein_id gnl|my_center|LOCUS_35270 175019 173817 gene locus_tag LOCUS_35280 gene hemT 175019 173817 CDS product 5-aminolevulinic acid synthase HemT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338981.1 protein_id gnl|my_center|LOCUS_35280 175144 176733 gene locus_tag LOCUS_35290 175144 176733 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972177.1 protein_id gnl|my_center|LOCUS_35290 177898 176747 gene locus_tag LOCUS_35300 177898 176747 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978381.1 protein_id gnl|my_center|LOCUS_35300 178035 178643 gene locus_tag LOCUS_35310 178035 178643 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225451.1 protein_id gnl|my_center|LOCUS_35310 179347 178739 gene locus_tag LOCUS_35320 179347 178739 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974671.1 protein_id gnl|my_center|LOCUS_35320 179444 180187 gene locus_tag LOCUS_35330 179444 180187 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974670.1 protein_id gnl|my_center|LOCUS_35330 180269 183217 gene locus_tag LOCUS_35340 180269 183217 CDS product Na+/H+ antiporter subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031336.1 protein_id gnl|my_center|LOCUS_35340 183214 183981 gene locus_tag LOCUS_35350 183214 183981 CDS product Na(+)/H(+) antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972191.1 protein_id gnl|my_center|LOCUS_35350 183978 185621 gene locus_tag LOCUS_35360 183978 185621 CDS product Na+/H+ antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031337.1 protein_id gnl|my_center|LOCUS_35360 185618 186205 gene locus_tag LOCUS_35370 185618 186205 CDS product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972189.1 protein_id gnl|my_center|LOCUS_35370 186202 186519 gene locus_tag LOCUS_35380 186202 186519 CDS product monovalent cation/H+ antiporter complex subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972188.1 protein_id gnl|my_center|LOCUS_35380 186516 186875 gene locus_tag LOCUS_35390 gene mnhG 186516 186875 CDS product monovalent cation/H(+) antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031338.1 protein_id gnl|my_center|LOCUS_35390 187430 186894 gene locus_tag LOCUS_35400 187430 186894 CDS product NUDIX hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870383.1 protein_id gnl|my_center|LOCUS_35400 187955 187623 gene locus_tag LOCUS_35410 187955 187623 CDS product DUF3140 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972181.1 protein_id gnl|my_center|LOCUS_35410 188483 188001 gene locus_tag LOCUS_35420 188483 188001 CDS product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973268.1 protein_id gnl|my_center|LOCUS_35420 189483 188674 gene locus_tag LOCUS_35430 189483 188674 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031343.1 protein_id gnl|my_center|LOCUS_35430 189617 190804 gene locus_tag LOCUS_35440 189617 190804 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972178.1 protein_id gnl|my_center|LOCUS_35440 190863 192260 gene locus_tag LOCUS_35450 190863 192260 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972177.1 protein_id gnl|my_center|LOCUS_35450 192423 193208 gene locus_tag LOCUS_35460 192423 193208 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031344.1 protein_id gnl|my_center|LOCUS_35460 195304 193223 gene locus_tag LOCUS_35470 195304 193223 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487206.1 protein_id gnl|my_center|LOCUS_35470 196134 195364 gene locus_tag LOCUS_35480 gene cobF 196134 195364 CDS product precorrin-6A synthase (deacetylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031346.1 protein_id gnl|my_center|LOCUS_35480 196684 196184 gene locus_tag LOCUS_35490 196684 196184 CDS product DUF309 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972173.1 protein_id gnl|my_center|LOCUS_35490 196783 196857 gene locus_tag LOCUS_t00600 196783 196857 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 197281 196913 gene locus_tag LOCUS_35500 197281 196913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35500 198066 197503 gene locus_tag LOCUS_35510 198066 197503 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226262.1 protein_id gnl|my_center|LOCUS_35510 198232 198642 gene locus_tag LOCUS_35520 198232 198642 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968175.1 protein_id gnl|my_center|LOCUS_35520 198978 198694 gene locus_tag LOCUS_35530 198978 198694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35530 199200 200180 gene locus_tag LOCUS_35540 199200 200180 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031422.1 protein_id gnl|my_center|LOCUS_35540 202071 200203 gene locus_tag LOCUS_35550 gene iolD 202071 200203 CDS product 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729994.1 protein_id gnl|my_center|LOCUS_35550 202949 202068 gene locus_tag LOCUS_35560 gene iolB 202949 202068 CDS product 5-deoxy-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031348.1 protein_id gnl|my_center|LOCUS_35560 203937 203059 gene locus_tag LOCUS_35570 203937 203059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031349.1 protein_id gnl|my_center|LOCUS_35570 204902 203934 gene locus_tag LOCUS_35580 gene iolC 204902 203934 CDS product 5-dehydro-2-deoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972167.1 protein_id gnl|my_center|LOCUS_35580 205123 206145 gene locus_tag LOCUS_35590 205123 206145 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031350.1 protein_id gnl|my_center|LOCUS_35590 206145 207212 gene locus_tag LOCUS_35600 206145 207212 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270370.1 protein_id gnl|my_center|LOCUS_35600 207217 208071 gene locus_tag LOCUS_35610 207217 208071 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031352.1 protein_id gnl|my_center|LOCUS_35610 208073 208975 gene locus_tag LOCUS_35620 208073 208975 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031353.1 protein_id gnl|my_center|LOCUS_35620 209997 208993 gene locus_tag LOCUS_35630 209997 208993 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487216.1 protein_id gnl|my_center|LOCUS_35630 211208 210045 gene locus_tag LOCUS_35640 211208 210045 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031359.1 protein_id gnl|my_center|LOCUS_35640 211327 212331 gene locus_tag LOCUS_35650 211327 212331 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223782.1 protein_id gnl|my_center|LOCUS_35650 212417 213067 gene locus_tag LOCUS_35660 212417 213067 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869088.1 protein_id gnl|my_center|LOCUS_35660 214100 213138 gene locus_tag LOCUS_35670 214100 213138 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031361.1 protein_id gnl|my_center|LOCUS_35670 215846 214212 gene locus_tag LOCUS_35680 215846 214212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35680 217992 215848 gene locus_tag LOCUS_35690 217992 215848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35690 218256 218909 gene locus_tag LOCUS_35700 218256 218909 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230194.1 protein_id gnl|my_center|LOCUS_35700 218890 220116 gene locus_tag LOCUS_35710 218890 220116 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230195.1 protein_id gnl|my_center|LOCUS_35710 220213 220866 gene locus_tag LOCUS_35720 220213 220866 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225902.1 protein_id gnl|my_center|LOCUS_35720 220868 222160 gene locus_tag LOCUS_35730 220868 222160 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973157.1 protein_id gnl|my_center|LOCUS_35730 222493 249717 gene locus_tag LOCUS_35740 222493 249717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35740 249714 254321 gene locus_tag LOCUS_35750 249714 254321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_35750 254336 267211 gene locus_tag LOCUS_35760 254336 267211 CDS product non-ribosomal peptide synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028843.1 protein_id gnl|my_center|LOCUS_35760 267311 268489 gene locus_tag LOCUS_35770 267311 268489 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727175.1 protein_id gnl|my_center|LOCUS_35770 268546 269715 gene locus_tag LOCUS_35780 268546 269715 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727175.1 protein_id gnl|my_center|LOCUS_35780 269834 270046 gene locus_tag LOCUS_35790 269834 270046 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228784.1 protein_id gnl|my_center|LOCUS_35790 270223 270783 gene locus_tag LOCUS_35800 270223 270783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230193.1 protein_id gnl|my_center|LOCUS_35800 270780 272111 gene locus_tag LOCUS_35810 270780 272111 CDS product peptidoglycan-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225401.1 protein_id gnl|my_center|LOCUS_35810 272108 272833 gene locus_tag LOCUS_35820 272108 272833 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225402.1 protein_id gnl|my_center|LOCUS_35820 272830 274092 gene locus_tag LOCUS_35830 272830 274092 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230190.1 protein_id gnl|my_center|LOCUS_35830 274362 274586 gene locus_tag LOCUS_35840 274362 274586 CDS product MbtH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726914.1 protein_id gnl|my_center|LOCUS_35840 274656 276815 gene locus_tag LOCUS_35850 274656 276815 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224732.1 protein_id gnl|my_center|LOCUS_35850 277523 276885 gene locus_tag LOCUS_35860 277523 276885 CDS product sulfotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929057.1 protein_id gnl|my_center|LOCUS_35860 278617 277577 gene locus_tag LOCUS_35870 278617 277577 CDS product type III polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421605.1 protein_id gnl|my_center|LOCUS_35870 280143 278623 gene locus_tag LOCUS_35880 280143 278623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35880 280135 280404 gene locus_tag LOCUS_35890 280135 280404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35890 280521 281525 gene locus_tag LOCUS_35900 280521 281525 CDS product ParB N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173142140.1 protein_id gnl|my_center|LOCUS_35900 282152 285178 gene locus_tag LOCUS_35910 282152 285178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35910 285326 287596 gene locus_tag LOCUS_35920 285326 287596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35920 287840 288985 gene locus_tag LOCUS_35930 287840 288985 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase III C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727205.1 protein_id gnl|my_center|LOCUS_35930 288979 289689 gene locus_tag LOCUS_35940 288979 289689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35940 289686 290993 gene locus_tag LOCUS_35950 289686 290993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35950 290990 291796 gene locus_tag LOCUS_35960 290990 291796 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921431.1 protein_id gnl|my_center|LOCUS_35960 291882 292691 gene locus_tag LOCUS_35970 291882 292691 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975579.1 protein_id gnl|my_center|LOCUS_35970 293748 292714 gene locus_tag LOCUS_35980 293748 292714 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030866892.1 protein_id gnl|my_center|LOCUS_35980 294184 293753 gene locus_tag LOCUS_35990 294184 293753 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971919.1 protein_id gnl|my_center|LOCUS_35990 295515 294430 gene locus_tag LOCUS_36000 295515 294430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031363.1 protein_id gnl|my_center|LOCUS_36000 295611 297425 gene locus_tag LOCUS_36010 295611 297425 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031364.1 protein_id gnl|my_center|LOCUS_36010 300023 297429 gene locus_tag LOCUS_36020 300023 297429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_36020 300171 301607 gene locus_tag LOCUS_36030 300171 301607 CDS product S8/S53 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972149.1 protein_id gnl|my_center|LOCUS_36030 301667 302242 gene locus_tag LOCUS_36040 301667 302242 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174854968.1 protein_id gnl|my_center|LOCUS_36040 302239 302703 gene locus_tag LOCUS_36050 302239 302703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031366.1 protein_id gnl|my_center|LOCUS_36050 303538 302741 gene locus_tag LOCUS_36060 303538 302741 CDS product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031368.1 protein_id gnl|my_center|LOCUS_36060 305847 303628 gene locus_tag LOCUS_36070 305847 303628 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031369.1 protein_id gnl|my_center|LOCUS_36070 307042 305966 gene locus_tag LOCUS_36080 307042 305966 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031370.1 protein_id gnl|my_center|LOCUS_36080 308220 307297 gene locus_tag LOCUS_36090 308220 307297 CDS product lysylphosphatidylglycerol synthase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031375.1 protein_id gnl|my_center|LOCUS_36090 309017 308418 gene locus_tag LOCUS_36100 309017 308418 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229197.1 protein_id gnl|my_center|LOCUS_36100 309165 309644 gene locus_tag LOCUS_36110 309165 309644 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027642.1 protein_id gnl|my_center|LOCUS_36110 309798 311378 gene locus_tag LOCUS_36120 309798 311378 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027641.1 protein_id gnl|my_center|LOCUS_36120 311628 315365 gene locus_tag LOCUS_36130 311628 315365 CDS product LamG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184834092.1 protein_id gnl|my_center|LOCUS_36130 315503 322120 gene locus_tag LOCUS_36140 315503 322120 CDS product RHS repeat-associated core domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_078949463.1 protein_id gnl|my_center|LOCUS_36140 322117 322533 gene locus_tag LOCUS_36150 322117 322533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36150 322692 323771 gene locus_tag LOCUS_36160 322692 323771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36160 323768 324529 gene locus_tag LOCUS_36170 323768 324529 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972011.1 protein_id gnl|my_center|LOCUS_36170 324609 325856 gene locus_tag LOCUS_36180 324609 325856 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226191.1 protein_id gnl|my_center|LOCUS_36180 328683 325906 gene locus_tag LOCUS_36190 328683 325906 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104583.1 protein_id gnl|my_center|LOCUS_36190 329679 328825 gene locus_tag LOCUS_36200 329679 328825 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972022.1 protein_id gnl|my_center|LOCUS_36200 330446 329721 gene locus_tag LOCUS_36210 330446 329721 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972022.1 protein_id gnl|my_center|LOCUS_36210 331525 330557 gene locus_tag LOCUS_36220 331525 330557 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222265.1 protein_id gnl|my_center|LOCUS_36220 333179 331620 gene locus_tag LOCUS_36230 333179 331620 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908308.1 protein_id gnl|my_center|LOCUS_36230 333308 333988 gene locus_tag LOCUS_36240 333308 333988 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034283980.1 protein_id gnl|my_center|LOCUS_36240 333975 335459 gene locus_tag LOCUS_36250 333975 335459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36250 336604 335468 gene locus_tag LOCUS_36260 336604 335468 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976380.1 protein_id gnl|my_center|LOCUS_36260 337836 336889 gene locus_tag LOCUS_36270 337836 336889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028345.1 protein_id gnl|my_center|LOCUS_36270 339473 337875 gene locus_tag LOCUS_36280 339473 337875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028344.1 protein_id gnl|my_center|LOCUS_36280 339995 339570 gene locus_tag LOCUS_36290 339995 339570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36290 339880 340227 gene locus_tag LOCUS_36300 339880 340227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36300 340953 342032 gene locus_tag LOCUS_36310 340953 342032 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326134.1 protein_id gnl|my_center|LOCUS_36310 342029 342793 gene locus_tag LOCUS_36320 342029 342793 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976385.1 protein_id gnl|my_center|LOCUS_36320 342799 343605 gene locus_tag LOCUS_36330 342799 343605 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976386.1 protein_id gnl|my_center|LOCUS_36330 343607 344869 gene locus_tag LOCUS_36340 343607 344869 CDS product MCE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976387.1 protein_id gnl|my_center|LOCUS_36340 344866 345942 gene locus_tag LOCUS_36350 344866 345942 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976388.1 protein_id gnl|my_center|LOCUS_36350 345939 347033 gene locus_tag LOCUS_36360 345939 347033 CDS product MCE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028342.1 protein_id gnl|my_center|LOCUS_36360 347026 348060 gene locus_tag LOCUS_36370 347026 348060 CDS product MCE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976390.1 protein_id gnl|my_center|LOCUS_36370 348057 349388 gene locus_tag LOCUS_36380 348057 349388 CDS product MCE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028341.1 protein_id gnl|my_center|LOCUS_36380 349385 350674 gene locus_tag LOCUS_36390 349385 350674 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028340.1 protein_id gnl|my_center|LOCUS_36390 350671 351189 gene locus_tag LOCUS_36400 350671 351189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223667.1 protein_id gnl|my_center|LOCUS_36400 351186 351932 gene locus_tag LOCUS_36410 351186 351932 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028338.1 protein_id gnl|my_center|LOCUS_36410 351959 352507 gene locus_tag LOCUS_36420 351959 352507 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028337.1 protein_id gnl|my_center|LOCUS_36420 352535 353275 gene locus_tag LOCUS_36430 352535 353275 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028336.1 protein_id gnl|my_center|LOCUS_36430 353313 354587 gene locus_tag LOCUS_36440 353313 354587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36440 354888 355643 gene locus_tag LOCUS_36450 354888 355643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36450 355633 356118 gene locus_tag LOCUS_36460 355633 356118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36460 356105 357547 gene locus_tag LOCUS_36470 356105 357547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36470 357675 358544 gene locus_tag LOCUS_36480 357675 358544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36480 358575 359798 gene locus_tag LOCUS_36490 358575 359798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36490 361932 359965 gene locus_tag LOCUS_36500 361932 359965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36500 362259 364157 gene locus_tag LOCUS_36510 362259 364157 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031492.1 protein_id gnl|my_center|LOCUS_36510 364280 365881 gene locus_tag LOCUS_36520 364280 365881 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230595.1 protein_id gnl|my_center|LOCUS_36520 367346 365871 gene locus_tag LOCUS_36530 367346 365871 CDS product carboxylic ester hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012297.1 protein_id gnl|my_center|LOCUS_36530 367622 368938 gene locus_tag LOCUS_36540 367622 368938 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228285.1 protein_id gnl|my_center|LOCUS_36540 368935 369597 gene locus_tag LOCUS_36550 368935 369597 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228286.1 protein_id gnl|my_center|LOCUS_36550 369739 370776 gene locus_tag LOCUS_36560 369739 370776 CDS product 3-dehydroquinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222554.1 protein_id gnl|my_center|LOCUS_36560 371701 370838 gene locus_tag LOCUS_36570 371701 370838 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222560.1 protein_id gnl|my_center|LOCUS_36570 372168 371749 gene locus_tag LOCUS_36580 372168 371749 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222584.1 protein_id gnl|my_center|LOCUS_36580 372390 373556 gene locus_tag LOCUS_36590 gene rifK 372390 373556 CDS product 3-amino-5-hydroxybenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222557.1 protein_id gnl|my_center|LOCUS_36590 373553 374731 gene locus_tag LOCUS_36600 373553 374731 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222558.1 protein_id gnl|my_center|LOCUS_36600 374775 375458 gene locus_tag LOCUS_36610 374775 375458 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222559.1 protein_id gnl|my_center|LOCUS_36610 376816 375668 gene locus_tag LOCUS_36620 376816 375668 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006095218.1 protein_id gnl|my_center|LOCUS_36620 376895 376983 gene locus_tag LOCUS_t00610 376895 376983 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 378146 376911 gene locus_tag LOCUS_36630 378146 376911 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730143.1 protein_id gnl|my_center|LOCUS_36630 378988 378230 gene locus_tag LOCUS_36640 378988 378230 CDS product arylamine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258316.1 protein_id gnl|my_center|LOCUS_36640 387440 379098 gene locus_tag LOCUS_36650 387440 379098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36650 393877 387440 gene locus_tag LOCUS_36660 393877 387440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36660 399472 393896 gene locus_tag LOCUS_36670 399472 393896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36670 406144 399578 gene locus_tag LOCUS_36680 406144 399578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36680 420770 406173 gene locus_tag LOCUS_36690 420770 406173 CDS product type I polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222547.1 protein_id gnl|my_center|LOCUS_36690 420921 422657 gene locus_tag LOCUS_36700 420921 422657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36700 422687 424288 gene locus_tag LOCUS_36710 422687 424288 CDS product bifunctional 3-(3-hydroxy-phenyl)propionate/3-hydroxycinnamic acid hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222576.1 protein_id gnl|my_center|LOCUS_36710 427175 424254 gene locus_tag LOCUS_36720 427175 424254 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030729.1 protein_id gnl|my_center|LOCUS_36720 428218 427589 gene locus_tag LOCUS_36730 428218 427589 CDS product malonic semialdehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015571.1 protein_id gnl|my_center|LOCUS_36730 428464 429426 gene locus_tag LOCUS_36740 428464 429426 CDS product Zn-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198526.1 protein_id gnl|my_center|LOCUS_36740 430157 429483 gene locus_tag LOCUS_36750 430157 429483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36750 430308 431168 gene locus_tag LOCUS_36760 430308 431168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36760 431464 432087 gene locus_tag LOCUS_36770 gene phzD 431464 432087 CDS product phenazine biosynthesis protein PhzD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093625.1 protein_id gnl|my_center|LOCUS_36770 432084 434003 gene locus_tag LOCUS_36780 gene phzE 432084 434003 CDS product phenazine biosynthesis protein PhzE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118954.1 protein_id gnl|my_center|LOCUS_36780 436318 434102 gene locus_tag LOCUS_36790 436318 434102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36790 437169 436396 gene locus_tag LOCUS_36800 437169 436396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36800 437400 439352 gene locus_tag LOCUS_36810 437400 439352 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227746.1 protein_id gnl|my_center|LOCUS_36810 439534 441120 gene locus_tag LOCUS_36820 439534 441120 CDS product BBE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020640551.1 protein_id gnl|my_center|LOCUS_36820 442437 441172 gene locus_tag LOCUS_36830 442437 441172 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083703.1 protein_id gnl|my_center|LOCUS_36830 442808 443572 gene locus_tag LOCUS_36840 442808 443572 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972223.1 protein_id gnl|my_center|LOCUS_36840 444053 445222 gene locus_tag LOCUS_36850 gene phzC 444053 445222 CDS product phenazine biosynthesis protein PhzC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093621.1 protein_id gnl|my_center|LOCUS_36850 445244 446014 gene locus_tag LOCUS_36860 445244 446014 CDS product 2,3-dihydro-2,3-dihydroxybenzoate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244476.1 protein_id gnl|my_center|LOCUS_36860 447308 446100 gene locus_tag LOCUS_36870 447308 446100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36870 448699 447305 gene locus_tag LOCUS_36880 448699 447305 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223027.1 protein_id gnl|my_center|LOCUS_36880 450780 448696 gene locus_tag LOCUS_36890 450780 448696 CDS product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223026.1 protein_id gnl|my_center|LOCUS_36890 452180 450777 gene locus_tag LOCUS_36900 452180 450777 CDS product NarK family nitrate/nitrite MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028683.1 protein_id gnl|my_center|LOCUS_36900 452643 453260 gene locus_tag LOCUS_36910 gene wrbA 452643 453260 CDS product NAD(P)H:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228078.1 protein_id gnl|my_center|LOCUS_36910 453414 453878 gene locus_tag LOCUS_36920 453414 453878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36920 455175 454009 gene locus_tag LOCUS_36930 455175 454009 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083703.1 protein_id gnl|my_center|LOCUS_36930 455442 456392 gene locus_tag LOCUS_36940 455442 456392 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296404.1 protein_id gnl|my_center|LOCUS_36940 456418 457461 gene locus_tag LOCUS_36950 456418 457461 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224198.1 protein_id gnl|my_center|LOCUS_36950 457466 459316 gene locus_tag LOCUS_36960 457466 459316 CDS product 1-deoxy-D-xylulose-5-phosphate synthase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417910.1 protein_id gnl|my_center|LOCUS_36960 459313 460482 gene locus_tag LOCUS_36970 gene ispG 459313 460482 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284254.1 protein_id gnl|my_center|LOCUS_36970 461083 463458 gene locus_tag LOCUS_36980 461083 463458 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225184.1 protein_id gnl|my_center|LOCUS_36980 464521 463556 gene locus_tag LOCUS_36990 464521 463556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36990 465791 464559 gene locus_tag LOCUS_37000 465791 464559 CDS product NDP-hexose 2,3-dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043781848.1 protein_id gnl|my_center|LOCUS_37000 466933 465947 gene locus_tag LOCUS_37010 gene rfbB 466933 465947 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222917.1 protein_id gnl|my_center|LOCUS_37010 467985 466930 gene locus_tag LOCUS_37020 467985 466930 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143227.1 protein_id gnl|my_center|LOCUS_37020 471465 468205 gene locus_tag LOCUS_37030 471465 468205 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222149.1 protein_id gnl|my_center|LOCUS_37030 471611 472195 gene locus_tag LOCUS_37040 471611 472195 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224876.1 protein_id gnl|my_center|LOCUS_37040 472256 473836 gene locus_tag LOCUS_37050 472256 473836 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030790.1 protein_id gnl|my_center|LOCUS_37050 474036 475253 gene locus_tag LOCUS_37060 474036 475253 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974172.1 protein_id gnl|my_center|LOCUS_37060 475325 476104 gene locus_tag LOCUS_37070 475325 476104 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222869.1 protein_id gnl|my_center|LOCUS_37070 476136 477491 gene locus_tag LOCUS_37080 476136 477491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37080 477488 478606 gene locus_tag LOCUS_37090 477488 478606 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091304024.1 protein_id gnl|my_center|LOCUS_37090 478654 479232 gene locus_tag LOCUS_37100 478654 479232 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080532.1 protein_id gnl|my_center|LOCUS_37100 479229 480221 gene locus_tag LOCUS_37110 479229 480221 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222572.1 protein_id gnl|my_center|LOCUS_37110 481249 480314 gene locus_tag LOCUS_37120 481249 480314 CDS product oxygenase MpaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027621.1 protein_id gnl|my_center|LOCUS_37120 483043 481484 gene locus_tag LOCUS_37130 483043 481484 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112961.1 protein_id gnl|my_center|LOCUS_37130 483611 483075 gene locus_tag LOCUS_37140 483611 483075 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083718.1 protein_id gnl|my_center|LOCUS_37140 484816 483788 gene locus_tag LOCUS_37150 484816 483788 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027388.1 protein_id gnl|my_center|LOCUS_37150 485002 486603 gene locus_tag LOCUS_37160 485002 486603 CDS product BBE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020640551.1 protein_id gnl|my_center|LOCUS_37160 487618 486710 gene locus_tag LOCUS_37170 487618 486710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37170 >Feature sequence08 244 864 gene locus_tag LOCUS_37180 244 864 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030865145.1 protein_id gnl|my_center|LOCUS_37180 940 1015 gene locus_tag LOCUS_t00620 940 1015 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 3808 1058 gene locus_tag LOCUS_37190 3808 1058 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973277.1 protein_id gnl|my_center|LOCUS_37190 4287 9680 gene locus_tag LOCUS_37200 4287 9680 CDS product HAMP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030433.1 protein_id gnl|my_center|LOCUS_37200 9963 10640 gene locus_tag LOCUS_37210 9963 10640 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030434.1 protein_id gnl|my_center|LOCUS_37210 11033 10707 gene locus_tag LOCUS_37220 11033 10707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37220 11008 13599 gene locus_tag LOCUS_37230 11008 13599 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973274.1 protein_id gnl|my_center|LOCUS_37230 13865 14716 gene locus_tag LOCUS_37240 13865 14716 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973273.1 protein_id gnl|my_center|LOCUS_37240 14821 16332 gene locus_tag LOCUS_37250 gene rimO 14821 16332 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973272.1 protein_id gnl|my_center|LOCUS_37250 16650 17201 gene locus_tag LOCUS_37260 16650 17201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37260 17198 17743 gene locus_tag LOCUS_37270 17198 17743 CDS product CinA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030436.1 protein_id gnl|my_center|LOCUS_37270 17853 18233 gene locus_tag LOCUS_37280 17853 18233 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973269.1 protein_id gnl|my_center|LOCUS_37280 18383 18973 gene locus_tag LOCUS_37290 18383 18973 CDS product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973268.1 protein_id gnl|my_center|LOCUS_37290 19056 19340 gene locus_tag LOCUS_37300 19056 19340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37300 20260 19418 gene locus_tag LOCUS_37310 20260 19418 CDS product Fpg/Nei family DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030437.1 protein_id gnl|my_center|LOCUS_37310 25258 20279 gene locus_tag LOCUS_37320 25258 20279 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030438.1 protein_id gnl|my_center|LOCUS_37320 25367 26266 gene locus_tag LOCUS_37330 25367 26266 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028257.1 protein_id gnl|my_center|LOCUS_37330 26263 26952 gene locus_tag LOCUS_37340 26263 26952 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973261.1 protein_id gnl|my_center|LOCUS_37340 26949 27257 gene locus_tag LOCUS_37350 26949 27257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37350 28196 27261 gene locus_tag LOCUS_37360 28196 27261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168715181.1 protein_id gnl|my_center|LOCUS_37360 28282 28470 gene locus_tag LOCUS_37370 28282 28470 CDS product DUF3046 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973258.1 protein_id gnl|my_center|LOCUS_37370 28513 29826 gene locus_tag LOCUS_37380 28513 29826 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030441.1 protein_id gnl|my_center|LOCUS_37380 30052 31179 gene locus_tag LOCUS_37390 gene recA 30052 31179 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030442.1 protein_id gnl|my_center|LOCUS_37390 31183 32103 gene locus_tag LOCUS_37400 gene recX 31183 32103 CDS product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_134111881.1 protein_id gnl|my_center|LOCUS_37400 32617 32216 gene locus_tag LOCUS_37410 32617 32216 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973252.1 protein_id gnl|my_center|LOCUS_37410 33147 32614 gene locus_tag LOCUS_37420 33147 32614 CDS product cysteine dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030444.1 protein_id gnl|my_center|LOCUS_37420 35081 33399 gene locus_tag LOCUS_37430 35081 33399 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030445.1 protein_id gnl|my_center|LOCUS_37430 36067 35258 gene locus_tag LOCUS_37440 36067 35258 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030446.1 protein_id gnl|my_center|LOCUS_37440 36810 36145 gene locus_tag LOCUS_37450 36810 36145 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973248.1 protein_id gnl|my_center|LOCUS_37450 37734 36895 gene locus_tag LOCUS_37460 37734 36895 CDS product glutamate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030447.1 protein_id gnl|my_center|LOCUS_37460 38676 37900 gene locus_tag LOCUS_37470 38676 37900 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973246.1 protein_id gnl|my_center|LOCUS_37470 38974 39660 gene locus_tag LOCUS_37480 38974 39660 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973245.1 protein_id gnl|my_center|LOCUS_37480 39670 41067 gene locus_tag LOCUS_37490 39670 41067 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224238.1 protein_id gnl|my_center|LOCUS_37490 42059 41064 gene locus_tag LOCUS_37500 42059 41064 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030449.1 protein_id gnl|my_center|LOCUS_37500 42160 42594 gene locus_tag LOCUS_37510 42160 42594 CDS product MazG nucleotide pyrophosphohydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046247567.1 protein_id gnl|my_center|LOCUS_37510 43889 42654 gene locus_tag LOCUS_37520 43889 42654 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973241.1 protein_id gnl|my_center|LOCUS_37520 44382 43894 gene locus_tag LOCUS_37530 44382 43894 CDS product TrkA C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973240.1 protein_id gnl|my_center|LOCUS_37530 44539 45525 gene locus_tag LOCUS_37540 44539 45525 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973239.1 protein_id gnl|my_center|LOCUS_37540 45525 46187 gene locus_tag LOCUS_37550 45525 46187 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030451.1 protein_id gnl|my_center|LOCUS_37550 46282 47772 gene locus_tag LOCUS_37560 gene miaB 46282 47772 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030453.1 protein_id gnl|my_center|LOCUS_37560 47854 48567 gene locus_tag LOCUS_37570 47854 48567 CDS product class III extradiol dioxygenase subunit B-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030454.1 protein_id gnl|my_center|LOCUS_37570 49043 48774 gene locus_tag LOCUS_37580 49043 48774 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030455.1 protein_id gnl|my_center|LOCUS_37580 49350 49093 gene locus_tag LOCUS_37590 49350 49093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37590 49531 50469 gene locus_tag LOCUS_37600 gene miaA 49531 50469 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030456.1 protein_id gnl|my_center|LOCUS_37600 50578 51084 gene locus_tag LOCUS_37610 50578 51084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327425.1 protein_id gnl|my_center|LOCUS_37610 51245 52114 gene locus_tag LOCUS_37620 gene dapF 51245 52114 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030458.1 protein_id gnl|my_center|LOCUS_37620 52331 54526 gene locus_tag LOCUS_37630 52331 54526 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030459.1 protein_id gnl|my_center|LOCUS_37630 54751 56247 gene locus_tag LOCUS_37640 54751 56247 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030460.1 protein_id gnl|my_center|LOCUS_37640 55706 55624 gene locus_tag LOCUS_t00630 55706 55624 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 56493 57983 gene locus_tag LOCUS_37650 gene hflX 56493 57983 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030461.1 protein_id gnl|my_center|LOCUS_37650 59261 58119 gene locus_tag LOCUS_37660 59261 58119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973224.1 protein_id gnl|my_center|LOCUS_37660 60024 61820 gene locus_tag LOCUS_37670 60024 61820 CDS product IucA/IucC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485565.1 protein_id gnl|my_center|LOCUS_37670 61880 62665 gene locus_tag LOCUS_37680 61880 62665 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973221.1 protein_id gnl|my_center|LOCUS_37680 63060 65036 gene locus_tag LOCUS_37690 63060 65036 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030465.1 protein_id gnl|my_center|LOCUS_37690 65814 65212 gene locus_tag LOCUS_37700 gene lexA 65814 65212 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030466.1 protein_id gnl|my_center|LOCUS_37700 66712 67263 gene locus_tag LOCUS_37710 gene nrdR 66712 67263 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973218.1 protein_id gnl|my_center|LOCUS_37710 67425 70313 gene locus_tag LOCUS_37720 67425 70313 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030467.1 protein_id gnl|my_center|LOCUS_37720 70944 70411 gene locus_tag LOCUS_37730 70944 70411 CDS product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030468.1 protein_id gnl|my_center|LOCUS_37730 71100 71705 gene locus_tag LOCUS_37740 71100 71705 CDS product YdbC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973215.1 protein_id gnl|my_center|LOCUS_37740 71821 72480 gene locus_tag LOCUS_37750 71821 72480 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973214.1 protein_id gnl|my_center|LOCUS_37750 72493 73413 gene locus_tag LOCUS_37760 72493 73413 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973213.1 protein_id gnl|my_center|LOCUS_37760 75253 73721 gene locus_tag LOCUS_37770 75253 73721 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030470.1 protein_id gnl|my_center|LOCUS_37770 75456 76076 gene locus_tag LOCUS_37780 75456 76076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37780 76158 76859 gene locus_tag LOCUS_37790 76158 76859 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030471.1 protein_id gnl|my_center|LOCUS_37790 76927 77553 gene locus_tag LOCUS_37800 76927 77553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030472.1 protein_id gnl|my_center|LOCUS_37800 78471 77857 gene locus_tag LOCUS_37810 78471 77857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973208.1 protein_id gnl|my_center|LOCUS_37810 80994 78829 gene locus_tag LOCUS_37820 80994 78829 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030473.1 protein_id gnl|my_center|LOCUS_37820 81260 82942 gene locus_tag LOCUS_37830 81260 82942 CDS product DUF4192 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030474.1 protein_id gnl|my_center|LOCUS_37830 83425 85344 gene locus_tag LOCUS_37840 83425 85344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37840 85476 86234 gene locus_tag LOCUS_37850 85476 86234 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973205.1 protein_id gnl|my_center|LOCUS_37850 86652 88724 gene locus_tag LOCUS_37860 86652 88724 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485553.1 protein_id gnl|my_center|LOCUS_37860 88887 89774 gene locus_tag LOCUS_37870 gene whiH 88887 89774 CDS product sporulation transcriptional regulator WhiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030477.1 protein_id gnl|my_center|LOCUS_37870 90194 91726 gene locus_tag LOCUS_37880 90194 91726 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973202.1 protein_id gnl|my_center|LOCUS_37880 91880 92728 gene locus_tag LOCUS_37890 91880 92728 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973201.1 protein_id gnl|my_center|LOCUS_37890 93091 92861 gene locus_tag LOCUS_37900 93091 92861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805039.1 protein_id gnl|my_center|LOCUS_37900 93538 95661 gene locus_tag LOCUS_37910 93538 95661 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973199.1 protein_id gnl|my_center|LOCUS_37910 95958 96506 gene locus_tag LOCUS_37920 95958 96506 CDS product DUF1453 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030478.1 protein_id gnl|my_center|LOCUS_37920 96503 97657 gene locus_tag LOCUS_37930 96503 97657 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030479.1 protein_id gnl|my_center|LOCUS_37930 97654 98340 gene locus_tag LOCUS_37940 97654 98340 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030480.1 protein_id gnl|my_center|LOCUS_37940 98404 98973 gene locus_tag LOCUS_37950 98404 98973 CDS product DUF485 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030481.1 protein_id gnl|my_center|LOCUS_37950 98970 100562 gene locus_tag LOCUS_37960 98970 100562 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030482.1 protein_id gnl|my_center|LOCUS_37960 101286 100606 gene locus_tag LOCUS_37970 101286 100606 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030483.1 protein_id gnl|my_center|LOCUS_37970 102890 101283 gene locus_tag LOCUS_37980 102890 101283 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191850856.1 protein_id gnl|my_center|LOCUS_37980 104199 103255 gene locus_tag LOCUS_37990 104199 103255 CDS product sucrase ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030485.1 protein_id gnl|my_center|LOCUS_37990 105573 104305 gene locus_tag LOCUS_38000 105573 104305 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973190.1 protein_id gnl|my_center|LOCUS_38000 105688 106854 gene locus_tag LOCUS_38010 105688 106854 CDS product citrate synthase/methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973189.1 protein_id gnl|my_center|LOCUS_38010 107300 107064 gene locus_tag LOCUS_38020 107300 107064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973188.1 protein_id gnl|my_center|LOCUS_38020 107981 107430 gene locus_tag LOCUS_38030 107981 107430 CDS product DUF6082 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485539.1 protein_id gnl|my_center|LOCUS_38030 108300 109490 gene locus_tag LOCUS_38040 108300 109490 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030486.1 protein_id gnl|my_center|LOCUS_38040 111940 109487 gene locus_tag LOCUS_38050 111940 109487 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030487.1 protein_id gnl|my_center|LOCUS_38050 112172 113596 gene locus_tag LOCUS_38060 112172 113596 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973184.1 protein_id gnl|my_center|LOCUS_38060 113593 114981 gene locus_tag LOCUS_38070 113593 114981 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030488.1 protein_id gnl|my_center|LOCUS_38070 115350 116126 gene locus_tag LOCUS_38080 115350 116126 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030489.1 protein_id gnl|my_center|LOCUS_38080 116371 117066 gene locus_tag LOCUS_38090 116371 117066 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030490.1 protein_id gnl|my_center|LOCUS_38090 117556 117275 gene locus_tag LOCUS_38100 117556 117275 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973180.1 protein_id gnl|my_center|LOCUS_38100 117733 120666 gene locus_tag LOCUS_38110 117733 120666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38110 120727 121314 gene locus_tag LOCUS_38120 120727 121314 CDS product DUF5998 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030492.1 protein_id gnl|my_center|LOCUS_38120 121314 122555 gene locus_tag LOCUS_38130 121314 122555 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030493.1 protein_id gnl|my_center|LOCUS_38130 122637 123287 gene locus_tag LOCUS_38140 122637 123287 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973175.1 protein_id gnl|my_center|LOCUS_38140 124104 123295 gene locus_tag LOCUS_38150 124104 123295 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973167.1 protein_id gnl|my_center|LOCUS_38150 123998 124321 gene locus_tag LOCUS_38160 123998 124321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38160 124393 125244 gene locus_tag LOCUS_38170 124393 125244 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030499.1 protein_id gnl|my_center|LOCUS_38170 126572 125541 gene locus_tag LOCUS_38180 gene sepH 126572 125541 CDS product septation protein SepH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973165.1 protein_id gnl|my_center|LOCUS_38180 127010 127870 gene locus_tag LOCUS_38190 127010 127870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030500.1 protein_id gnl|my_center|LOCUS_38190 129128 127803 gene locus_tag LOCUS_38200 129128 127803 CDS product D-arabinono-1,4-lactone oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030501.1 protein_id gnl|my_center|LOCUS_38200 130326 129082 gene locus_tag LOCUS_38210 130326 129082 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973162.1 protein_id gnl|my_center|LOCUS_38210 130546 131673 gene locus_tag LOCUS_38220 130546 131673 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973161.1 protein_id gnl|my_center|LOCUS_38220 131682 132506 gene locus_tag LOCUS_38230 131682 132506 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153505920.1 protein_id gnl|my_center|LOCUS_38230 132769 132596 gene locus_tag LOCUS_38240 132769 132596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38240 133216 133869 gene locus_tag LOCUS_38250 133216 133869 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003993508.1 protein_id gnl|my_center|LOCUS_38250 133876 135105 gene locus_tag LOCUS_38260 133876 135105 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973157.1 protein_id gnl|my_center|LOCUS_38260 135555 135851 gene locus_tag LOCUS_38270 135555 135851 CDS product DUF4193 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003993510.1 protein_id gnl|my_center|LOCUS_38270 135865 136764 gene locus_tag LOCUS_38280 135865 136764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030505.1 protein_id gnl|my_center|LOCUS_38280 137259 136792 gene locus_tag LOCUS_38290 137259 136792 CDS product DUF3093 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973155.1 protein_id gnl|my_center|LOCUS_38290 137318 137905 gene locus_tag LOCUS_38300 137318 137905 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030506.1 protein_id gnl|my_center|LOCUS_38300 137902 138453 gene locus_tag LOCUS_38310 gene dut 137902 138453 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973153.1 protein_id gnl|my_center|LOCUS_38310 138455 139207 gene locus_tag LOCUS_38320 138455 139207 CDS product DUF3710 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973152.1 protein_id gnl|my_center|LOCUS_38320 139357 140049 gene locus_tag LOCUS_38330 139357 140049 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973151.1 protein_id gnl|my_center|LOCUS_38330 140181 142724 gene locus_tag LOCUS_38340 140181 142724 CDS product sensor histidine kinase KdpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030507.1 protein_id gnl|my_center|LOCUS_38340 142721 143404 gene locus_tag LOCUS_38350 142721 143404 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973149.1 protein_id gnl|my_center|LOCUS_38350 143503 143901 gene locus_tag LOCUS_38360 143503 143901 CDS product OB-fold nucleic acid binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327459.1 protein_id gnl|my_center|LOCUS_38360 143905 144678 gene locus_tag LOCUS_38370 143905 144678 CDS product DUF3159 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973147.1 protein_id gnl|my_center|LOCUS_38370 145734 145057 gene locus_tag LOCUS_38380 145734 145057 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973146.1 protein_id gnl|my_center|LOCUS_38380 146405 145734 gene locus_tag LOCUS_38390 146405 145734 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973145.1 protein_id gnl|my_center|LOCUS_38390 147021 149084 gene locus_tag LOCUS_38400 147021 149084 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973119.1 protein_id gnl|my_center|LOCUS_38400 149140 150468 gene locus_tag LOCUS_38410 149140 150468 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030522.1 protein_id gnl|my_center|LOCUS_38410 150800 151008 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gggaccacccccgcgtgcgcgggga 152419 151484 gene locus_tag LOCUS_38420 152419 151484 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966131.1 protein_id gnl|my_center|LOCUS_38420 153756 152431 gene locus_tag LOCUS_38430 153756 152431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38430 153905 154111 gene locus_tag LOCUS_38440 153905 154111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38440 154098 155489 gene locus_tag LOCUS_38450 154098 155489 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727401.1 protein_id gnl|my_center|LOCUS_38450 155647 156225 gene locus_tag LOCUS_38460 155647 156225 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626529.1 protein_id gnl|my_center|LOCUS_38460 156405 157628 gene locus_tag LOCUS_38470 156405 157628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38470 157634 158593 gene locus_tag LOCUS_38480 157634 158593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38480 159215 158547 gene locus_tag LOCUS_38490 159215 158547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38490 160544 159240 gene locus_tag LOCUS_38500 160544 159240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38500 161873 160548 gene locus_tag LOCUS_38510 161873 160548 CDS product MaoC family dehydratase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133901583.1 protein_id gnl|my_center|LOCUS_38510 163087 161849 gene locus_tag LOCUS_38520 163087 161849 CDS product MaoC family dehydratase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133901583.1 protein_id gnl|my_center|LOCUS_38520 164429 163071 gene locus_tag LOCUS_38530 164429 163071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38530 164698 164426 gene locus_tag LOCUS_38540 164698 164426 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222160.1 protein_id gnl|my_center|LOCUS_38540 166358 165093 gene locus_tag LOCUS_38550 166358 165093 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878633.1 protein_id gnl|my_center|LOCUS_38550 166603 166373 gene locus_tag LOCUS_38560 166603 166373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38560 166802 167836 gene locus_tag LOCUS_38570 166802 167836 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994459.1 protein_id gnl|my_center|LOCUS_38570 167846 168454 gene locus_tag LOCUS_38580 167846 168454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38580 168483 169358 gene locus_tag LOCUS_38590 168483 169358 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224579.1 protein_id gnl|my_center|LOCUS_38590 169355 170248 gene locus_tag LOCUS_38600 169355 170248 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228350.1 protein_id gnl|my_center|LOCUS_38600 170259 171005 gene locus_tag LOCUS_38610 170259 171005 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089900.1 protein_id gnl|my_center|LOCUS_38610 171002 172042 gene locus_tag LOCUS_38620 171002 172042 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731485.1 protein_id gnl|my_center|LOCUS_38620 173095 172139 gene locus_tag LOCUS_38630 173095 172139 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223734.1 protein_id gnl|my_center|LOCUS_38630 174757 173378 gene locus_tag LOCUS_38640 174757 173378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38640 176234 174792 gene locus_tag LOCUS_38650 176234 174792 CDS product endo-1,4-beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030540.1 protein_id gnl|my_center|LOCUS_38650 177267 179612 gene locus_tag LOCUS_38660 177267 179612 CDS product DUF1906 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029885.1 protein_id gnl|my_center|LOCUS_38660 179631 180074 gene locus_tag LOCUS_38670 179631 180074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38670 180067 180756 gene locus_tag LOCUS_38680 180067 180756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029884.1 protein_id gnl|my_center|LOCUS_38680 180773 180979 gene locus_tag LOCUS_38690 180773 180979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38690 181427 181020 gene locus_tag LOCUS_38700 181427 181020 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227867.1 protein_id gnl|my_center|LOCUS_38700 181508 183001 gene locus_tag LOCUS_38710 181508 183001 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227868.1 protein_id gnl|my_center|LOCUS_38710 184406 183174 gene locus_tag LOCUS_38720 184406 183174 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106206.1 protein_id gnl|my_center|LOCUS_38720 185092 184511 gene locus_tag LOCUS_38730 185092 184511 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226768.1 protein_id gnl|my_center|LOCUS_38730 185232 185972 gene locus_tag LOCUS_38740 185232 185972 CDS product cobalt-precorrin-6A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975552.1 protein_id gnl|my_center|LOCUS_38740 186810 185962 gene locus_tag LOCUS_38750 186810 185962 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030564.1 protein_id gnl|my_center|LOCUS_38750 187556 186807 gene locus_tag LOCUS_38760 gene cbiQ 187556 186807 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030565.1 protein_id gnl|my_center|LOCUS_38760 187916 187557 gene locus_tag LOCUS_38770 187916 187557 CDS product energy-coupling factor ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030566.1 protein_id gnl|my_center|LOCUS_38770 188680 187913 gene locus_tag LOCUS_38780 188680 187913 CDS product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030567.1 protein_id gnl|my_center|LOCUS_38780 188981 189433 gene locus_tag LOCUS_38790 188981 189433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973057.1 protein_id gnl|my_center|LOCUS_38790 189496 189936 gene locus_tag LOCUS_38800 189496 189936 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030864086.1 protein_id gnl|my_center|LOCUS_38800 190114 191289 gene locus_tag LOCUS_38810 190114 191289 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973054.1 protein_id gnl|my_center|LOCUS_38810 191286 191639 gene locus_tag LOCUS_38820 191286 191639 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030572.1 protein_id gnl|my_center|LOCUS_38820 191797 192279 gene locus_tag LOCUS_38830 191797 192279 CDS product DUF6099 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030573.1 protein_id gnl|my_center|LOCUS_38830 192451 193377 gene locus_tag LOCUS_38840 192451 193377 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973051.1 protein_id gnl|my_center|LOCUS_38840 193552 195168 gene locus_tag LOCUS_38850 193552 195168 CDS product 3' terminal RNA ribose 2'-O-methyltransferase Hen1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485480.1 protein_id gnl|my_center|LOCUS_38850 195165 197723 gene locus_tag LOCUS_38860 195165 197723 CDS product polynucleotide kinase-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030575.1 protein_id gnl|my_center|LOCUS_38860 197883 199115 gene locus_tag LOCUS_38870 197883 199115 CDS product arginine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973047.1 protein_id gnl|my_center|LOCUS_38870 199180 200187 gene locus_tag LOCUS_38880 gene argF 199180 200187 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030578.1 protein_id gnl|my_center|LOCUS_38880 200327 201763 gene locus_tag LOCUS_38890 200327 201763 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973044.1 protein_id gnl|my_center|LOCUS_38890 202205 201723 gene locus_tag LOCUS_38900 202205 201723 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973043.1 protein_id gnl|my_center|LOCUS_38900 202381 203208 gene locus_tag LOCUS_38910 202381 203208 CDS product enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973042.1 protein_id gnl|my_center|LOCUS_38910 203205 205535 gene locus_tag LOCUS_38920 203205 205535 CDS product bifunctional salicylyl-CoA 5-hydroxylase/oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030579.1 protein_id gnl|my_center|LOCUS_38920 206724 205519 gene locus_tag LOCUS_38930 206724 205519 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972823.1 protein_id gnl|my_center|LOCUS_38930 207629 206727 gene locus_tag LOCUS_38940 gene cysD 207629 206727 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972822.1 protein_id gnl|my_center|LOCUS_38940 208177 207626 gene locus_tag LOCUS_38950 gene cysC 208177 207626 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164276380.1 protein_id gnl|my_center|LOCUS_38950 209238 208420 gene locus_tag LOCUS_38960 209238 208420 CDS product PaaX family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030580.1 protein_id gnl|my_center|LOCUS_38960 210864 209254 gene locus_tag LOCUS_38970 gene ambL 210864 209254 CDS product aminobenozate:CoA ligase AmbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485583.1 protein_id gnl|my_center|LOCUS_38970 211019 212149 gene locus_tag LOCUS_38980 211019 212149 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973037.1 protein_id gnl|my_center|LOCUS_38980 212146 212544 gene locus_tag LOCUS_38990 212146 212544 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973036.1 protein_id gnl|my_center|LOCUS_38990 213756 212608 gene locus_tag LOCUS_39000 213756 212608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39000 215063 213753 gene locus_tag LOCUS_39010 215063 213753 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083617.1 protein_id gnl|my_center|LOCUS_39010 216651 215122 gene locus_tag LOCUS_39020 216651 215122 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972925.1 protein_id gnl|my_center|LOCUS_39020 216913 216716 gene locus_tag LOCUS_39030 216913 216716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39030 217163 217570 gene locus_tag LOCUS_39040 217163 217570 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005078910.1 protein_id gnl|my_center|LOCUS_39040 217752 220145 gene locus_tag LOCUS_39050 217752 220145 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030980.1 protein_id gnl|my_center|LOCUS_39050 220209 220685 gene locus_tag LOCUS_39060 220209 220685 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891554.1 protein_id gnl|my_center|LOCUS_39060 222059 220881 gene locus_tag LOCUS_39070 222059 220881 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031811.1 protein_id gnl|my_center|LOCUS_39070 222492 225326 gene locus_tag LOCUS_39080 gene acnA 222492 225326 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972923.1 protein_id gnl|my_center|LOCUS_39080 229197 225394 gene locus_tag LOCUS_39090 229197 225394 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226484.1 protein_id gnl|my_center|LOCUS_39090 229578 231044 gene locus_tag LOCUS_39100 gene ngcE 229578 231044 CDS product N-acetylglucosamine/diacetylchitobiose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776381.1 protein_id gnl|my_center|LOCUS_39100 231130 232056 gene locus_tag LOCUS_39110 231130 232056 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776380.1 protein_id gnl|my_center|LOCUS_39110 232059 232952 gene locus_tag LOCUS_39120 232059 232952 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030593.1 protein_id gnl|my_center|LOCUS_39120 233138 234349 gene locus_tag LOCUS_39130 233138 234349 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972914.1 protein_id gnl|my_center|LOCUS_39130 234471 235586 gene locus_tag LOCUS_39140 234471 235586 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972913.1 protein_id gnl|my_center|LOCUS_39140 235775 236557 gene locus_tag LOCUS_39150 235775 236557 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972912.1 protein_id gnl|my_center|LOCUS_39150 236554 237846 gene locus_tag LOCUS_39160 236554 237846 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972911.1 protein_id gnl|my_center|LOCUS_39160 238042 239961 gene locus_tag LOCUS_39170 gene dxs 238042 239961 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972908.1 protein_id gnl|my_center|LOCUS_39170 240098 241591 gene locus_tag LOCUS_39180 240098 241591 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972907.1 protein_id gnl|my_center|LOCUS_39180 241618 243054 gene locus_tag LOCUS_39190 241618 243054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39190 243484 243089 gene locus_tag LOCUS_39200 243484 243089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030597.1 protein_id gnl|my_center|LOCUS_39200 243550 244566 gene locus_tag LOCUS_39210 243550 244566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030598.1 protein_id gnl|my_center|LOCUS_39210 244692 245969 gene locus_tag LOCUS_39220 244692 245969 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974201.1 protein_id gnl|my_center|LOCUS_39220 248162 246033 gene locus_tag LOCUS_39230 248162 246033 CDS product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030602.1 protein_id gnl|my_center|LOCUS_39230 249376 248159 gene locus_tag LOCUS_39240 249376 248159 CDS product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030603.1 protein_id gnl|my_center|LOCUS_39240 250879 249722 gene locus_tag LOCUS_39250 250879 249722 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972895.1 protein_id gnl|my_center|LOCUS_39250 251811 251149 gene locus_tag LOCUS_39260 251811 251149 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972894.1 protein_id gnl|my_center|LOCUS_39260 252763 252113 gene locus_tag LOCUS_39270 252763 252113 CDS product DUF3000 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030605.1 protein_id gnl|my_center|LOCUS_39270 252974 254041 gene locus_tag LOCUS_39280 gene hemE 252974 254041 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972892.1 protein_id gnl|my_center|LOCUS_39280 254233 255039 gene locus_tag LOCUS_39290 254233 255039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39290 255114 255389 gene locus_tag LOCUS_39300 255114 255389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39300 255418 256647 gene locus_tag LOCUS_39310 255418 256647 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225893.1 protein_id gnl|my_center|LOCUS_39310 256644 257753 gene locus_tag LOCUS_39320 256644 257753 CDS product beta-ketoacyl synthase N-terminal-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225892.1 protein_id gnl|my_center|LOCUS_39320 257997 258443 gene locus_tag LOCUS_39330 257997 258443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39330 260072 258531 gene locus_tag LOCUS_39340 260072 258531 CDS product tryptophan 7-halogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198157253.1 protein_id gnl|my_center|LOCUS_39340 260476 261471 gene locus_tag LOCUS_39350 gene sbnA 260476 261471 CDS product 2,3-diaminopropionate biosynthesis protein SbnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225888.1 protein_id gnl|my_center|LOCUS_39350 261468 266048 gene locus_tag LOCUS_39360 261468 266048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39360 266045 277795 gene locus_tag LOCUS_39370 266045 277795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39370 277860 278678 gene locus_tag LOCUS_39380 277860 278678 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086839001.1 protein_id gnl|my_center|LOCUS_39380 278720 279946 gene locus_tag LOCUS_39390 278720 279946 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228024.1 protein_id gnl|my_center|LOCUS_39390 279972 280187 gene locus_tag LOCUS_39400 279972 280187 CDS product MbtH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005062145.1 protein_id gnl|my_center|LOCUS_39400 280184 281152 gene locus_tag LOCUS_39410 280184 281152 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225886.1 protein_id gnl|my_center|LOCUS_39410 281234 282259 gene locus_tag LOCUS_39420 281234 282259 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090392.1 protein_id gnl|my_center|LOCUS_39420 282605 283399 gene locus_tag LOCUS_39430 282605 283399 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225876.1 protein_id gnl|my_center|LOCUS_39430 283399 285963 gene locus_tag LOCUS_39440 283399 285963 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225877.1 protein_id gnl|my_center|LOCUS_39440 287075 286086 gene locus_tag LOCUS_39450 287075 286086 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031660.1 protein_id gnl|my_center|LOCUS_39450 288238 287465 gene locus_tag LOCUS_39460 288238 287465 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114603.1 protein_id gnl|my_center|LOCUS_39460 288904 288287 gene locus_tag LOCUS_39470 288904 288287 CDS product ScbR family autoregulator-binding transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972660.1 protein_id gnl|my_center|LOCUS_39470 289076 290590 gene locus_tag LOCUS_39480 289076 290590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39480 292022 291105 gene locus_tag LOCUS_39490 292022 291105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39490 293533 292226 gene locus_tag LOCUS_39500 293533 292226 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537059.1 protein_id gnl|my_center|LOCUS_39500 294155 293640 gene locus_tag LOCUS_39510 294155 293640 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532115.1 protein_id gnl|my_center|LOCUS_39510 294583 295374 gene locus_tag LOCUS_39520 294583 295374 CDS product AfsR/SARP family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086839027.1 protein_id gnl|my_center|LOCUS_39520 295371 296099 gene locus_tag LOCUS_39530 295371 296099 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222578.1 protein_id gnl|my_center|LOCUS_39530 297168 296113 gene locus_tag LOCUS_39540 gene sbnB 297168 296113 CDS product 2,3-diaminopropionate biosynthesis protein SbnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225889.1 protein_id gnl|my_center|LOCUS_39540 298629 297220 gene locus_tag LOCUS_39550 298629 297220 CDS product 3-deoxy-7-phosphoheptulonate synthase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976701.1 protein_id gnl|my_center|LOCUS_39550 298884 299468 gene locus_tag LOCUS_39560 298884 299468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39560 299602 300531 gene locus_tag LOCUS_39570 299602 300531 CDS product ScbA/BarX family gamma-butyrolactone biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190059139.1 protein_id gnl|my_center|LOCUS_39570 301405 300587 gene locus_tag LOCUS_39580 301405 300587 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270259.1 protein_id gnl|my_center|LOCUS_39580 302865 301495 gene locus_tag LOCUS_39590 302865 301495 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030612.1 protein_id gnl|my_center|LOCUS_39590 303894 302875 gene locus_tag LOCUS_39600 303894 302875 CDS product DUF4349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030613.1 protein_id gnl|my_center|LOCUS_39600 304053 305516 gene locus_tag LOCUS_39610 gene hemG 304053 305516 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224513.1 protein_id gnl|my_center|LOCUS_39610 305521 306252 gene locus_tag LOCUS_39620 305521 306252 CDS product chlorite dismutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972879.1 protein_id gnl|my_center|LOCUS_39620 307178 306399 gene locus_tag LOCUS_39630 307178 306399 CDS product TIGR04222 domain-containing membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972877.1 protein_id gnl|my_center|LOCUS_39630 308581 307274 gene locus_tag LOCUS_39640 308581 307274 CDS product DUF692 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030615.1 protein_id gnl|my_center|LOCUS_39640 309394 308678 gene locus_tag LOCUS_39650 309394 308678 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030616.1 protein_id gnl|my_center|LOCUS_39650 309601 309419 gene locus_tag LOCUS_39660 309601 309419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39660 310461 309631 gene locus_tag LOCUS_39670 310461 309631 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030618.1 protein_id gnl|my_center|LOCUS_39670 312095 310572 gene locus_tag LOCUS_39680 312095 310572 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485437.1 protein_id gnl|my_center|LOCUS_39680 313541 312126 gene locus_tag LOCUS_39690 313541 312126 CDS product PhoX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030620.1 protein_id gnl|my_center|LOCUS_39690 315294 313762 gene locus_tag LOCUS_39700 315294 313762 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115028.1 protein_id gnl|my_center|LOCUS_39700 315884 315303 gene locus_tag LOCUS_39710 315884 315303 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972866.1 protein_id gnl|my_center|LOCUS_39710 316358 315963 gene locus_tag LOCUS_39720 316358 315963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030621.1 protein_id gnl|my_center|LOCUS_39720 317621 316521 gene locus_tag LOCUS_39730 gene zapE 317621 316521 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485435.1 protein_id gnl|my_center|LOCUS_39730 317659 318444 gene locus_tag LOCUS_39740 317659 318444 CDS product pyrimidine reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030623.1 protein_id gnl|my_center|LOCUS_39740 318556 319029 gene locus_tag LOCUS_39750 318556 319029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972862.1 protein_id gnl|my_center|LOCUS_39750 319183 320580 gene locus_tag LOCUS_39760 gene murC 319183 320580 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030625.1 protein_id gnl|my_center|LOCUS_39760 320587 320994 gene locus_tag LOCUS_39770 gene msrB 320587 320994 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972860.1 protein_id gnl|my_center|LOCUS_39770 322434 320998 gene locus_tag LOCUS_39780 322434 320998 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223635.1 protein_id gnl|my_center|LOCUS_39780 323147 322431 gene locus_tag LOCUS_39790 323147 322431 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223634.1 protein_id gnl|my_center|LOCUS_39790 323387 324502 gene locus_tag LOCUS_39800 323387 324502 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972859.1 protein_id gnl|my_center|LOCUS_39800 324499 325170 gene locus_tag LOCUS_39810 324499 325170 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972858.1 protein_id gnl|my_center|LOCUS_39810 325167 325832 gene locus_tag LOCUS_39820 325167 325832 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030627.1 protein_id gnl|my_center|LOCUS_39820 325910 326872 gene locus_tag LOCUS_39830 325910 326872 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972856.1 protein_id gnl|my_center|LOCUS_39830 327467 326865 gene locus_tag LOCUS_39840 327467 326865 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327591.1 protein_id gnl|my_center|LOCUS_39840 327813 327454 gene locus_tag LOCUS_39850 327813 327454 CDS product DUF742 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972854.1 protein_id gnl|my_center|LOCUS_39850 328234 327815 gene locus_tag LOCUS_39860 328234 327815 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972853.1 protein_id gnl|my_center|LOCUS_39860 330507 328231 gene locus_tag LOCUS_39870 330507 328231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39870 331551 330541 gene locus_tag LOCUS_39880 331551 330541 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030629.1 protein_id gnl|my_center|LOCUS_39880 331924 332571 gene locus_tag LOCUS_39890 gene cprB 331924 332571 CDS product transcriptional regulator CprB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030630.1 protein_id gnl|my_center|LOCUS_39890 332851 334110 gene locus_tag LOCUS_39900 332851 334110 CDS product damage-control phosphatase ARMT1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485432.1 protein_id gnl|my_center|LOCUS_39900 334211 336373 gene locus_tag LOCUS_39910 334211 336373 CDS product terpene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030632.1 protein_id gnl|my_center|LOCUS_39910 336532 338418 gene locus_tag LOCUS_39920 336532 338418 CDS product multicopper oxidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228163.1 protein_id gnl|my_center|LOCUS_39920 338508 339065 gene locus_tag LOCUS_39930 338508 339065 CDS product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485430.1 protein_id gnl|my_center|LOCUS_39930 339245 340372 gene locus_tag LOCUS_39940 339245 340372 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030634.1 protein_id gnl|my_center|LOCUS_39940 340424 341602 gene locus_tag LOCUS_39950 340424 341602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39950 343609 341864 gene locus_tag LOCUS_39960 gene treZ 343609 341864 CDS product malto-oligosyltrehalose trehalohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030636.1 protein_id gnl|my_center|LOCUS_39960 343781 344335 gene locus_tag LOCUS_39970 343781 344335 CDS product DUF1707 and FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030637.1 protein_id gnl|my_center|LOCUS_39970 344472 345830 gene locus_tag LOCUS_39980 344472 345830 CDS product M14 family zinc carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327597.1 protein_id gnl|my_center|LOCUS_39980 345827 346297 gene locus_tag LOCUS_39990 345827 346297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39990 348642 346294 gene locus_tag LOCUS_40000 gene treY 348642 346294 CDS product malto-oligosyltrehalose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030639.1 protein_id gnl|my_center|LOCUS_40000 350833 348725 gene locus_tag LOCUS_40010 gene glgX 350833 348725 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030640.1 protein_id gnl|my_center|LOCUS_40010 351132 352379 gene locus_tag LOCUS_40020 351132 352379 CDS product SAV2148 family HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030641.1 protein_id gnl|my_center|LOCUS_40020 352494 353216 gene locus_tag LOCUS_40030 352494 353216 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030642.1 protein_id gnl|my_center|LOCUS_40030 354111 353248 gene locus_tag LOCUS_40040 354111 353248 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030643.1 protein_id gnl|my_center|LOCUS_40040 354262 355170 gene locus_tag LOCUS_40050 354262 355170 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030644.1 protein_id gnl|my_center|LOCUS_40050 355167 356000 gene locus_tag LOCUS_40060 355167 356000 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030645.1 protein_id gnl|my_center|LOCUS_40060 356000 357283 gene locus_tag LOCUS_40070 356000 357283 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030646.1 protein_id gnl|my_center|LOCUS_40070 357318 358562 gene locus_tag LOCUS_40080 gene mgt 357318 358562 CDS product macrolide-inactivating glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972830.1 protein_id gnl|my_center|LOCUS_40080 360901 358637 gene locus_tag LOCUS_40090 360901 358637 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030648.1 protein_id gnl|my_center|LOCUS_40090 361136 361684 gene locus_tag LOCUS_40100 361136 361684 CDS product DUF1697 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030649.1 protein_id gnl|my_center|LOCUS_40100 362420 361689 gene locus_tag LOCUS_40110 362420 361689 CDS product sirohydrochlorin chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030650.1 protein_id gnl|my_center|LOCUS_40110 363322 362426 gene locus_tag LOCUS_40120 363322 362426 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030651.1 protein_id gnl|my_center|LOCUS_40120 364097 363309 gene locus_tag LOCUS_40130 364097 363309 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972825.1 protein_id gnl|my_center|LOCUS_40130 365316 364159 gene locus_tag LOCUS_40140 365316 364159 CDS product aliphatic sulfonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030652.1 protein_id gnl|my_center|LOCUS_40140 366653 365304 gene locus_tag LOCUS_40150 366653 365304 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972823.1 protein_id gnl|my_center|LOCUS_40150 367591 366656 gene locus_tag LOCUS_40160 gene cysD 367591 366656 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972822.1 protein_id gnl|my_center|LOCUS_40160 368124 367588 gene locus_tag LOCUS_40170 gene cysC 368124 367588 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164276380.1 protein_id gnl|my_center|LOCUS_40170 368867 368154 gene locus_tag LOCUS_40180 368867 368154 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972820.1 protein_id gnl|my_center|LOCUS_40180 369043 368864 gene locus_tag LOCUS_40190 369043 368864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972819.1 protein_id gnl|my_center|LOCUS_40190 370740 369040 gene locus_tag LOCUS_40200 gene sirA 370740 369040 CDS product sulfite reductase SirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972818.1 protein_id gnl|my_center|LOCUS_40200 371671 371099 gene locus_tag LOCUS_40210 371671 371099 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030654.1 protein_id gnl|my_center|LOCUS_40210 373214 371913 gene locus_tag LOCUS_40220 373214 371913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972816.1 protein_id gnl|my_center|LOCUS_40220 374856 373408 gene locus_tag LOCUS_40230 374856 373408 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972815.1 protein_id gnl|my_center|LOCUS_40230 376758 375124 gene locus_tag LOCUS_40240 376758 375124 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030655.1 protein_id gnl|my_center|LOCUS_40240 376847 377986 gene locus_tag LOCUS_40250 376847 377986 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972813.1 protein_id gnl|my_center|LOCUS_40250 378425 377994 gene locus_tag LOCUS_40260 378425 377994 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016328136.1 protein_id gnl|my_center|LOCUS_40260 378535 379611 gene locus_tag LOCUS_40270 378535 379611 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971557.1 protein_id gnl|my_center|LOCUS_40270 378908 378837 gene locus_tag LOCUS_t00640 378908 378837 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 379758 379615 gene locus_tag LOCUS_40280 379758 379615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40280 380828 379812 gene locus_tag LOCUS_40290 380828 379812 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029843.1 protein_id gnl|my_center|LOCUS_40290 380945 382438 gene locus_tag LOCUS_40300 380945 382438 CDS product carboxylesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030671.1 protein_id gnl|my_center|LOCUS_40300 382634 382395 gene locus_tag LOCUS_40310 382634 382395 CDS product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030672.1 protein_id gnl|my_center|LOCUS_40310 383539 382631 gene locus_tag LOCUS_40320 383539 382631 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226025318.1 protein_id gnl|my_center|LOCUS_40320 383580 384014 gene locus_tag LOCUS_40330 383580 384014 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093457988.1 protein_id gnl|my_center|LOCUS_40330 384004 384849 gene locus_tag LOCUS_40340 384004 384849 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028329.1 protein_id gnl|my_center|LOCUS_40340 385724 384834 gene locus_tag LOCUS_40350 385724 384834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027166.1 protein_id gnl|my_center|LOCUS_40350 385942 386451 gene locus_tag LOCUS_40360 385942 386451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40360 387352 386456 gene locus_tag LOCUS_40370 gene mmuM 387352 386456 CDS product homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030679.1 protein_id gnl|my_center|LOCUS_40370 387418 388290 gene locus_tag LOCUS_40380 387418 388290 CDS product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971637.1 protein_id gnl|my_center|LOCUS_40380 388343 389089 gene locus_tag LOCUS_40390 388343 389089 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231034.1 protein_id gnl|my_center|LOCUS_40390 389672 389310 gene locus_tag LOCUS_40400 389672 389310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40400 390078 389797 gene locus_tag LOCUS_40410 390078 389797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40410 390963 390496 gene locus_tag LOCUS_40420 390963 390496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40420 392416 391115 gene locus_tag LOCUS_40430 392416 391115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40430 392606 393481 gene locus_tag LOCUS_40440 392606 393481 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030711.1 protein_id gnl|my_center|LOCUS_40440 394054 393476 gene locus_tag LOCUS_40450 394054 393476 CDS product TetR-like C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972778.1 protein_id gnl|my_center|LOCUS_40450 394249 395961 gene locus_tag LOCUS_40460 394249 395961 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030684.1 protein_id gnl|my_center|LOCUS_40460 395958 396479 gene locus_tag LOCUS_40470 395958 396479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972776.1 protein_id gnl|my_center|LOCUS_40470 396558 397826 gene locus_tag LOCUS_40480 396558 397826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40480 399060 397786 gene locus_tag LOCUS_40490 gene aldO 399060 397786 CDS product alditol oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030685.1 protein_id gnl|my_center|LOCUS_40490 399204 400523 gene locus_tag LOCUS_40500 399204 400523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030686.1 protein_id gnl|my_center|LOCUS_40500 400683 402167 gene locus_tag LOCUS_40510 400683 402167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40510 402478 410100 gene locus_tag LOCUS_40520 402478 410100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40520 410156 419653 gene locus_tag LOCUS_40530 410156 419653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40530 420307 419756 gene locus_tag LOCUS_40540 420307 419756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40540 420707 421282 gene locus_tag LOCUS_40550 420707 421282 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921379.1 protein_id gnl|my_center|LOCUS_40550 421500 424253 gene locus_tag LOCUS_40560 421500 424253 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228256.1 protein_id gnl|my_center|LOCUS_40560 424984 424271 gene locus_tag LOCUS_40570 424984 424271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40570 425788 425324 gene locus_tag LOCUS_40580 425788 425324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40580 426076 427497 gene locus_tag LOCUS_40590 426076 427497 CDS product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971990.1 protein_id gnl|my_center|LOCUS_40590 430450 427568 gene locus_tag LOCUS_40600 430450 427568 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225477.1 protein_id gnl|my_center|LOCUS_40600 430936 433725 gene locus_tag LOCUS_40610 430936 433725 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487609.1 protein_id gnl|my_center|LOCUS_40610 434591 433740 gene locus_tag LOCUS_40620 434591 433740 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083103.1 protein_id gnl|my_center|LOCUS_40620 435848 434817 gene locus_tag LOCUS_40630 435848 434817 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104356.1 protein_id gnl|my_center|LOCUS_40630 435988 436344 gene locus_tag LOCUS_40640 435988 436344 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896562.1 protein_id gnl|my_center|LOCUS_40640 437214 436378 gene locus_tag LOCUS_40650 437214 436378 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731568.1 protein_id gnl|my_center|LOCUS_40650 438150 437386 gene locus_tag LOCUS_40660 438150 437386 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031575.1 protein_id gnl|my_center|LOCUS_40660 440070 438385 gene locus_tag LOCUS_40670 440070 438385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40670 440768 440157 gene locus_tag LOCUS_40680 440768 440157 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729782.1 protein_id gnl|my_center|LOCUS_40680 441127 440849 gene locus_tag LOCUS_40690 441127 440849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40690 441865 441386 gene locus_tag LOCUS_40700 441865 441386 CDS product SsgA family sporulation/cell division regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229257.1 protein_id gnl|my_center|LOCUS_40700 443029 442193 gene locus_tag LOCUS_40710 443029 442193 CDS product bromoperoxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001074319.1 protein_id gnl|my_center|LOCUS_40710 443312 444244 gene locus_tag LOCUS_40720 443312 444244 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030286.1 protein_id gnl|my_center|LOCUS_40720 444408 445160 gene locus_tag LOCUS_40730 444408 445160 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229414.1 protein_id gnl|my_center|LOCUS_40730 445209 445520 gene locus_tag LOCUS_40740 445209 445520 CDS product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705536.1 protein_id gnl|my_center|LOCUS_40740 445685 446878 gene locus_tag LOCUS_40750 445685 446878 CDS product L-dopachrome tautomerase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228342.1 protein_id gnl|my_center|LOCUS_40750 447398 447078 gene locus_tag LOCUS_40760 447398 447078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40760 447690 448025 gene locus_tag LOCUS_40770 447690 448025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40770 448022 448333 gene locus_tag LOCUS_40780 448022 448333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40780 448339 449013 gene locus_tag LOCUS_40790 gene nthA 448339 449013 CDS product nitrile hydratase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174055.1 protein_id gnl|my_center|LOCUS_40790 449010 449876 gene locus_tag LOCUS_40800 449010 449876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40800 449881 450306 gene locus_tag LOCUS_40810 449881 450306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40810 450293 451381 gene locus_tag LOCUS_40820 450293 451381 CDS product HoxN/HupN/NixA family nickel/cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414559.1 protein_id gnl|my_center|LOCUS_40820 452415 451402 gene locus_tag LOCUS_40830 452415 451402 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388814.1 protein_id gnl|my_center|LOCUS_40830 453940 452501 gene locus_tag LOCUS_40840 453940 452501 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223303.1 protein_id gnl|my_center|LOCUS_40840 454005 454679 gene locus_tag LOCUS_40850 454005 454679 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030873188.1 protein_id gnl|my_center|LOCUS_40850 454807 455616 gene locus_tag LOCUS_40860 454807 455616 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259482.1 protein_id gnl|my_center|LOCUS_40860 458453 455844 gene locus_tag LOCUS_40870 458453 455844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40870 461290 458450 gene locus_tag LOCUS_40880 461290 458450 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487609.1 protein_id gnl|my_center|LOCUS_40880 464223 461506 gene locus_tag LOCUS_40890 464223 461506 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731565.1 protein_id gnl|my_center|LOCUS_40890 464525 464806 gene locus_tag LOCUS_40900 464525 464806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40900 464938 465387 gene locus_tag LOCUS_40910 464938 465387 CDS product SsgA family sporulation/cell division regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975886.1 protein_id gnl|my_center|LOCUS_40910 465502 466341 gene locus_tag LOCUS_40920 465502 466341 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228200.1 protein_id gnl|my_center|LOCUS_40920 466413 467075 gene locus_tag LOCUS_40930 466413 467075 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029782.1 protein_id gnl|my_center|LOCUS_40930 467366 467893 gene locus_tag LOCUS_40940 467366 467893 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895586.1 protein_id gnl|my_center|LOCUS_40940 468872 467943 gene locus_tag LOCUS_40950 468872 467943 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228693.1 protein_id gnl|my_center|LOCUS_40950 468985 469773 gene locus_tag LOCUS_40960 468985 469773 CDS product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263858.1 protein_id gnl|my_center|LOCUS_40960 469885 470427 gene locus_tag LOCUS_40970 469885 470427 CDS product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973268.1 protein_id gnl|my_center|LOCUS_40970 470477 470722 gene locus_tag LOCUS_40980 470477 470722 CDS product DUF2630 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224533.1 protein_id gnl|my_center|LOCUS_40980 >Feature sequence09 301 762 gene locus_tag LOCUS_40990 301 762 CDS product DUF3237 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896441.1 protein_id gnl|my_center|LOCUS_40990 1199 774 gene locus_tag LOCUS_41000 1199 774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41000 1384 2352 gene locus_tag LOCUS_41010 1384 2352 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013534.1 protein_id gnl|my_center|LOCUS_41010 2354 3238 gene locus_tag LOCUS_41020 gene couO 2354 3238 CDS product 4-hydroxyphenyl-beta-ketoacyl-CoA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225127.1 protein_id gnl|my_center|LOCUS_41020 3259 4767 gene locus_tag LOCUS_41030 3259 4767 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225131.1 protein_id gnl|my_center|LOCUS_41030 4788 5246 gene locus_tag LOCUS_41040 4788 5246 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863309.1 protein_id gnl|my_center|LOCUS_41040 5840 5364 gene locus_tag LOCUS_41050 5840 5364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41050 7478 5880 gene locus_tag LOCUS_41060 7478 5880 CDS product Tat pathway signal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_199314899.1 protein_id gnl|my_center|LOCUS_41060 7565 7996 gene locus_tag LOCUS_41070 7565 7996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41070 8084 8380 gene locus_tag LOCUS_41080 8084 8380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41080 8456 8872 gene locus_tag LOCUS_41090 8456 8872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41090 8869 9591 gene locus_tag LOCUS_41100 8869 9591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41100 9595 10227 gene locus_tag LOCUS_41110 9595 10227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41110 10382 10894 gene locus_tag LOCUS_41120 10382 10894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030180053.1 protein_id gnl|my_center|LOCUS_41120 12289 11201 gene locus_tag LOCUS_41130 gene ychF 12289 11201 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973917.1 protein_id gnl|my_center|LOCUS_41130 12454 12996 gene locus_tag LOCUS_41140 12454 12996 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030028.1 protein_id gnl|my_center|LOCUS_41140 13843 13088 gene locus_tag LOCUS_41150 13843 13088 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973919.1 protein_id gnl|my_center|LOCUS_41150 14880 13873 gene locus_tag LOCUS_41160 14880 13873 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973920.1 protein_id gnl|my_center|LOCUS_41160 14982 16346 gene locus_tag LOCUS_41170 14982 16346 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973921.1 protein_id gnl|my_center|LOCUS_41170 16642 17850 gene locus_tag LOCUS_41180 gene xseA 16642 17850 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030027.1 protein_id gnl|my_center|LOCUS_41180 17860 18108 gene locus_tag LOCUS_41190 17860 18108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41190 18325 18116 gene locus_tag LOCUS_41200 18325 18116 CDS product DUF4287 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167469699.1 protein_id gnl|my_center|LOCUS_41200 19868 18417 gene locus_tag LOCUS_41210 19868 18417 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030024.1 protein_id gnl|my_center|LOCUS_41210 20209 19910 gene locus_tag LOCUS_41220 20209 19910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41220 21654 20206 gene locus_tag LOCUS_41230 21654 20206 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030022.1 protein_id gnl|my_center|LOCUS_41230 21893 22483 gene locus_tag LOCUS_41240 21893 22483 CDS product malonic semialdehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973928.1 protein_id gnl|my_center|LOCUS_41240 23156 22614 gene locus_tag LOCUS_41250 23156 22614 CDS product DUF4245 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973929.1 protein_id gnl|my_center|LOCUS_41250 23273 24307 gene locus_tag LOCUS_41260 gene glpX 23273 24307 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973930.1 protein_id gnl|my_center|LOCUS_41260 24772 24395 gene locus_tag LOCUS_41270 24772 24395 CDS product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030021.1 protein_id gnl|my_center|LOCUS_41270 25574 24891 gene locus_tag LOCUS_41280 25574 24891 CDS product DUF1707 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030020.1 protein_id gnl|my_center|LOCUS_41280 25739 27406 gene locus_tag LOCUS_41290 25739 27406 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327174.1 protein_id gnl|my_center|LOCUS_41290 27889 29274 gene locus_tag LOCUS_41300 27889 29274 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030018.1 protein_id gnl|my_center|LOCUS_41300 29319 30014 gene locus_tag LOCUS_41310 29319 30014 CDS product DUF402 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030017.1 protein_id gnl|my_center|LOCUS_41310 30131 30313 gene locus_tag LOCUS_41320 30131 30313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41320 30310 32337 gene locus_tag LOCUS_41330 30310 32337 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487155.1 protein_id gnl|my_center|LOCUS_41330 34729 32399 gene locus_tag LOCUS_41340 34729 32399 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973938.1 protein_id gnl|my_center|LOCUS_41340 34955 35896 gene locus_tag LOCUS_41350 34955 35896 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973939.1 protein_id gnl|my_center|LOCUS_41350 35893 36162 gene locus_tag LOCUS_41360 35893 36162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030014.1 protein_id gnl|my_center|LOCUS_41360 36257 36781 gene locus_tag LOCUS_41370 36257 36781 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973941.1 protein_id gnl|my_center|LOCUS_41370 36778 37467 gene locus_tag LOCUS_41380 36778 37467 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973942.1 protein_id gnl|my_center|LOCUS_41380 37464 39800 gene locus_tag LOCUS_41390 37464 39800 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327169.1 protein_id gnl|my_center|LOCUS_41390 40754 39759 gene locus_tag LOCUS_41400 40754 39759 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973944.1 protein_id gnl|my_center|LOCUS_41400 40895 41449 gene locus_tag LOCUS_41410 40895 41449 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973945.1 protein_id gnl|my_center|LOCUS_41410 41456 41989 gene locus_tag LOCUS_41420 41456 41989 CDS product alkyl hydroperoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973946.1 protein_id gnl|my_center|LOCUS_41420 43595 42105 gene locus_tag LOCUS_41430 43595 42105 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030013.1 protein_id gnl|my_center|LOCUS_41430 44442 43732 gene locus_tag LOCUS_41440 44442 43732 CDS product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973948.1 protein_id gnl|my_center|LOCUS_41440 46192 44867 gene locus_tag LOCUS_41450 46192 44867 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973949.1 protein_id gnl|my_center|LOCUS_41450 47779 47051 gene locus_tag LOCUS_41460 47779 47051 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030011.1 protein_id gnl|my_center|LOCUS_41460 48771 47899 gene locus_tag LOCUS_41470 48771 47899 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973953.1 protein_id gnl|my_center|LOCUS_41470 49966 48926 gene locus_tag LOCUS_41480 49966 48926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973954.1 protein_id gnl|my_center|LOCUS_41480 50607 49954 gene locus_tag LOCUS_41490 50607 49954 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030008.1 protein_id gnl|my_center|LOCUS_41490 50788 51204 gene locus_tag LOCUS_41500 50788 51204 CDS product DUF192 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487141.1 protein_id gnl|my_center|LOCUS_41500 51893 51234 gene locus_tag LOCUS_41510 51893 51234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973957.1 protein_id gnl|my_center|LOCUS_41510 53008 51977 gene locus_tag LOCUS_41520 53008 51977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973954.1 protein_id gnl|my_center|LOCUS_41520 53700 52996 gene locus_tag LOCUS_41530 53700 52996 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030009.1 protein_id gnl|my_center|LOCUS_41530 54386 53760 gene locus_tag LOCUS_41540 54386 53760 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030005.1 protein_id gnl|my_center|LOCUS_41540 54973 54395 gene locus_tag LOCUS_41550 54973 54395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030004.1 protein_id gnl|my_center|LOCUS_41550 55292 55008 gene locus_tag LOCUS_41560 55292 55008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41560 55777 55604 gene locus_tag LOCUS_41570 55777 55604 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030002.1 protein_id gnl|my_center|LOCUS_41570 56713 55898 gene locus_tag LOCUS_41580 56713 55898 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804224.1 protein_id gnl|my_center|LOCUS_41580 57936 56710 gene locus_tag LOCUS_41590 57936 56710 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230183.1 protein_id gnl|my_center|LOCUS_41590 57851 58177 gene locus_tag LOCUS_41600 57851 58177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41600 59092 58205 gene locus_tag LOCUS_41610 59092 58205 CDS product DUF5936 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030001.1 protein_id gnl|my_center|LOCUS_41610 60047 59103 gene locus_tag LOCUS_41620 60047 59103 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030000.1 protein_id gnl|my_center|LOCUS_41620 61395 60058 gene locus_tag LOCUS_41630 61395 60058 CDS product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973968.1 protein_id gnl|my_center|LOCUS_41630 61776 61414 gene locus_tag LOCUS_41640 61776 61414 CDS product TadE/TadG family type IV pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029999.1 protein_id gnl|my_center|LOCUS_41640 62356 61778 gene locus_tag LOCUS_41650 62356 61778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41650 63609 62353 gene locus_tag LOCUS_41660 63609 62353 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973971.1 protein_id gnl|my_center|LOCUS_41660 64324 63617 gene locus_tag LOCUS_41670 gene cpaB 64324 63617 CDS product Flp pilus assembly protein CpaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973972.1 protein_id gnl|my_center|LOCUS_41670 65272 64376 gene locus_tag LOCUS_41680 65272 64376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029997.1 protein_id gnl|my_center|LOCUS_41680 65663 67360 gene locus_tag LOCUS_41690 65663 67360 CDS product glycoside hydrolase family 18 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029996.1 protein_id gnl|my_center|LOCUS_41690 68689 67376 gene locus_tag LOCUS_41700 68689 67376 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327153.1 protein_id gnl|my_center|LOCUS_41700 68907 70238 gene locus_tag LOCUS_41710 68907 70238 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230482.1 protein_id gnl|my_center|LOCUS_41710 70812 70246 gene locus_tag LOCUS_41720 70812 70246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973985.1 protein_id gnl|my_center|LOCUS_41720 72581 71106 gene locus_tag LOCUS_41730 72581 71106 CDS product gluconate:H+ symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029989.1 protein_id gnl|my_center|LOCUS_41730 73130 72720 gene locus_tag LOCUS_41740 73130 72720 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973987.1 protein_id gnl|my_center|LOCUS_41740 73891 73127 gene locus_tag LOCUS_41750 73891 73127 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973988.1 protein_id gnl|my_center|LOCUS_41750 74928 73888 gene locus_tag LOCUS_41760 74928 73888 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029988.1 protein_id gnl|my_center|LOCUS_41760 75063 76340 gene locus_tag LOCUS_41770 75063 76340 CDS product amino acid deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973990.1 protein_id gnl|my_center|LOCUS_41770 76352 77962 gene locus_tag LOCUS_41780 76352 77962 CDS product D-aminoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029987.1 protein_id gnl|my_center|LOCUS_41780 78019 79230 gene locus_tag LOCUS_41790 78019 79230 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973993.1 protein_id gnl|my_center|LOCUS_41790 79303 79722 gene locus_tag LOCUS_41800 79303 79722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973994.1 protein_id gnl|my_center|LOCUS_41800 81972 80152 gene locus_tag LOCUS_41810 81972 80152 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973998.1 protein_id gnl|my_center|LOCUS_41810 82314 83027 gene locus_tag LOCUS_41820 82314 83027 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029984.1 protein_id gnl|my_center|LOCUS_41820 83065 83802 gene locus_tag LOCUS_41830 83065 83802 CDS product Mut7-C RNAse domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974001.1 protein_id gnl|my_center|LOCUS_41830 85824 83818 gene locus_tag LOCUS_41840 85824 83818 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974002.1 protein_id gnl|my_center|LOCUS_41840 85995 89198 gene locus_tag LOCUS_41850 85995 89198 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270179.1 protein_id gnl|my_center|LOCUS_41850 89353 89949 gene locus_tag LOCUS_41860 89353 89949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41860 90326 90042 gene locus_tag LOCUS_41870 90326 90042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41870 91200 90319 gene locus_tag LOCUS_41880 gene mca 91200 90319 CDS product mycothiol conjugate amidase Mca inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007444314.1 protein_id gnl|my_center|LOCUS_41880 91351 91749 gene locus_tag LOCUS_41890 91351 91749 CDS product DUF4307 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974010.1 protein_id gnl|my_center|LOCUS_41890 91947 92444 gene locus_tag LOCUS_41900 gene greA 91947 92444 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974011.1 protein_id gnl|my_center|LOCUS_41900 93330 92530 gene locus_tag LOCUS_41910 93330 92530 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974012.1 protein_id gnl|my_center|LOCUS_41910 94433 93327 gene locus_tag LOCUS_41920 94433 93327 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029976.1 protein_id gnl|my_center|LOCUS_41920 95869 94640 gene locus_tag LOCUS_41930 gene ilvA 95869 94640 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029975.1 protein_id gnl|my_center|LOCUS_41930 96038 96535 gene locus_tag LOCUS_41940 96038 96535 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037666375.1 protein_id gnl|my_center|LOCUS_41940 96664 97173 gene locus_tag LOCUS_41950 96664 97173 CDS product sigma factor-like helix-turn-helix DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974016.1 protein_id gnl|my_center|LOCUS_41950 97203 97451 gene locus_tag LOCUS_41960 97203 97451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974017.1 protein_id gnl|my_center|LOCUS_41960 98732 97578 gene locus_tag LOCUS_41970 98732 97578 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870223.1 protein_id gnl|my_center|LOCUS_41970 98852 99970 gene locus_tag LOCUS_41980 98852 99970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974019.1 protein_id gnl|my_center|LOCUS_41980 100037 100717 gene locus_tag LOCUS_41990 gene msrA 100037 100717 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338316.1 protein_id gnl|my_center|LOCUS_41990 100872 101771 gene locus_tag LOCUS_42000 100872 101771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42000 102671 101808 gene locus_tag LOCUS_42010 102671 101808 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731478.1 protein_id gnl|my_center|LOCUS_42010 102880 103782 gene locus_tag LOCUS_42020 102880 103782 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151128636.1 protein_id gnl|my_center|LOCUS_42020 104937 103894 gene locus_tag LOCUS_42030 104937 103894 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974028.1 protein_id gnl|my_center|LOCUS_42030 105056 105988 gene locus_tag LOCUS_42040 105056 105988 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029967.1 protein_id gnl|my_center|LOCUS_42040 106119 107012 gene locus_tag LOCUS_42050 106119 107012 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971940.1 protein_id gnl|my_center|LOCUS_42050 110398 107108 gene locus_tag LOCUS_42060 110398 107108 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091308744.1 protein_id gnl|my_center|LOCUS_42060 111332 110649 gene locus_tag LOCUS_42070 111332 110649 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974037.1 protein_id gnl|my_center|LOCUS_42070 112915 111458 gene locus_tag LOCUS_42080 112915 111458 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029960.1 protein_id gnl|my_center|LOCUS_42080 114311 113049 gene locus_tag LOCUS_42090 114311 113049 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029959.1 protein_id gnl|my_center|LOCUS_42090 114520 114314 gene locus_tag LOCUS_42100 114520 114314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42100 114831 114517 gene locus_tag LOCUS_42110 114831 114517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327131.1 protein_id gnl|my_center|LOCUS_42110 115001 115294 gene locus_tag LOCUS_42120 115001 115294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42120 116888 115350 gene locus_tag LOCUS_42130 gene hutH 116888 115350 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974041.1 protein_id gnl|my_center|LOCUS_42130 118107 116953 gene locus_tag LOCUS_42140 118107 116953 CDS product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870180.1 protein_id gnl|my_center|LOCUS_42140 118994 118194 gene locus_tag LOCUS_42150 118994 118194 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029956.1 protein_id gnl|my_center|LOCUS_42150 120205 119084 gene locus_tag LOCUS_42160 120205 119084 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029954.1 protein_id gnl|my_center|LOCUS_42160 121216 120350 gene locus_tag LOCUS_42170 121216 120350 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029953.1 protein_id gnl|my_center|LOCUS_42170 121327 122916 gene locus_tag LOCUS_42180 121327 122916 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029952.1 protein_id gnl|my_center|LOCUS_42180 122926 123135 gene locus_tag LOCUS_42190 122926 123135 CDS product acyl-CoA carboxylase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974048.1 protein_id gnl|my_center|LOCUS_42190 123249 123377 gene locus_tag LOCUS_42200 123249 123377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974049.1 protein_id gnl|my_center|LOCUS_42200 123411 124031 gene locus_tag LOCUS_42210 123411 124031 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974050.1 protein_id gnl|my_center|LOCUS_42210 124551 124000 gene locus_tag LOCUS_42220 124551 124000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42220 124826 126598 gene locus_tag LOCUS_42230 124826 126598 CDS product biotin carboxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029950.1 protein_id gnl|my_center|LOCUS_42230 127634 126681 gene locus_tag LOCUS_42240 127634 126681 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029949.1 protein_id gnl|my_center|LOCUS_42240 129300 127852 gene locus_tag LOCUS_42250 129300 127852 CDS product NAD(P)H-quinone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030872192.1 protein_id gnl|my_center|LOCUS_42250 129385 129822 gene locus_tag LOCUS_42260 129385 129822 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974055.1 protein_id gnl|my_center|LOCUS_42260 129934 130758 gene locus_tag LOCUS_42270 129934 130758 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974056.1 protein_id gnl|my_center|LOCUS_42270 131235 130837 gene locus_tag LOCUS_42280 131235 130837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42280 131489 133120 gene locus_tag LOCUS_42290 131489 133120 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162495362.1 protein_id gnl|my_center|LOCUS_42290 133447 133359 gene locus_tag LOCUS_t00650 133447 133359 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 134186 133482 gene locus_tag LOCUS_42300 134186 133482 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029946.1 protein_id gnl|my_center|LOCUS_42300 134179 135237 gene locus_tag LOCUS_42310 gene deoC 134179 135237 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029945.1 protein_id gnl|my_center|LOCUS_42310 135243 136679 gene locus_tag LOCUS_42320 135243 136679 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029944.1 protein_id gnl|my_center|LOCUS_42320 136672 137562 gene locus_tag LOCUS_42330 136672 137562 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168715428.1 protein_id gnl|my_center|LOCUS_42330 138076 137636 gene locus_tag LOCUS_42340 138076 137636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029941.1 protein_id gnl|my_center|LOCUS_42340 138256 138858 gene locus_tag LOCUS_42350 138256 138858 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189397579.1 protein_id gnl|my_center|LOCUS_42350 139861 139085 gene locus_tag LOCUS_42360 139861 139085 CDS product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327117.1 protein_id gnl|my_center|LOCUS_42360 140094 140771 gene locus_tag LOCUS_42370 gene afsQ1 140094 140771 CDS product two-component system response regulator AfsQ1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974066.1 protein_id gnl|my_center|LOCUS_42370 140768 142375 gene locus_tag LOCUS_42380 gene afsQ2 140768 142375 CDS product two-component system sensor histidine kinase AfsQ2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974067.1 protein_id gnl|my_center|LOCUS_42380 142375 142977 gene locus_tag LOCUS_42390 142375 142977 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974068.1 protein_id gnl|my_center|LOCUS_42390 143061 143621 gene locus_tag LOCUS_42400 143061 143621 CDS product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029938.1 protein_id gnl|my_center|LOCUS_42400 143713 143916 gene locus_tag LOCUS_42410 143713 143916 CDS product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974070.1 protein_id gnl|my_center|LOCUS_42410 144344 144006 gene locus_tag LOCUS_42420 144344 144006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42420 145645 144488 gene locus_tag LOCUS_42430 145645 144488 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974072.1 protein_id gnl|my_center|LOCUS_42430 145769 146509 gene locus_tag LOCUS_42440 145769 146509 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029936.1 protein_id gnl|my_center|LOCUS_42440 147343 146531 gene locus_tag LOCUS_42450 147343 146531 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029934.1 protein_id gnl|my_center|LOCUS_42450 147263 147448 gene locus_tag LOCUS_42460 147263 147448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42460 147545 148834 gene locus_tag LOCUS_42470 147545 148834 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029933.1 protein_id gnl|my_center|LOCUS_42470 148955 149968 gene locus_tag LOCUS_42480 148955 149968 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974078.1 protein_id gnl|my_center|LOCUS_42480 150202 149852 gene locus_tag LOCUS_42490 150202 149852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42490 150358 150732 gene locus_tag LOCUS_42500 150358 150732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42500 151332 150769 gene locus_tag LOCUS_42510 151332 150769 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230158.1 protein_id gnl|my_center|LOCUS_42510 152765 151482 gene locus_tag LOCUS_42520 152765 151482 CDS product thymidine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030872150.1 protein_id gnl|my_center|LOCUS_42520 153170 152778 gene locus_tag LOCUS_42530 153170 152778 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974083.1 protein_id gnl|my_center|LOCUS_42530 154432 153167 gene locus_tag LOCUS_42540 154432 153167 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029928.1 protein_id gnl|my_center|LOCUS_42540 155553 154429 gene locus_tag LOCUS_42550 155553 154429 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029927.1 protein_id gnl|my_center|LOCUS_42550 157157 155553 gene locus_tag LOCUS_42560 157157 155553 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974086.1 protein_id gnl|my_center|LOCUS_42560 158359 157310 gene locus_tag LOCUS_42570 158359 157310 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974087.1 protein_id gnl|my_center|LOCUS_42570 159630 158617 gene locus_tag LOCUS_42580 159630 158617 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029926.1 protein_id gnl|my_center|LOCUS_42580 161083 159851 gene locus_tag LOCUS_42590 161083 159851 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029925.1 protein_id gnl|my_center|LOCUS_42590 161401 164133 gene locus_tag LOCUS_42600 161401 164133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42600 164347 164138 gene locus_tag LOCUS_42610 164347 164138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42610 164567 164352 gene locus_tag LOCUS_42620 164567 164352 CDS product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028317.1 protein_id gnl|my_center|LOCUS_42620 165375 164542 gene locus_tag LOCUS_42630 165375 164542 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028316.1 protein_id gnl|my_center|LOCUS_42630 166954 165881 gene locus_tag LOCUS_42640 166954 165881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974090.1 protein_id gnl|my_center|LOCUS_42640 167937 166999 gene locus_tag LOCUS_42650 167937 166999 CDS product N-acetylneuraminate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974091.1 protein_id gnl|my_center|LOCUS_42650 169190 167952 gene locus_tag LOCUS_42660 169190 167952 CDS product N-acylneuraminate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029924.1 protein_id gnl|my_center|LOCUS_42660 170530 169235 gene locus_tag LOCUS_42670 170530 169235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029923.1 protein_id gnl|my_center|LOCUS_42670 170759 171739 gene locus_tag LOCUS_42680 170759 171739 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974094.1 protein_id gnl|my_center|LOCUS_42680 171736 173073 gene locus_tag LOCUS_42690 171736 173073 CDS product alpha-2,8-polysialyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029922.1 protein_id gnl|my_center|LOCUS_42690 173229 174215 gene locus_tag LOCUS_42700 173229 174215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42700 176594 174267 gene locus_tag LOCUS_42710 176594 174267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42710 178060 176591 gene locus_tag LOCUS_42720 178060 176591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42720 178276 179448 gene locus_tag LOCUS_42730 178276 179448 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028897.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_42730 180140 179490 gene locus_tag LOCUS_42740 180140 179490 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974101.1 protein_id gnl|my_center|LOCUS_42740 180234 181640 gene locus_tag LOCUS_42750 180234 181640 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029917.1 protein_id gnl|my_center|LOCUS_42750 182295 181645 gene locus_tag LOCUS_42760 gene leuE 182295 181645 CDS product leucine efflux protein LeuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192135.1 protein_id gnl|my_center|LOCUS_42760 184018 182438 gene locus_tag LOCUS_42770 184018 182438 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974103.1 protein_id gnl|my_center|LOCUS_42770 184250 185170 gene locus_tag LOCUS_42780 184250 185170 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029915.1 protein_id gnl|my_center|LOCUS_42780 186372 185317 gene locus_tag LOCUS_42790 186372 185317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029914.1 protein_id gnl|my_center|LOCUS_42790 187034 186372 gene locus_tag LOCUS_42800 187034 186372 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974105.1 protein_id gnl|my_center|LOCUS_42800 188101 187346 gene locus_tag LOCUS_42810 188101 187346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029913.1 protein_id gnl|my_center|LOCUS_42810 188715 188098 gene locus_tag LOCUS_42820 188715 188098 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046247785.1 protein_id gnl|my_center|LOCUS_42820 188969 191683 gene locus_tag LOCUS_42830 188969 191683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42830 192051 191731 gene locus_tag LOCUS_42840 192051 191731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42840 193807 192233 gene locus_tag LOCUS_42850 193807 192233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42850 194083 194640 gene locus_tag LOCUS_42860 194083 194640 CDS product 2-oxo-4-hydroxy-4-carboxy-5-ureidoimidazoline decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029908.1 protein_id gnl|my_center|LOCUS_42860 194810 195190 gene locus_tag LOCUS_42870 gene sdhC 194810 195190 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974113.1 protein_id gnl|my_center|LOCUS_42870 195200 195694 gene locus_tag LOCUS_42880 195200 195694 CDS product succinate dehydrogenase hydrophobic membrane anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029907.1 protein_id gnl|my_center|LOCUS_42880 195714 197468 gene locus_tag LOCUS_42890 gene sdhA 195714 197468 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974115.1 protein_id gnl|my_center|LOCUS_42890 197468 198247 gene locus_tag LOCUS_42900 197468 198247 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974116.1 protein_id gnl|my_center|LOCUS_42900 198357 198767 gene locus_tag LOCUS_42910 198357 198767 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974118.1 protein_id gnl|my_center|LOCUS_42910 198805 199533 gene locus_tag LOCUS_42920 198805 199533 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029905.1 protein_id gnl|my_center|LOCUS_42920 202000 199583 gene locus_tag LOCUS_42930 202000 199583 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030282.1 protein_id gnl|my_center|LOCUS_42930 202162 202851 gene locus_tag LOCUS_42940 202162 202851 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804420.1 protein_id gnl|my_center|LOCUS_42940 202848 204335 gene locus_tag LOCUS_42950 202848 204335 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225021.1 protein_id gnl|my_center|LOCUS_42950 205662 204301 gene locus_tag LOCUS_42960 205662 204301 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029904.1 protein_id gnl|my_center|LOCUS_42960 206043 205699 gene locus_tag LOCUS_42970 206043 205699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42970 206042 207322 gene locus_tag LOCUS_42980 206042 207322 CDS product DUF5136 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486558.1 protein_id gnl|my_center|LOCUS_42980 208178 207270 gene locus_tag LOCUS_42990 208178 207270 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974125.1 protein_id gnl|my_center|LOCUS_42990 208660 208166 gene locus_tag LOCUS_43000 208660 208166 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029902.1 protein_id gnl|my_center|LOCUS_43000 209604 208657 gene locus_tag LOCUS_43010 209604 208657 CDS product decaprenyl-phosphate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029901.1 protein_id gnl|my_center|LOCUS_43010 210094 209597 gene locus_tag LOCUS_43020 210094 209597 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974128.1 protein_id gnl|my_center|LOCUS_43020 210239 211588 gene locus_tag LOCUS_43030 210239 211588 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974129.1 protein_id gnl|my_center|LOCUS_43030 211598 212353 gene locus_tag LOCUS_43040 211598 212353 CDS product decaprenylphospho-beta-D-erythro-pentofuranosid-2-ulose 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974130.1 protein_id gnl|my_center|LOCUS_43040 212996 212415 gene locus_tag LOCUS_43050 212996 212415 CDS product 2'-5' RNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029900.1 protein_id gnl|my_center|LOCUS_43050 214136 213123 gene locus_tag LOCUS_43060 gene trpS 214136 213123 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974132.1 protein_id gnl|my_center|LOCUS_43060 215859 214414 gene locus_tag LOCUS_43070 215859 214414 CDS product glycine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974134.1 protein_id gnl|my_center|LOCUS_43070 217311 216127 gene locus_tag LOCUS_43080 217311 216127 CDS product glutathionylspermidine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112824.1 protein_id gnl|my_center|LOCUS_43080 217662 217315 gene locus_tag LOCUS_43090 217662 217315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43090 219144 217753 gene locus_tag LOCUS_43100 219144 217753 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029898.1 protein_id gnl|my_center|LOCUS_43100 219191 219715 gene locus_tag LOCUS_43110 219191 219715 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029897.1 protein_id gnl|my_center|LOCUS_43110 219712 220158 gene locus_tag LOCUS_43120 219712 220158 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029896.1 protein_id gnl|my_center|LOCUS_43120 220155 220955 gene locus_tag LOCUS_43130 220155 220955 CDS product isocitrate lyase/phosphoenolpyruvate mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223482.1 protein_id gnl|my_center|LOCUS_43130 222072 221083 gene locus_tag LOCUS_43140 222072 221083 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974145.1 protein_id gnl|my_center|LOCUS_43140 223840 222464 gene locus_tag LOCUS_43150 223840 222464 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038534464.1 protein_id gnl|my_center|LOCUS_43150 224783 224292 gene locus_tag LOCUS_43160 224783 224292 CDS product DUF3017 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974147.1 protein_id gnl|my_center|LOCUS_43160 225744 224890 gene locus_tag LOCUS_43170 225744 224890 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974148.1 protein_id gnl|my_center|LOCUS_43170 225999 226751 gene locus_tag LOCUS_43180 225999 226751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43180 226879 227775 gene locus_tag LOCUS_43190 226879 227775 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191850455.1 protein_id gnl|my_center|LOCUS_43190 227772 229298 gene locus_tag LOCUS_43200 227772 229298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43200 229397 229864 gene locus_tag LOCUS_43210 229397 229864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974152.1 protein_id gnl|my_center|LOCUS_43210 231524 229956 gene locus_tag LOCUS_43220 gene purH 231524 229956 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029883.1 protein_id gnl|my_center|LOCUS_43220 232159 231521 gene locus_tag LOCUS_43230 gene purN 232159 231521 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974158.1 protein_id gnl|my_center|LOCUS_43230 232095 232634 gene locus_tag LOCUS_43240 232095 232634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43240 232634 233407 gene locus_tag LOCUS_43250 232634 233407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029882.1 protein_id gnl|my_center|LOCUS_43250 235397 233439 gene locus_tag LOCUS_43260 235397 233439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43260 235563 236732 gene locus_tag LOCUS_43270 235563 236732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43270 237851 236967 gene locus_tag LOCUS_43280 gene sucD 237851 236967 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974163.1 protein_id gnl|my_center|LOCUS_43280 239064 237880 gene locus_tag LOCUS_43290 gene sucC 239064 237880 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974164.1 protein_id gnl|my_center|LOCUS_43290 240733 239549 gene locus_tag LOCUS_43300 240733 239549 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162495359.1 protein_id gnl|my_center|LOCUS_43300 243276 240730 gene locus_tag LOCUS_43310 243276 240730 CDS product DUF5682 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029876.1 protein_id gnl|my_center|LOCUS_43310 244758 243631 gene locus_tag LOCUS_43320 244758 243631 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029875.1 protein_id gnl|my_center|LOCUS_43320 244948 246297 gene locus_tag LOCUS_43330 244948 246297 CDS product SWIM zinc finger family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055512687.1 protein_id gnl|my_center|LOCUS_43330 246431 248077 gene locus_tag LOCUS_43340 246431 248077 CDS product DUF5691 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029873.1 protein_id gnl|my_center|LOCUS_43340 248530 248114 gene locus_tag LOCUS_43350 248530 248114 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974171.1 protein_id gnl|my_center|LOCUS_43350 249257 250183 gene locus_tag LOCUS_43360 249257 250183 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029872.1 protein_id gnl|my_center|LOCUS_43360 250416 251996 gene locus_tag LOCUS_43370 250416 251996 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029871.1 protein_id gnl|my_center|LOCUS_43370 254499 252013 gene locus_tag LOCUS_43380 gene pcrA 254499 252013 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029870.1 protein_id gnl|my_center|LOCUS_43380 254938 256113 gene locus_tag LOCUS_43390 254938 256113 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029869.1 protein_id gnl|my_center|LOCUS_43390 256140 257126 gene locus_tag LOCUS_43400 256140 257126 CDS product tellurite resistance/C4-dicarboxylate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974176.1 protein_id gnl|my_center|LOCUS_43400 257457 257104 gene locus_tag LOCUS_43410 257457 257104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327076.1 protein_id gnl|my_center|LOCUS_43410 257904 258965 gene locus_tag LOCUS_43420 257904 258965 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029867.1 protein_id gnl|my_center|LOCUS_43420 259728 259009 gene locus_tag LOCUS_43430 259728 259009 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029866.1 protein_id gnl|my_center|LOCUS_43430 261053 259725 gene locus_tag LOCUS_43440 261053 259725 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974180.1 protein_id gnl|my_center|LOCUS_43440 261197 262582 gene locus_tag LOCUS_43450 261197 262582 CDS product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029865.1 protein_id gnl|my_center|LOCUS_43450 262569 262829 gene locus_tag LOCUS_43460 262569 262829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43460 263465 262932 gene locus_tag LOCUS_43470 263465 262932 CDS product DoxX family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037897578.1 protein_id gnl|my_center|LOCUS_43470 265028 263754 gene locus_tag LOCUS_43480 265028 263754 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029864.1 protein_id gnl|my_center|LOCUS_43480 265207 266130 gene locus_tag LOCUS_43490 265207 266130 CDS product DUF4429 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976013.1 protein_id gnl|my_center|LOCUS_43490 267073 266270 gene locus_tag LOCUS_43500 267073 266270 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974185.1 protein_id gnl|my_center|LOCUS_43500 267195 267710 gene locus_tag LOCUS_43510 267195 267710 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486580.1 protein_id gnl|my_center|LOCUS_43510 269297 267714 gene locus_tag LOCUS_43520 gene guaA 269297 267714 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974187.1 protein_id gnl|my_center|LOCUS_43520 269664 270020 gene locus_tag LOCUS_43530 269664 270020 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486583.1 protein_id gnl|my_center|LOCUS_43530 272075 270285 gene locus_tag LOCUS_43540 272075 270285 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029860.1 protein_id gnl|my_center|LOCUS_43540 273852 272173 gene locus_tag LOCUS_43550 273852 272173 CDS product succinic semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029859.1 protein_id gnl|my_center|LOCUS_43550 275266 274097 gene locus_tag LOCUS_43560 275266 274097 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029857.1 protein_id gnl|my_center|LOCUS_43560 277183 275348 gene locus_tag LOCUS_43570 277183 275348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43570 279935 277371 gene locus_tag LOCUS_43580 279935 277371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_43580 282147 280090 gene locus_tag LOCUS_43590 282147 280090 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029854.1 protein_id gnl|my_center|LOCUS_43590 284033 282684 gene locus_tag LOCUS_43600 284033 282684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43600 286014 284308 gene locus_tag LOCUS_43610 286014 284308 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974200.1 protein_id gnl|my_center|LOCUS_43610 286312 287520 gene locus_tag LOCUS_43620 286312 287520 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974201.1 protein_id gnl|my_center|LOCUS_43620 288704 287580 gene locus_tag LOCUS_43630 288704 287580 CDS product GuaB3 family IMP dehydrogenase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974202.1 protein_id gnl|my_center|LOCUS_43630 290477 288969 gene locus_tag LOCUS_43640 gene guaB 290477 288969 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974203.1 protein_id gnl|my_center|LOCUS_43640 291210 290620 gene locus_tag LOCUS_43650 291210 290620 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974204.1 protein_id gnl|my_center|LOCUS_43650 292144 291533 gene locus_tag LOCUS_43660 292144 291533 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948568.1 protein_id gnl|my_center|LOCUS_43660 292525 292854 gene locus_tag LOCUS_43670 292525 292854 CDS product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974205.1 protein_id gnl|my_center|LOCUS_43670 293735 292947 gene locus_tag LOCUS_43680 293735 292947 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029852.1 protein_id gnl|my_center|LOCUS_43680 293640 293900 gene locus_tag LOCUS_43690 293640 293900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43690 293925 294593 gene locus_tag LOCUS_43700 293925 294593 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189284363.1 protein_id gnl|my_center|LOCUS_43700 294702 295463 gene locus_tag LOCUS_43710 294702 295463 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029850.1 protein_id gnl|my_center|LOCUS_43710 297153 295528 gene locus_tag LOCUS_43720 gene groL 297153 295528 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974210.1 protein_id gnl|my_center|LOCUS_43720 297586 297278 gene locus_tag LOCUS_43730 gene groES 297586 297278 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974211.1 protein_id gnl|my_center|LOCUS_43730 298560 297871 gene locus_tag LOCUS_43740 298560 297871 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029848.1 protein_id gnl|my_center|LOCUS_43740 299450 298557 gene locus_tag LOCUS_43750 299450 298557 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486593.1 protein_id gnl|my_center|LOCUS_43750 299574 300740 gene locus_tag LOCUS_43760 299574 300740 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029846.1 protein_id gnl|my_center|LOCUS_43760 301776 300787 gene locus_tag LOCUS_43770 301776 300787 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486597.1 protein_id gnl|my_center|LOCUS_43770 303035 301983 gene locus_tag LOCUS_43780 303035 301983 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029843.1 protein_id gnl|my_center|LOCUS_43780 303208 305529 gene locus_tag LOCUS_43790 303208 305529 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031390.1 protein_id gnl|my_center|LOCUS_43790 305847 305593 gene locus_tag LOCUS_43800 305847 305593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029842.1 protein_id gnl|my_center|LOCUS_43800 306929 305844 gene locus_tag LOCUS_43810 gene tsaD 306929 305844 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029841.1 protein_id gnl|my_center|LOCUS_43810 307434 306922 gene locus_tag LOCUS_43820 gene rimI 307434 306922 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029840.1 protein_id gnl|my_center|LOCUS_43820 308084 307431 gene locus_tag LOCUS_43830 gene tsaB 308084 307431 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029839.1 protein_id gnl|my_center|LOCUS_43830 308195 308758 gene locus_tag LOCUS_43840 308195 308758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974224.1 protein_id gnl|my_center|LOCUS_43840 308939 309106 gene locus_tag LOCUS_43850 308939 309106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43850 309634 309110 gene locus_tag LOCUS_43860 gene tsaE 309634 309110 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029837.1 protein_id gnl|my_center|LOCUS_43860 310865 309600 gene locus_tag LOCUS_43870 310865 309600 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327056.1 protein_id gnl|my_center|LOCUS_43870 312115 310955 gene locus_tag LOCUS_43880 gene alr 312115 310955 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029835.1 protein_id gnl|my_center|LOCUS_43880 312797 312156 gene locus_tag LOCUS_43890 312797 312156 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031843.1 protein_id gnl|my_center|LOCUS_43890 312910 313335 gene locus_tag LOCUS_43900 312910 313335 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031844.1 protein_id gnl|my_center|LOCUS_43900 314791 313358 gene locus_tag LOCUS_43910 314791 313358 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029833.1 protein_id gnl|my_center|LOCUS_43910 315279 314908 gene locus_tag LOCUS_43920 315279 314908 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974229.1 protein_id gnl|my_center|LOCUS_43920 315588 315289 gene locus_tag LOCUS_43930 315588 315289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43930 316039 315593 gene locus_tag LOCUS_43940 316039 315593 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029722.1 protein_id gnl|my_center|LOCUS_43940 316262 317104 gene locus_tag LOCUS_43950 gene whiJ 316262 317104 CDS product transcriptional regulator WhiJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029721.1 protein_id gnl|my_center|LOCUS_43950 317112 317333 gene locus_tag LOCUS_43960 317112 317333 CDS product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976062.1 protein_id gnl|my_center|LOCUS_43960 319141 317294 gene locus_tag LOCUS_43970 gene glmS 319141 317294 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974233.1 protein_id gnl|my_center|LOCUS_43970 319293 320282 gene locus_tag LOCUS_43980 gene coaA 319293 320282 CDS product type I pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974235.1 protein_id gnl|my_center|LOCUS_43980 320294 321235 gene locus_tag LOCUS_43990 320294 321235 CDS product DUF389 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082376.1 protein_id gnl|my_center|LOCUS_43990 322717 321359 gene locus_tag LOCUS_44000 gene glmM 322717 321359 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974237.1 protein_id gnl|my_center|LOCUS_44000 323399 322887 gene locus_tag LOCUS_44010 gene rpsI 323399 322887 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974238.1 protein_id gnl|my_center|LOCUS_44010 323885 323442 gene locus_tag LOCUS_44020 gene rplM 323885 323442 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974239.1 protein_id gnl|my_center|LOCUS_44020 325326 324109 gene locus_tag LOCUS_44030 325326 324109 CDS product glycosyltransferase family 87 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486603.1 protein_id gnl|my_center|LOCUS_44030 325401 326279 gene locus_tag LOCUS_44040 325401 326279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029828.1 protein_id gnl|my_center|LOCUS_44040 327131 326301 gene locus_tag LOCUS_44050 gene truA 327131 326301 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974242.1 protein_id gnl|my_center|LOCUS_44050 327783 327289 gene locus_tag LOCUS_44060 gene rplQ 327783 327289 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974243.1 protein_id gnl|my_center|LOCUS_44060 328997 327975 gene locus_tag LOCUS_44070 328997 327975 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003966937.1 protein_id gnl|my_center|LOCUS_44070 329520 329116 gene locus_tag LOCUS_44080 gene rpsK 329520 329116 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948617.1 protein_id gnl|my_center|LOCUS_44080 329970 329590 gene locus_tag LOCUS_44090 gene rpsM 329970 329590 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974244.1 protein_id gnl|my_center|LOCUS_44090 330566 330345 gene locus_tag LOCUS_44100 gene infA 330566 330345 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948620.1 protein_id gnl|my_center|LOCUS_44100 331551 330715 gene locus_tag LOCUS_44110 gene map 331551 330715 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029827.1 protein_id gnl|my_center|LOCUS_44110 332335 331682 gene locus_tag LOCUS_44120 332335 331682 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029826.1 protein_id gnl|my_center|LOCUS_44120 333648 332335 gene locus_tag LOCUS_44130 gene secY 333648 332335 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974248.1 protein_id gnl|my_center|LOCUS_44130 334344 333889 gene locus_tag LOCUS_44140 gene rplO 334344 333889 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974249.1 protein_id gnl|my_center|LOCUS_44140 334529 334347 gene locus_tag LOCUS_44150 gene rpmD 334529 334347 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974250.1 protein_id gnl|my_center|LOCUS_44150 335137 334529 gene locus_tag LOCUS_44160 gene rpsE 335137 334529 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974251.1 protein_id gnl|my_center|LOCUS_44160 335557 335174 gene locus_tag LOCUS_44170 gene rplR 335557 335174 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974252.1 protein_id gnl|my_center|LOCUS_44170 336100 335561 gene locus_tag LOCUS_44180 gene rplF 336100 335561 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974253.1 protein_id gnl|my_center|LOCUS_44180 336523 336125 gene locus_tag LOCUS_44190 gene rpsH 336523 336125 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974254.1 protein_id gnl|my_center|LOCUS_44190 336920 336735 gene locus_tag LOCUS_44200 336920 336735 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948630.1 protein_id gnl|my_center|LOCUS_44200 337483 336926 gene locus_tag LOCUS_44210 gene rplE 337483 336926 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974255.1 protein_id gnl|my_center|LOCUS_44210 337806 337483 gene locus_tag LOCUS_44220 gene rplX 337806 337483 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974256.1 protein_id gnl|my_center|LOCUS_44220 338177 337809 gene locus_tag LOCUS_44230 gene rplN 338177 337809 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974257.1 protein_id gnl|my_center|LOCUS_44230 338561 338274 gene locus_tag LOCUS_44240 gene rpsQ 338561 338274 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974258.1 protein_id gnl|my_center|LOCUS_44240 338782 338558 gene locus_tag LOCUS_44250 gene rpmC 338782 338558 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974259.1 protein_id gnl|my_center|LOCUS_44250 339201 338782 gene locus_tag LOCUS_44260 gene rplP 339201 338782 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974260.1 protein_id gnl|my_center|LOCUS_44260 340037 339207 gene locus_tag LOCUS_44270 gene rpsC 340037 339207 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974261.1 protein_id gnl|my_center|LOCUS_44270 340384 340037 gene locus_tag LOCUS_44280 gene rplV 340384 340037 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974262.1 protein_id gnl|my_center|LOCUS_44280 340707 340426 gene locus_tag LOCUS_44290 gene rpsS 340707 340426 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974263.1 protein_id gnl|my_center|LOCUS_44290 341556 340720 gene locus_tag LOCUS_44300 gene rplB 341556 340720 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974264.1 protein_id gnl|my_center|LOCUS_44300 342027 341608 gene locus_tag LOCUS_44310 gene rplW 342027 341608 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974265.1 protein_id gnl|my_center|LOCUS_44310 342683 342027 gene locus_tag LOCUS_44320 gene rplD 342683 342027 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974266.1 protein_id gnl|my_center|LOCUS_44320 343336 342692 gene locus_tag LOCUS_44330 gene rplC 343336 342692 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974267.1 protein_id gnl|my_center|LOCUS_44330 343662 343354 gene locus_tag LOCUS_44340 gene rpsJ 343662 343354 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948644.1 protein_id gnl|my_center|LOCUS_44340 344435 344112 gene locus_tag LOCUS_44350 344435 344112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44350 349048 344432 gene locus_tag LOCUS_44360 349048 344432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44360 349782 349135 gene locus_tag LOCUS_44370 349782 349135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974272.1 protein_id gnl|my_center|LOCUS_44370 351078 349900 gene locus_tag LOCUS_44380 351078 349900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44380 351259 352206 gene locus_tag LOCUS_44390 351259 352206 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029804.1 protein_id gnl|my_center|LOCUS_44390 352493 353902 gene locus_tag LOCUS_44400 352493 353902 CDS product alpha-lytic protease prodomain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029803.1 protein_id gnl|my_center|LOCUS_44400 355102 353999 gene locus_tag LOCUS_44410 355102 353999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029802.1 protein_id gnl|my_center|LOCUS_44410 356406 355213 gene locus_tag LOCUS_44420 gene tuf 356406 355213 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029795.1 protein_id gnl|my_center|LOCUS_44420 358691 356565 gene locus_tag LOCUS_44430 gene fusA 358691 356565 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974302.1 protein_id gnl|my_center|LOCUS_44430 359201 358731 gene locus_tag LOCUS_44440 gene rpsG 359201 358731 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974303.1 protein_id gnl|my_center|LOCUS_44440 359575 359204 gene locus_tag LOCUS_44450 gene rpsL 359575 359204 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948652.1 protein_id gnl|my_center|LOCUS_44450 360493 359870 gene locus_tag LOCUS_44460 360493 359870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44460 361705 360773 gene locus_tag LOCUS_44470 361705 360773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44470 362324 361875 gene locus_tag LOCUS_44480 362324 361875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44480 362592 362867 gene locus_tag LOCUS_44490 362592 362867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44490 362949 363725 gene locus_tag LOCUS_44500 362949 363725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44500 363722 363934 gene locus_tag LOCUS_44510 363722 363934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44510 364374 364138 gene locus_tag LOCUS_44520 364374 364138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44520 364775 364368 gene locus_tag LOCUS_44530 364775 364368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44530 364796 365212 gene locus_tag LOCUS_44540 364796 365212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44540 365342 365947 gene locus_tag LOCUS_44550 365342 365947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44550 366030 366320 gene locus_tag LOCUS_44560 366030 366320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44560 366386 366793 gene locus_tag LOCUS_44570 366386 366793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44570 367025 367225 gene locus_tag LOCUS_44580 367025 367225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44580 367669 368418 gene locus_tag LOCUS_44590 367669 368418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44590 368440 369633 gene locus_tag LOCUS_44600 368440 369633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44600 369630 370904 gene locus_tag LOCUS_44610 369630 370904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44610 370963 371919 gene locus_tag LOCUS_44620 370963 371919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44620 371978 373183 gene locus_tag LOCUS_44630 371978 373183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44630 373194 374318 gene locus_tag LOCUS_44640 373194 374318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44640 374322 375056 gene locus_tag LOCUS_44650 374322 375056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44650 375087 376535 gene locus_tag LOCUS_44660 375087 376535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44660 376574 377437 gene locus_tag LOCUS_44670 376574 377437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44670 377515 378387 gene locus_tag LOCUS_44680 377515 378387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44680 378393 378641 gene locus_tag LOCUS_44690 378393 378641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44690 378638 378889 gene locus_tag LOCUS_44700 378638 378889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44700 382873 378956 gene locus_tag LOCUS_44710 382873 378956 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974308.1 protein_id gnl|my_center|LOCUS_44710 386456 382971 gene locus_tag LOCUS_44720 gene rpoB 386456 382971 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029792.1 protein_id gnl|my_center|LOCUS_44720 387409 387023 gene locus_tag LOCUS_44730 gene rplL 387409 387023 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974310.1 protein_id gnl|my_center|LOCUS_44730 388055 387525 gene locus_tag LOCUS_44740 gene rplJ 388055 387525 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974311.1 protein_id gnl|my_center|LOCUS_44740 389122 388361 gene locus_tag LOCUS_44750 389122 388361 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974313.1 protein_id gnl|my_center|LOCUS_44750 390022 389297 gene locus_tag LOCUS_44760 gene rplA 390022 389297 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974314.1 protein_id gnl|my_center|LOCUS_44760 390538 390104 gene locus_tag LOCUS_44770 gene rplK 390538 390104 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974315.1 protein_id gnl|my_center|LOCUS_44770 391577 390708 gene locus_tag LOCUS_44780 gene nusG 391577 390708 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029791.1 protein_id gnl|my_center|LOCUS_44780 391945 391658 gene locus_tag LOCUS_44790 gene secE 391945 391658 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974317.1 protein_id gnl|my_center|LOCUS_44790 392126 392053 gene locus_tag LOCUS_t00660 392126 392053 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 392399 393625 gene locus_tag LOCUS_44800 392399 393625 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029790.1 protein_id gnl|my_center|LOCUS_44800 393747 394787 gene locus_tag LOCUS_44810 393747 394787 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974319.1 protein_id gnl|my_center|LOCUS_44810 395409 394768 gene locus_tag LOCUS_44820 395409 394768 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222250.1 protein_id gnl|my_center|LOCUS_44820 395514 396146 gene locus_tag LOCUS_44830 395514 396146 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222251.1 protein_id gnl|my_center|LOCUS_44830 397242 396187 gene locus_tag LOCUS_44840 397242 396187 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270166.1 protein_id gnl|my_center|LOCUS_44840 397962 397534 gene locus_tag LOCUS_44850 397962 397534 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029785.1 protein_id gnl|my_center|LOCUS_44850 398423 397971 gene locus_tag LOCUS_44860 398423 397971 CDS product MaoC family dehydratase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029784.1 protein_id gnl|my_center|LOCUS_44860 398684 398520 gene locus_tag LOCUS_44870 gene rpmG 398684 398520 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948671.1 protein_id gnl|my_center|LOCUS_44870 398845 398772 gene locus_tag LOCUS_t00670 398845 398772 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 398964 398891 gene locus_tag LOCUS_t00680 398964 398891 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 399189 400448 gene locus_tag LOCUS_44880 399189 400448 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029783.1 protein_id gnl|my_center|LOCUS_44880 400520 401176 gene locus_tag LOCUS_44890 400520 401176 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029782.1 protein_id gnl|my_center|LOCUS_44890 401494 401282 gene locus_tag LOCUS_44900 401494 401282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44900 401888 402376 gene locus_tag LOCUS_44910 401888 402376 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974333.1 protein_id gnl|my_center|LOCUS_44910 402424 403782 gene locus_tag LOCUS_44920 402424 403782 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029762.1 protein_id gnl|my_center|LOCUS_44920 404399 404007 gene locus_tag LOCUS_44930 404399 404007 CDS product YccF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029761.1 protein_id gnl|my_center|LOCUS_44930 405259 404396 gene locus_tag LOCUS_44940 gene htpX 405259 404396 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974338.1 protein_id gnl|my_center|LOCUS_44940 407049 405523 gene locus_tag LOCUS_44950 407049 405523 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029760.1 protein_id gnl|my_center|LOCUS_44950 408620 407046 gene locus_tag LOCUS_44960 408620 407046 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029759.1 protein_id gnl|my_center|LOCUS_44960 410621 408627 gene locus_tag LOCUS_44970 410621 408627 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029758.1 protein_id gnl|my_center|LOCUS_44970 411067 410618 gene locus_tag LOCUS_44980 411067 410618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44980 411873 411067 gene locus_tag LOCUS_44990 411873 411067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44990 412595 411870 gene locus_tag LOCUS_45000 412595 411870 CDS product NADH-quinone oxidoreductase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974344.1 protein_id gnl|my_center|LOCUS_45000 413563 412595 gene locus_tag LOCUS_45010 413563 412595 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029756.1 protein_id gnl|my_center|LOCUS_45010 414792 413560 gene locus_tag LOCUS_45020 414792 413560 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029755.1 protein_id gnl|my_center|LOCUS_45020 415397 414789 gene locus_tag LOCUS_45030 415397 414789 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486629.1 protein_id gnl|my_center|LOCUS_45030 415804 415388 gene locus_tag LOCUS_45040 415804 415388 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974348.1 protein_id gnl|my_center|LOCUS_45040 416094 417317 gene locus_tag LOCUS_45050 416094 417317 CDS product sensor domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029753.1 protein_id gnl|my_center|LOCUS_45050 418047 417388 gene locus_tag LOCUS_45060 418047 417388 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972782.1 protein_id gnl|my_center|LOCUS_45060 419306 418044 gene locus_tag LOCUS_45070 419306 418044 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222997.1 protein_id gnl|my_center|LOCUS_45070 420139 419306 gene locus_tag LOCUS_45080 420139 419306 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222998.1 protein_id gnl|my_center|LOCUS_45080 420433 421803 gene locus_tag LOCUS_45090 420433 421803 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029752.1 protein_id gnl|my_center|LOCUS_45090 421951 422610 gene locus_tag LOCUS_45100 421951 422610 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974351.1 protein_id gnl|my_center|LOCUS_45100 >Feature sequence10 292 1266 gene locus_tag LOCUS_45110 292 1266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_45110 1266 1922 gene locus_tag LOCUS_45120 1266 1922 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977032.1 protein_id gnl|my_center|LOCUS_45120 3279 1987 gene locus_tag LOCUS_45130 3279 1987 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027979.1 protein_id gnl|my_center|LOCUS_45130 3351 4382 gene locus_tag LOCUS_45140 3351 4382 CDS product HAD hydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027978.1 protein_id gnl|my_center|LOCUS_45140 4599 5642 gene locus_tag LOCUS_45150 4599 5642 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027977.1 protein_id gnl|my_center|LOCUS_45150 5639 6676 gene locus_tag LOCUS_45160 5639 6676 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868181.1 protein_id gnl|my_center|LOCUS_45160 6673 7533 gene locus_tag LOCUS_45170 6673 7533 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027975.1 protein_id gnl|my_center|LOCUS_45170 7894 7547 gene locus_tag LOCUS_45180 7894 7547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977038.1 protein_id gnl|my_center|LOCUS_45180 7937 8278 gene locus_tag LOCUS_45190 7937 8278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977039.1 protein_id gnl|my_center|LOCUS_45190 8286 9101 gene locus_tag LOCUS_45200 8286 9101 CDS product hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027974.1 protein_id gnl|my_center|LOCUS_45200 9098 10003 gene locus_tag LOCUS_45210 9098 10003 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027973.1 protein_id gnl|my_center|LOCUS_45210 10175 11893 gene locus_tag LOCUS_45220 gene recN 10175 11893 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325905.1 protein_id gnl|my_center|LOCUS_45220 11922 12677 gene locus_tag LOCUS_45230 11922 12677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45230 12864 14003 gene locus_tag LOCUS_45240 12864 14003 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037666770.1 protein_id gnl|my_center|LOCUS_45240 15684 14026 gene locus_tag LOCUS_45250 15684 14026 CDS product PucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027970.1 protein_id gnl|my_center|LOCUS_45250 17511 15709 gene locus_tag LOCUS_45260 17511 15709 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027969.1 protein_id gnl|my_center|LOCUS_45260 17981 17568 gene locus_tag LOCUS_45270 17981 17568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45270 18054 19703 gene locus_tag LOCUS_45280 18054 19703 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027968.1 protein_id gnl|my_center|LOCUS_45280 19802 20428 gene locus_tag LOCUS_45290 19802 20428 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977050.1 protein_id gnl|my_center|LOCUS_45290 20625 22679 gene locus_tag LOCUS_45300 20625 22679 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868162.1 protein_id gnl|my_center|LOCUS_45300 22822 23937 gene locus_tag LOCUS_45310 gene ald 22822 23937 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868159.1 protein_id gnl|my_center|LOCUS_45310 24453 25454 gene locus_tag LOCUS_45320 24453 25454 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977053.1 protein_id gnl|my_center|LOCUS_45320 25451 25981 gene locus_tag LOCUS_45330 25451 25981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162495132.1 protein_id gnl|my_center|LOCUS_45330 26000 27199 gene locus_tag LOCUS_45340 26000 27199 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868147.1 protein_id gnl|my_center|LOCUS_45340 27196 27810 gene locus_tag LOCUS_45350 gene scpB 27196 27810 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027964.1 protein_id gnl|my_center|LOCUS_45350 27810 28925 gene locus_tag LOCUS_45360 27810 28925 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027963.1 protein_id gnl|my_center|LOCUS_45360 29005 29724 gene locus_tag LOCUS_45370 29005 29724 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027962.1 protein_id gnl|my_center|LOCUS_45370 29721 30743 gene locus_tag LOCUS_45380 29721 30743 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977058.1 protein_id gnl|my_center|LOCUS_45380 31581 30781 gene locus_tag LOCUS_45390 31581 30781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45390 31569 32654 gene locus_tag LOCUS_45400 31569 32654 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027959.1 protein_id gnl|my_center|LOCUS_45400 32789 33484 gene locus_tag LOCUS_45410 gene cmk 32789 33484 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027958.1 protein_id gnl|my_center|LOCUS_45410 33481 34125 gene locus_tag LOCUS_45420 33481 34125 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977065.1 protein_id gnl|my_center|LOCUS_45420 34200 35678 gene locus_tag LOCUS_45430 gene der 34200 35678 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977066.1 protein_id gnl|my_center|LOCUS_45430 36010 35750 gene locus_tag LOCUS_45440 36010 35750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977067.1 protein_id gnl|my_center|LOCUS_45440 36860 36078 gene locus_tag LOCUS_45450 36860 36078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977068.1 protein_id gnl|my_center|LOCUS_45450 37673 36969 gene locus_tag LOCUS_45460 37673 36969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45460 39792 38101 gene locus_tag LOCUS_45470 gene ctaD 39792 38101 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976660.1 protein_id gnl|my_center|LOCUS_45470 40238 40453 gene locus_tag LOCUS_45480 40238 40453 CDS product I78 family peptidase inhibitor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977071.1 protein_id gnl|my_center|LOCUS_45480 41524 40523 gene locus_tag LOCUS_45490 41524 40523 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027956.1 protein_id gnl|my_center|LOCUS_45490 42903 41764 gene locus_tag LOCUS_45500 42903 41764 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977073.1 protein_id gnl|my_center|LOCUS_45500 43127 44302 gene locus_tag LOCUS_45510 43127 44302 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977076.1 protein_id gnl|my_center|LOCUS_45510 44793 44356 gene locus_tag LOCUS_45520 44793 44356 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977077.1 protein_id gnl|my_center|LOCUS_45520 45084 46280 gene locus_tag LOCUS_45530 45084 46280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45530 46297 47178 gene locus_tag LOCUS_45540 46297 47178 CDS product DUF1684 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027953.1 protein_id gnl|my_center|LOCUS_45540 47600 47268 gene locus_tag LOCUS_45550 47600 47268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45550 47545 48282 gene locus_tag LOCUS_45560 47545 48282 CDS product S1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977080.1 protein_id gnl|my_center|LOCUS_45560 48687 49760 gene locus_tag LOCUS_45570 48687 49760 CDS product S1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027949.1 protein_id gnl|my_center|LOCUS_45570 50838 49780 gene locus_tag LOCUS_45580 50838 49780 CDS product DUF3533 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977086.1 protein_id gnl|my_center|LOCUS_45580 50975 54502 gene locus_tag LOCUS_45590 gene dnaE 50975 54502 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027948.1 protein_id gnl|my_center|LOCUS_45590 54499 55467 gene locus_tag LOCUS_45600 54499 55467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027947.1 protein_id gnl|my_center|LOCUS_45600 56570 55533 gene locus_tag LOCUS_45610 gene cbcC 56570 55533 CDS product carbohydrate-binding protein CbpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027945.1 protein_id gnl|my_center|LOCUS_45610 56902 56768 gene locus_tag LOCUS_45620 56902 56768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977094.1 protein_id gnl|my_center|LOCUS_45620 57170 57538 gene locus_tag LOCUS_45630 57170 57538 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027943.1 protein_id gnl|my_center|LOCUS_45630 58345 57590 gene locus_tag LOCUS_45640 58345 57590 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027942.1 protein_id gnl|my_center|LOCUS_45640 59460 58363 gene locus_tag LOCUS_45650 59460 58363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45650 60328 59528 gene locus_tag LOCUS_45660 60328 59528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45660 61379 60321 gene locus_tag LOCUS_45670 61379 60321 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878124.1 protein_id gnl|my_center|LOCUS_45670 62092 61376 gene locus_tag LOCUS_45680 62092 61376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45680 61992 62318 gene locus_tag LOCUS_45690 61992 62318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45690 62707 63519 gene locus_tag LOCUS_45700 62707 63519 CDS product SGNH family lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977101.1 protein_id gnl|my_center|LOCUS_45700 65145 63532 gene locus_tag LOCUS_45710 65145 63532 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027941.1 protein_id gnl|my_center|LOCUS_45710 65631 65807 gene locus_tag LOCUS_45720 65631 65807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45720 66707 65925 gene locus_tag LOCUS_45730 66707 65925 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027939.1 protein_id gnl|my_center|LOCUS_45730 67594 66704 gene locus_tag LOCUS_45740 67594 66704 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027938.1 protein_id gnl|my_center|LOCUS_45740 67791 67711 gene locus_tag LOCUS_t00690 67791 67711 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 69568 68423 gene locus_tag LOCUS_45750 69568 68423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325881.1 protein_id gnl|my_center|LOCUS_45750 70350 69601 gene locus_tag LOCUS_45760 70350 69601 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977110.1 protein_id gnl|my_center|LOCUS_45760 71703 70378 gene locus_tag LOCUS_45770 gene hmgA 71703 70378 CDS product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977111.1 protein_id gnl|my_center|LOCUS_45770 71840 72397 gene locus_tag LOCUS_45780 71840 72397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027936.1 protein_id gnl|my_center|LOCUS_45780 72394 73017 gene locus_tag LOCUS_45790 72394 73017 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222036.1 protein_id gnl|my_center|LOCUS_45790 73157 75388 gene locus_tag LOCUS_45800 73157 75388 CDS product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027934.1 protein_id gnl|my_center|LOCUS_45800 75512 76945 gene locus_tag LOCUS_45810 75512 76945 CDS product citrate:proton symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027933.1 protein_id gnl|my_center|LOCUS_45810 76973 78190 gene locus_tag LOCUS_45820 76973 78190 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027932.1 protein_id gnl|my_center|LOCUS_45820 78611 80083 gene locus_tag LOCUS_45830 78611 80083 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977118.1 protein_id gnl|my_center|LOCUS_45830 80193 81581 gene locus_tag LOCUS_45840 80193 81581 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027930.1 protein_id gnl|my_center|LOCUS_45840 81598 82686 gene locus_tag LOCUS_45850 81598 82686 CDS product Zn-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027929.1 protein_id gnl|my_center|LOCUS_45850 83639 82683 gene locus_tag LOCUS_45860 83639 82683 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027928.1 protein_id gnl|my_center|LOCUS_45860 84604 83834 gene locus_tag LOCUS_45870 84604 83834 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027927.1 protein_id gnl|my_center|LOCUS_45870 86080 84608 gene locus_tag LOCUS_45880 86080 84608 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809224.1 protein_id gnl|my_center|LOCUS_45880 86240 86581 gene locus_tag LOCUS_45890 86240 86581 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815632.1 protein_id gnl|my_center|LOCUS_45890 87289 86639 gene locus_tag LOCUS_45900 87289 86639 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977123.1 protein_id gnl|my_center|LOCUS_45900 87345 88496 gene locus_tag LOCUS_45910 87345 88496 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027926.1 protein_id gnl|my_center|LOCUS_45910 88600 88923 gene locus_tag LOCUS_45920 88600 88923 CDS product YiaA/YiaB family inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977125.1 protein_id gnl|my_center|LOCUS_45920 88999 89643 gene locus_tag LOCUS_45930 88999 89643 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977126.1 protein_id gnl|my_center|LOCUS_45930 90095 89634 gene locus_tag LOCUS_45940 90095 89634 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977127.1 protein_id gnl|my_center|LOCUS_45940 90195 90683 gene locus_tag LOCUS_45950 gene soxR 90195 90683 CDS product redox-sensitive transcriptional activator SoxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977128.1 protein_id gnl|my_center|LOCUS_45950 90846 92525 gene locus_tag LOCUS_45960 90846 92525 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031102.1 protein_id gnl|my_center|LOCUS_45960 93010 92408 gene locus_tag LOCUS_45970 93010 92408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977130.1 protein_id gnl|my_center|LOCUS_45970 93297 96098 gene locus_tag LOCUS_45980 93297 96098 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485851.1 protein_id gnl|my_center|LOCUS_45980 97427 96120 gene locus_tag LOCUS_45990 97427 96120 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729636.1 protein_id gnl|my_center|LOCUS_45990 98758 97517 gene locus_tag LOCUS_46000 98758 97517 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230529.1 protein_id gnl|my_center|LOCUS_46000 99010 99750 gene locus_tag LOCUS_46010 99010 99750 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977133.1 protein_id gnl|my_center|LOCUS_46010 99747 101414 gene locus_tag LOCUS_46020 99747 101414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46020 101441 102034 gene locus_tag LOCUS_46030 101441 102034 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868049.1 protein_id gnl|my_center|LOCUS_46030 103255 102041 gene locus_tag LOCUS_46040 103255 102041 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027921.1 protein_id gnl|my_center|LOCUS_46040 104283 103261 gene locus_tag LOCUS_46050 104283 103261 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027920.1 protein_id gnl|my_center|LOCUS_46050 104635 104405 gene locus_tag LOCUS_46060 104635 104405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_46060 105114 104743 gene locus_tag LOCUS_46070 105114 104743 CDS product DUF202 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977138.1 protein_id gnl|my_center|LOCUS_46070 105907 105389 gene locus_tag LOCUS_46080 105907 105389 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485846.1 protein_id gnl|my_center|LOCUS_46080 106133 107083 gene locus_tag LOCUS_46090 106133 107083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977141.1 protein_id gnl|my_center|LOCUS_46090 107186 108730 gene locus_tag LOCUS_46100 107186 108730 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027916.1 protein_id gnl|my_center|LOCUS_46100 109890 108787 gene locus_tag LOCUS_46110 109890 108787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46110 111371 109974 gene locus_tag LOCUS_46120 111371 109974 CDS product gluconate:H+ symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223067.1 protein_id gnl|my_center|LOCUS_46120 111947 111423 gene locus_tag LOCUS_46130 111947 111423 CDS product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977146.1 protein_id gnl|my_center|LOCUS_46130 112085 112786 gene locus_tag LOCUS_46140 112085 112786 CDS product FCD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027913.1 protein_id gnl|my_center|LOCUS_46140 113202 112828 gene locus_tag LOCUS_46150 113202 112828 CDS product YchJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027912.1 protein_id gnl|my_center|LOCUS_46150 113365 113280 gene locus_tag LOCUS_t00700 113365 113280 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 113552 114877 gene locus_tag LOCUS_46160 113552 114877 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977149.1 protein_id gnl|my_center|LOCUS_46160 115035 115268 gene locus_tag LOCUS_46170 gene chpH 115035 115268 CDS product chaplin ChpH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977150.1 protein_id gnl|my_center|LOCUS_46170 115407 116240 gene locus_tag LOCUS_46180 115407 116240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46180 116505 116317 gene locus_tag LOCUS_46190 116505 116317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46190 116565 117296 gene locus_tag LOCUS_46200 116565 117296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027910.1 protein_id gnl|my_center|LOCUS_46200 119751 117367 gene locus_tag LOCUS_46210 119751 117367 CDS product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027909.1 protein_id gnl|my_center|LOCUS_46210 120734 119748 gene locus_tag LOCUS_46220 120734 119748 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977155.1 protein_id gnl|my_center|LOCUS_46220 120848 121903 gene locus_tag LOCUS_46230 120848 121903 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027908.1 protein_id gnl|my_center|LOCUS_46230 122176 122967 gene locus_tag LOCUS_46240 122176 122967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027907.1 protein_id gnl|my_center|LOCUS_46240 123984 122980 gene locus_tag LOCUS_46250 gene corA 123984 122980 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027906.1 protein_id gnl|my_center|LOCUS_46250 123956 124723 gene locus_tag LOCUS_46260 123956 124723 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977159.1 protein_id gnl|my_center|LOCUS_46260 124791 125381 gene locus_tag LOCUS_46270 124791 125381 CDS product DUF3090 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977160.1 protein_id gnl|my_center|LOCUS_46270 125378 126160 gene locus_tag LOCUS_46280 125378 126160 CDS product SCO1664 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270002.1 protein_id gnl|my_center|LOCUS_46280 126255 127484 gene locus_tag LOCUS_46290 gene mshC 126255 127484 CDS product cysteine--1-D-myo-inosityl 2-amino-2-deoxy-alpha-D-glucopyranoside ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977162.1 protein_id gnl|my_center|LOCUS_46290 127623 128579 gene locus_tag LOCUS_46300 127623 128579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46300 129749 128766 gene locus_tag LOCUS_46310 gene parJ 129749 128766 CDS product filament polymerization regulator ParJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977163.1 protein_id gnl|my_center|LOCUS_46310 130553 129882 gene locus_tag LOCUS_46320 130553 129882 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223733.1 protein_id gnl|my_center|LOCUS_46320 132334 130718 gene locus_tag LOCUS_46330 132334 130718 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977164.1 protein_id gnl|my_center|LOCUS_46330 133881 132343 gene locus_tag LOCUS_46340 gene glpK 133881 132343 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977165.1 protein_id gnl|my_center|LOCUS_46340 134723 133929 gene locus_tag LOCUS_46350 134723 133929 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977166.1 protein_id gnl|my_center|LOCUS_46350 135799 135035 gene locus_tag LOCUS_46360 135799 135035 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977167.1 protein_id gnl|my_center|LOCUS_46360 136133 139645 gene locus_tag LOCUS_46370 gene metH 136133 139645 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027904.1 protein_id gnl|my_center|LOCUS_46370 139752 140453 gene locus_tag LOCUS_46380 139752 140453 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977169.1 protein_id gnl|my_center|LOCUS_46380 140901 142505 gene locus_tag LOCUS_46390 140901 142505 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977170.1 protein_id gnl|my_center|LOCUS_46390 143257 142586 gene locus_tag LOCUS_46400 143257 142586 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977171.1 protein_id gnl|my_center|LOCUS_46400 144332 143274 gene locus_tag LOCUS_46410 144332 143274 CDS product RecB family exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485830.1 protein_id gnl|my_center|LOCUS_46410 144541 146097 gene locus_tag LOCUS_46420 144541 146097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_46420 146099 147061 gene locus_tag LOCUS_46430 146099 147061 CDS product tRNA (adenine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027901.1 protein_id gnl|my_center|LOCUS_46430 147302 147874 gene locus_tag LOCUS_46440 147302 147874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977175.1 protein_id gnl|my_center|LOCUS_46440 148246 147947 gene locus_tag LOCUS_46450 148246 147947 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977176.1 protein_id gnl|my_center|LOCUS_46450 148496 150262 gene locus_tag LOCUS_46460 gene arc 148496 150262 CDS product proteasome ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027900.1 protein_id gnl|my_center|LOCUS_46460 150497 152008 gene locus_tag LOCUS_46470 gene dop 150497 152008 CDS product depupylase/deamidase Dop inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977179.1 protein_id gnl|my_center|LOCUS_46470 152177 152395 gene locus_tag LOCUS_46480 152177 152395 CDS product ubiquitin-like protein Pup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027899.1 protein_id gnl|my_center|LOCUS_46480 152673 153518 gene locus_tag LOCUS_46490 gene prcB 152673 153518 CDS product proteasome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977182.1 protein_id gnl|my_center|LOCUS_46490 153616 154326 gene locus_tag LOCUS_46500 gene prcA 153616 154326 CDS product proteasome subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027897.1 protein_id gnl|my_center|LOCUS_46500 155402 154389 gene locus_tag LOCUS_46510 155402 154389 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977184.1 protein_id gnl|my_center|LOCUS_46510 155505 156764 gene locus_tag LOCUS_46520 155505 156764 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870809.1 protein_id gnl|my_center|LOCUS_46520 156774 158135 gene locus_tag LOCUS_46530 gene pafA 156774 158135 CDS product Pup--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977186.1 protein_id gnl|my_center|LOCUS_46530 158259 159260 gene locus_tag LOCUS_46540 158259 159260 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977187.1 protein_id gnl|my_center|LOCUS_46540 159321 159692 gene locus_tag LOCUS_46550 159321 159692 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977188.1 protein_id gnl|my_center|LOCUS_46550 159868 160869 gene locus_tag LOCUS_46560 159868 160869 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027895.1 protein_id gnl|my_center|LOCUS_46560 160888 161958 gene locus_tag LOCUS_46570 160888 161958 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027894.1 protein_id gnl|my_center|LOCUS_46570 161955 162248 gene locus_tag LOCUS_46580 161955 162248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977191.1 protein_id gnl|my_center|LOCUS_46580 162293 162487 gene locus_tag LOCUS_46590 162293 162487 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977192.1 protein_id gnl|my_center|LOCUS_46590 162803 163087 gene locus_tag LOCUS_46600 gene tatA 162803 163087 CDS product Sec-independent protein translocase subunit TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977193.1 protein_id gnl|my_center|LOCUS_46600 163136 164086 gene locus_tag LOCUS_46610 gene tatC 163136 164086 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977194.1 protein_id gnl|my_center|LOCUS_46610 164150 167002 gene locus_tag LOCUS_46620 164150 167002 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027893.1 protein_id gnl|my_center|LOCUS_46620 167175 166984 gene locus_tag LOCUS_46630 167175 166984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46630 167533 169101 gene locus_tag LOCUS_46640 167533 169101 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977196.1 protein_id gnl|my_center|LOCUS_46640 169098 169505 gene locus_tag LOCUS_46650 169098 169505 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977197.1 protein_id gnl|my_center|LOCUS_46650 169502 169945 gene locus_tag LOCUS_46660 169502 169945 CDS product DUF742 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977198.1 protein_id gnl|my_center|LOCUS_46660 169926 170546 gene locus_tag LOCUS_46670 169926 170546 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977199.1 protein_id gnl|my_center|LOCUS_46670 170608 172248 gene locus_tag LOCUS_46680 170608 172248 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027891.1 protein_id gnl|my_center|LOCUS_46680 173204 172242 gene locus_tag LOCUS_46690 173204 172242 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977201.1 protein_id gnl|my_center|LOCUS_46690 173283 173864 gene locus_tag LOCUS_46700 173283 173864 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870827.1 protein_id gnl|my_center|LOCUS_46700 174797 173946 gene locus_tag LOCUS_46710 174797 173946 CDS product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977203.1 protein_id gnl|my_center|LOCUS_46710 175881 174961 gene locus_tag LOCUS_46720 175881 174961 CDS product 5'-3' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027889.1 protein_id gnl|my_center|LOCUS_46720 176060 177145 gene locus_tag LOCUS_46730 176060 177145 CDS product betaine/proline/choline family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977205.1 protein_id gnl|my_center|LOCUS_46730 177138 179753 gene locus_tag LOCUS_46740 177138 179753 CDS product ABC transporter permease/substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027888.1 protein_id gnl|my_center|LOCUS_46740 180162 180731 gene locus_tag LOCUS_46750 180162 180731 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977207.1 protein_id gnl|my_center|LOCUS_46750 180758 181459 gene locus_tag LOCUS_46760 180758 181459 CDS product helical backbone metal receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223098.1 protein_id gnl|my_center|LOCUS_46760 182537 181386 gene locus_tag LOCUS_46770 182537 181386 CDS product TDT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027886.1 protein_id gnl|my_center|LOCUS_46770 182608 183561 gene locus_tag LOCUS_46780 182608 183561 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977210.1 protein_id gnl|my_center|LOCUS_46780 184357 183650 gene locus_tag LOCUS_46790 184357 183650 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027885.1 protein_id gnl|my_center|LOCUS_46790 185225 184482 gene locus_tag LOCUS_46800 185225 184482 CDS product FCD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027884.1 protein_id gnl|my_center|LOCUS_46800 185312 186673 gene locus_tag LOCUS_46810 gene glnA4 185312 186673 CDS product gamma-glutamylethanolamide synthetase GlnA4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027883.1 protein_id gnl|my_center|LOCUS_46810 186681 188054 gene locus_tag LOCUS_46820 186681 188054 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162495124.1 protein_id gnl|my_center|LOCUS_46820 188051 188833 gene locus_tag LOCUS_46830 188051 188833 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977216.1 protein_id gnl|my_center|LOCUS_46830 188854 189696 gene locus_tag LOCUS_46840 188854 189696 CDS product DUF2510 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027881.1 protein_id gnl|my_center|LOCUS_46840 190937 189735 gene locus_tag LOCUS_46850 190937 189735 CDS product amino acid deaminase/aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027880.1 protein_id gnl|my_center|LOCUS_46850 191350 191030 gene locus_tag LOCUS_46860 191350 191030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46860 191319 192314 gene locus_tag LOCUS_46870 191319 192314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46870 192311 193486 gene locus_tag LOCUS_46880 gene mycP 192311 193486 CDS product type VII secretion-associated serine protease mycosin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977220.1 protein_id gnl|my_center|LOCUS_46880 194460 193471 gene locus_tag LOCUS_46890 194460 193471 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027879.1 protein_id gnl|my_center|LOCUS_46890 194610 195341 gene locus_tag LOCUS_46900 194610 195341 CDS product SseB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027875.1 protein_id gnl|my_center|LOCUS_46900 195719 195345 gene locus_tag LOCUS_46910 195719 195345 CDS product DUF1844 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977223.1 protein_id gnl|my_center|LOCUS_46910 196055 196732 gene locus_tag LOCUS_46920 gene infC 196055 196732 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027874.1 protein_id gnl|my_center|LOCUS_46920 196843 197037 gene locus_tag LOCUS_46930 gene rpmI 196843 197037 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977225.1 protein_id gnl|my_center|LOCUS_46930 197138 197521 gene locus_tag LOCUS_46940 gene rplT 197138 197521 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977226.1 protein_id gnl|my_center|LOCUS_46940 197665 198510 gene locus_tag LOCUS_46950 197665 198510 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027873.1 protein_id gnl|my_center|LOCUS_46950 198561 199697 gene locus_tag LOCUS_46960 198561 199697 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027872.1 protein_id gnl|my_center|LOCUS_46960 199871 200947 gene locus_tag LOCUS_46970 gene pheS 199871 200947 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977229.1 protein_id gnl|my_center|LOCUS_46970 200947 203514 gene locus_tag LOCUS_46980 gene pheT 200947 203514 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027870.1 protein_id gnl|my_center|LOCUS_46980 203707 204693 gene locus_tag LOCUS_46990 203707 204693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46990 204946 206286 gene locus_tag LOCUS_47000 204946 206286 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027869.1 protein_id gnl|my_center|LOCUS_47000 206429 206974 gene locus_tag LOCUS_47010 206429 206974 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977232.1 protein_id gnl|my_center|LOCUS_47010 207260 207003 gene locus_tag LOCUS_47020 207260 207003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47020 208328 207456 gene locus_tag LOCUS_47030 208328 207456 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977233.1 protein_id gnl|my_center|LOCUS_47030 208516 209781 gene locus_tag LOCUS_47040 208516 209781 CDS product family 10 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027868.1 protein_id gnl|my_center|LOCUS_47040 209995 209801 gene locus_tag LOCUS_47050 209995 209801 CDS product DUF1918 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977235.1 protein_id gnl|my_center|LOCUS_47050 211000 210086 gene locus_tag LOCUS_47060 211000 210086 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027867.1 protein_id gnl|my_center|LOCUS_47060 210999 212450 gene locus_tag LOCUS_47070 210999 212450 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038535091.1 protein_id gnl|my_center|LOCUS_47070 213054 212611 gene locus_tag LOCUS_47080 213054 212611 CDS product DUF6314 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174855167.1 protein_id gnl|my_center|LOCUS_47080 213203 215686 gene locus_tag LOCUS_47090 213203 215686 CDS product alpha-L-arabinofuranosidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027862.1 protein_id gnl|my_center|LOCUS_47090 215783 216811 gene locus_tag LOCUS_47100 gene argC 215783 216811 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977244.1 protein_id gnl|my_center|LOCUS_47100 216808 217959 gene locus_tag LOCUS_47110 gene argJ 216808 217959 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027859.1 protein_id gnl|my_center|LOCUS_47110 217956 218867 gene locus_tag LOCUS_47120 gene argB 217956 218867 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977246.1 protein_id gnl|my_center|LOCUS_47120 218864 220063 gene locus_tag LOCUS_47130 218864 220063 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977247.1 protein_id gnl|my_center|LOCUS_47130 220071 220613 gene locus_tag LOCUS_47140 220071 220613 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977248.1 protein_id gnl|my_center|LOCUS_47140 221108 220764 gene locus_tag LOCUS_47150 221108 220764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47150 221865 221170 gene locus_tag LOCUS_47160 221865 221170 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027855.1 protein_id gnl|my_center|LOCUS_47160 222035 223459 gene locus_tag LOCUS_47170 gene argH 222035 223459 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027854.1 protein_id gnl|my_center|LOCUS_47170 223589 224539 gene locus_tag LOCUS_47180 223589 224539 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325827.1 protein_id gnl|my_center|LOCUS_47180 224601 225170 gene locus_tag LOCUS_47190 224601 225170 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325826.1 protein_id gnl|my_center|LOCUS_47190 225167 226693 gene locus_tag LOCUS_47200 225167 226693 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977257.1 protein_id gnl|my_center|LOCUS_47200 227503 226829 gene locus_tag LOCUS_47210 227503 226829 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007447704.1 protein_id gnl|my_center|LOCUS_47210 227896 229065 gene locus_tag LOCUS_47220 227896 229065 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027852.1 protein_id gnl|my_center|LOCUS_47220 229132 229641 gene locus_tag LOCUS_47230 229132 229641 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027851.1 protein_id gnl|my_center|LOCUS_47230 229700 230197 gene locus_tag LOCUS_47240 229700 230197 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977261.1 protein_id gnl|my_center|LOCUS_47240 230629 230201 gene locus_tag LOCUS_47250 230629 230201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977262.1 protein_id gnl|my_center|LOCUS_47250 230990 230631 gene locus_tag LOCUS_47260 230990 230631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977263.1 protein_id gnl|my_center|LOCUS_47260 231061 231711 gene locus_tag LOCUS_47270 231061 231711 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027849.1 protein_id gnl|my_center|LOCUS_47270 232094 233137 gene locus_tag LOCUS_47280 232094 233137 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325822.1 protein_id gnl|my_center|LOCUS_47280 233134 233871 gene locus_tag LOCUS_47290 233134 233871 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027847.1 protein_id gnl|my_center|LOCUS_47290 233965 234792 gene locus_tag LOCUS_47300 233965 234792 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977267.1 protein_id gnl|my_center|LOCUS_47300 234935 235570 gene locus_tag LOCUS_47310 234935 235570 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161269997.1 protein_id gnl|my_center|LOCUS_47310 235687 236916 gene locus_tag LOCUS_47320 gene cbiE 235687 236916 CDS product precorrin-6y C5,15-methyltransferase (decarboxylating) subunit CbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977269.1 protein_id gnl|my_center|LOCUS_47320 237198 240572 gene locus_tag LOCUS_47330 237198 240572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47330 240865 242097 gene locus_tag LOCUS_47340 gene cobA 240865 242097 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977272.1 protein_id gnl|my_center|LOCUS_47340 242097 242915 gene locus_tag LOCUS_47350 242097 242915 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977273.1 protein_id gnl|my_center|LOCUS_47350 244451 242934 gene locus_tag LOCUS_47360 244451 242934 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168715246.1 protein_id gnl|my_center|LOCUS_47360 244568 244924 gene locus_tag LOCUS_47370 244568 244924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47370 245127 245294 gene locus_tag LOCUS_47380 245127 245294 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977275.1 protein_id gnl|my_center|LOCUS_47380 245656 245731 gene locus_tag LOCUS_t00710 245656 245731 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 245984 246979 gene locus_tag LOCUS_47390 245984 246979 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027843.1 protein_id gnl|my_center|LOCUS_47390 247059 247340 gene locus_tag LOCUS_47400 247059 247340 CDS product zf-TFIIB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109033875.1 protein_id gnl|my_center|LOCUS_47400 247483 247409 gene locus_tag LOCUS_t00720 247483 247409 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 247589 247517 gene locus_tag LOCUS_t00730 247589 247517 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 247684 247612 gene locus_tag LOCUS_t00740 247684 247612 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 247759 247686 gene locus_tag LOCUS_t00750 247759 247686 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 247869 247796 gene locus_tag LOCUS_t00760 247869 247796 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 248070 249122 gene locus_tag LOCUS_47410 248070 249122 CDS product chorismate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027841.1 protein_id gnl|my_center|LOCUS_47410 249119 249940 gene locus_tag LOCUS_47420 249119 249940 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977279.1 protein_id gnl|my_center|LOCUS_47420 250013 250837 gene locus_tag LOCUS_47430 250013 250837 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485797.1 protein_id gnl|my_center|LOCUS_47430 251473 250958 gene locus_tag LOCUS_47440 251473 250958 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325815.1 protein_id gnl|my_center|LOCUS_47440 251646 252149 gene locus_tag LOCUS_47450 251646 252149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977282.1 protein_id gnl|my_center|LOCUS_47450 252259 252426 gene locus_tag LOCUS_47460 252259 252426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47460 253053 252493 gene locus_tag LOCUS_47470 253053 252493 CDS product CGNR zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977284.1 protein_id gnl|my_center|LOCUS_47470 253893 253480 gene locus_tag LOCUS_47480 253893 253480 CDS product SsgA family sporulation/cell division regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004002642.1 protein_id gnl|my_center|LOCUS_47480 254124 254540 gene locus_tag LOCUS_47490 254124 254540 CDS product TIGR02611 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027839.1 protein_id gnl|my_center|LOCUS_47490 254600 254673 gene locus_tag LOCUS_t00770 254600 254673 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 255086 256375 gene locus_tag LOCUS_47500 255086 256375 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027838.1 protein_id gnl|my_center|LOCUS_47500 256375 257376 gene locus_tag LOCUS_47510 256375 257376 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030871104.1 protein_id gnl|my_center|LOCUS_47510 257373 258266 gene locus_tag LOCUS_47520 257373 258266 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977289.1 protein_id gnl|my_center|LOCUS_47520 258277 258876 gene locus_tag LOCUS_47530 258277 258876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47530 258986 261724 gene locus_tag LOCUS_47540 258986 261724 CDS product Tat pathway signal sequence domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136207739.1 protein_id gnl|my_center|LOCUS_47540 261753 262199 gene locus_tag LOCUS_47550 261753 262199 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027835.1 protein_id gnl|my_center|LOCUS_47550 262239 262313 gene locus_tag LOCUS_t00780 262239 262313 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 263103 262378 gene locus_tag LOCUS_47560 263103 262378 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977293.1 protein_id gnl|my_center|LOCUS_47560 263398 265377 gene locus_tag LOCUS_47570 gene thrS 263398 265377 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977296.1 protein_id gnl|my_center|LOCUS_47570 265455 266000 gene locus_tag LOCUS_47580 265455 266000 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027833.1 protein_id gnl|my_center|LOCUS_47580 267668 266007 gene locus_tag LOCUS_47590 267668 266007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027832.1 protein_id gnl|my_center|LOCUS_47590 270039 267832 gene locus_tag LOCUS_47600 270039 267832 CDS product elongation factor G-like protein EF-G2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027831.1 protein_id gnl|my_center|LOCUS_47600 270303 270974 gene locus_tag LOCUS_47610 270303 270974 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027830.1 protein_id gnl|my_center|LOCUS_47610 270971 271879 gene locus_tag LOCUS_47620 270971 271879 CDS product phosphatidylinositol mannoside acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027829.1 protein_id gnl|my_center|LOCUS_47620 271876 273039 gene locus_tag LOCUS_47630 271876 273039 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027828.1 protein_id gnl|my_center|LOCUS_47630 273397 273939 gene locus_tag LOCUS_47640 273397 273939 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027827.1 protein_id gnl|my_center|LOCUS_47640 274052 274963 gene locus_tag LOCUS_47650 gene pdxS 274052 274963 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977304.1 protein_id gnl|my_center|LOCUS_47650 274971 275579 gene locus_tag LOCUS_47660 gene pdxT 274971 275579 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977305.1 protein_id gnl|my_center|LOCUS_47660 275629 276381 gene locus_tag LOCUS_47670 275629 276381 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977306.1 protein_id gnl|my_center|LOCUS_47670 276485 277042 gene locus_tag LOCUS_47680 gene ruvC 276485 277042 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977307.1 protein_id gnl|my_center|LOCUS_47680 277039 277644 gene locus_tag LOCUS_47690 gene ruvA 277039 277644 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027825.1 protein_id gnl|my_center|LOCUS_47690 277697 278776 gene locus_tag LOCUS_47700 gene ruvB 277697 278776 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977309.1 protein_id gnl|my_center|LOCUS_47700 278953 279447 gene locus_tag LOCUS_47710 gene yajC 278953 279447 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027824.1 protein_id gnl|my_center|LOCUS_47710 279550 281358 gene locus_tag LOCUS_47720 gene secD 279550 281358 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027823.1 protein_id gnl|my_center|LOCUS_47720 281362 282483 gene locus_tag LOCUS_47730 gene secF 281362 282483 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977312.1 protein_id gnl|my_center|LOCUS_47730 282480 283019 gene locus_tag LOCUS_47740 282480 283019 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325803.1 protein_id gnl|my_center|LOCUS_47740 283213 285744 gene locus_tag LOCUS_47750 gene relA 283213 285744 CDS product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977314.1 protein_id gnl|my_center|LOCUS_47750 287047 285818 gene locus_tag LOCUS_47760 287047 285818 CDS product DUF349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325802.1 protein_id gnl|my_center|LOCUS_47760 288004 287183 gene locus_tag LOCUS_47770 288004 287183 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977316.1 protein_id gnl|my_center|LOCUS_47770 288185 288892 gene locus_tag LOCUS_47780 288185 288892 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977317.1 protein_id gnl|my_center|LOCUS_47780 288906 290168 gene locus_tag LOCUS_47790 gene hisS 288906 290168 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325801.1 protein_id gnl|my_center|LOCUS_47790 290353 290997 gene locus_tag LOCUS_47800 290353 290997 CDS product vitamin K epoxide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030871078.1 protein_id gnl|my_center|LOCUS_47800 291041 292396 gene locus_tag LOCUS_47810 291041 292396 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977320.1 protein_id gnl|my_center|LOCUS_47810 292701 293315 gene locus_tag LOCUS_47820 gene rpsD 292701 293315 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977321.1 protein_id gnl|my_center|LOCUS_47820 295439 293346 gene locus_tag LOCUS_47830 295439 293346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325800.1 protein_id gnl|my_center|LOCUS_47830 295660 296103 gene locus_tag LOCUS_47840 295660 296103 CDS product DUF948 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977323.1 protein_id gnl|my_center|LOCUS_47840 296112 296468 gene locus_tag LOCUS_47850 296112 296468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977324.1 protein_id gnl|my_center|LOCUS_47850 296468 299140 gene locus_tag LOCUS_47860 gene alaS 296468 299140 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977325.1 protein_id gnl|my_center|LOCUS_47860 299137 299640 gene locus_tag LOCUS_47870 gene ruvX 299137 299640 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042825781.1 protein_id gnl|my_center|LOCUS_47870 299765 301525 gene locus_tag LOCUS_47880 gene mltG 299765 301525 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977327.1 protein_id gnl|my_center|LOCUS_47880 301506 302384 gene locus_tag LOCUS_47890 301506 302384 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027816.1 protein_id gnl|my_center|LOCUS_47890 302607 303782 gene locus_tag LOCUS_47900 gene aroC 302607 303782 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977330.1 protein_id gnl|my_center|LOCUS_47900 303779 305425 gene locus_tag LOCUS_47910 303779 305425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47910 306419 307072 gene locus_tag LOCUS_47920 306419 307072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47920 307142 308248 gene locus_tag LOCUS_47930 307142 308248 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977334.1 protein_id gnl|my_center|LOCUS_47930 308318 308884 gene locus_tag LOCUS_47940 gene efp 308318 308884 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977335.1 protein_id gnl|my_center|LOCUS_47940 308887 309315 gene locus_tag LOCUS_47950 gene nusB 308887 309315 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977336.1 protein_id gnl|my_center|LOCUS_47950 310003 309500 gene locus_tag LOCUS_47960 gene bldD 310003 309500 CDS product transcriptional regulator BldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977337.1 protein_id gnl|my_center|LOCUS_47960 310289 310855 gene locus_tag LOCUS_47970 gene pyrR 310289 310855 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977338.1 protein_id gnl|my_center|LOCUS_47970 310948 311919 gene locus_tag LOCUS_47980 310948 311919 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027811.1 protein_id gnl|my_center|LOCUS_47980 311924 313210 gene locus_tag LOCUS_47990 311924 313210 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977340.1 protein_id gnl|my_center|LOCUS_47990 313207 313773 gene locus_tag LOCUS_48000 313207 313773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977341.1 protein_id gnl|my_center|LOCUS_48000 313770 314912 gene locus_tag LOCUS_48010 gene carA 313770 314912 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027810.1 protein_id gnl|my_center|LOCUS_48010 314905 318213 gene locus_tag LOCUS_48020 gene carB 314905 318213 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977343.1 protein_id gnl|my_center|LOCUS_48020 318305 319411 gene locus_tag LOCUS_48030 318305 319411 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977344.1 protein_id gnl|my_center|LOCUS_48030 319408 320247 gene locus_tag LOCUS_48040 gene pyrF 319408 320247 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485777.1 protein_id gnl|my_center|LOCUS_48040 320539 320862 gene locus_tag LOCUS_48050 320539 320862 CDS product integration host factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977346.1 protein_id gnl|my_center|LOCUS_48050 320930 321493 gene locus_tag LOCUS_48060 gene gmk 320930 321493 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977347.1 protein_id gnl|my_center|LOCUS_48060 321545 321817 gene locus_tag LOCUS_48070 gene rpoZ 321545 321817 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977348.1 protein_id gnl|my_center|LOCUS_48070 321951 323153 gene locus_tag LOCUS_48080 gene coaBC 321951 323153 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485775.1 protein_id gnl|my_center|LOCUS_48080 323415 324623 gene locus_tag LOCUS_48090 gene metK 323415 324623 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977350.1 protein_id gnl|my_center|LOCUS_48090 325783 324677 gene locus_tag LOCUS_48100 325783 324677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48100 327814 325868 gene locus_tag LOCUS_48110 327814 325868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48110 328563 327811 gene locus_tag LOCUS_48120 328563 327811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48120 329878 328577 gene locus_tag LOCUS_48130 329878 328577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48130 330133 332271 gene locus_tag LOCUS_48140 330133 332271 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027807.1 protein_id gnl|my_center|LOCUS_48140 332942 332397 gene locus_tag LOCUS_48150 332942 332397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027806.1 protein_id gnl|my_center|LOCUS_48150 333244 334176 gene locus_tag LOCUS_48160 gene fmt 333244 334176 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027805.1 protein_id gnl|my_center|LOCUS_48160 334231 335685 gene locus_tag LOCUS_48170 334231 335685 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977354.1 protein_id gnl|my_center|LOCUS_48170 335997 336683 gene locus_tag LOCUS_48180 gene rpe 335997 336683 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977361.1 protein_id gnl|my_center|LOCUS_48180 336871 336590 gene locus_tag LOCUS_48190 336871 336590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48190 336870 337820 gene locus_tag LOCUS_48200 336870 337820 CDS product sugar-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977362.1 protein_id gnl|my_center|LOCUS_48200 337822 338202 gene locus_tag LOCUS_48210 337822 338202 CDS product barstar family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977363.1 protein_id gnl|my_center|LOCUS_48210 338311 339753 gene locus_tag LOCUS_48220 338311 339753 CDS product GuaB1 family IMP dehydrogenase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164279790.1 protein_id gnl|my_center|LOCUS_48220 339991 341460 gene locus_tag LOCUS_48230 339991 341460 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027796.1 protein_id gnl|my_center|LOCUS_48230 341471 341923 gene locus_tag LOCUS_48240 341471 341923 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977367.1 protein_id gnl|my_center|LOCUS_48240 342418 341906 gene locus_tag LOCUS_48250 342418 341906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104366.1 protein_id gnl|my_center|LOCUS_48250 342546 343790 gene locus_tag LOCUS_48260 342546 343790 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027795.1 protein_id gnl|my_center|LOCUS_48260 343894 344682 gene locus_tag LOCUS_48270 343894 344682 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027793.1 protein_id gnl|my_center|LOCUS_48270 344723 346423 gene locus_tag LOCUS_48280 344723 346423 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027792.1 protein_id gnl|my_center|LOCUS_48280 347155 346457 gene locus_tag LOCUS_48290 347155 346457 CDS product DUF5995 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977373.1 protein_id gnl|my_center|LOCUS_48290 348627 347248 gene locus_tag LOCUS_48300 348627 347248 CDS product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977375.1 protein_id gnl|my_center|LOCUS_48300 350353 349151 gene locus_tag LOCUS_48310 350353 349151 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977377.1 protein_id gnl|my_center|LOCUS_48310 350491 351696 gene locus_tag LOCUS_48320 350491 351696 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977378.1 protein_id gnl|my_center|LOCUS_48320 352267 352869 gene locus_tag LOCUS_48330 352267 352869 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977382.1 protein_id gnl|my_center|LOCUS_48330 352866 353510 gene locus_tag LOCUS_48340 352866 353510 CDS product nicotinamide mononucleotide transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977383.1 protein_id gnl|my_center|LOCUS_48340 353507 354796 gene locus_tag LOCUS_48350 353507 354796 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977384.1 protein_id gnl|my_center|LOCUS_48350 354827 355333 gene locus_tag LOCUS_48360 gene ribH 354827 355333 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977385.1 protein_id gnl|my_center|LOCUS_48360 355347 355619 gene locus_tag LOCUS_48370 355347 355619 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027788.1 protein_id gnl|my_center|LOCUS_48370 355667 356515 gene locus_tag LOCUS_48380 gene hisG 355667 356515 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977387.1 protein_id gnl|my_center|LOCUS_48380 356934 357010 gene locus_tag LOCUS_t00790 356934 357010 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 357282 358613 gene locus_tag LOCUS_48390 357282 358613 CDS product CNNM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977389.1 protein_id gnl|my_center|LOCUS_48390 358610 359683 gene locus_tag LOCUS_48400 358610 359683 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977390.1 protein_id gnl|my_center|LOCUS_48400 360739 359699 gene locus_tag LOCUS_48410 360739 359699 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107014379.1 protein_id gnl|my_center|LOCUS_48410 361652 360744 gene locus_tag LOCUS_48420 361652 360744 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529557.1 protein_id gnl|my_center|LOCUS_48420 362389 361772 gene locus_tag LOCUS_48430 362389 361772 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225664.1 protein_id gnl|my_center|LOCUS_48430 362470 363426 gene locus_tag LOCUS_48440 362470 363426 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225665.1 protein_id gnl|my_center|LOCUS_48440 365351 363486 gene locus_tag LOCUS_48450 365351 363486 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027787.1 protein_id gnl|my_center|LOCUS_48450 365650 365351 gene locus_tag LOCUS_48460 365650 365351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48460 366409 365810 gene locus_tag LOCUS_48470 366409 365810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48470 366668 368011 gene locus_tag LOCUS_48480 366668 368011 CDS product peptidase C39 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162495115.1 protein_id gnl|my_center|LOCUS_48480 368176 368316 gene locus_tag LOCUS_48490 368176 368316 CDS product SCO1431 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109034050.1 protein_id gnl|my_center|LOCUS_48490 368633 369805 gene locus_tag LOCUS_48500 368633 369805 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027782.1 protein_id gnl|my_center|LOCUS_48500 370013 369768 gene locus_tag LOCUS_48510 370013 369768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027781.1 protein_id gnl|my_center|LOCUS_48510 370539 370102 gene locus_tag LOCUS_48520 370539 370102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977399.1 protein_id gnl|my_center|LOCUS_48520 370806 371246 gene locus_tag LOCUS_48530 370806 371246 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019983923.1 protein_id gnl|my_center|LOCUS_48530 371288 372898 gene locus_tag LOCUS_48540 371288 372898 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030866976.1 protein_id gnl|my_center|LOCUS_48540 373423 374238 gene locus_tag LOCUS_48550 373423 374238 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027779.1 protein_id gnl|my_center|LOCUS_48550 374307 374876 gene locus_tag LOCUS_48560 374307 374876 CDS product FxsA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977403.1 protein_id gnl|my_center|LOCUS_48560 375600 375226 gene locus_tag LOCUS_48570 375600 375226 CDS product RNA polymerase-binding protein RbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977404.1 protein_id gnl|my_center|LOCUS_48570 377225 375879 gene locus_tag LOCUS_48580 377225 375879 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027778.1 protein_id gnl|my_center|LOCUS_48580 378051 377284 gene locus_tag LOCUS_48590 378051 377284 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977406.1 protein_id gnl|my_center|LOCUS_48590 378713 378048 gene locus_tag LOCUS_48600 378713 378048 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027777.1 protein_id gnl|my_center|LOCUS_48600 378814 380316 gene locus_tag LOCUS_48610 378814 380316 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977408.1 protein_id gnl|my_center|LOCUS_48610 382158 380380 gene locus_tag LOCUS_48620 382158 380380 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027776.1 protein_id gnl|my_center|LOCUS_48620 382406 382212 gene locus_tag LOCUS_48630 382406 382212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977410.1 protein_id gnl|my_center|LOCUS_48630 382717 383109 gene locus_tag LOCUS_48640 382717 383109 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325767.1 protein_id gnl|my_center|LOCUS_48640 383422 384840 gene locus_tag LOCUS_48650 383422 384840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977413.1 protein_id gnl|my_center|LOCUS_48650 385136 386263 gene locus_tag LOCUS_48660 385136 386263 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742121.1 protein_id gnl|my_center|LOCUS_48660 386260 387429 gene locus_tag LOCUS_48670 386260 387429 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222448.1 protein_id gnl|my_center|LOCUS_48670 388775 387462 gene locus_tag LOCUS_48680 388775 387462 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027774.1 protein_id gnl|my_center|LOCUS_48680 388903 389598 gene locus_tag LOCUS_48690 388903 389598 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027773.1 protein_id gnl|my_center|LOCUS_48690 389801 391360 gene locus_tag LOCUS_48700 389801 391360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977417.1 protein_id gnl|my_center|LOCUS_48700 391407 392291 gene locus_tag LOCUS_48710 391407 392291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027772.1 protein_id gnl|my_center|LOCUS_48710 392335 396993 gene locus_tag LOCUS_48720 392335 396993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48720 397380 397057 gene locus_tag LOCUS_48730 397380 397057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48730 397274 397762 gene locus_tag LOCUS_48740 397274 397762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48740 398014 400824 gene locus_tag LOCUS_48750 398014 400824 CDS product nitrate- and nitrite sensing domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027766.1 protein_id gnl|my_center|LOCUS_48750 400821 401255 gene locus_tag LOCUS_48760 400821 401255 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977425.1 protein_id gnl|my_center|LOCUS_48760 401265 401660 gene locus_tag LOCUS_48770 401265 401660 CDS product DUF742 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977426.1 protein_id gnl|my_center|LOCUS_48770 401674 402282 gene locus_tag LOCUS_48780 401674 402282 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977427.1 protein_id gnl|my_center|LOCUS_48780 403944 402415 gene locus_tag LOCUS_48790 gene glpK 403944 402415 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977165.1 protein_id gnl|my_center|LOCUS_48790 404766 404029 gene locus_tag LOCUS_48800 404766 404029 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977166.1 protein_id gnl|my_center|LOCUS_48800 406759 405125 gene locus_tag LOCUS_48810 406759 405125 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485749.1 protein_id gnl|my_center|LOCUS_48810 406997 406800 gene locus_tag LOCUS_48820 406997 406800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48820 406890 407711 gene locus_tag LOCUS_48830 406890 407711 CDS product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027763.1 protein_id gnl|my_center|LOCUS_48830 407762 408295 gene locus_tag LOCUS_48840 407762 408295 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977430.1 protein_id gnl|my_center|LOCUS_48840 410693 408345 gene locus_tag LOCUS_48850 410693 408345 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027761.1 protein_id gnl|my_center|LOCUS_48850 410926 412902 gene locus_tag LOCUS_48860 410926 412902 CDS product acetoacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027760.1 protein_id gnl|my_center|LOCUS_48860 412973 413863 gene locus_tag LOCUS_48870 412973 413863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977433.1 protein_id gnl|my_center|LOCUS_48870 415595 413925 gene locus_tag LOCUS_48880 gene ptsP 415595 413925 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977434.1 protein_id gnl|my_center|LOCUS_48880 416123 415674 gene locus_tag LOCUS_48890 416123 415674 CDS product PTS glucose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977435.1 protein_id gnl|my_center|LOCUS_48890 >Feature sequence11 306 1406 gene locus_tag LOCUS_48900 306 1406 CDS product DUF4190 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030057.1 protein_id gnl|my_center|LOCUS_48900 1583 2308 gene locus_tag LOCUS_48910 1583 2308 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973878.1 protein_id gnl|my_center|LOCUS_48910 2722 2925 gene locus_tag LOCUS_48920 2722 2925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973877.1 protein_id gnl|my_center|LOCUS_48920 2936 3361 gene locus_tag LOCUS_48930 2936 3361 CDS product (deoxy)nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973876.1 protein_id gnl|my_center|LOCUS_48930 3556 3954 gene locus_tag LOCUS_48940 3556 3954 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030058.1 protein_id gnl|my_center|LOCUS_48940 4235 6889 gene locus_tag LOCUS_48950 4235 6889 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030059.1 protein_id gnl|my_center|LOCUS_48950 6966 8270 gene locus_tag LOCUS_48960 6966 8270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48960 9021 8251 gene locus_tag LOCUS_48970 9021 8251 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973872.1 protein_id gnl|my_center|LOCUS_48970 10964 9018 gene locus_tag LOCUS_48980 10964 9018 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030061.1 protein_id gnl|my_center|LOCUS_48980 11800 10964 gene locus_tag LOCUS_48990 11800 10964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030062.1 protein_id gnl|my_center|LOCUS_48990 12112 11822 gene locus_tag LOCUS_49000 12112 11822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973869.1 protein_id gnl|my_center|LOCUS_49000 12423 14702 gene locus_tag LOCUS_49010 12423 14702 CDS product ABC transporter family substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030064.1 protein_id gnl|my_center|LOCUS_49010 14826 16742 gene locus_tag LOCUS_49020 gene typA 14826 16742 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973866.1 protein_id gnl|my_center|LOCUS_49020 17425 18468 gene locus_tag LOCUS_49030 17425 18468 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973865.1 protein_id gnl|my_center|LOCUS_49030 18508 20301 gene locus_tag LOCUS_49040 18508 20301 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973864.1 protein_id gnl|my_center|LOCUS_49040 20402 21379 gene locus_tag LOCUS_49050 20402 21379 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973863.1 protein_id gnl|my_center|LOCUS_49050 21394 22455 gene locus_tag LOCUS_49060 21394 22455 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973862.1 protein_id gnl|my_center|LOCUS_49060 22466 23587 gene locus_tag LOCUS_49070 22466 23587 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973861.1 protein_id gnl|my_center|LOCUS_49070 24671 23721 gene locus_tag LOCUS_49080 24671 23721 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973861.1 protein_id gnl|my_center|LOCUS_49080 25828 24791 gene locus_tag LOCUS_49090 25828 24791 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973862.1 protein_id gnl|my_center|LOCUS_49090 26854 25874 gene locus_tag LOCUS_49100 26854 25874 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973863.1 protein_id gnl|my_center|LOCUS_49100 28708 26954 gene locus_tag LOCUS_49110 28708 26954 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973864.1 protein_id gnl|my_center|LOCUS_49110 29780 28791 gene locus_tag LOCUS_49120 29780 28791 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973865.1 protein_id gnl|my_center|LOCUS_49120 30281 31912 gene locus_tag LOCUS_49130 30281 31912 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973860.1 protein_id gnl|my_center|LOCUS_49130 31919 32842 gene locus_tag LOCUS_49140 31919 32842 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973859.1 protein_id gnl|my_center|LOCUS_49140 32835 33809 gene locus_tag LOCUS_49150 32835 33809 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973858.1 protein_id gnl|my_center|LOCUS_49150 33819 34793 gene locus_tag LOCUS_49160 33819 34793 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030066.1 protein_id gnl|my_center|LOCUS_49160 34786 35844 gene locus_tag LOCUS_49170 34786 35844 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030067.1 protein_id gnl|my_center|LOCUS_49170 38162 36009 gene locus_tag LOCUS_49180 38162 36009 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030068.1 protein_id gnl|my_center|LOCUS_49180 38353 38547 gene locus_tag LOCUS_49190 38353 38547 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973854.1 protein_id gnl|my_center|LOCUS_49190 38612 39475 gene locus_tag LOCUS_49200 gene mshB 38612 39475 CDS product N-acetyl-1-D-myo-inositol-2-amino-2-deoxy-alpha-D-glucopyranoside deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030070.1 protein_id gnl|my_center|LOCUS_49200 39472 39894 gene locus_tag LOCUS_49210 39472 39894 CDS product DUF6113 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030071.1 protein_id gnl|my_center|LOCUS_49210 40454 40128 gene locus_tag LOCUS_49220 40454 40128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49220 40684 42258 gene locus_tag LOCUS_49230 40684 42258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_49230 43215 42361 gene locus_tag LOCUS_49240 43215 42361 CDS product transglutaminase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030075.1 protein_id gnl|my_center|LOCUS_49240 44257 43247 gene locus_tag LOCUS_49250 44257 43247 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030076.1 protein_id gnl|my_center|LOCUS_49250 44399 44719 gene locus_tag LOCUS_49260 44399 44719 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973842.1 protein_id gnl|my_center|LOCUS_49260 44827 45918 gene locus_tag LOCUS_49270 44827 45918 CDS product bifunctional succinyldiaminopimelate transaminase/glutamate-prephenate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030077.1 protein_id gnl|my_center|LOCUS_49270 46454 46005 gene locus_tag LOCUS_49280 46454 46005 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973840.1 protein_id gnl|my_center|LOCUS_49280 47727 46768 gene locus_tag LOCUS_49290 47727 46768 CDS product heavy metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486364.1 protein_id gnl|my_center|LOCUS_49290 47863 48942 gene locus_tag LOCUS_49300 gene dapE 47863 48942 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030079.1 protein_id gnl|my_center|LOCUS_49300 49052 49810 gene locus_tag LOCUS_49310 49052 49810 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973837.1 protein_id gnl|my_center|LOCUS_49310 50678 49818 gene locus_tag LOCUS_49320 gene folP 50678 49818 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327205.1 protein_id gnl|my_center|LOCUS_49320 50824 51180 gene locus_tag LOCUS_49330 50824 51180 CDS product DivIVA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973835.1 protein_id gnl|my_center|LOCUS_49330 51177 51761 gene locus_tag LOCUS_49340 51177 51761 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973834.1 protein_id gnl|my_center|LOCUS_49340 52568 51765 gene locus_tag LOCUS_49350 52568 51765 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030081.1 protein_id gnl|my_center|LOCUS_49350 52945 53112 gene locus_tag LOCUS_49360 52945 53112 CDS product DUF3117 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003966491.1 protein_id gnl|my_center|LOCUS_49360 53736 53212 gene locus_tag LOCUS_49370 53736 53212 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167469700.1 protein_id gnl|my_center|LOCUS_49370 54081 54809 gene locus_tag LOCUS_49380 gene sigE 54081 54809 CDS product RNA polymerase sigma factor SigE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973830.1 protein_id gnl|my_center|LOCUS_49380 54806 55792 gene locus_tag LOCUS_49390 54806 55792 CDS product zf-HC2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030084.1 protein_id gnl|my_center|LOCUS_49390 55877 57541 gene locus_tag LOCUS_49400 55877 57541 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093456948.1 protein_id gnl|my_center|LOCUS_49400 57689 58123 gene locus_tag LOCUS_49410 57689 58123 CDS product sec-independent translocase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030086.1 protein_id gnl|my_center|LOCUS_49410 58339 59010 gene locus_tag LOCUS_49420 58339 59010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327210.1 protein_id gnl|my_center|LOCUS_49420 60219 59104 gene locus_tag LOCUS_49430 60219 59104 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973825.1 protein_id gnl|my_center|LOCUS_49430 60892 60281 gene locus_tag LOCUS_49440 60892 60281 CDS product DUF1003 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167469672.1 protein_id gnl|my_center|LOCUS_49440 62255 60882 gene locus_tag LOCUS_49450 62255 60882 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030088.1 protein_id gnl|my_center|LOCUS_49450 62527 63225 gene locus_tag LOCUS_49460 62527 63225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973822.1 protein_id gnl|my_center|LOCUS_49460 63784 63272 gene locus_tag LOCUS_49470 63784 63272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973821.1 protein_id gnl|my_center|LOCUS_49470 64916 63807 gene locus_tag LOCUS_49480 64916 63807 CDS product magnesium and cobalt transport protein CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030090.1 protein_id gnl|my_center|LOCUS_49480 65391 66008 gene locus_tag LOCUS_49490 65391 66008 CDS product suppressor of fused domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030091.1 protein_id gnl|my_center|LOCUS_49490 67271 66048 gene locus_tag LOCUS_49500 67271 66048 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973818.1 protein_id gnl|my_center|LOCUS_49500 67462 68103 gene locus_tag LOCUS_49510 67462 68103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973817.1 protein_id gnl|my_center|LOCUS_49510 68395 69252 gene locus_tag LOCUS_49520 68395 69252 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973816.1 protein_id gnl|my_center|LOCUS_49520 69306 69911 gene locus_tag LOCUS_49530 69306 69911 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973815.1 protein_id gnl|my_center|LOCUS_49530 70190 69978 gene locus_tag LOCUS_49540 70190 69978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49540 70376 71272 gene locus_tag LOCUS_49550 70376 71272 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167469674.1 protein_id gnl|my_center|LOCUS_49550 72171 71269 gene locus_tag LOCUS_49560 72171 71269 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030092.1 protein_id gnl|my_center|LOCUS_49560 74809 72329 gene locus_tag LOCUS_49570 74809 72329 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030093.1 protein_id gnl|my_center|LOCUS_49570 75305 76066 gene locus_tag LOCUS_49580 75305 76066 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973811.1 protein_id gnl|my_center|LOCUS_49580 76580 76311 gene locus_tag LOCUS_49590 76580 76311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973810.1 protein_id gnl|my_center|LOCUS_49590 76993 76784 gene locus_tag LOCUS_49600 76993 76784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_49600 76874 77083 gene locus_tag LOCUS_49610 76874 77083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49610 77704 77162 gene locus_tag LOCUS_49620 77704 77162 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973808.1 protein_id gnl|my_center|LOCUS_49620 78227 78003 gene locus_tag LOCUS_49630 78227 78003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973806.1 protein_id gnl|my_center|LOCUS_49630 78436 79452 gene locus_tag LOCUS_49640 78436 79452 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030094.1 protein_id gnl|my_center|LOCUS_49640 79461 81080 gene locus_tag LOCUS_49650 79461 81080 CDS product DUF3152 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030095.1 protein_id gnl|my_center|LOCUS_49650 81295 83019 gene locus_tag LOCUS_49660 81295 83019 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030096.1 protein_id gnl|my_center|LOCUS_49660 83016 84557 gene locus_tag LOCUS_49670 83016 84557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49670 84707 85777 gene locus_tag LOCUS_49680 84707 85777 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_134112038.1 protein_id gnl|my_center|LOCUS_49680 85765 86523 gene locus_tag LOCUS_49690 85765 86523 CDS product spherulation-specific family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973799.1 protein_id gnl|my_center|LOCUS_49690 86587 87765 gene locus_tag LOCUS_49700 gene moeZ 86587 87765 CDS product adenylyltransferase/sulfurtransferase MoeZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973798.1 protein_id gnl|my_center|LOCUS_49700 89336 87834 gene locus_tag LOCUS_49710 89336 87834 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030099.1 protein_id gnl|my_center|LOCUS_49710 91009 89465 gene locus_tag LOCUS_49720 91009 89465 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030100.1 protein_id gnl|my_center|LOCUS_49720 93819 91087 gene locus_tag LOCUS_49730 93819 91087 CDS product lysylphosphatidylglycerol synthase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030101.1 protein_id gnl|my_center|LOCUS_49730 94018 94476 gene locus_tag LOCUS_49740 94018 94476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_49740 94743 98234 gene locus_tag LOCUS_49750 94743 98234 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030103.1 protein_id gnl|my_center|LOCUS_49750 98334 101900 gene locus_tag LOCUS_49760 98334 101900 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486348.1 protein_id gnl|my_center|LOCUS_49760 101911 103323 gene locus_tag LOCUS_49770 101911 103323 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973791.1 protein_id gnl|my_center|LOCUS_49770 103480 104424 gene locus_tag LOCUS_49780 gene nudC 103480 104424 CDS product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327228.1 protein_id gnl|my_center|LOCUS_49780 104739 104497 gene locus_tag LOCUS_49790 104739 104497 CDS product mycoredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973789.1 protein_id gnl|my_center|LOCUS_49790 104974 107175 gene locus_tag LOCUS_49800 104974 107175 CDS product ATP-dependent DNA helicase UvrD2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173668762.1 protein_id gnl|my_center|LOCUS_49800 107340 107660 gene locus_tag LOCUS_49810 107340 107660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973787.1 protein_id gnl|my_center|LOCUS_49810 107837 108205 gene locus_tag LOCUS_49820 107837 108205 CDS product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973786.1 protein_id gnl|my_center|LOCUS_49820 108202 108525 gene locus_tag LOCUS_49830 108202 108525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49830 110024 108651 gene locus_tag LOCUS_49840 110024 108651 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030108.1 protein_id gnl|my_center|LOCUS_49840 111279 110017 gene locus_tag LOCUS_49850 111279 110017 CDS product TOMM precursor leader peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486346.1 protein_id gnl|my_center|LOCUS_49850 111702 112145 gene locus_tag LOCUS_49860 111702 112145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49860 112297 114066 gene locus_tag LOCUS_49870 112297 114066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49870 114081 114761 gene locus_tag LOCUS_49880 114081 114761 CDS product AIM24 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973780.1 protein_id gnl|my_center|LOCUS_49880 114779 115534 gene locus_tag LOCUS_49890 114779 115534 CDS product AIM24 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030111.1 protein_id gnl|my_center|LOCUS_49890 116176 115661 gene locus_tag LOCUS_49900 116176 115661 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973778.1 protein_id gnl|my_center|LOCUS_49900 117657 116173 gene locus_tag LOCUS_49910 117657 116173 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973777.1 protein_id gnl|my_center|LOCUS_49910 117848 118906 gene locus_tag LOCUS_49920 117848 118906 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973776.1 protein_id gnl|my_center|LOCUS_49920 119047 119505 gene locus_tag LOCUS_49930 119047 119505 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973775.1 protein_id gnl|my_center|LOCUS_49930 119680 119844 gene locus_tag LOCUS_49940 119680 119844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49940 119902 120996 gene locus_tag LOCUS_49950 119902 120996 CDS product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973773.1 protein_id gnl|my_center|LOCUS_49950 121548 121006 gene locus_tag LOCUS_49960 121548 121006 CDS product PPA1309 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167526720.1 protein_id gnl|my_center|LOCUS_49960 121756 124689 gene locus_tag LOCUS_49970 121756 124689 CDS product UPF0182 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973771.1 protein_id gnl|my_center|LOCUS_49970 124742 124816 gene locus_tag LOCUS_t00800 124742 124816 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 125024 126838 gene locus_tag LOCUS_49980 125024 126838 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030113.1 protein_id gnl|my_center|LOCUS_49980 127279 127353 gene locus_tag LOCUS_t00810 127279 127353 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 127840 127466 gene locus_tag LOCUS_49990 127840 127466 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973766.1 protein_id gnl|my_center|LOCUS_49990 128028 129479 gene locus_tag LOCUS_50000 128028 129479 CDS product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972723.1 protein_id gnl|my_center|LOCUS_50000 129944 129558 gene locus_tag LOCUS_50010 129944 129558 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486342.1 protein_id gnl|my_center|LOCUS_50010 130885 130085 gene locus_tag LOCUS_50020 gene hisN 130885 130085 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973764.1 protein_id gnl|my_center|LOCUS_50020 131311 131922 gene locus_tag LOCUS_50030 131311 131922 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030115.1 protein_id gnl|my_center|LOCUS_50030 132259 131936 gene locus_tag LOCUS_50040 132259 131936 CDS product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973762.1 protein_id gnl|my_center|LOCUS_50040 133383 132370 gene locus_tag LOCUS_50050 gene rsgA 133383 132370 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973761.1 protein_id gnl|my_center|LOCUS_50050 134710 133394 gene locus_tag LOCUS_50060 gene aroA 134710 133394 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973760.1 protein_id gnl|my_center|LOCUS_50060 135567 134845 gene locus_tag LOCUS_50070 135567 134845 CDS product M50 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973759.1 protein_id gnl|my_center|LOCUS_50070 135673 136488 gene locus_tag LOCUS_50080 135673 136488 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030116.1 protein_id gnl|my_center|LOCUS_50080 136490 137128 gene locus_tag LOCUS_50090 136490 137128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973757.1 protein_id gnl|my_center|LOCUS_50090 137221 138072 gene locus_tag LOCUS_50100 gene sigR 137221 138072 CDS product RNA polymerase sigma factor SigR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973756.1 protein_id gnl|my_center|LOCUS_50100 138069 138380 gene locus_tag LOCUS_50110 gene rsrA 138069 138380 CDS product mycothiol system anti-sigma-R factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973755.1 protein_id gnl|my_center|LOCUS_50110 138717 139757 gene locus_tag LOCUS_50120 138717 139757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973752.1 protein_id gnl|my_center|LOCUS_50120 139872 140522 gene locus_tag LOCUS_50130 gene def 139872 140522 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973751.1 protein_id gnl|my_center|LOCUS_50130 140776 141852 gene locus_tag LOCUS_50140 140776 141852 CDS product terpene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030119.1 protein_id gnl|my_center|LOCUS_50140 141858 143228 gene locus_tag LOCUS_50150 141858 143228 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030120.1 protein_id gnl|my_center|LOCUS_50150 144217 143252 gene locus_tag LOCUS_50160 144217 143252 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030121.1 protein_id gnl|my_center|LOCUS_50160 144302 144529 gene locus_tag LOCUS_50170 144302 144529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50170 146247 144637 gene locus_tag LOCUS_50180 146247 144637 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973742.1 protein_id gnl|my_center|LOCUS_50180 146468 146244 gene locus_tag LOCUS_50190 146468 146244 CDS product DUF3311 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973741.1 protein_id gnl|my_center|LOCUS_50190 147426 146662 gene locus_tag LOCUS_50200 147426 146662 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973740.1 protein_id gnl|my_center|LOCUS_50200 147879 149180 gene locus_tag LOCUS_50210 147879 149180 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226207.1 protein_id gnl|my_center|LOCUS_50210 149317 150309 gene locus_tag LOCUS_50220 149317 150309 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978331.1 protein_id gnl|my_center|LOCUS_50220 150306 151181 gene locus_tag LOCUS_50230 150306 151181 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226209.1 protein_id gnl|my_center|LOCUS_50230 151192 152682 gene locus_tag LOCUS_50240 151192 152682 CDS product glycoside hydrolase family 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031132272.1 protein_id gnl|my_center|LOCUS_50240 153734 152949 gene locus_tag LOCUS_50250 gene nagB 153734 152949 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030128.1 protein_id gnl|my_center|LOCUS_50250 154703 153951 gene locus_tag LOCUS_50260 154703 153951 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030129.1 protein_id gnl|my_center|LOCUS_50260 154798 155403 gene locus_tag LOCUS_50270 154798 155403 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030130.1 protein_id gnl|my_center|LOCUS_50270 155890 157365 gene locus_tag LOCUS_50280 155890 157365 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973732.1 protein_id gnl|my_center|LOCUS_50280 157877 157620 gene locus_tag LOCUS_50290 157877 157620 CDS product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973730.1 protein_id gnl|my_center|LOCUS_50290 159162 158194 gene locus_tag LOCUS_50300 159162 158194 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030131.1 protein_id gnl|my_center|LOCUS_50300 159279 159740 gene locus_tag LOCUS_50310 159279 159740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030132.1 protein_id gnl|my_center|LOCUS_50310 160965 159835 gene locus_tag LOCUS_50320 160965 159835 CDS product RNA polymerase sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270193.1 protein_id gnl|my_center|LOCUS_50320 161396 160983 gene locus_tag LOCUS_50330 161396 160983 CDS product anti-sigma regulatory factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973726.1 protein_id gnl|my_center|LOCUS_50330 161925 161659 gene locus_tag LOCUS_50340 161925 161659 CDS product UBP-type zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973725.1 protein_id gnl|my_center|LOCUS_50340 161987 163582 gene locus_tag LOCUS_50350 161987 163582 CDS product Na+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973724.1 protein_id gnl|my_center|LOCUS_50350 164506 163583 gene locus_tag LOCUS_50360 164506 163583 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030134.1 protein_id gnl|my_center|LOCUS_50360 165101 164511 gene locus_tag LOCUS_50370 165101 164511 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030135.1 protein_id gnl|my_center|LOCUS_50370 165403 166812 gene locus_tag LOCUS_50380 165403 166812 CDS product family 2B encapsulin nanocompartment shell protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973721.1 protein_id gnl|my_center|LOCUS_50380 166809 167999 gene locus_tag LOCUS_50390 166809 167999 CDS product family 2 encapsulin nanocompartment cargo protein polyprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973720.1 protein_id gnl|my_center|LOCUS_50390 168360 168968 gene locus_tag LOCUS_50400 168360 168968 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973719.1 protein_id gnl|my_center|LOCUS_50400 169317 174416 gene locus_tag LOCUS_50410 169317 174416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50410 175149 174652 gene locus_tag LOCUS_50420 175149 174652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50420 175782 175183 gene locus_tag LOCUS_50430 175782 175183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50430 175839 177215 gene locus_tag LOCUS_50440 175839 177215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50440 177212 178030 gene locus_tag LOCUS_50450 177212 178030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50450 178194 177964 gene locus_tag LOCUS_50460 178194 177964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50460 178679 178284 gene locus_tag LOCUS_50470 gene sodN 178679 178284 CDS product superoxide dismutase, Ni inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973716.1 protein_id gnl|my_center|LOCUS_50470 178825 179259 gene locus_tag LOCUS_50480 gene sodX 178825 179259 CDS product nickel-type superoxide dismutase maturation protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868025.1 protein_id gnl|my_center|LOCUS_50480 179792 179142 gene locus_tag LOCUS_50490 179792 179142 CDS product CGNR zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973714.1 protein_id gnl|my_center|LOCUS_50490 179892 180662 gene locus_tag LOCUS_50500 179892 180662 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030136.1 protein_id gnl|my_center|LOCUS_50500 181485 180721 gene locus_tag LOCUS_50510 181485 180721 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973712.1 protein_id gnl|my_center|LOCUS_50510 182420 181482 gene locus_tag LOCUS_50520 182420 181482 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973711.1 protein_id gnl|my_center|LOCUS_50520 183431 182463 gene locus_tag LOCUS_50530 183431 182463 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973710.1 protein_id gnl|my_center|LOCUS_50530 184034 185257 gene locus_tag LOCUS_50540 184034 185257 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973709.1 protein_id gnl|my_center|LOCUS_50540 185420 186385 gene locus_tag LOCUS_50550 185420 186385 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973708.1 protein_id gnl|my_center|LOCUS_50550 186538 186747 gene locus_tag LOCUS_50560 186538 186747 CDS product sigma factor-like helix-turn-helix DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004559389.1 protein_id gnl|my_center|LOCUS_50560 186747 187310 gene locus_tag LOCUS_50570 186747 187310 CDS product Clp protease N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030137.1 protein_id gnl|my_center|LOCUS_50570 188350 187382 gene locus_tag LOCUS_50580 188350 187382 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973705.1 protein_id gnl|my_center|LOCUS_50580 189239 188352 gene locus_tag LOCUS_50590 189239 188352 CDS product DUF4097 family beta strand repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486398.1 protein_id gnl|my_center|LOCUS_50590 189619 189434 gene locus_tag LOCUS_50600 189619 189434 CDS product DUF6104 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030139.1 protein_id gnl|my_center|LOCUS_50600 189883 190353 gene locus_tag LOCUS_50610 189883 190353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50610 190422 192497 gene locus_tag LOCUS_50620 190422 192497 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030140.1 protein_id gnl|my_center|LOCUS_50620 192612 193637 gene locus_tag LOCUS_50630 192612 193637 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030141.1 protein_id gnl|my_center|LOCUS_50630 193645 196977 gene locus_tag LOCUS_50640 193645 196977 CDS product SAV_2336 N-terminal domain-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030142.1 protein_id gnl|my_center|LOCUS_50640 197029 197247 gene locus_tag LOCUS_50650 gene fxsA 197029 197247 CDS product FxSxx-COOH protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973697.1 protein_id gnl|my_center|LOCUS_50650 197383 198549 gene locus_tag LOCUS_50660 197383 198549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_50660 198549 200066 gene locus_tag LOCUS_50670 198549 200066 CDS product HEXXH motif-containing putative peptide modification protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030144.1 protein_id gnl|my_center|LOCUS_50670 200199 203240 gene locus_tag LOCUS_50680 gene fxsT 200199 203240 CDS product FxSxx-COOH system tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030145.1 protein_id gnl|my_center|LOCUS_50680 203336 203716 gene locus_tag LOCUS_50690 203336 203716 CDS product CU044_2847 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109033515.1 protein_id gnl|my_center|LOCUS_50690 203713 204654 gene locus_tag LOCUS_50700 203713 204654 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109033516.1 protein_id gnl|my_center|LOCUS_50700 204662 206545 gene locus_tag LOCUS_50710 204662 206545 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030148.1 protein_id gnl|my_center|LOCUS_50710 206535 207857 gene locus_tag LOCUS_50720 206535 207857 CDS product CHAT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109033517.1 protein_id gnl|my_center|LOCUS_50720 207854 211228 gene locus_tag LOCUS_50730 gene fxsT 207854 211228 CDS product FxSxx-COOH system tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030149.1 protein_id gnl|my_center|LOCUS_50730 215142 211300 gene locus_tag LOCUS_50740 215142 211300 CDS product multifunctional oxoglutarate decarboxylase/oxoglutarate dehydrogenase thiamine pyrophosphate-binding subunit/dihydrolipoyllysine-residue succinyltransferase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030150.1 protein_id gnl|my_center|LOCUS_50740 216532 215423 gene locus_tag LOCUS_50750 216532 215423 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973687.1 protein_id gnl|my_center|LOCUS_50750 217269 216529 gene locus_tag LOCUS_50760 217269 216529 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973686.1 protein_id gnl|my_center|LOCUS_50760 218069 217383 gene locus_tag LOCUS_50770 218069 217383 CDS product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030151.1 protein_id gnl|my_center|LOCUS_50770 217992 218315 gene locus_tag LOCUS_50780 217992 218315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50780 218460 220886 gene locus_tag LOCUS_50790 gene lon 218460 220886 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030152.1 protein_id gnl|my_center|LOCUS_50790 221845 221027 gene locus_tag LOCUS_50800 221845 221027 CDS product lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030153.1 protein_id gnl|my_center|LOCUS_50800 222007 222561 gene locus_tag LOCUS_50810 222007 222561 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973682.1 protein_id gnl|my_center|LOCUS_50810 223372 222572 gene locus_tag LOCUS_50820 223372 222572 CDS product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030154.1 protein_id gnl|my_center|LOCUS_50820 223774 226581 gene locus_tag LOCUS_50830 223774 226581 CDS product nitrate- and nitrite sensing domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486303.1 protein_id gnl|my_center|LOCUS_50830 226578 227081 gene locus_tag LOCUS_50840 226578 227081 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327267.1 protein_id gnl|my_center|LOCUS_50840 227078 227512 gene locus_tag LOCUS_50850 227078 227512 CDS product DUF742 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973678.1 protein_id gnl|my_center|LOCUS_50850 227493 228131 gene locus_tag LOCUS_50860 227493 228131 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973677.1 protein_id gnl|my_center|LOCUS_50860 228149 229411 gene locus_tag LOCUS_50870 228149 229411 CDS product alanine-phosphoribitol ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973676.1 protein_id gnl|my_center|LOCUS_50870 230541 229375 gene locus_tag LOCUS_50880 230541 229375 CDS product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030158.1 protein_id gnl|my_center|LOCUS_50880 230974 230645 gene locus_tag LOCUS_50890 230974 230645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030159.1 protein_id gnl|my_center|LOCUS_50890 231620 230967 gene locus_tag LOCUS_50900 231620 230967 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030160.1 protein_id gnl|my_center|LOCUS_50900 232600 231662 gene locus_tag LOCUS_50910 232600 231662 CDS product diiron oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030161.1 protein_id gnl|my_center|LOCUS_50910 234445 232988 gene locus_tag LOCUS_50920 234445 232988 CDS product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973670.1 protein_id gnl|my_center|LOCUS_50920 235800 234442 gene locus_tag LOCUS_50930 235800 234442 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189283896.1 protein_id gnl|my_center|LOCUS_50930 236251 235844 gene locus_tag LOCUS_50940 236251 235844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50940 237753 236521 gene locus_tag LOCUS_50950 237753 236521 CDS product histidine kinase dimerization/phospho-acceptor domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030163.1 protein_id gnl|my_center|LOCUS_50950 238484 237756 gene locus_tag LOCUS_50960 238484 237756 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030164.1 protein_id gnl|my_center|LOCUS_50960 239211 238711 gene locus_tag LOCUS_50970 239211 238711 CDS product dual specificity protein phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486294.1 protein_id gnl|my_center|LOCUS_50970 239324 240127 gene locus_tag LOCUS_50980 239324 240127 CDS product NERD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270195.1 protein_id gnl|my_center|LOCUS_50980 241084 240203 gene locus_tag LOCUS_50990 gene ligD 241084 240203 CDS product non-homologous end-joining DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973663.1 protein_id gnl|my_center|LOCUS_50990 241152 242276 gene locus_tag LOCUS_51000 241152 242276 CDS product Ku protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030872665.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_51000 243025 242291 gene locus_tag LOCUS_51010 243025 242291 CDS product DUF4142 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973661.1 protein_id gnl|my_center|LOCUS_51010 243280 244812 gene locus_tag LOCUS_51020 243280 244812 CDS product Y4yA family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921741.1 protein_id gnl|my_center|LOCUS_51020 244809 246134 gene locus_tag LOCUS_51030 244809 246134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51030 246137 247336 gene locus_tag LOCUS_51040 246137 247336 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172824500.1 protein_id gnl|my_center|LOCUS_51040 247487 248248 gene locus_tag LOCUS_51050 247487 248248 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088221.1 protein_id gnl|my_center|LOCUS_51050 248342 250333 gene locus_tag LOCUS_51060 248342 250333 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030938.1 protein_id gnl|my_center|LOCUS_51060 250421 252061 gene locus_tag LOCUS_51070 250421 252061 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_212987816.1 protein_id gnl|my_center|LOCUS_51070 253239 254312 gene locus_tag LOCUS_51080 253239 254312 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015931.1 protein_id gnl|my_center|LOCUS_51080 254309 256534 gene locus_tag LOCUS_51090 254309 256534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51090 256569 257171 gene locus_tag LOCUS_51100 256569 257171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51100 257164 258312 gene locus_tag LOCUS_51110 257164 258312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51110 258372 259607 gene locus_tag LOCUS_51120 258372 259607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51120 259734 260267 gene locus_tag LOCUS_51130 259734 260267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_51130 260542 260835 gene locus_tag LOCUS_51140 260542 260835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51140 261082 261009 gene locus_tag LOCUS_t00820 261082 261009 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 261265 261681 gene locus_tag LOCUS_51150 261265 261681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51150 261756 262772 gene locus_tag LOCUS_51160 261756 262772 CDS product DALR anticodon-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030201.1 protein_id gnl|my_center|LOCUS_51160 262802 264193 gene locus_tag LOCUS_51170 gene lysA 262802 264193 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030202.1 protein_id gnl|my_center|LOCUS_51170 264354 265646 gene locus_tag LOCUS_51180 264354 265646 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189283905.1 protein_id gnl|my_center|LOCUS_51180 265653 266711 gene locus_tag LOCUS_51190 gene thrC 265653 266711 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973642.1 protein_id gnl|my_center|LOCUS_51190 267029 267958 gene locus_tag LOCUS_51200 gene thrB 267029 267958 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030204.1 protein_id gnl|my_center|LOCUS_51200 268370 270430 gene locus_tag LOCUS_51210 268370 270430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51210 270767 271906 gene locus_tag LOCUS_51220 270767 271906 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973639.1 protein_id gnl|my_center|LOCUS_51220 272141 271893 gene locus_tag LOCUS_51230 272141 271893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51230 272044 272268 gene locus_tag LOCUS_51240 gene rpmE 272044 272268 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973638.1 protein_id gnl|my_center|LOCUS_51240 272377 273444 gene locus_tag LOCUS_51250 gene prfA 272377 273444 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973637.1 protein_id gnl|my_center|LOCUS_51250 273470 274315 gene locus_tag LOCUS_51260 gene prmC 273470 274315 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973636.1 protein_id gnl|my_center|LOCUS_51260 274368 275015 gene locus_tag LOCUS_51270 274368 275015 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973635.1 protein_id gnl|my_center|LOCUS_51270 275012 275683 gene locus_tag LOCUS_51280 275012 275683 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068381.1 protein_id gnl|my_center|LOCUS_51280 275776 277029 gene locus_tag LOCUS_51290 275776 277029 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973633.1 protein_id gnl|my_center|LOCUS_51290 277147 278478 gene locus_tag LOCUS_51300 277147 278478 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030207.1 protein_id gnl|my_center|LOCUS_51300 278766 279200 gene locus_tag LOCUS_51310 278766 279200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973631.1 protein_id gnl|my_center|LOCUS_51310 279426 280250 gene locus_tag LOCUS_51320 gene atpB 279426 280250 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030208.1 protein_id gnl|my_center|LOCUS_51320 280324 280548 gene locus_tag LOCUS_51330 gene atpE 280324 280548 CDS product ATP synthase F0 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973629.1 protein_id gnl|my_center|LOCUS_51330 280589 281149 gene locus_tag LOCUS_51340 280589 281149 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030209.1 protein_id gnl|my_center|LOCUS_51340 281146 281967 gene locus_tag LOCUS_51350 281146 281967 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327277.1 protein_id gnl|my_center|LOCUS_51350 282110 283699 gene locus_tag LOCUS_51360 gene atpA 282110 283699 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973626.1 protein_id gnl|my_center|LOCUS_51360 283721 284638 gene locus_tag LOCUS_51370 283721 284638 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973625.1 protein_id gnl|my_center|LOCUS_51370 284638 286086 gene locus_tag LOCUS_51380 gene atpD 284638 286086 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973624.1 protein_id gnl|my_center|LOCUS_51380 286200 286574 gene locus_tag LOCUS_51390 286200 286574 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973623.1 protein_id gnl|my_center|LOCUS_51390 286704 287150 gene locus_tag LOCUS_51400 286704 287150 CDS product DUF2550 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973622.1 protein_id gnl|my_center|LOCUS_51400 288991 287156 gene locus_tag LOCUS_51410 288991 287156 CDS product glycoside hydrolase family 18 chitinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030211.1 protein_id gnl|my_center|LOCUS_51410 289772 289131 gene locus_tag LOCUS_51420 289772 289131 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973620.1 protein_id gnl|my_center|LOCUS_51420 290944 289769 gene locus_tag LOCUS_51430 290944 289769 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030212.1 protein_id gnl|my_center|LOCUS_51430 291098 291793 gene locus_tag LOCUS_51440 291098 291793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030213.1 protein_id gnl|my_center|LOCUS_51440 292269 291697 gene locus_tag LOCUS_51450 292269 291697 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973616.1 protein_id gnl|my_center|LOCUS_51450 293032 292283 gene locus_tag LOCUS_51460 293032 292283 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973615.1 protein_id gnl|my_center|LOCUS_51460 293825 293043 gene locus_tag LOCUS_51470 293825 293043 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973614.1 protein_id gnl|my_center|LOCUS_51470 293921 294562 gene locus_tag LOCUS_51480 293921 294562 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973613.1 protein_id gnl|my_center|LOCUS_51480 294686 295534 gene locus_tag LOCUS_51490 294686 295534 CDS product 3-hydroxyacyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030215.1 protein_id gnl|my_center|LOCUS_51490 295696 296019 gene locus_tag LOCUS_51500 295696 296019 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973611.1 protein_id gnl|my_center|LOCUS_51500 296333 299074 gene locus_tag LOCUS_51510 296333 299074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51510 299815 299144 gene locus_tag LOCUS_51520 gene nucS 299815 299144 CDS product endonuclease NucS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007387684.1 protein_id gnl|my_center|LOCUS_51520 300107 300499 gene locus_tag LOCUS_51530 300107 300499 CDS product SCO5389 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973607.1 protein_id gnl|my_center|LOCUS_51530 301539 300571 gene locus_tag LOCUS_51540 301539 300571 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030217.1 protein_id gnl|my_center|LOCUS_51540 301855 302187 gene locus_tag LOCUS_51550 301855 302187 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973605.1 protein_id gnl|my_center|LOCUS_51550 303046 302195 gene locus_tag LOCUS_51560 303046 302195 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973604.1 protein_id gnl|my_center|LOCUS_51560 304218 303043 gene locus_tag LOCUS_51570 304218 303043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51570 305101 304331 gene locus_tag LOCUS_51580 305101 304331 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973602.1 protein_id gnl|my_center|LOCUS_51580 306069 305104 gene locus_tag LOCUS_51590 306069 305104 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973601.1 protein_id gnl|my_center|LOCUS_51590 307090 306155 gene locus_tag LOCUS_51600 307090 306155 CDS product cellulose-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973600.1 protein_id gnl|my_center|LOCUS_51600 311254 307274 gene locus_tag LOCUS_51610 311254 307274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51610 311928 311488 gene locus_tag LOCUS_51620 gene mce 311928 311488 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973598.1 protein_id gnl|my_center|LOCUS_51620 312076 313299 gene locus_tag LOCUS_51630 312076 313299 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030221.1 protein_id gnl|my_center|LOCUS_51630 313331 314287 gene locus_tag LOCUS_51640 gene meaB 313331 314287 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030222.1 protein_id gnl|my_center|LOCUS_51640 314909 314433 gene locus_tag LOCUS_51650 314909 314433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51650 315032 315700 gene locus_tag LOCUS_51660 315032 315700 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973594.1 protein_id gnl|my_center|LOCUS_51660 315697 317079 gene locus_tag LOCUS_51670 315697 317079 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973593.1 protein_id gnl|my_center|LOCUS_51670 317575 317099 gene locus_tag LOCUS_51680 317575 317099 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973592.1 protein_id gnl|my_center|LOCUS_51680 318444 317671 gene locus_tag LOCUS_51690 318444 317671 CDS product AIM24 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973591.1 protein_id gnl|my_center|LOCUS_51690 319091 318441 gene locus_tag LOCUS_51700 319091 318441 CDS product AIM24 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109033475.1 protein_id gnl|my_center|LOCUS_51700 319723 319091 gene locus_tag LOCUS_51710 319723 319091 CDS product AIM24 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189739317.1 protein_id gnl|my_center|LOCUS_51710 319857 320201 gene locus_tag LOCUS_51720 319857 320201 CDS product DUF3817 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030226.1 protein_id gnl|my_center|LOCUS_51720 320198 320491 gene locus_tag LOCUS_51730 320198 320491 CDS product MTH1187 family thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409536.1 protein_id gnl|my_center|LOCUS_51730 320657 322456 gene locus_tag LOCUS_51740 320657 322456 CDS product cellulose synthase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028608.1 protein_id gnl|my_center|LOCUS_51740 322460 324415 gene locus_tag LOCUS_51750 322460 324415 CDS product kelch motif-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028609.1 protein_id gnl|my_center|LOCUS_51750 325417 324428 gene locus_tag LOCUS_51760 325417 324428 CDS product glycoside hydrolase family 6 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168715516.1 protein_id gnl|my_center|LOCUS_51760 325584 326093 gene locus_tag LOCUS_51770 325584 326093 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973586.1 protein_id gnl|my_center|LOCUS_51770 326150 326488 gene locus_tag LOCUS_51780 326150 326488 CDS product DUF3817 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037666291.1 protein_id gnl|my_center|LOCUS_51780 326561 328261 gene locus_tag LOCUS_51790 326561 328261 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030230.1 protein_id gnl|my_center|LOCUS_51790 329065 328346 gene locus_tag LOCUS_51800 329065 328346 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030233.1 protein_id gnl|my_center|LOCUS_51800 329301 330275 gene locus_tag LOCUS_51810 329301 330275 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973580.1 protein_id gnl|my_center|LOCUS_51810 330915 331559 gene locus_tag LOCUS_51820 330915 331559 CDS product DUF6230 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030235.1 protein_id gnl|my_center|LOCUS_51820 331651 332139 gene locus_tag LOCUS_51830 331651 332139 CDS product DUF6114 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030236.1 protein_id gnl|my_center|LOCUS_51830 332129 333535 gene locus_tag LOCUS_51840 332129 333535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189283916.1 protein_id gnl|my_center|LOCUS_51840 335051 333624 gene locus_tag LOCUS_51850 gene pyk 335051 333624 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973575.1 protein_id gnl|my_center|LOCUS_51850 336371 335157 gene locus_tag LOCUS_51860 336371 335157 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030238.1 protein_id gnl|my_center|LOCUS_51860 338458 336368 gene locus_tag LOCUS_51870 gene pta 338458 336368 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030239.1 protein_id gnl|my_center|LOCUS_51870 338652 339677 gene locus_tag LOCUS_51880 338652 339677 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973572.1 protein_id gnl|my_center|LOCUS_51880 340555 339716 gene locus_tag LOCUS_51890 340555 339716 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973570.1 protein_id gnl|my_center|LOCUS_51890 341428 340562 gene locus_tag LOCUS_51900 341428 340562 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030240.1 protein_id gnl|my_center|LOCUS_51900 342786 341425 gene locus_tag LOCUS_51910 342786 341425 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486252.1 protein_id gnl|my_center|LOCUS_51910 343081 342890 gene locus_tag LOCUS_51920 343081 342890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973980.1 protein_id gnl|my_center|LOCUS_51920 343947 343096 gene locus_tag LOCUS_51930 343947 343096 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973979.1 protein_id gnl|my_center|LOCUS_51930 344122 344616 gene locus_tag LOCUS_51940 344122 344616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029992.1 protein_id gnl|my_center|LOCUS_51940 346512 344620 gene locus_tag LOCUS_51950 gene tcrA 346512 344620 CDS product AfsR-like transcriptional regulator TcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030244.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_51950 347545 346670 gene locus_tag LOCUS_51960 347545 346670 CDS product 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030242.1 protein_id gnl|my_center|LOCUS_51960 347602 348153 gene locus_tag LOCUS_51970 347602 348153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030243.1 protein_id gnl|my_center|LOCUS_51970 348207 350690 gene locus_tag LOCUS_51980 gene tcrA 348207 350690 CDS product AfsR-like transcriptional regulator TcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030244.1 protein_id gnl|my_center|LOCUS_51980 351261 350572 gene locus_tag LOCUS_51990 351261 350572 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030245.1 protein_id gnl|my_center|LOCUS_51990 352871 351258 gene locus_tag LOCUS_52000 352871 351258 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030246.1 protein_id gnl|my_center|LOCUS_52000 353016 354401 gene locus_tag LOCUS_52010 353016 354401 CDS product C4-dicarboxylate transporter DctA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973562.1 protein_id gnl|my_center|LOCUS_52010 354512 354913 gene locus_tag LOCUS_52020 354512 354913 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973561.1 protein_id gnl|my_center|LOCUS_52020 354907 355236 gene locus_tag LOCUS_52030 354907 355236 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973560.1 protein_id gnl|my_center|LOCUS_52030 355405 357624 gene locus_tag LOCUS_52040 355405 357624 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973559.1 protein_id gnl|my_center|LOCUS_52040 360085 357629 gene locus_tag LOCUS_52050 gene glgB 360085 357629 CDS product 1,4-alpha-glucan branching enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486244.1 protein_id gnl|my_center|LOCUS_52050 359994 360479 gene locus_tag LOCUS_52060 359994 360479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52060 361894 360500 gene locus_tag LOCUS_52070 361894 360500 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973557.1 protein_id gnl|my_center|LOCUS_52070 <362509 361983 gene locus_tag LOCUS_52080 <362509 361983 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003973556.1:maltose alpha-D-glucosyltransferase >Feature sequence12 1957 272 gene locus_tag LOCUS_52090 1957 272 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973282.1 protein_id gnl|my_center|LOCUS_52090 2995 2096 gene locus_tag LOCUS_52100 gene dapA 2995 2096 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030431.1 protein_id gnl|my_center|LOCUS_52100 3968 3228 gene locus_tag LOCUS_52110 gene thyX 3968 3228 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030430.1 protein_id gnl|my_center|LOCUS_52110 4166 4405 gene locus_tag LOCUS_52120 4166 4405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973285.1 protein_id gnl|my_center|LOCUS_52120 4567 5121 gene locus_tag LOCUS_52130 4567 5121 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030429.1 protein_id gnl|my_center|LOCUS_52130 5734 5270 gene locus_tag LOCUS_52140 5734 5270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973287.1 protein_id gnl|my_center|LOCUS_52140 6495 5743 gene locus_tag LOCUS_52150 gene dapB 6495 5743 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030428.1 protein_id gnl|my_center|LOCUS_52150 7902 6523 gene locus_tag LOCUS_52160 7902 6523 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973289.1 protein_id gnl|my_center|LOCUS_52160 10133 7899 gene locus_tag LOCUS_52170 10133 7899 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973290.1 protein_id gnl|my_center|LOCUS_52170 10728 10441 gene locus_tag LOCUS_52180 gene rpsO 10728 10441 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973291.1 protein_id gnl|my_center|LOCUS_52180 11004 11300 gene locus_tag LOCUS_52190 11004 11300 CDS product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030415.1 protein_id gnl|my_center|LOCUS_52190 12202 11981 gene locus_tag LOCUS_52200 12202 11981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52200 12105 14480 gene locus_tag LOCUS_52210 12105 14480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_52210 15511 14555 gene locus_tag LOCUS_52220 15511 14555 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973315.1 protein_id gnl|my_center|LOCUS_52220 19213 15611 gene locus_tag LOCUS_52230 19213 15611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52230 20375 19470 gene locus_tag LOCUS_52240 gene truB 20375 19470 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030403.1 protein_id gnl|my_center|LOCUS_52240 20824 20372 gene locus_tag LOCUS_52250 gene rbfA 20824 20372 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973318.1 protein_id gnl|my_center|LOCUS_52250 21153 20860 gene locus_tag LOCUS_52260 21153 20860 CDS product DUF503 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973319.1 protein_id gnl|my_center|LOCUS_52260 24385 21281 gene locus_tag LOCUS_52270 24385 21281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52270 24787 24551 gene locus_tag LOCUS_52280 24787 24551 CDS product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973321.1 protein_id gnl|my_center|LOCUS_52280 25967 24981 gene locus_tag LOCUS_52290 gene nusA 25967 24981 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030401.1 protein_id gnl|my_center|LOCUS_52290 26635 25970 gene locus_tag LOCUS_52300 gene rimP 26635 25970 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973323.1 protein_id gnl|my_center|LOCUS_52300 26695 27216 gene locus_tag LOCUS_52310 26695 27216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52310 27213 27671 gene locus_tag LOCUS_52320 27213 27671 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030399.1 protein_id gnl|my_center|LOCUS_52320 27712 28611 gene locus_tag LOCUS_52330 27712 28611 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030398.1 protein_id gnl|my_center|LOCUS_52330 30351 28651 gene locus_tag LOCUS_52340 30351 28651 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973327.1 protein_id gnl|my_center|LOCUS_52340 30958 30434 gene locus_tag LOCUS_52350 30958 30434 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973328.1 protein_id gnl|my_center|LOCUS_52350 30842 31087 gene locus_tag LOCUS_52360 30842 31087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52360 31946 31098 gene locus_tag LOCUS_52370 31946 31098 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030873433.1 protein_id gnl|my_center|LOCUS_52370 33204 32047 gene locus_tag LOCUS_52380 gene ispG 33204 32047 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973330.1 protein_id gnl|my_center|LOCUS_52380 34698 33394 gene locus_tag LOCUS_52390 34698 33394 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030397.1 protein_id gnl|my_center|LOCUS_52390 35951 34695 gene locus_tag LOCUS_52400 gene dxr 35951 34695 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973332.1 protein_id gnl|my_center|LOCUS_52400 37985 36045 gene locus_tag LOCUS_52410 37985 36045 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030396.1 protein_id gnl|my_center|LOCUS_52410 38284 39294 gene locus_tag LOCUS_52420 38284 39294 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973334.1 protein_id gnl|my_center|LOCUS_52420 40036 39323 gene locus_tag LOCUS_52430 40036 39323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973335.1 protein_id gnl|my_center|LOCUS_52430 42270 40018 gene locus_tag LOCUS_52440 42270 40018 CDS product glycoside hydrolase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030395.1 protein_id gnl|my_center|LOCUS_52440 44303 42267 gene locus_tag LOCUS_52450 44303 42267 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030394.1 protein_id gnl|my_center|LOCUS_52450 45235 44300 gene locus_tag LOCUS_52460 45235 44300 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109035954.1 protein_id gnl|my_center|LOCUS_52460 46254 45232 gene locus_tag LOCUS_52470 46254 45232 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030392.1 protein_id gnl|my_center|LOCUS_52470 47976 46282 gene locus_tag LOCUS_52480 47976 46282 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030391.1 protein_id gnl|my_center|LOCUS_52480 48434 51256 gene locus_tag LOCUS_52490 48434 51256 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030390.1 protein_id gnl|my_center|LOCUS_52490 52769 51324 gene locus_tag LOCUS_52500 52769 51324 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030384.1 protein_id gnl|my_center|LOCUS_52500 54530 52953 gene locus_tag LOCUS_52510 54530 52953 CDS product PucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030383.1 protein_id gnl|my_center|LOCUS_52510 56719 54695 gene locus_tag LOCUS_52520 56719 54695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52520 57283 58617 gene locus_tag LOCUS_52530 gene gabT 57283 58617 CDS product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973349.1 protein_id gnl|my_center|LOCUS_52530 58957 59553 gene locus_tag LOCUS_52540 58957 59553 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046247811.1 protein_id gnl|my_center|LOCUS_52540 60233 59769 gene locus_tag LOCUS_52550 60233 59769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030378.1 protein_id gnl|my_center|LOCUS_52550 61771 60359 gene locus_tag LOCUS_52560 61771 60359 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030377.1 protein_id gnl|my_center|LOCUS_52560 62575 61775 gene locus_tag LOCUS_52570 62575 61775 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973355.1 protein_id gnl|my_center|LOCUS_52570 63505 62576 gene locus_tag LOCUS_52580 63505 62576 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030376.1 protein_id gnl|my_center|LOCUS_52580 64644 63505 gene locus_tag LOCUS_52590 64644 63505 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973357.1 protein_id gnl|my_center|LOCUS_52590 65897 64650 gene locus_tag LOCUS_52600 65897 64650 CDS product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973358.1 protein_id gnl|my_center|LOCUS_52600 67469 65952 gene locus_tag LOCUS_52610 67469 65952 CDS product gamma-aminobutyraldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030374.1 protein_id gnl|my_center|LOCUS_52610 67672 68277 gene locus_tag LOCUS_52620 67672 68277 CDS product NADAR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166680960.1 protein_id gnl|my_center|LOCUS_52620 69109 68261 gene locus_tag LOCUS_52630 69109 68261 CDS product DUF4190 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973362.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_52630 69265 70326 gene locus_tag LOCUS_52640 69265 70326 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030372.1 protein_id gnl|my_center|LOCUS_52640 70352 71083 gene locus_tag LOCUS_52650 70352 71083 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973364.1 protein_id gnl|my_center|LOCUS_52650 72591 71152 gene locus_tag LOCUS_52660 72591 71152 CDS product gamma-aminobutyraldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030368.1 protein_id gnl|my_center|LOCUS_52660 72832 73272 gene locus_tag LOCUS_52670 72832 73272 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973369.1 protein_id gnl|my_center|LOCUS_52670 73257 74648 gene locus_tag LOCUS_52680 73257 74648 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973370.1 protein_id gnl|my_center|LOCUS_52680 74869 75798 gene locus_tag LOCUS_52690 74869 75798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52690 75780 77291 gene locus_tag LOCUS_52700 75780 77291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030366.1 protein_id gnl|my_center|LOCUS_52700 77400 77807 gene locus_tag LOCUS_52710 77400 77807 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973373.1 protein_id gnl|my_center|LOCUS_52710 77845 78975 gene locus_tag LOCUS_52720 77845 78975 CDS product LOG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189284839.1 protein_id gnl|my_center|LOCUS_52720 79134 79856 gene locus_tag LOCUS_52730 79134 79856 CDS product LAETG motif-containing sortase-dependent surface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030364.1 protein_id gnl|my_center|LOCUS_52730 80982 79945 gene locus_tag LOCUS_52740 80982 79945 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030362.1 protein_id gnl|my_center|LOCUS_52740 82583 80985 gene locus_tag LOCUS_52750 82583 80985 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487169.1 protein_id gnl|my_center|LOCUS_52750 83713 82631 gene locus_tag LOCUS_52760 83713 82631 CDS product thiamine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487181.1 protein_id gnl|my_center|LOCUS_52760 85073 83961 gene locus_tag LOCUS_52770 gene rlmN 85073 83961 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973380.1 protein_id gnl|my_center|LOCUS_52770 86237 85245 gene locus_tag LOCUS_52780 86237 85245 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973382.1 protein_id gnl|my_center|LOCUS_52780 86923 86366 gene locus_tag LOCUS_52790 gene frr 86923 86366 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973383.1 protein_id gnl|my_center|LOCUS_52790 87823 87065 gene locus_tag LOCUS_52800 gene pyrH 87823 87065 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973384.1 protein_id gnl|my_center|LOCUS_52800 88830 87994 gene locus_tag LOCUS_52810 gene tsf 88830 87994 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973385.1 protein_id gnl|my_center|LOCUS_52810 89830 88925 gene locus_tag LOCUS_52820 gene rpsB 89830 88925 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106517497.1 protein_id gnl|my_center|LOCUS_52820 90194 90706 gene locus_tag LOCUS_52830 90194 90706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_52830 91336 90776 gene locus_tag LOCUS_52840 91336 90776 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973388.1 protein_id gnl|my_center|LOCUS_52840 92274 91432 gene locus_tag LOCUS_52850 gene whiG 92274 91432 CDS product RNA polymerase sigma factor WhiG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973389.1 protein_id gnl|my_center|LOCUS_52850 93726 92566 gene locus_tag LOCUS_52860 gene dprA 93726 92566 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487183.1 protein_id gnl|my_center|LOCUS_52860 95339 93723 gene locus_tag LOCUS_52870 95339 93723 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030329.1 protein_id gnl|my_center|LOCUS_52870 95683 95339 gene locus_tag LOCUS_52880 95683 95339 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030872622.1 protein_id gnl|my_center|LOCUS_52880 96128 95820 gene locus_tag LOCUS_52890 96128 95820 CDS product DUF2469 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003965949.1 protein_id gnl|my_center|LOCUS_52890 96709 96185 gene locus_tag LOCUS_52900 96709 96185 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327363.1 protein_id gnl|my_center|LOCUS_52900 97466 96699 gene locus_tag LOCUS_52910 gene lepB 97466 96699 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030327.1 protein_id gnl|my_center|LOCUS_52910 98711 97662 gene locus_tag LOCUS_52920 98711 97662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52920 99774 98662 gene locus_tag LOCUS_52930 99774 98662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_52930 100489 99740 gene locus_tag LOCUS_52940 gene lepB 100489 99740 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030325.1 protein_id gnl|my_center|LOCUS_52940 100886 100536 gene locus_tag LOCUS_52950 gene rplS 100886 100536 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973398.1 protein_id gnl|my_center|LOCUS_52950 101854 101021 gene locus_tag LOCUS_52960 gene trmD 101854 101021 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973399.1 protein_id gnl|my_center|LOCUS_52960 102399 101854 gene locus_tag LOCUS_52970 gene rimM 102399 101854 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973400.1 protein_id gnl|my_center|LOCUS_52970 102723 102484 gene locus_tag LOCUS_52980 102723 102484 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973401.1 protein_id gnl|my_center|LOCUS_52980 103145 102726 gene locus_tag LOCUS_52990 gene rpsP 103145 102726 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007444852.1 protein_id gnl|my_center|LOCUS_52990 103914 103318 gene locus_tag LOCUS_53000 103914 103318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973403.1 protein_id gnl|my_center|LOCUS_53000 104370 104041 gene locus_tag LOCUS_53010 104370 104041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53010 104989 105747 gene locus_tag LOCUS_53020 104989 105747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030324.1 protein_id gnl|my_center|LOCUS_53020 107724 105778 gene locus_tag LOCUS_53030 gene ftsH 107724 105778 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030322.1 protein_id gnl|my_center|LOCUS_53030 109393 107843 gene locus_tag LOCUS_53040 gene ffh 109393 107843 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327355.1 protein_id gnl|my_center|LOCUS_53040 112073 109611 gene locus_tag LOCUS_53050 112073 109611 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487177.1 protein_id gnl|my_center|LOCUS_53050 112437 112099 gene locus_tag LOCUS_53060 112437 112099 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051565.1 protein_id gnl|my_center|LOCUS_53060 113774 112434 gene locus_tag LOCUS_53070 113774 112434 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030319.1 protein_id gnl|my_center|LOCUS_53070 115570 114077 gene locus_tag LOCUS_53080 115570 114077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030318.1 protein_id gnl|my_center|LOCUS_53080 116026 116691 gene locus_tag LOCUS_53090 116026 116691 CDS product bifunctional DNA primase/polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030317.1 protein_id gnl|my_center|LOCUS_53090 118166 116958 gene locus_tag LOCUS_53100 gene ftsY 118166 116958 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164278219.1 protein_id gnl|my_center|LOCUS_53100 119788 118370 gene locus_tag LOCUS_53110 119788 118370 CDS product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971990.1 protein_id gnl|my_center|LOCUS_53110 123579 119992 gene locus_tag LOCUS_53120 gene smc 123579 119992 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030315.1 protein_id gnl|my_center|LOCUS_53120 124009 123806 gene locus_tag LOCUS_53130 124009 123806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53130 124659 124378 gene locus_tag LOCUS_53140 124659 124378 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973419.1 protein_id gnl|my_center|LOCUS_53140 124825 125967 gene locus_tag LOCUS_53150 124825 125967 CDS product CAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030314.1 protein_id gnl|my_center|LOCUS_53150 126033 126416 gene locus_tag LOCUS_53160 126033 126416 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973421.1 protein_id gnl|my_center|LOCUS_53160 127459 126599 gene locus_tag LOCUS_53170 gene mutM 127459 126599 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973422.1 protein_id gnl|my_center|LOCUS_53170 128374 127565 gene locus_tag LOCUS_53180 gene rnc 128374 127565 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973423.1 protein_id gnl|my_center|LOCUS_53180 128567 128394 gene locus_tag LOCUS_53190 gene rpmF 128567 128394 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006139588.1 protein_id gnl|my_center|LOCUS_53190 129217 128570 gene locus_tag LOCUS_53200 129217 128570 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973424.1 protein_id gnl|my_center|LOCUS_53200 130463 129345 gene locus_tag LOCUS_53210 130463 129345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030311.1 protein_id gnl|my_center|LOCUS_53210 131092 130583 gene locus_tag LOCUS_53220 gene coaD 131092 130583 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973426.1 protein_id gnl|my_center|LOCUS_53220 131673 131089 gene locus_tag LOCUS_53230 gene rsmD 131673 131089 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030310.1 protein_id gnl|my_center|LOCUS_53230 134030 131817 gene locus_tag LOCUS_53240 gene recG 134030 131817 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973428.1 protein_id gnl|my_center|LOCUS_53240 134202 136037 gene locus_tag LOCUS_53250 134202 136037 CDS product HSP90 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027769.1 protein_id gnl|my_center|LOCUS_53250 136037 139057 gene locus_tag LOCUS_53260 136037 139057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53260 140773 139061 gene locus_tag LOCUS_53270 140773 139061 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030309.1 protein_id gnl|my_center|LOCUS_53270 141083 141268 gene locus_tag LOCUS_53280 gene rpmB 141083 141268 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973430.1 protein_id gnl|my_center|LOCUS_53280 142130 141357 gene locus_tag LOCUS_53290 gene thiD 142130 141357 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973431.1 protein_id gnl|my_center|LOCUS_53290 143113 142145 gene locus_tag LOCUS_53300 143113 142145 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973432.1 protein_id gnl|my_center|LOCUS_53300 143320 143553 gene locus_tag LOCUS_53310 143320 143553 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973433.1 protein_id gnl|my_center|LOCUS_53310 143568 144074 gene locus_tag LOCUS_53320 143568 144074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53320 145253 144096 gene locus_tag LOCUS_53330 145253 144096 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973434.1 protein_id gnl|my_center|LOCUS_53330 146323 145313 gene locus_tag LOCUS_53340 146323 145313 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030308.1 protein_id gnl|my_center|LOCUS_53340 147084 146320 gene locus_tag LOCUS_53350 147084 146320 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973436.1 protein_id gnl|my_center|LOCUS_53350 147240 147878 gene locus_tag LOCUS_53360 gene cofC 147240 147878 CDS product 2-phospho-L-lactate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973437.1 protein_id gnl|my_center|LOCUS_53360 147888 148091 gene locus_tag LOCUS_53370 147888 148091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030307.1 protein_id gnl|my_center|LOCUS_53370 148839 148171 gene locus_tag LOCUS_53380 148839 148171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_53380 149206 148976 gene locus_tag LOCUS_53390 149206 148976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973440.1 protein_id gnl|my_center|LOCUS_53390 150058 149465 gene locus_tag LOCUS_53400 gene leuD 150058 149465 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030306.1 protein_id gnl|my_center|LOCUS_53400 151492 150065 gene locus_tag LOCUS_53410 gene leuC 151492 150065 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973442.1 protein_id gnl|my_center|LOCUS_53410 151686 152402 gene locus_tag LOCUS_53420 gene ndgR 151686 152402 CDS product IclR family transcriptional regulator NdgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030305.1 protein_id gnl|my_center|LOCUS_53420 152965 152480 gene locus_tag LOCUS_53430 152965 152480 CDS product DUF4188 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030304.1 protein_id gnl|my_center|LOCUS_53430 153071 153718 gene locus_tag LOCUS_53440 153071 153718 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973445.1 protein_id gnl|my_center|LOCUS_53440 153839 153766 gene locus_tag LOCUS_t00830 153839 153766 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 153955 153883 gene locus_tag LOCUS_t00840 153955 153883 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 154048 153975 gene locus_tag LOCUS_t00850 154048 153975 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 154153 154080 gene locus_tag LOCUS_t00860 154153 154080 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 154295 154223 gene locus_tag LOCUS_t00870 154295 154223 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 155125 154391 gene locus_tag LOCUS_53450 155125 154391 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030303.1 protein_id gnl|my_center|LOCUS_53450 156657 155230 gene locus_tag LOCUS_53460 gene gltX 156657 155230 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973448.1 protein_id gnl|my_center|LOCUS_53460 157498 156713 gene locus_tag LOCUS_53470 157498 156713 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973449.1 protein_id gnl|my_center|LOCUS_53470 157769 157590 gene locus_tag LOCUS_53480 157769 157590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327338.1 protein_id gnl|my_center|LOCUS_53480 158389 162315 gene locus_tag LOCUS_53490 158389 162315 CDS product nitrate- and nitrite sensing domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030302.1 protein_id gnl|my_center|LOCUS_53490 162316 162738 gene locus_tag LOCUS_53500 162316 162738 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973453.1 protein_id gnl|my_center|LOCUS_53500 162850 163248 gene locus_tag LOCUS_53510 162850 163248 CDS product DUF742 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973454.1 protein_id gnl|my_center|LOCUS_53510 163229 163804 gene locus_tag LOCUS_53520 163229 163804 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009314218.1 protein_id gnl|my_center|LOCUS_53520 164194 167499 gene locus_tag LOCUS_53530 164194 167499 CDS product nitrate- and nitrite sensing domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030300.1 protein_id gnl|my_center|LOCUS_53530 167501 167923 gene locus_tag LOCUS_53540 167501 167923 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_078643930.1 protein_id gnl|my_center|LOCUS_53540 168018 168590 gene locus_tag LOCUS_53550 168018 168590 CDS product DUF742 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973458.1 protein_id gnl|my_center|LOCUS_53550 168631 169152 gene locus_tag LOCUS_53560 168631 169152 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009314218.1 protein_id gnl|my_center|LOCUS_53560 169425 169228 gene locus_tag LOCUS_53570 169425 169228 CDS product acyl-CoA carboxylase epsilon subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030299.1 protein_id gnl|my_center|LOCUS_53570 171029 169446 gene locus_tag LOCUS_53580 171029 169446 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973461.1 protein_id gnl|my_center|LOCUS_53580 173499 171184 gene locus_tag LOCUS_53590 173499 171184 CDS product polysaccharide lyase 8 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030298.1 protein_id gnl|my_center|LOCUS_53590 173718 174326 gene locus_tag LOCUS_53600 173718 174326 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973463.1 protein_id gnl|my_center|LOCUS_53600 174942 174355 gene locus_tag LOCUS_53610 174942 174355 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973464.1 protein_id gnl|my_center|LOCUS_53610 175017 175958 gene locus_tag LOCUS_53620 175017 175958 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030296.1 protein_id gnl|my_center|LOCUS_53620 176232 175861 gene locus_tag LOCUS_53630 176232 175861 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093457988.1 protein_id gnl|my_center|LOCUS_53630 176408 177229 gene locus_tag LOCUS_53640 176408 177229 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226025318.1 protein_id gnl|my_center|LOCUS_53640 177226 177522 gene locus_tag LOCUS_53650 177226 177522 CDS product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030672.1 protein_id gnl|my_center|LOCUS_53650 178858 177527 gene locus_tag LOCUS_53660 178858 177527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973466.1 protein_id gnl|my_center|LOCUS_53660 180584 178980 gene locus_tag LOCUS_53670 gene cimA 180584 178980 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030295.1 protein_id gnl|my_center|LOCUS_53670 181480 180869 gene locus_tag LOCUS_53680 181480 180869 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973468.1 protein_id gnl|my_center|LOCUS_53680 182533 181499 gene locus_tag LOCUS_53690 182533 181499 CDS product agmatine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973469.1 protein_id gnl|my_center|LOCUS_53690 184254 182545 gene locus_tag LOCUS_53700 184254 182545 CDS product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030294.1 protein_id gnl|my_center|LOCUS_53700 184946 184251 gene locus_tag LOCUS_53710 gene ureA 184946 184251 CDS product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030293.1 protein_id gnl|my_center|LOCUS_53710 186179 185091 gene locus_tag LOCUS_53720 186179 185091 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030291.1 protein_id gnl|my_center|LOCUS_53720 187463 186420 gene locus_tag LOCUS_53730 187463 186420 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030290.1 protein_id gnl|my_center|LOCUS_53730 187593 189152 gene locus_tag LOCUS_53740 187593 189152 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110463.1 protein_id gnl|my_center|LOCUS_53740 189294 189163 gene locus_tag LOCUS_53750 189294 189163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030289.1 protein_id gnl|my_center|LOCUS_53750 189293 189565 gene locus_tag LOCUS_53760 189293 189565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53760 191224 189593 gene locus_tag LOCUS_53770 gene pruA 191224 189593 CDS product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730329.1 protein_id gnl|my_center|LOCUS_53770 192196 191270 gene locus_tag LOCUS_53780 192196 191270 CDS product proline dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973477.1 protein_id gnl|my_center|LOCUS_53780 192329 193570 gene locus_tag LOCUS_53790 192329 193570 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973478.1 protein_id gnl|my_center|LOCUS_53790 195248 193659 gene locus_tag LOCUS_53800 gene serA 195248 193659 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973481.1 protein_id gnl|my_center|LOCUS_53800 196489 195491 gene locus_tag LOCUS_53810 gene ilvC 196489 195491 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973482.1 protein_id gnl|my_center|LOCUS_53810 197132 196608 gene locus_tag LOCUS_53820 gene ilvN 197132 196608 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973483.1 protein_id gnl|my_center|LOCUS_53820 199004 197154 gene locus_tag LOCUS_53830 199004 197154 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973484.1 protein_id gnl|my_center|LOCUS_53830 202292 199248 gene locus_tag LOCUS_53840 202292 199248 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030287.1 protein_id gnl|my_center|LOCUS_53840 203732 202782 gene locus_tag LOCUS_53850 203732 202782 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030286.1 protein_id gnl|my_center|LOCUS_53850 203855 204853 gene locus_tag LOCUS_53860 203855 204853 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870088.1 protein_id gnl|my_center|LOCUS_53860 205083 206156 gene locus_tag LOCUS_53870 205083 206156 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486947.1 protein_id gnl|my_center|LOCUS_53870 206406 206167 gene locus_tag LOCUS_53880 206406 206167 CDS product DUF6191 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973490.1 protein_id gnl|my_center|LOCUS_53880 209431 206444 gene locus_tag LOCUS_53890 209431 206444 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486951.1 protein_id gnl|my_center|LOCUS_53890 210033 209842 gene locus_tag LOCUS_53900 210033 209842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53900 210781 210230 gene locus_tag LOCUS_53910 210781 210230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030283.1 protein_id gnl|my_center|LOCUS_53910 211392 210817 gene locus_tag LOCUS_53920 211392 210817 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973495.1 protein_id gnl|my_center|LOCUS_53920 213607 211370 gene locus_tag LOCUS_53930 213607 211370 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030282.1 protein_id gnl|my_center|LOCUS_53930 215343 213829 gene locus_tag LOCUS_53940 gene gatB 215343 213829 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030281.1 protein_id gnl|my_center|LOCUS_53940 215598 215359 gene locus_tag LOCUS_53950 215598 215359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007444751.1 protein_id gnl|my_center|LOCUS_53950 217094 215595 gene locus_tag LOCUS_53960 gene gatA 217094 215595 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973499.1 protein_id gnl|my_center|LOCUS_53960 217397 217101 gene locus_tag LOCUS_53970 gene gatC 217397 217101 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973500.1 protein_id gnl|my_center|LOCUS_53970 217895 217527 gene locus_tag LOCUS_53980 217895 217527 CDS product DUF4267 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030280.1 protein_id gnl|my_center|LOCUS_53980 217956 218567 gene locus_tag LOCUS_53990 217956 218567 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030666.1 protein_id gnl|my_center|LOCUS_53990 221283 219031 gene locus_tag LOCUS_54000 gene rmdB 221283 219031 CDS product cyclic Di-GMP phosphodiesterase RmdB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030279.1 protein_id gnl|my_center|LOCUS_54000 223760 221565 gene locus_tag LOCUS_54010 gene ligA 223760 221565 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030278.1 protein_id gnl|my_center|LOCUS_54010 224784 223777 gene locus_tag LOCUS_54020 224784 223777 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030277.1 protein_id gnl|my_center|LOCUS_54020 225514 224816 gene locus_tag LOCUS_54030 225514 224816 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870060.1 protein_id gnl|my_center|LOCUS_54030 226071 225532 gene locus_tag LOCUS_54040 226071 225532 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870058.1 protein_id gnl|my_center|LOCUS_54040 226172 226492 gene locus_tag LOCUS_54050 226172 226492 CDS product DUF427 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973508.1 protein_id gnl|my_center|LOCUS_54050 227632 226502 gene locus_tag LOCUS_54060 gene mnmA 227632 226502 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973510.1 protein_id gnl|my_center|LOCUS_54060 227693 228406 gene locus_tag LOCUS_54070 227693 228406 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973511.1 protein_id gnl|my_center|LOCUS_54070 229573 228410 gene locus_tag LOCUS_54080 229573 228410 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030274.1 protein_id gnl|my_center|LOCUS_54080 229900 229634 gene locus_tag LOCUS_54090 229900 229634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973513.1 protein_id gnl|my_center|LOCUS_54090 230097 229933 gene locus_tag LOCUS_54100 230097 229933 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973514.1 protein_id gnl|my_center|LOCUS_54100 230213 230839 gene locus_tag LOCUS_54110 230213 230839 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973515.1 protein_id gnl|my_center|LOCUS_54110 231749 230889 gene locus_tag LOCUS_54120 231749 230889 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327314.1 protein_id gnl|my_center|LOCUS_54120 232475 231816 gene locus_tag LOCUS_54130 232475 231816 CDS product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973517.1 protein_id gnl|my_center|LOCUS_54130 233897 232545 gene locus_tag LOCUS_54140 233897 232545 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_079021131.1 protein_id gnl|my_center|LOCUS_54140 234991 233894 gene locus_tag LOCUS_54150 234991 233894 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973519.1 protein_id gnl|my_center|LOCUS_54150 235986 234988 gene locus_tag LOCUS_54160 235986 234988 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973520.1 protein_id gnl|my_center|LOCUS_54160 237888 236095 gene locus_tag LOCUS_54170 237888 236095 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973521.1 protein_id gnl|my_center|LOCUS_54170 238805 237960 gene locus_tag LOCUS_54180 238805 237960 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973522.1 protein_id gnl|my_center|LOCUS_54180 238725 238997 gene locus_tag LOCUS_54190 238725 238997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54190 240034 239279 gene locus_tag LOCUS_54200 240034 239279 CDS product enhanced serine sensitivity protein SseB C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030271.1 protein_id gnl|my_center|LOCUS_54200 241037 240252 gene locus_tag LOCUS_54210 241037 240252 CDS product enhanced serine sensitivity protein SseB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973524.1 protein_id gnl|my_center|LOCUS_54210 241773 241108 gene locus_tag LOCUS_54220 241773 241108 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030270.1 protein_id gnl|my_center|LOCUS_54220 242200 243318 gene locus_tag LOCUS_54230 gene gcvT 242200 243318 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973526.1 protein_id gnl|my_center|LOCUS_54230 243490 243867 gene locus_tag LOCUS_54240 gene gcvH 243490 243867 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973527.1 protein_id gnl|my_center|LOCUS_54240 243882 245144 gene locus_tag LOCUS_54250 243882 245144 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973528.1 protein_id gnl|my_center|LOCUS_54250 245246 246613 gene locus_tag LOCUS_54260 245246 246613 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030269.1 protein_id gnl|my_center|LOCUS_54260 246733 248154 gene locus_tag LOCUS_54270 246733 248154 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030268.1 protein_id gnl|my_center|LOCUS_54270 248283 248840 gene locus_tag LOCUS_54280 248283 248840 CDS product glycoside hydrolase family 25 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973532.1 protein_id gnl|my_center|LOCUS_54280 249504 248842 gene locus_tag LOCUS_54290 249504 248842 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973533.1 protein_id gnl|my_center|LOCUS_54290 249859 249647 gene locus_tag LOCUS_54300 249859 249647 CDS product EF-hand domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973534.1 protein_id gnl|my_center|LOCUS_54300 250498 249974 gene locus_tag LOCUS_54310 250498 249974 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_079178808.1 protein_id gnl|my_center|LOCUS_54310 251539 250772 gene locus_tag LOCUS_54320 251539 250772 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030262.1 protein_id gnl|my_center|LOCUS_54320 252841 251600 gene locus_tag LOCUS_54330 252841 251600 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486965.1 protein_id gnl|my_center|LOCUS_54330 254176 252983 gene locus_tag LOCUS_54340 254176 252983 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030260.1 protein_id gnl|my_center|LOCUS_54340 254397 256664 gene locus_tag LOCUS_54350 gene glgX 254397 256664 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486968.1 protein_id gnl|my_center|LOCUS_54350 256974 258374 gene locus_tag LOCUS_54360 256974 258374 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121616.1 protein_id gnl|my_center|LOCUS_54360 258460 260358 gene locus_tag LOCUS_54370 258460 260358 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030255.1 protein_id gnl|my_center|LOCUS_54370 260355 262214 gene locus_tag LOCUS_54380 260355 262214 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030254.1 protein_id gnl|my_center|LOCUS_54380 262386 262898 gene locus_tag LOCUS_54390 262386 262898 CDS product DUF1990 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173943975.1 protein_id gnl|my_center|LOCUS_54390 265550 262932 gene locus_tag LOCUS_54400 265550 262932 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486976.1 protein_id gnl|my_center|LOCUS_54400 266157 265819 gene locus_tag LOCUS_54410 266157 265819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54410 >Feature sequence13 <1 545 gene locus_tag LOCUS_54420 <1 545 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011031594.1:maltose alpha-D-glucosyltransferase 574 1935 gene locus_tag LOCUS_54430 574 1935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031593.1 protein_id gnl|my_center|LOCUS_54430 1937 4159 gene locus_tag LOCUS_54440 gene glgB 1937 4159 CDS product 1,4-alpha-glucan branching enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031592.1 protein_id gnl|my_center|LOCUS_54440 4271 5359 gene locus_tag LOCUS_54450 4271 5359 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031591.1 protein_id gnl|my_center|LOCUS_54450 5624 5391 gene locus_tag LOCUS_54460 5624 5391 CDS product DUF6480 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971811.1 protein_id gnl|my_center|LOCUS_54460 5777 7681 gene locus_tag LOCUS_54470 5777 7681 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031590.1 protein_id gnl|my_center|LOCUS_54470 7827 8261 gene locus_tag LOCUS_54480 7827 8261 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971813.1 protein_id gnl|my_center|LOCUS_54480 8668 8303 gene locus_tag LOCUS_54490 8668 8303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54490 9092 13090 gene locus_tag LOCUS_54500 9092 13090 CDS product HAMP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031589.1 protein_id gnl|my_center|LOCUS_54500 13161 15566 gene locus_tag LOCUS_54510 13161 15566 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031588.1 protein_id gnl|my_center|LOCUS_54510 15746 16138 gene locus_tag LOCUS_54520 15746 16138 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971816.1 protein_id gnl|my_center|LOCUS_54520 16345 17238 gene locus_tag LOCUS_54530 16345 17238 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971817.1 protein_id gnl|my_center|LOCUS_54530 17235 17645 gene locus_tag LOCUS_54540 17235 17645 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971818.1 protein_id gnl|my_center|LOCUS_54540 17645 18085 gene locus_tag LOCUS_54550 17645 18085 CDS product anti-sigma regulatory factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036370.1 protein_id gnl|my_center|LOCUS_54550 18085 19152 gene locus_tag LOCUS_54560 18085 19152 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031587.1 protein_id gnl|my_center|LOCUS_54560 19149 20864 gene locus_tag LOCUS_54570 19149 20864 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031586.1 protein_id gnl|my_center|LOCUS_54570 21005 22378 gene locus_tag LOCUS_54580 21005 22378 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030866777.1 protein_id gnl|my_center|LOCUS_54580 22479 24704 gene locus_tag LOCUS_54590 22479 24704 CDS product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168715412.1 protein_id gnl|my_center|LOCUS_54590 25158 24721 gene locus_tag LOCUS_54600 25158 24721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971824.1 protein_id gnl|my_center|LOCUS_54600 26026 25181 gene locus_tag LOCUS_54610 26026 25181 CDS product DUF1206 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031583.1 protein_id gnl|my_center|LOCUS_54610 26412 26182 gene locus_tag LOCUS_54620 26412 26182 CDS product DUF5133 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971826.1 protein_id gnl|my_center|LOCUS_54620 27323 26430 gene locus_tag LOCUS_54630 27323 26430 CDS product SigB/SigF/SigG family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031582.1 protein_id gnl|my_center|LOCUS_54630 27939 27496 gene locus_tag LOCUS_54640 27939 27496 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031581.1 protein_id gnl|my_center|LOCUS_54640 28116 28322 gene locus_tag LOCUS_54650 28116 28322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971829.1 protein_id gnl|my_center|LOCUS_54650 28409 29878 gene locus_tag LOCUS_54660 28409 29878 CDS product ornithine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971830.1 protein_id gnl|my_center|LOCUS_54660 30173 30628 gene locus_tag LOCUS_54670 30173 30628 CDS product cyclic nucleotide-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971831.1 protein_id gnl|my_center|LOCUS_54670 31940 30633 gene locus_tag LOCUS_54680 31940 30633 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031580.1 protein_id gnl|my_center|LOCUS_54680 32634 32020 gene locus_tag LOCUS_54690 32634 32020 CDS product LysE/ArgO family amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031579.1 protein_id gnl|my_center|LOCUS_54690 32705 33616 gene locus_tag LOCUS_54700 32705 33616 CDS product LysR family transcriptional regulator ArgP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971834.1 protein_id gnl|my_center|LOCUS_54700 33726 33977 gene locus_tag LOCUS_54710 33726 33977 CDS product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971835.1 protein_id gnl|my_center|LOCUS_54710 33979 34065 gene locus_tag LOCUS_t00880 33979 34065 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 34496 34047 gene locus_tag LOCUS_54720 34496 34047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54720 34618 35019 gene locus_tag LOCUS_54730 34618 35019 CDS product DUF488 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031578.1 protein_id gnl|my_center|LOCUS_54730 36709 35036 gene locus_tag LOCUS_54740 36709 35036 CDS product FAD-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031577.1 protein_id gnl|my_center|LOCUS_54740 37391 36771 gene locus_tag LOCUS_54750 37391 36771 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270392.1 protein_id gnl|my_center|LOCUS_54750 37507 38133 gene locus_tag LOCUS_54760 37507 38133 CDS product alpha-ketoglutarate-dependent dioxygenase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971839.1 protein_id gnl|my_center|LOCUS_54760 38218 38973 gene locus_tag LOCUS_54770 38218 38973 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031575.1 protein_id gnl|my_center|LOCUS_54770 39027 40262 gene locus_tag LOCUS_54780 39027 40262 CDS product DUF4032 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971841.1 protein_id gnl|my_center|LOCUS_54780 41130 40264 gene locus_tag LOCUS_54790 41130 40264 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030866806.1 protein_id gnl|my_center|LOCUS_54790 41318 42994 gene locus_tag LOCUS_54800 41318 42994 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971843.1 protein_id gnl|my_center|LOCUS_54800 43006 44454 gene locus_tag LOCUS_54810 43006 44454 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031573.1 protein_id gnl|my_center|LOCUS_54810 44451 44804 gene locus_tag LOCUS_54820 44451 44804 CDS product UBP-type zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971845.1 protein_id gnl|my_center|LOCUS_54820 45006 47954 gene locus_tag LOCUS_54830 45006 47954 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031572.1 protein_id gnl|my_center|LOCUS_54830 48083 49483 gene locus_tag LOCUS_54840 48083 49483 CDS product CAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031571.1 protein_id gnl|my_center|LOCUS_54840 49538 50215 gene locus_tag LOCUS_54850 49538 50215 CDS product AIM24 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971849.1 protein_id gnl|my_center|LOCUS_54850 50228 51187 gene locus_tag LOCUS_54860 50228 51187 CDS product threonine/serine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031570.1 protein_id gnl|my_center|LOCUS_54860 51309 52286 gene locus_tag LOCUS_54870 51309 52286 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031568.1 protein_id gnl|my_center|LOCUS_54870 52411 52839 gene locus_tag LOCUS_54880 52411 52839 CDS product SsgA family sporulation/cell division regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971854.1 protein_id gnl|my_center|LOCUS_54880 53353 52847 gene locus_tag LOCUS_54890 53353 52847 CDS product DUF6328 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971855.1 protein_id gnl|my_center|LOCUS_54890 53509 53850 gene locus_tag LOCUS_54900 53509 53850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031567.1 protein_id gnl|my_center|LOCUS_54900 54849 53866 gene locus_tag LOCUS_54910 54849 53866 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031566.1 protein_id gnl|my_center|LOCUS_54910 56089 54878 gene locus_tag LOCUS_54920 56089 54878 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031565.1 protein_id gnl|my_center|LOCUS_54920 56238 56687 gene locus_tag LOCUS_54930 56238 56687 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971936.1 protein_id gnl|my_center|LOCUS_54930 57381 56710 gene locus_tag LOCUS_54940 57381 56710 CDS product ribonuclease H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031564.1 protein_id gnl|my_center|LOCUS_54940 57948 57466 gene locus_tag LOCUS_54950 57948 57466 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031562.1 protein_id gnl|my_center|LOCUS_54950 58148 58801 gene locus_tag LOCUS_54960 58148 58801 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971862.1 protein_id gnl|my_center|LOCUS_54960 58804 59406 gene locus_tag LOCUS_54970 58804 59406 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971863.1 protein_id gnl|my_center|LOCUS_54970 59892 59464 gene locus_tag LOCUS_54980 59892 59464 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031561.1 protein_id gnl|my_center|LOCUS_54980 60156 61043 gene locus_tag LOCUS_54990 60156 61043 CDS product RNA polymerase sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971865.1 protein_id gnl|my_center|LOCUS_54990 61591 61136 gene locus_tag LOCUS_55000 61591 61136 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971866.1 protein_id gnl|my_center|LOCUS_55000 61590 62339 gene locus_tag LOCUS_55010 61590 62339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55010 62339 62755 gene locus_tag LOCUS_55020 62339 62755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031559.1 protein_id gnl|my_center|LOCUS_55020 62817 64076 gene locus_tag LOCUS_55030 62817 64076 CDS product streptophobe family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_220451617.1 protein_id gnl|my_center|LOCUS_55030 64521 64111 gene locus_tag LOCUS_55040 64521 64111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971870.1 protein_id gnl|my_center|LOCUS_55040 65752 64760 gene locus_tag LOCUS_55050 gene mgrA 65752 64760 CDS product L-glyceraldehyde 3-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031556.1 protein_id gnl|my_center|LOCUS_55050 65844 66749 gene locus_tag LOCUS_55060 65844 66749 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971873.1 protein_id gnl|my_center|LOCUS_55060 66775 67290 gene locus_tag LOCUS_55070 66775 67290 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031555.1 protein_id gnl|my_center|LOCUS_55070 68345 67272 gene locus_tag LOCUS_55080 68345 67272 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031554.1 protein_id gnl|my_center|LOCUS_55080 68752 68342 gene locus_tag LOCUS_55090 68752 68342 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031553.1 protein_id gnl|my_center|LOCUS_55090 69759 68872 gene locus_tag LOCUS_55100 69759 68872 CDS product chitinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031550.1 protein_id gnl|my_center|LOCUS_55100 71085 69976 gene locus_tag LOCUS_55110 71085 69976 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226848.1 protein_id gnl|my_center|LOCUS_55110 71646 71089 gene locus_tag LOCUS_55120 gene ssuE 71646 71089 CDS product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808029.1 protein_id gnl|my_center|LOCUS_55120 71597 72127 gene locus_tag LOCUS_55130 71597 72127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55130 72342 72175 gene locus_tag LOCUS_55140 72342 72175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976837.1 protein_id gnl|my_center|LOCUS_55140 72504 74033 gene locus_tag LOCUS_55150 72504 74033 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027383.1 protein_id gnl|my_center|LOCUS_55150 74123 74563 gene locus_tag LOCUS_55160 74123 74563 CDS product SPW repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971883.1 protein_id gnl|my_center|LOCUS_55160 74728 74991 gene locus_tag LOCUS_55170 74728 74991 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971884.1 protein_id gnl|my_center|LOCUS_55170 75136 75621 gene locus_tag LOCUS_55180 75136 75621 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971886.1 protein_id gnl|my_center|LOCUS_55180 75764 77365 gene locus_tag LOCUS_55190 75764 77365 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031546.1 protein_id gnl|my_center|LOCUS_55190 79217 77376 gene locus_tag LOCUS_55200 gene asnB 79217 77376 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223784.1 protein_id gnl|my_center|LOCUS_55200 79609 80631 gene locus_tag LOCUS_55210 79609 80631 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031545.1 protein_id gnl|my_center|LOCUS_55210 80882 80628 gene locus_tag LOCUS_55220 80882 80628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55220 80881 82251 gene locus_tag LOCUS_55230 80881 82251 CDS product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031544.1 protein_id gnl|my_center|LOCUS_55230 83764 82268 gene locus_tag LOCUS_55240 83764 82268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031543.1 protein_id gnl|my_center|LOCUS_55240 84068 83823 gene locus_tag LOCUS_55250 84068 83823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55250 84028 85167 gene locus_tag LOCUS_55260 84028 85167 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971893.1 protein_id gnl|my_center|LOCUS_55260 85373 87352 gene locus_tag LOCUS_55270 85373 87352 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031541.1 protein_id gnl|my_center|LOCUS_55270 87869 87363 gene locus_tag LOCUS_55280 87869 87363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031540.1 protein_id gnl|my_center|LOCUS_55280 88816 87911 gene locus_tag LOCUS_55290 88816 87911 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971898.1 protein_id gnl|my_center|LOCUS_55290 89208 88966 gene locus_tag LOCUS_55300 89208 88966 CDS product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971899.1 protein_id gnl|my_center|LOCUS_55300 90792 89293 gene locus_tag LOCUS_55310 90792 89293 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031537.1 protein_id gnl|my_center|LOCUS_55310 91154 92935 gene locus_tag LOCUS_55320 91154 92935 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971902.1 protein_id gnl|my_center|LOCUS_55320 93245 92949 gene locus_tag LOCUS_55330 93245 92949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55330 94869 93301 gene locus_tag LOCUS_55340 94869 93301 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162483874.1 protein_id gnl|my_center|LOCUS_55340 95806 94916 gene locus_tag LOCUS_55350 95806 94916 CDS product oxygenase MpaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971907.1 protein_id gnl|my_center|LOCUS_55350 96310 95840 gene locus_tag LOCUS_55360 96310 95840 CDS product four-helix bundle copper-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971908.1 protein_id gnl|my_center|LOCUS_55360 96350 96754 gene locus_tag LOCUS_55370 96350 96754 CDS product ChaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727919.1 protein_id gnl|my_center|LOCUS_55370 96807 97151 gene locus_tag LOCUS_55380 96807 97151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55380 97221 97571 gene locus_tag LOCUS_55390 97221 97571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730478.1 protein_id gnl|my_center|LOCUS_55390 97705 99270 gene locus_tag LOCUS_55400 97705 99270 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030563.1 protein_id gnl|my_center|LOCUS_55400 100426 99257 gene locus_tag LOCUS_55410 100426 99257 CDS product zinc-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037159.1 protein_id gnl|my_center|LOCUS_55410 100884 100423 gene locus_tag LOCUS_55420 100884 100423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55420 101604 101014 gene locus_tag LOCUS_55430 101604 101014 CDS product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226035.1 protein_id gnl|my_center|LOCUS_55430 102814 101615 gene locus_tag LOCUS_55440 102814 101615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55440 104045 103218 gene locus_tag LOCUS_55450 104045 103218 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971433.1 protein_id gnl|my_center|LOCUS_55450 104206 105051 gene locus_tag LOCUS_55460 104206 105051 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227678.1 protein_id gnl|my_center|LOCUS_55460 107247 105220 gene locus_tag LOCUS_55470 107247 105220 CDS product NPCBM/NEW2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026988.1 protein_id gnl|my_center|LOCUS_55470 108920 107445 gene locus_tag LOCUS_55480 108920 107445 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026958.1 protein_id gnl|my_center|LOCUS_55480 108984 109610 gene locus_tag LOCUS_55490 108984 109610 CDS product TetR/AcrR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005059796.1 protein_id gnl|my_center|LOCUS_55490 111296 109860 gene locus_tag LOCUS_55500 111296 109860 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229299.1 protein_id gnl|my_center|LOCUS_55500 111912 111418 gene locus_tag LOCUS_55510 111912 111418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55510 112177 112500 gene locus_tag LOCUS_55520 112177 112500 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414042.1 protein_id gnl|my_center|LOCUS_55520 112572 113543 gene locus_tag LOCUS_55530 112572 113543 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222872.1 protein_id gnl|my_center|LOCUS_55530 114851 113700 gene locus_tag LOCUS_55540 114851 113700 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803896.1 protein_id gnl|my_center|LOCUS_55540 115742 115068 gene locus_tag LOCUS_55550 115742 115068 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031938971.1 protein_id gnl|my_center|LOCUS_55550 118102 115748 gene locus_tag LOCUS_55560 118102 115748 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173038923.1 protein_id gnl|my_center|LOCUS_55560 118668 118327 gene locus_tag LOCUS_55570 118668 118327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55570 118743 119126 gene locus_tag LOCUS_55580 118743 119126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55580 119129 120115 gene locus_tag LOCUS_55590 gene dhaK 119129 120115 CDS product dihydroxyacetone kinase subunit DhaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972071.1 protein_id gnl|my_center|LOCUS_55590 120171 120770 gene locus_tag LOCUS_55600 gene dhaL 120171 120770 CDS product dihydroxyacetone kinase subunit DhaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031416.1 protein_id gnl|my_center|LOCUS_55600 120763 121173 gene locus_tag LOCUS_55610 120763 121173 CDS product PTS fructose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164277346.1 protein_id gnl|my_center|LOCUS_55610 122057 121257 gene locus_tag LOCUS_55620 122057 121257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_55620 122407 123396 gene locus_tag LOCUS_55630 122407 123396 CDS product fibronectin type III domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031414.1 protein_id gnl|my_center|LOCUS_55630 123553 124098 gene locus_tag LOCUS_55640 123553 124098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030865689.1 protein_id gnl|my_center|LOCUS_55640 124646 124095 gene locus_tag LOCUS_55650 124646 124095 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972077.1 protein_id gnl|my_center|LOCUS_55650 126691 124676 gene locus_tag LOCUS_55660 126691 124676 CDS product NADPH-dependent 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031412.1 protein_id gnl|my_center|LOCUS_55660 127165 126794 gene locus_tag LOCUS_55670 127165 126794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031411.1 protein_id gnl|my_center|LOCUS_55670 128174 127269 gene locus_tag LOCUS_55680 128174 127269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031410.1 protein_id gnl|my_center|LOCUS_55680 128427 130511 gene locus_tag LOCUS_55690 128427 130511 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031409.1 protein_id gnl|my_center|LOCUS_55690 131310 130513 gene locus_tag LOCUS_55700 131310 130513 CDS product putative protein N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031408.1 protein_id gnl|my_center|LOCUS_55700 132580 131480 gene locus_tag LOCUS_55710 132580 131480 CDS product DUF3533 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031515.1 protein_id gnl|my_center|LOCUS_55710 132743 133168 gene locus_tag LOCUS_55720 132743 133168 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972083.1 protein_id gnl|my_center|LOCUS_55720 133184 133831 gene locus_tag LOCUS_55730 133184 133831 CDS product sulfite oxidase-like oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031407.1 protein_id gnl|my_center|LOCUS_55730 133824 134582 gene locus_tag LOCUS_55740 133824 134582 CDS product ferredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030865676.1 protein_id gnl|my_center|LOCUS_55740 134752 135336 gene locus_tag LOCUS_55750 134752 135336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972086.1 protein_id gnl|my_center|LOCUS_55750 135574 136563 gene locus_tag LOCUS_55760 135574 136563 CDS product acetylxylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972087.1 protein_id gnl|my_center|LOCUS_55760 137266 136547 gene locus_tag LOCUS_55770 137266 136547 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972089.1 protein_id gnl|my_center|LOCUS_55770 137666 138808 gene locus_tag LOCUS_55780 gene rho 137666 138808 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972093.1 protein_id gnl|my_center|LOCUS_55780 138925 140088 gene locus_tag LOCUS_55790 138925 140088 CDS product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162483876.1 protein_id gnl|my_center|LOCUS_55790 141126 140218 gene locus_tag LOCUS_55800 141126 140218 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030054.1 protein_id gnl|my_center|LOCUS_55800 141237 142073 gene locus_tag LOCUS_55810 141237 142073 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030055.1 protein_id gnl|my_center|LOCUS_55810 143099 142083 gene locus_tag LOCUS_55820 143099 142083 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224034.1 protein_id gnl|my_center|LOCUS_55820 143832 143131 gene locus_tag LOCUS_55830 143832 143131 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224036.1 protein_id gnl|my_center|LOCUS_55830 144181 145227 gene locus_tag LOCUS_55840 144181 145227 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972096.1 protein_id gnl|my_center|LOCUS_55840 145600 145262 gene locus_tag LOCUS_55850 145600 145262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55850 146103 145627 gene locus_tag LOCUS_55860 146103 145627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55860 146547 146257 gene locus_tag LOCUS_55870 146547 146257 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327912.1 protein_id gnl|my_center|LOCUS_55870 146686 147099 gene locus_tag LOCUS_55880 146686 147099 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972102.1 protein_id gnl|my_center|LOCUS_55880 147497 147096 gene locus_tag LOCUS_55890 147497 147096 CDS product SseB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972103.1 protein_id gnl|my_center|LOCUS_55890 147752 149515 gene locus_tag LOCUS_55900 147752 149515 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229240.1 protein_id gnl|my_center|LOCUS_55900 149534 149884 gene locus_tag LOCUS_55910 149534 149884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55910 149881 150939 gene locus_tag LOCUS_55920 149881 150939 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226239.1 protein_id gnl|my_center|LOCUS_55920 151048 152493 gene locus_tag LOCUS_55930 151048 152493 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972104.1 protein_id gnl|my_center|LOCUS_55930 152581 153213 gene locus_tag LOCUS_55940 152581 153213 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030864062.1 protein_id gnl|my_center|LOCUS_55940 154729 153275 gene locus_tag LOCUS_55950 154729 153275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55950 154900 155385 gene locus_tag LOCUS_55960 154900 155385 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862546.1 protein_id gnl|my_center|LOCUS_55960 156071 155454 gene locus_tag LOCUS_55970 156071 155454 CDS product TetR-like C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030557.1 protein_id gnl|my_center|LOCUS_55970 156187 157275 gene locus_tag LOCUS_55980 156187 157275 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529023.1 protein_id gnl|my_center|LOCUS_55980 158452 157694 gene locus_tag LOCUS_55990 158452 157694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55990 158337 158618 gene locus_tag LOCUS_56000 158337 158618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56000 159664 158603 gene locus_tag LOCUS_56010 159664 158603 CDS product DUF1996 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031031.1 protein_id gnl|my_center|LOCUS_56010 159800 160168 gene locus_tag LOCUS_56020 159800 160168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56020 160230 160622 gene locus_tag LOCUS_56030 160230 160622 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977977.1 protein_id gnl|my_center|LOCUS_56030 160635 161279 gene locus_tag LOCUS_56040 160635 161279 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027414.1 protein_id gnl|my_center|LOCUS_56040 162888 161332 gene locus_tag LOCUS_56050 162888 161332 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027415.1 protein_id gnl|my_center|LOCUS_56050 162909 163313 gene locus_tag LOCUS_56060 gene trxA 162909 163313 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027416.1 protein_id gnl|my_center|LOCUS_56060 164431 163430 gene locus_tag LOCUS_56070 164431 163430 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027417.1 protein_id gnl|my_center|LOCUS_56070 165161 164460 gene locus_tag LOCUS_56080 165161 164460 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027418.1 protein_id gnl|my_center|LOCUS_56080 165278 165841 gene locus_tag LOCUS_56090 165278 165841 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977971.1 protein_id gnl|my_center|LOCUS_56090 166809 165904 gene locus_tag LOCUS_56100 166809 165904 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977970.1 protein_id gnl|my_center|LOCUS_56100 166808 167164 gene locus_tag LOCUS_56110 166808 167164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56110 167926 167231 gene locus_tag LOCUS_56120 167926 167231 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027419.1 protein_id gnl|my_center|LOCUS_56120 168089 168880 gene locus_tag LOCUS_56130 168089 168880 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027420.1 protein_id gnl|my_center|LOCUS_56130 170888 168924 gene locus_tag LOCUS_56140 170888 168924 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027426.1 protein_id gnl|my_center|LOCUS_56140 171030 171908 gene locus_tag LOCUS_56150 171030 171908 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027427.1 protein_id gnl|my_center|LOCUS_56150 172353 171928 gene locus_tag LOCUS_56160 172353 171928 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977952.1 protein_id gnl|my_center|LOCUS_56160 173269 172385 gene locus_tag LOCUS_56170 173269 172385 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027435.1 protein_id gnl|my_center|LOCUS_56170 173544 174926 gene locus_tag LOCUS_56180 gene egtA 173544 174926 CDS product ergothioneine biosynthesis glutamate--cysteine ligase EgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027438.1 protein_id gnl|my_center|LOCUS_56180 174923 176242 gene locus_tag LOCUS_56190 gene egtB 174923 176242 CDS product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027439.1 protein_id gnl|my_center|LOCUS_56190 176242 177033 gene locus_tag LOCUS_56200 gene egtC 176242 177033 CDS product ergothioneine biosynthesis protein EgtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027440.1 protein_id gnl|my_center|LOCUS_56200 177030 177992 gene locus_tag LOCUS_56210 gene egtD 177030 177992 CDS product L-histidine N(alpha)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027441.1 protein_id gnl|my_center|LOCUS_56210 179298 178033 gene locus_tag LOCUS_56220 179298 178033 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027442.1 protein_id gnl|my_center|LOCUS_56220 179505 179726 gene locus_tag LOCUS_56230 179505 179726 CDS product dodecin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325534.1 protein_id gnl|my_center|LOCUS_56230 180248 179751 gene locus_tag LOCUS_56240 180248 179751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977943.1 protein_id gnl|my_center|LOCUS_56240 180327 181325 gene locus_tag LOCUS_56250 180327 181325 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027444.1 protein_id gnl|my_center|LOCUS_56250 181338 183722 gene locus_tag LOCUS_56260 181338 183722 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027445.1 protein_id gnl|my_center|LOCUS_56260 184659 183751 gene locus_tag LOCUS_56270 184659 183751 CDS product PRC and DUF2382 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027446.1 protein_id gnl|my_center|LOCUS_56270 185562 184732 gene locus_tag LOCUS_56280 185562 184732 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027447.1 protein_id gnl|my_center|LOCUS_56280 186329 185559 gene locus_tag LOCUS_56290 186329 185559 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977938.1 protein_id gnl|my_center|LOCUS_56290 187415 186666 gene locus_tag LOCUS_56300 187415 186666 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027448.1 protein_id gnl|my_center|LOCUS_56300 189361 187412 gene locus_tag LOCUS_56310 189361 187412 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977936.1 protein_id gnl|my_center|LOCUS_56310 190035 189364 gene locus_tag LOCUS_56320 190035 189364 CDS product succinate dehydrogenase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325539.1 protein_id gnl|my_center|LOCUS_56320 190114 191040 gene locus_tag LOCUS_56330 190114 191040 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977934.1 protein_id gnl|my_center|LOCUS_56330 193334 191184 gene locus_tag LOCUS_56340 gene rmdA 193334 191184 CDS product cyclic Di-GMP phosphodiesterase RmdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027451.1 protein_id gnl|my_center|LOCUS_56340 194143 193331 gene locus_tag LOCUS_56350 194143 193331 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027452.1 protein_id gnl|my_center|LOCUS_56350 195353 194412 gene locus_tag LOCUS_56360 195353 194412 CDS product SCO0930 family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027453.1 protein_id gnl|my_center|LOCUS_56360 196153 195629 gene locus_tag LOCUS_56370 196153 195629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56370 196324 197088 gene locus_tag LOCUS_56380 196324 197088 CDS product DUF4239 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977928.1 protein_id gnl|my_center|LOCUS_56380 197266 197895 gene locus_tag LOCUS_56390 197266 197895 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977927.1 protein_id gnl|my_center|LOCUS_56390 198485 198000 gene locus_tag LOCUS_56400 198485 198000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325544.1 protein_id gnl|my_center|LOCUS_56400 198817 199482 gene locus_tag LOCUS_56410 198817 199482 CDS product class F sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027455.1 protein_id gnl|my_center|LOCUS_56410 200331 199516 gene locus_tag LOCUS_56420 200331 199516 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868999.1 protein_id gnl|my_center|LOCUS_56420 200487 200951 gene locus_tag LOCUS_56430 200487 200951 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977923.1 protein_id gnl|my_center|LOCUS_56430 202127 200976 gene locus_tag LOCUS_56440 202127 200976 CDS product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977919.1 protein_id gnl|my_center|LOCUS_56440 202356 202901 gene locus_tag LOCUS_56450 202356 202901 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977918.1 protein_id gnl|my_center|LOCUS_56450 203048 203551 gene locus_tag LOCUS_56460 203048 203551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977917.1 protein_id gnl|my_center|LOCUS_56460 203746 204396 gene locus_tag LOCUS_56470 203746 204396 CDS product zf-HC2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977916.1 protein_id gnl|my_center|LOCUS_56470 205270 204407 gene locus_tag LOCUS_56480 205270 204407 CDS product Fpg/Nei family DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027460.1 protein_id gnl|my_center|LOCUS_56480 207397 205313 gene locus_tag LOCUS_56490 207397 205313 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975145.1 protein_id gnl|my_center|LOCUS_56490 207502 208923 gene locus_tag LOCUS_56500 207502 208923 CDS product lipase maturation factor family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977913.1 protein_id gnl|my_center|LOCUS_56500 210166 208991 gene locus_tag LOCUS_56510 210166 208991 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223734.1 protein_id gnl|my_center|LOCUS_56510 210918 210163 gene locus_tag LOCUS_56520 210918 210163 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027048.1 protein_id gnl|my_center|LOCUS_56520 212255 210915 gene locus_tag LOCUS_56530 212255 210915 CDS product L-fuconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039138.1 protein_id gnl|my_center|LOCUS_56530 212455 213180 gene locus_tag LOCUS_56540 212455 213180 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224957.1 protein_id gnl|my_center|LOCUS_56540 216200 213186 gene locus_tag LOCUS_56550 216200 213186 CDS product glycoside hydrolase family 38 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027462.1 protein_id gnl|my_center|LOCUS_56550 215773 215867 gene locus_tag LOCUS_t00890 215773 215867 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 216380 217723 gene locus_tag LOCUS_56560 216380 217723 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406369.1 protein_id gnl|my_center|LOCUS_56560 218266 217784 gene locus_tag LOCUS_56570 218266 217784 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027466.1 protein_id gnl|my_center|LOCUS_56570 218495 218322 gene locus_tag LOCUS_56580 218495 218322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027467.1 protein_id gnl|my_center|LOCUS_56580 220405 218903 gene locus_tag LOCUS_56590 220405 218903 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977903.1 protein_id gnl|my_center|LOCUS_56590 221851 220511 gene locus_tag LOCUS_56600 221851 220511 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027469.1 protein_id gnl|my_center|LOCUS_56600 224681 222072 gene locus_tag LOCUS_56610 224681 222072 CDS product glycoside hydrolase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027471.1 protein_id gnl|my_center|LOCUS_56610 226063 224864 gene locus_tag LOCUS_56620 gene glgC 226063 224864 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027472.1 protein_id gnl|my_center|LOCUS_56620 227299 226139 gene locus_tag LOCUS_56630 gene glgA 227299 226139 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027473.1 protein_id gnl|my_center|LOCUS_56630 227599 228741 gene locus_tag LOCUS_56640 227599 228741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56640 230125 228731 gene locus_tag LOCUS_56650 230125 228731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56650 230513 231952 gene locus_tag LOCUS_56660 gene gndA 230513 231952 CDS product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027484.1 protein_id gnl|my_center|LOCUS_56660 232395 232099 gene locus_tag LOCUS_56670 232395 232099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56670 232944 232594 gene locus_tag LOCUS_56680 232944 232594 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977882.1 protein_id gnl|my_center|LOCUS_56680 233398 232964 gene locus_tag LOCUS_56690 233398 232964 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027487.1 protein_id gnl|my_center|LOCUS_56690 233805 233488 gene locus_tag LOCUS_56700 233805 233488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56700 >Feature sequence14 138 758 gene locus_tag LOCUS_56710 138 758 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972709.1 protein_id gnl|my_center|LOCUS_56710 2203 815 gene locus_tag LOCUS_56720 2203 815 CDS product mercuric reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946005.1 protein_id gnl|my_center|LOCUS_56720 2461 4479 gene locus_tag LOCUS_56730 2461 4479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56730 7804 4460 gene locus_tag LOCUS_56740 7804 4460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56740 8638 8069 gene locus_tag LOCUS_56750 8638 8069 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528041.1 protein_id gnl|my_center|LOCUS_56750 9914 8640 gene locus_tag LOCUS_56760 9914 8640 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729017.1 protein_id gnl|my_center|LOCUS_56760 10595 9987 gene locus_tag LOCUS_56770 10595 9987 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895563.1 protein_id gnl|my_center|LOCUS_56770 11688 10819 gene locus_tag LOCUS_56780 11688 10819 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228409.1 protein_id gnl|my_center|LOCUS_56780 12475 11756 gene locus_tag LOCUS_56790 12475 11756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162139575.1 protein_id gnl|my_center|LOCUS_56790 13348 12506 gene locus_tag LOCUS_56800 13348 12506 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731568.1 protein_id gnl|my_center|LOCUS_56800 56389 13559 gene locus_tag LOCUS_56810 56389 13559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56810 54672 54766 gene locus_tag LOCUS_t00900 54672 54766 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 56722 56393 gene locus_tag LOCUS_56820 56722 56393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56820 57125 56715 gene locus_tag LOCUS_56830 57125 56715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56830 60922 57176 gene locus_tag LOCUS_56840 60922 57176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56840 57595 57677 gene locus_tag LOCUS_t00910 57595 57677 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 61411 60968 gene locus_tag LOCUS_56850 61411 60968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56850 61806 61492 gene locus_tag LOCUS_56860 61806 61492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56860 62234 61848 gene locus_tag LOCUS_56870 62234 61848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56870 64000 62498 gene locus_tag LOCUS_56880 gene eccB 64000 62498 CDS product type VII secretion protein EccB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224123.1 protein_id gnl|my_center|LOCUS_56880 65414 64020 gene locus_tag LOCUS_56890 gene eccD 65414 64020 CDS product type VII secretion integral membrane protein EccD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224120.1 protein_id gnl|my_center|LOCUS_56890 65847 69836 gene locus_tag LOCUS_56900 65847 69836 CDS product type VII secretion protein EccC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030426.1 protein_id gnl|my_center|LOCUS_56900 71282 70068 gene locus_tag LOCUS_56910 71282 70068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56910 71736 74891 gene locus_tag LOCUS_56920 71736 74891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56920 74985 76439 gene locus_tag LOCUS_56930 74985 76439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56930 76867 77481 gene locus_tag LOCUS_56940 76867 77481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56940 77753 78856 gene locus_tag LOCUS_56950 gene rsgA 77753 78856 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030687.1 protein_id gnl|my_center|LOCUS_56950 79002 80342 gene locus_tag LOCUS_56960 79002 80342 CDS product AlkA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030688.1 protein_id gnl|my_center|LOCUS_56960 80347 80916 gene locus_tag LOCUS_56970 80347 80916 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030689.1 protein_id gnl|my_center|LOCUS_56970 81324 80842 gene locus_tag LOCUS_56980 81324 80842 CDS product DUF456 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030690.1 protein_id gnl|my_center|LOCUS_56980 82540 81557 gene locus_tag LOCUS_56990 82540 81557 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030691.1 protein_id gnl|my_center|LOCUS_56990 82779 84191 gene locus_tag LOCUS_57000 82779 84191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_57000 84258 86000 gene locus_tag LOCUS_57010 84258 86000 CDS product pyruvate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030693.1 protein_id gnl|my_center|LOCUS_57010 86044 86604 gene locus_tag LOCUS_57020 86044 86604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57020 87693 86644 gene locus_tag LOCUS_57030 87693 86644 CDS product DUF2637 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030695.1 protein_id gnl|my_center|LOCUS_57030 88817 87972 gene locus_tag LOCUS_57040 88817 87972 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030696.1 protein_id gnl|my_center|LOCUS_57040 88986 89777 gene locus_tag LOCUS_57050 88986 89777 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030697.1 protein_id gnl|my_center|LOCUS_57050 90589 89807 gene locus_tag LOCUS_57060 90589 89807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972756.1 protein_id gnl|my_center|LOCUS_57060 92418 90727 gene locus_tag LOCUS_57070 92418 90727 CDS product PucR family transcriptional regulator ligand-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030705.1 protein_id gnl|my_center|LOCUS_57070 92705 93592 gene locus_tag LOCUS_57080 92705 93592 CDS product FAD binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030706.1 protein_id gnl|my_center|LOCUS_57080 93592 94101 gene locus_tag LOCUS_57090 93592 94101 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030707.1 protein_id gnl|my_center|LOCUS_57090 94104 96488 gene locus_tag LOCUS_57100 94104 96488 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030708.1 protein_id gnl|my_center|LOCUS_57100 96620 98077 gene locus_tag LOCUS_57110 96620 98077 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030709.1 protein_id gnl|my_center|LOCUS_57110 98131 99270 gene locus_tag LOCUS_57120 98131 99270 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030710.1 protein_id gnl|my_center|LOCUS_57120 99724 99284 gene locus_tag LOCUS_57130 99724 99284 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030713.1 protein_id gnl|my_center|LOCUS_57130 99859 100836 gene locus_tag LOCUS_57140 99859 100836 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030715.1 protein_id gnl|my_center|LOCUS_57140 100977 102620 gene locus_tag LOCUS_57150 100977 102620 CDS product carbamoyltransferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226120.1 protein_id gnl|my_center|LOCUS_57150 102617 103636 gene locus_tag LOCUS_57160 102617 103636 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030717.1 protein_id gnl|my_center|LOCUS_57160 103633 104247 gene locus_tag LOCUS_57170 103633 104247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_57170 104244 105239 gene locus_tag LOCUS_57180 104244 105239 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030719.1 protein_id gnl|my_center|LOCUS_57180 105236 106186 gene locus_tag LOCUS_57190 105236 106186 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030720.1 protein_id gnl|my_center|LOCUS_57190 106183 107400 gene locus_tag LOCUS_57200 106183 107400 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030721.1 protein_id gnl|my_center|LOCUS_57200 107400 108002 gene locus_tag LOCUS_57210 107400 108002 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030722.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_57210 107995 109365 gene locus_tag LOCUS_57220 gene rfaE2 107995 109365 CDS product D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270276.1 protein_id gnl|my_center|LOCUS_57220 109362 110333 gene locus_tag LOCUS_57230 109362 110333 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162483893.1 protein_id gnl|my_center|LOCUS_57230 110330 111244 gene locus_tag LOCUS_57240 110330 111244 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030725.1 protein_id gnl|my_center|LOCUS_57240 111241 112137 gene locus_tag LOCUS_57250 111241 112137 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030726.1 protein_id gnl|my_center|LOCUS_57250 112461 112153 gene locus_tag LOCUS_57260 112461 112153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57260 113404 112523 gene locus_tag LOCUS_57270 113404 112523 CDS product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030727.1 protein_id gnl|my_center|LOCUS_57270 113521 114624 gene locus_tag LOCUS_57280 113521 114624 CDS product winged helix DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030728.1 protein_id gnl|my_center|LOCUS_57280 114713 116383 gene locus_tag LOCUS_57290 gene ibuL 114713 116383 CDS product isobutyrate:CoA ligase IbuL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030731.1 protein_id gnl|my_center|LOCUS_57290 116380 117963 gene locus_tag LOCUS_57300 gene lbuL 116380 117963 CDS product linear/branched/unsaturated fatty acid:CoA ligase LbuL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030732.1 protein_id gnl|my_center|LOCUS_57300 118141 119925 gene locus_tag LOCUS_57310 gene gcl 118141 119925 CDS product glyoxylate carboligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030737.1 protein_id gnl|my_center|LOCUS_57310 120600 119989 gene locus_tag LOCUS_57320 120600 119989 CDS product TIGR04222 domain-containing membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030738.1 protein_id gnl|my_center|LOCUS_57320 122542 121085 gene locus_tag LOCUS_57330 122542 121085 CDS product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972723.1 protein_id gnl|my_center|LOCUS_57330 123615 122725 gene locus_tag LOCUS_57340 123615 122725 CDS product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972722.1 protein_id gnl|my_center|LOCUS_57340 124487 123648 gene locus_tag LOCUS_57350 124487 123648 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972721.1 protein_id gnl|my_center|LOCUS_57350 124624 124875 gene locus_tag LOCUS_57360 124624 124875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063646595.1 protein_id gnl|my_center|LOCUS_57360 124872 125240 gene locus_tag LOCUS_57370 124872 125240 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972719.1 protein_id gnl|my_center|LOCUS_57370 125392 125910 gene locus_tag LOCUS_57380 gene uraD 125392 125910 CDS product 2-oxo-4-hydroxy-4-carboxy-5-ureidoimidazoline decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030740.1 protein_id gnl|my_center|LOCUS_57380 125907 126305 gene locus_tag LOCUS_57390 gene uraH 125907 126305 CDS product hydroxyisourate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030741.1 protein_id gnl|my_center|LOCUS_57390 126312 127235 gene locus_tag LOCUS_57400 gene pucL 126312 127235 CDS product urate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972716.1 protein_id gnl|my_center|LOCUS_57400 127299 128714 gene locus_tag LOCUS_57410 127299 128714 CDS product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972715.1 protein_id gnl|my_center|LOCUS_57410 128756 130135 gene locus_tag LOCUS_57420 128756 130135 CDS product 8-oxoguanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030742.1 protein_id gnl|my_center|LOCUS_57420 130409 131758 gene locus_tag LOCUS_57430 130409 131758 CDS product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972712.1 protein_id gnl|my_center|LOCUS_57430 132330 131905 gene locus_tag LOCUS_57440 132330 131905 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030744.1 protein_id gnl|my_center|LOCUS_57440 133030 132389 gene locus_tag LOCUS_57450 133030 132389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030745.1 protein_id gnl|my_center|LOCUS_57450 133678 133079 gene locus_tag LOCUS_57460 133678 133079 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972709.1 protein_id gnl|my_center|LOCUS_57460 134175 133774 gene locus_tag LOCUS_57470 134175 133774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57470 136475 134217 gene locus_tag LOCUS_57480 136475 134217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57480 137788 136580 gene locus_tag LOCUS_57490 137788 136580 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972705.1 protein_id gnl|my_center|LOCUS_57490 137813 138502 gene locus_tag LOCUS_57500 137813 138502 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972704.1 protein_id gnl|my_center|LOCUS_57500 139311 138535 gene locus_tag LOCUS_57510 139311 138535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972703.1 protein_id gnl|my_center|LOCUS_57510 140579 139311 gene locus_tag LOCUS_57520 140579 139311 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030748.1 protein_id gnl|my_center|LOCUS_57520 142133 140628 gene locus_tag LOCUS_57530 142133 140628 CDS product IucA/IucC family siderophore biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030749.1 protein_id gnl|my_center|LOCUS_57530 142277 143809 gene locus_tag LOCUS_57540 142277 143809 CDS product IucA/IucC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030750.1 protein_id gnl|my_center|LOCUS_57540 144103 145776 gene locus_tag LOCUS_57550 144103 145776 CDS product BBE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020640551.1 protein_id gnl|my_center|LOCUS_57550 145957 147240 gene locus_tag LOCUS_57560 145957 147240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57560 147279 148409 gene locus_tag LOCUS_57570 147279 148409 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804460.1 protein_id gnl|my_center|LOCUS_57570 148406 149566 gene locus_tag LOCUS_57580 148406 149566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57580 149568 150344 gene locus_tag LOCUS_57590 149568 150344 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067764.1 protein_id gnl|my_center|LOCUS_57590 150341 151198 gene locus_tag LOCUS_57600 150341 151198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57600 151195 151872 gene locus_tag LOCUS_57610 151195 151872 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972881.1 protein_id gnl|my_center|LOCUS_57610 151921 153159 gene locus_tag LOCUS_57620 151921 153159 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224733.1 protein_id gnl|my_center|LOCUS_57620 153302 154141 gene locus_tag LOCUS_57630 153302 154141 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224371.1 protein_id gnl|my_center|LOCUS_57630 155205 154315 gene locus_tag LOCUS_57640 155205 154315 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226009.1 protein_id gnl|my_center|LOCUS_57640 156267 155308 gene locus_tag LOCUS_57650 156267 155308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57650 156890 156264 gene locus_tag LOCUS_57660 156890 156264 CDS product ScbR family autoregulator-binding transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972660.1 protein_id gnl|my_center|LOCUS_57660 157038 158012 gene locus_tag LOCUS_57670 gene scbA 157038 158012 CDS product gamma-butyrolactone biosynthesis protein ScbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972659.1 protein_id gnl|my_center|LOCUS_57670 158031 159416 gene locus_tag LOCUS_57680 158031 159416 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186025.1 protein_id gnl|my_center|LOCUS_57680 159505 159951 gene locus_tag LOCUS_57690 159505 159951 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973561.1 protein_id gnl|my_center|LOCUS_57690 160039 160581 gene locus_tag LOCUS_57700 160039 160581 CDS product cold shock domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030920.1 protein_id gnl|my_center|LOCUS_57700 161290 162204 gene locus_tag LOCUS_57710 161290 162204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972685.1 protein_id gnl|my_center|LOCUS_57710 162201 162494 gene locus_tag LOCUS_57720 162201 162494 CDS product SelT/SelW/SelH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812024.1 protein_id gnl|my_center|LOCUS_57720 164121 162499 gene locus_tag LOCUS_57730 gene aceB 164121 162499 CDS product malate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030763.1 protein_id gnl|my_center|LOCUS_57730 164884 164306 gene locus_tag LOCUS_57740 164884 164306 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030764.1 protein_id gnl|my_center|LOCUS_57740 165108 165425 gene locus_tag LOCUS_57750 165108 165425 CDS product DUF5955 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972682.1 protein_id gnl|my_center|LOCUS_57750 166407 165601 gene locus_tag LOCUS_57760 gene allR 166407 165601 CDS product allantoin degradation transcriptional regulator AllR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972681.1 protein_id gnl|my_center|LOCUS_57760 166693 168030 gene locus_tag LOCUS_57770 gene allB 166693 168030 CDS product allantoinase AllB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972680.1 protein_id gnl|my_center|LOCUS_57770 168272 169387 gene locus_tag LOCUS_57780 gene alc 168272 169387 CDS product allantoicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030765.1 protein_id gnl|my_center|LOCUS_57780 169541 170368 gene locus_tag LOCUS_57790 169541 170368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57790 170873 170478 gene locus_tag LOCUS_57800 170873 170478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57800 171215 171015 gene locus_tag LOCUS_57810 171215 171015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030769.1 protein_id gnl|my_center|LOCUS_57810 171395 172648 gene locus_tag LOCUS_57820 171395 172648 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030770.1 protein_id gnl|my_center|LOCUS_57820 172709 173389 gene locus_tag LOCUS_57830 172709 173389 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030771.1 protein_id gnl|my_center|LOCUS_57830 174533 173457 gene locus_tag LOCUS_57840 174533 173457 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972671.1 protein_id gnl|my_center|LOCUS_57840 174593 175357 gene locus_tag LOCUS_57850 174593 175357 CDS product myo-inositol degradation transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030772.1 protein_id gnl|my_center|LOCUS_57850 175547 176551 gene locus_tag LOCUS_57860 175547 176551 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030773.1 protein_id gnl|my_center|LOCUS_57860 176548 177588 gene locus_tag LOCUS_57870 176548 177588 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972668.1 protein_id gnl|my_center|LOCUS_57870 177585 178376 gene locus_tag LOCUS_57880 177585 178376 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030774.1 protein_id gnl|my_center|LOCUS_57880 178638 179786 gene locus_tag LOCUS_57890 178638 179786 CDS product ROK family glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030775.1 protein_id gnl|my_center|LOCUS_57890 179783 180364 gene locus_tag LOCUS_57900 179783 180364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972665.1 protein_id gnl|my_center|LOCUS_57900 180459 183308 gene locus_tag LOCUS_57910 180459 183308 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030777.1 protein_id gnl|my_center|LOCUS_57910 183305 185494 gene locus_tag LOCUS_57920 183305 185494 CDS product SWIM zinc finger family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030778.1 protein_id gnl|my_center|LOCUS_57920 185695 187575 gene locus_tag LOCUS_57930 185695 187575 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030802.1 protein_id gnl|my_center|LOCUS_57930 188162 187596 gene locus_tag LOCUS_57940 188162 187596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57940 189181 188174 gene locus_tag LOCUS_57950 189181 188174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57950 189726 189211 gene locus_tag LOCUS_57960 189726 189211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57960 190032 193769 gene locus_tag LOCUS_57970 190032 193769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57970 194643 193813 gene locus_tag LOCUS_57980 194643 193813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57980 196713 194797 gene locus_tag LOCUS_57990 196713 194797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57990 197672 196887 gene locus_tag LOCUS_58000 197672 196887 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027507.1 protein_id gnl|my_center|LOCUS_58000 198787 197669 gene locus_tag LOCUS_58010 198787 197669 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209211630.1 protein_id gnl|my_center|LOCUS_58010 199809 198784 gene locus_tag LOCUS_58020 199809 198784 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027505.1 protein_id gnl|my_center|LOCUS_58020 200874 200125 gene locus_tag LOCUS_58030 200874 200125 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027504.1 protein_id gnl|my_center|LOCUS_58030 202001 200871 gene locus_tag LOCUS_58040 202001 200871 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027503.1 protein_id gnl|my_center|LOCUS_58040 203346 202105 gene locus_tag LOCUS_58050 203346 202105 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027502.1 protein_id gnl|my_center|LOCUS_58050 204365 203343 gene locus_tag LOCUS_58060 204365 203343 CDS product cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027501.1 protein_id gnl|my_center|LOCUS_58060 205507 204362 gene locus_tag LOCUS_58070 205507 204362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027500.1 protein_id gnl|my_center|LOCUS_58070 206006 206992 gene locus_tag LOCUS_58080 206006 206992 CDS product ferric reductase-like transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027499.1 protein_id gnl|my_center|LOCUS_58080 207200 207355 gene locus_tag LOCUS_58090 207200 207355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58090 207730 207551 gene locus_tag LOCUS_58100 207730 207551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58100 207934 207755 gene locus_tag LOCUS_58110 207934 207755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58110 208183 209430 gene locus_tag LOCUS_58120 208183 209430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58120 210348 209464 gene locus_tag LOCUS_58130 210348 209464 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226908.1 protein_id gnl|my_center|LOCUS_58130 210434 210925 gene locus_tag LOCUS_58140 210434 210925 CDS product winged helix DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093954200.1 protein_id gnl|my_center|LOCUS_58140 211119 212063 gene locus_tag LOCUS_58150 211119 212063 CDS product C45 family autoproteolytic acyltransferase/hydolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024312247.1 protein_id gnl|my_center|LOCUS_58150 212701 212177 gene locus_tag LOCUS_58160 212701 212177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58160 213471 212815 gene locus_tag LOCUS_58170 213471 212815 CDS product lytic polysaccharide monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027267.1 protein_id gnl|my_center|LOCUS_58170 215982 213649 gene locus_tag LOCUS_58180 215982 213649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58180 216596 217780 gene locus_tag LOCUS_58190 216596 217780 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229571.1 protein_id gnl|my_center|LOCUS_58190 217876 219615 gene locus_tag LOCUS_58200 gene malL 217876 219615 CDS product oligo-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415207.1 protein_id gnl|my_center|LOCUS_58200 219659 220975 gene locus_tag LOCUS_58210 219659 220975 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803805.1 protein_id gnl|my_center|LOCUS_58210 221083 221976 gene locus_tag LOCUS_58220 221083 221976 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803806.1 protein_id gnl|my_center|LOCUS_58220 221979 222902 gene locus_tag LOCUS_58230 221979 222902 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803807.1 protein_id gnl|my_center|LOCUS_58230 223278 223027 gene locus_tag LOCUS_58240 223278 223027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58240 223639 223484 gene locus_tag LOCUS_58250 223639 223484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58250 223575 223871 gene locus_tag LOCUS_58260 223575 223871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58260 >Feature sequence15 139 723 gene locus_tag LOCUS_58270 139 723 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972709.1 protein_id gnl|my_center|LOCUS_58270 782 2248 gene locus_tag LOCUS_58280 782 2248 CDS product membrane-associated oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485705.1 protein_id gnl|my_center|LOCUS_58280 4025 2235 gene locus_tag LOCUS_58290 4025 2235 CDS product sugar phosphate isomerase/epimerase and 4-hydroxyphenylpyruvate domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226206.1 protein_id gnl|my_center|LOCUS_58290 4948 4073 gene locus_tag LOCUS_58300 4948 4073 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226205.1 protein_id gnl|my_center|LOCUS_58300 5081 5746 gene locus_tag LOCUS_58310 5081 5746 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226204.1 protein_id gnl|my_center|LOCUS_58310 5868 7220 gene locus_tag LOCUS_58320 5868 7220 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226203.1 protein_id gnl|my_center|LOCUS_58320 7689 7246 gene locus_tag LOCUS_58330 7689 7246 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730357.1 protein_id gnl|my_center|LOCUS_58330 7816 9045 gene locus_tag LOCUS_58340 7816 9045 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031081.1 protein_id gnl|my_center|LOCUS_58340 10354 9110 gene locus_tag LOCUS_58350 10354 9110 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031072.1 protein_id gnl|my_center|LOCUS_58350 12138 10351 gene locus_tag LOCUS_58360 12138 10351 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031071.1 protein_id gnl|my_center|LOCUS_58360 13641 12142 gene locus_tag LOCUS_58370 13641 12142 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031070.1 protein_id gnl|my_center|LOCUS_58370 14264 13728 gene locus_tag LOCUS_58380 14264 13728 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031069.1 protein_id gnl|my_center|LOCUS_58380 14486 14292 gene locus_tag LOCUS_58390 14486 14292 CDS product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976560.1 protein_id gnl|my_center|LOCUS_58390 15304 14483 gene locus_tag LOCUS_58400 15304 14483 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031055.1 protein_id gnl|my_center|LOCUS_58400 17273 15402 gene locus_tag LOCUS_58410 17273 15402 CDS product discoidin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227075.1 protein_id gnl|my_center|LOCUS_58410 18765 17404 gene locus_tag LOCUS_58420 18765 17404 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093457391.1 protein_id gnl|my_center|LOCUS_58420 19634 18795 gene locus_tag LOCUS_58430 19634 18795 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972375.1 protein_id gnl|my_center|LOCUS_58430 20679 19675 gene locus_tag LOCUS_58440 20679 19675 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031035.1 protein_id gnl|my_center|LOCUS_58440 22001 20685 gene locus_tag LOCUS_58450 22001 20685 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972377.1 protein_id gnl|my_center|LOCUS_58450 22233 24047 gene locus_tag LOCUS_58460 22233 24047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031030.1 protein_id gnl|my_center|LOCUS_58460 26433 24178 gene locus_tag LOCUS_58470 gene fusA 26433 24178 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031026.1 protein_id gnl|my_center|LOCUS_58470 27286 26456 gene locus_tag LOCUS_58480 27286 26456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58480 28021 27515 gene locus_tag LOCUS_58490 28021 27515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58490 30011 28278 gene locus_tag LOCUS_58500 30011 28278 CDS product diadenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_150790356.1 protein_id gnl|my_center|LOCUS_58500 30712 30077 gene locus_tag LOCUS_58510 30712 30077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58510 31596 30709 gene locus_tag LOCUS_58520 31596 30709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58520 32159 31746 gene locus_tag LOCUS_58530 32159 31746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58530 32546 32459 gene locus_tag LOCUS_t00920 32546 32459 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 32885 34567 gene locus_tag LOCUS_58540 32885 34567 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972394.1 protein_id gnl|my_center|LOCUS_58540 34580 35812 gene locus_tag LOCUS_58550 gene frc 34580 35812 CDS product formyl-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972395.1 protein_id gnl|my_center|LOCUS_58550 35814 37967 gene locus_tag LOCUS_58560 35814 37967 CDS product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031021.1 protein_id gnl|my_center|LOCUS_58560 38084 39472 gene locus_tag LOCUS_58570 38084 39472 CDS product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327784.1 protein_id gnl|my_center|LOCUS_58570 40814 39606 gene locus_tag LOCUS_58580 40814 39606 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921962.1 protein_id gnl|my_center|LOCUS_58580 42308 40920 gene locus_tag LOCUS_58590 42308 40920 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031019.1 protein_id gnl|my_center|LOCUS_58590 43474 42305 gene locus_tag LOCUS_58600 gene eboE 43474 42305 CDS product metabolite traffic protein EboE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031018.1 protein_id gnl|my_center|LOCUS_58600 44326 43478 gene locus_tag LOCUS_58610 44326 43478 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031017.1 protein_id gnl|my_center|LOCUS_58610 45048 44326 gene locus_tag LOCUS_58620 45048 44326 CDS product EboA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031016.1 protein_id gnl|my_center|LOCUS_58620 46031 45045 gene locus_tag LOCUS_58630 46031 45045 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031015.1 protein_id gnl|my_center|LOCUS_58630 47341 46028 gene locus_tag LOCUS_58640 47341 46028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58640 48639 47356 gene locus_tag LOCUS_58650 48639 47356 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031013.1 protein_id gnl|my_center|LOCUS_58650 52519 48812 gene locus_tag LOCUS_58660 52519 48812 CDS product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031012.1 protein_id gnl|my_center|LOCUS_58660 53611 52613 gene locus_tag LOCUS_58670 53611 52613 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972408.1 protein_id gnl|my_center|LOCUS_58670 55100 53628 gene locus_tag LOCUS_58680 55100 53628 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031011.1 protein_id gnl|my_center|LOCUS_58680 56236 55184 gene locus_tag LOCUS_58690 56236 55184 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972410.1 protein_id gnl|my_center|LOCUS_58690 57273 56254 gene locus_tag LOCUS_58700 57273 56254 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972411.1 protein_id gnl|my_center|LOCUS_58700 58787 57270 gene locus_tag LOCUS_58710 58787 57270 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972412.1 protein_id gnl|my_center|LOCUS_58710 60294 59104 gene locus_tag LOCUS_58720 60294 59104 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225823.1 protein_id gnl|my_center|LOCUS_58720 61146 60463 gene locus_tag LOCUS_58730 61146 60463 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972414.1 protein_id gnl|my_center|LOCUS_58730 62235 61288 gene locus_tag LOCUS_58740 62235 61288 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031009.1 protein_id gnl|my_center|LOCUS_58740 62513 62379 gene locus_tag LOCUS_58750 62513 62379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58750 63999 62482 gene locus_tag LOCUS_58760 63999 62482 CDS product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972416.1 protein_id gnl|my_center|LOCUS_58760 64088 64921 gene locus_tag LOCUS_58770 gene fdhD 64088 64921 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031006.1 protein_id gnl|my_center|LOCUS_58770 65984 64935 gene locus_tag LOCUS_58780 65984 64935 CDS product bile acid:sodium symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972424.1 protein_id gnl|my_center|LOCUS_58780 66137 67021 gene locus_tag LOCUS_58790 66137 67021 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972425.1 protein_id gnl|my_center|LOCUS_58790 67976 66996 gene locus_tag LOCUS_58800 67976 66996 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031004.1 protein_id gnl|my_center|LOCUS_58800 68089 69606 gene locus_tag LOCUS_58810 68089 69606 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972427.1 protein_id gnl|my_center|LOCUS_58810 69817 71643 gene locus_tag LOCUS_58820 69817 71643 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972428.1 protein_id gnl|my_center|LOCUS_58820 71729 72565 gene locus_tag LOCUS_58830 71729 72565 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031003.1 protein_id gnl|my_center|LOCUS_58830 74470 72737 gene locus_tag LOCUS_58840 74470 72737 CDS product cellulose 1,4-beta-cellobiosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031002.1 protein_id gnl|my_center|LOCUS_58840 74724 77639 gene locus_tag LOCUS_58850 74724 77639 CDS product glycoside hydrolase family 48 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031000.1 protein_id gnl|my_center|LOCUS_58850 77740 80376 gene locus_tag LOCUS_58860 77740 80376 CDS product xyloglucanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030999.1 protein_id gnl|my_center|LOCUS_58860 82288 80420 gene locus_tag LOCUS_58870 82288 80420 CDS product rhamnogalacturonan lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030997.1 protein_id gnl|my_center|LOCUS_58870 83199 82459 gene locus_tag LOCUS_58880 83199 82459 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972438.1 protein_id gnl|my_center|LOCUS_58880 83652 83206 gene locus_tag LOCUS_58890 83652 83206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58890 83633 84454 gene locus_tag LOCUS_58900 83633 84454 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030996.1 protein_id gnl|my_center|LOCUS_58900 84906 84436 gene locus_tag LOCUS_58910 84906 84436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030995.1 protein_id gnl|my_center|LOCUS_58910 85029 85892 gene locus_tag LOCUS_58920 85029 85892 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972442.1 protein_id gnl|my_center|LOCUS_58920 85941 86738 gene locus_tag LOCUS_58930 85941 86738 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972443.1 protein_id gnl|my_center|LOCUS_58930 86818 90513 gene locus_tag LOCUS_58940 86818 90513 CDS product nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972444.1 protein_id gnl|my_center|LOCUS_58940 90513 92084 gene locus_tag LOCUS_58950 gene narH 90513 92084 CDS product nitrate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030994.1 protein_id gnl|my_center|LOCUS_58950 92084 92578 gene locus_tag LOCUS_58960 gene narJ 92084 92578 CDS product nitrate reductase molybdenum cofactor assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972446.1 protein_id gnl|my_center|LOCUS_58960 92575 93297 gene locus_tag LOCUS_58970 gene narI 92575 93297 CDS product respiratory nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030993.1 protein_id gnl|my_center|LOCUS_58970 95169 93307 gene locus_tag LOCUS_58980 gene dnaK 95169 93307 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975268.1 protein_id gnl|my_center|LOCUS_58980 95713 95288 gene locus_tag LOCUS_58990 95713 95288 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972448.1 protein_id gnl|my_center|LOCUS_58990 97171 95759 gene locus_tag LOCUS_59000 97171 95759 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030990.1 protein_id gnl|my_center|LOCUS_59000 99379 97256 gene locus_tag LOCUS_59010 99379 97256 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030989.1 protein_id gnl|my_center|LOCUS_59010 99882 99481 gene locus_tag LOCUS_59020 99882 99481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030988.1 protein_id gnl|my_center|LOCUS_59020 99965 100738 gene locus_tag LOCUS_59030 99965 100738 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972454.1 protein_id gnl|my_center|LOCUS_59030 100985 101356 gene locus_tag LOCUS_59040 100985 101356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_59040 102454 101396 gene locus_tag LOCUS_59050 102454 101396 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030985.1 protein_id gnl|my_center|LOCUS_59050 103695 102451 gene locus_tag LOCUS_59060 103695 102451 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485736.1 protein_id gnl|my_center|LOCUS_59060 104758 103832 gene locus_tag LOCUS_59070 104758 103832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59070 105283 105080 gene locus_tag LOCUS_59080 105283 105080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59080 105434 105823 gene locus_tag LOCUS_59090 105434 105823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59090 105836 106276 gene locus_tag LOCUS_59100 105836 106276 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027424.1 protein_id gnl|my_center|LOCUS_59100 106322 106861 gene locus_tag LOCUS_59110 106322 106861 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030978.1 protein_id gnl|my_center|LOCUS_59110 107265 106936 gene locus_tag LOCUS_59120 107265 106936 CDS product DUF6158 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030977.1 protein_id gnl|my_center|LOCUS_59120 107264 108382 gene locus_tag LOCUS_59130 107264 108382 CDS product Vms1/Ankzf1 family peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030976.1 protein_id gnl|my_center|LOCUS_59130 110042 108423 gene locus_tag LOCUS_59140 110042 108423 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030975.1 protein_id gnl|my_center|LOCUS_59140 110137 111627 gene locus_tag LOCUS_59150 110137 111627 CDS product bifunctional phosphatase PAP2/diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030974.1 protein_id gnl|my_center|LOCUS_59150 111755 112576 gene locus_tag LOCUS_59160 111755 112576 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030973.1 protein_id gnl|my_center|LOCUS_59160 112620 112790 gene locus_tag LOCUS_59170 112620 112790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59170 113101 112817 gene locus_tag LOCUS_59180 113101 112817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59180 113285 113103 gene locus_tag LOCUS_59190 113285 113103 CDS product gas vesicle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972471.1 protein_id gnl|my_center|LOCUS_59190 114070 113282 gene locus_tag LOCUS_59200 114070 113282 CDS product GvpL/GvpF family gas vesicle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030972.1 protein_id gnl|my_center|LOCUS_59200 114396 114067 gene locus_tag LOCUS_59210 114396 114067 CDS product gas vesicle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972473.1 protein_id gnl|my_center|LOCUS_59210 115622 114393 gene locus_tag LOCUS_59220 115622 114393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59220 116227 115622 gene locus_tag LOCUS_59230 116227 115622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59230 116487 116224 gene locus_tag LOCUS_59240 116487 116224 CDS product gas vesicle protein GvpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972476.1 protein_id gnl|my_center|LOCUS_59240 117268 116492 gene locus_tag LOCUS_59250 117268 116492 CDS product GvpL/GvpF family gas vesicle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972477.1 protein_id gnl|my_center|LOCUS_59250 117690 117265 gene locus_tag LOCUS_59260 117690 117265 CDS product gas vesicle structural protein GvpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030969.1 protein_id gnl|my_center|LOCUS_59260 118184 117738 gene locus_tag LOCUS_59270 118184 117738 CDS product gas vesicle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030968.1 protein_id gnl|my_center|LOCUS_59270 119178 118243 gene locus_tag LOCUS_59280 gene ligD 119178 118243 CDS product non-homologous end-joining DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030863172.1 protein_id gnl|my_center|LOCUS_59280 121022 119175 gene locus_tag LOCUS_59290 121022 119175 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030966.1 protein_id gnl|my_center|LOCUS_59290 121238 122191 gene locus_tag LOCUS_59300 121238 122191 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030964.1 protein_id gnl|my_center|LOCUS_59300 122767 122240 gene locus_tag LOCUS_59310 122767 122240 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162495280.1 protein_id gnl|my_center|LOCUS_59310 122837 123184 gene locus_tag LOCUS_59320 122837 123184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972485.1 protein_id gnl|my_center|LOCUS_59320 123774 123223 gene locus_tag LOCUS_59330 123774 123223 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030960.1 protein_id gnl|my_center|LOCUS_59330 125749 123797 gene locus_tag LOCUS_59340 125749 123797 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972490.1 protein_id gnl|my_center|LOCUS_59340 127088 125766 gene locus_tag LOCUS_59350 127088 125766 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030958.1 protein_id gnl|my_center|LOCUS_59350 127914 127081 gene locus_tag LOCUS_59360 127914 127081 CDS product M55 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030957.1 protein_id gnl|my_center|LOCUS_59360 128695 127970 gene locus_tag LOCUS_59370 128695 127970 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030956.1 protein_id gnl|my_center|LOCUS_59370 131223 128803 gene locus_tag LOCUS_59380 131223 128803 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485626.1 protein_id gnl|my_center|LOCUS_59380 133819 131426 gene locus_tag LOCUS_59390 133819 131426 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173668834.1 protein_id gnl|my_center|LOCUS_59390 134410 133967 gene locus_tag LOCUS_59400 134410 133967 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972496.1 protein_id gnl|my_center|LOCUS_59400 134560 135600 gene locus_tag LOCUS_59410 134560 135600 CDS product Rv2578c family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972497.1 protein_id gnl|my_center|LOCUS_59410 135687 136085 gene locus_tag LOCUS_59420 135687 136085 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030951.1 protein_id gnl|my_center|LOCUS_59420 136665 136090 gene locus_tag LOCUS_59430 136665 136090 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030949.1 protein_id gnl|my_center|LOCUS_59430 137047 138852 gene locus_tag LOCUS_59440 137047 138852 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030948.1 protein_id gnl|my_center|LOCUS_59440 138974 139798 gene locus_tag LOCUS_59450 138974 139798 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972504.1 protein_id gnl|my_center|LOCUS_59450 140114 141457 gene locus_tag LOCUS_59460 gene ccrA 140114 141457 CDS product crotonyl-CoA carboxylase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189283587.1 protein_id gnl|my_center|LOCUS_59460 141468 143495 gene locus_tag LOCUS_59470 141468 143495 CDS product protein meaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030947.1 protein_id gnl|my_center|LOCUS_59470 143492 144511 gene locus_tag LOCUS_59480 143492 144511 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030946.1 protein_id gnl|my_center|LOCUS_59480 144517 145029 gene locus_tag LOCUS_59490 144517 145029 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030945.1 protein_id gnl|my_center|LOCUS_59490 145032 146237 gene locus_tag LOCUS_59500 145032 146237 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030944.1 protein_id gnl|my_center|LOCUS_59500 146408 147064 gene locus_tag LOCUS_59510 146408 147064 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972510.1 protein_id gnl|my_center|LOCUS_59510 147051 147911 gene locus_tag LOCUS_59520 gene pssA 147051 147911 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972511.1 protein_id gnl|my_center|LOCUS_59520 149335 148199 gene locus_tag LOCUS_59530 149335 148199 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093457344.1 protein_id gnl|my_center|LOCUS_59530 149509 150003 gene locus_tag LOCUS_59540 149509 150003 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184978408.1 protein_id gnl|my_center|LOCUS_59540 150128 150820 gene locus_tag LOCUS_59550 150128 150820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59550 151399 150917 gene locus_tag LOCUS_59560 151399 150917 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030939.1 protein_id gnl|my_center|LOCUS_59560 152879 151410 gene locus_tag LOCUS_59570 152879 151410 CDS product AlkA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972517.1 protein_id gnl|my_center|LOCUS_59570 152999 153361 gene locus_tag LOCUS_59580 152999 153361 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030937.1 protein_id gnl|my_center|LOCUS_59580 154205 153342 gene locus_tag LOCUS_59590 154205 153342 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030936.1 protein_id gnl|my_center|LOCUS_59590 158121 154237 gene locus_tag LOCUS_59600 158121 154237 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030935.1 protein_id gnl|my_center|LOCUS_59600 155535 155625 gene locus_tag LOCUS_t00930 155535 155625 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 158811 158302 gene locus_tag LOCUS_59610 158811 158302 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030929.1 protein_id gnl|my_center|LOCUS_59610 160223 158808 gene locus_tag LOCUS_59620 160223 158808 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972529.1 protein_id gnl|my_center|LOCUS_59620 161286 160438 gene locus_tag LOCUS_59630 161286 160438 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972533.1 protein_id gnl|my_center|LOCUS_59630 163208 161373 gene locus_tag LOCUS_59640 163208 161373 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327729.1 protein_id gnl|my_center|LOCUS_59640 164593 163394 gene locus_tag LOCUS_59650 164593 163394 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230190.1 protein_id gnl|my_center|LOCUS_59650 165360 164590 gene locus_tag LOCUS_59660 165360 164590 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230191.1 protein_id gnl|my_center|LOCUS_59660 166502 165357 gene locus_tag LOCUS_59670 166502 165357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59670 166830 167483 gene locus_tag LOCUS_59680 166830 167483 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284338.1 protein_id gnl|my_center|LOCUS_59680 167493 168749 gene locus_tag LOCUS_59690 167493 168749 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973157.1 protein_id gnl|my_center|LOCUS_59690 169429 168806 gene locus_tag LOCUS_59700 169429 168806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59700 171818 169554 gene locus_tag LOCUS_59710 171818 169554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59710 172975 171911 gene locus_tag LOCUS_59720 172975 171911 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169618726.1 protein_id gnl|my_center|LOCUS_59720 182044 172991 gene locus_tag LOCUS_59730 182044 172991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_59730 182006 182434 gene locus_tag LOCUS_59740 182006 182434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59740 182456 182686 gene locus_tag LOCUS_59750 182456 182686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59750 182828 183919 gene locus_tag LOCUS_59760 182828 183919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59760 >Feature sequence16 154 798 gene locus_tag LOCUS_59770 154 798 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975504.1 protein_id gnl|my_center|LOCUS_59770 855 2120 gene locus_tag LOCUS_59780 855 2120 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028914.1 protein_id gnl|my_center|LOCUS_59780 2092 3246 gene locus_tag LOCUS_59790 2092 3246 CDS product acetoin utilization protein AcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326515.1 protein_id gnl|my_center|LOCUS_59790 3439 4254 gene locus_tag LOCUS_59800 3439 4254 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028912.1 protein_id gnl|my_center|LOCUS_59800 4384 4593 gene locus_tag LOCUS_59810 4384 4593 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004984898.1 protein_id gnl|my_center|LOCUS_59810 5077 6138 gene locus_tag LOCUS_59820 5077 6138 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975510.1 protein_id gnl|my_center|LOCUS_59820 6273 7199 gene locus_tag LOCUS_59830 6273 7199 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975511.1 protein_id gnl|my_center|LOCUS_59830 8508 7264 gene locus_tag LOCUS_59840 8508 7264 CDS product DUF5667 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162495181.1 protein_id gnl|my_center|LOCUS_59840 9508 8729 gene locus_tag LOCUS_59850 9508 8729 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975513.1 protein_id gnl|my_center|LOCUS_59850 10781 9846 gene locus_tag LOCUS_59860 10781 9846 CDS product HAD-IB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037666589.1 protein_id gnl|my_center|LOCUS_59860 10875 11162 gene locus_tag LOCUS_59870 10875 11162 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030145241.1 protein_id gnl|my_center|LOCUS_59870 11437 12198 gene locus_tag LOCUS_59880 11437 12198 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975516.1 protein_id gnl|my_center|LOCUS_59880 12195 13892 gene locus_tag LOCUS_59890 12195 13892 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028907.1 protein_id gnl|my_center|LOCUS_59890 13889 14848 gene locus_tag LOCUS_59900 gene hemC 13889 14848 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975518.1 protein_id gnl|my_center|LOCUS_59900 14941 16554 gene locus_tag LOCUS_59910 14941 16554 CDS product bifunctional uroporphyrinogen-III C-methyltransferase/uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975519.1 protein_id gnl|my_center|LOCUS_59910 16783 16589 gene locus_tag LOCUS_59920 16783 16589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59920 17022 16828 gene locus_tag LOCUS_59930 17022 16828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59930 17210 17019 gene locus_tag LOCUS_59940 17210 17019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59940 18040 17207 gene locus_tag LOCUS_59950 18040 17207 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973852.1 protein_id gnl|my_center|LOCUS_59950 18221 19153 gene locus_tag LOCUS_59960 gene hemB 18221 19153 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028903.1 protein_id gnl|my_center|LOCUS_59960 19946 19212 gene locus_tag LOCUS_59970 19946 19212 CDS product DUF4232 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109034961.1 protein_id gnl|my_center|LOCUS_59970 20183 21562 gene locus_tag LOCUS_59980 20183 21562 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028900.1 protein_id gnl|my_center|LOCUS_59980 21658 22560 gene locus_tag LOCUS_59990 21658 22560 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028899.1 protein_id gnl|my_center|LOCUS_59990 22661 23884 gene locus_tag LOCUS_60000 22661 23884 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028898.1 protein_id gnl|my_center|LOCUS_60000 23980 24828 gene locus_tag LOCUS_60010 23980 24828 CDS product arylamine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004556107.1 protein_id gnl|my_center|LOCUS_60010 26566 24806 gene locus_tag LOCUS_60020 gene argS 26566 24806 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028896.1 protein_id gnl|my_center|LOCUS_60020 26695 28437 gene locus_tag LOCUS_60030 gene lysS 26695 28437 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975532.1 protein_id gnl|my_center|LOCUS_60030 29766 28510 gene locus_tag LOCUS_60040 29766 28510 CDS product DUF2637 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028895.1 protein_id gnl|my_center|LOCUS_60040 30778 29885 gene locus_tag LOCUS_60050 30778 29885 CDS product DUF3558 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173668737.1 protein_id gnl|my_center|LOCUS_60050 31821 30901 gene locus_tag LOCUS_60060 31821 30901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975534.1 protein_id gnl|my_center|LOCUS_60060 32027 33220 gene locus_tag LOCUS_60070 32027 33220 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028892.1 protein_id gnl|my_center|LOCUS_60070 34105 33272 gene locus_tag LOCUS_60080 34105 33272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60080 35028 34264 gene locus_tag LOCUS_60090 35028 34264 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975536.1 protein_id gnl|my_center|LOCUS_60090 35443 35108 gene locus_tag LOCUS_60100 35443 35108 CDS product YnfA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028891.1 protein_id gnl|my_center|LOCUS_60100 35540 36649 gene locus_tag LOCUS_60110 35540 36649 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975538.1 protein_id gnl|my_center|LOCUS_60110 36646 37251 gene locus_tag LOCUS_60120 36646 37251 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975539.1 protein_id gnl|my_center|LOCUS_60120 37351 38091 gene locus_tag LOCUS_60130 37351 38091 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225546.1 protein_id gnl|my_center|LOCUS_60130 38092 39666 gene locus_tag LOCUS_60140 38092 39666 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225545.1 protein_id gnl|my_center|LOCUS_60140 40310 39687 gene locus_tag LOCUS_60150 40310 39687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972757.1 protein_id gnl|my_center|LOCUS_60150 41212 40352 gene locus_tag LOCUS_60160 41212 40352 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972758.1 protein_id gnl|my_center|LOCUS_60160 41756 41388 gene locus_tag LOCUS_60170 41756 41388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60170 42119 41778 gene locus_tag LOCUS_60180 42119 41778 CDS product TraR/DksA C4-type zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972760.1 protein_id gnl|my_center|LOCUS_60180 42550 43512 gene locus_tag LOCUS_60190 42550 43512 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327630.1 protein_id gnl|my_center|LOCUS_60190 43515 44186 gene locus_tag LOCUS_60200 43515 44186 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030700.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_60200 44213 44695 gene locus_tag LOCUS_60210 44213 44695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60210 44749 46998 gene locus_tag LOCUS_60220 gene secD 44749 46998 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030698.1 protein_id gnl|my_center|LOCUS_60220 47728 46931 gene locus_tag LOCUS_60230 47728 46931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60230 47850 48371 gene locus_tag LOCUS_60240 47850 48371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60240 48531 48920 gene locus_tag LOCUS_60250 48531 48920 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057988.1 protein_id gnl|my_center|LOCUS_60250 49941 48958 gene locus_tag LOCUS_60260 49941 48958 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228296.1 protein_id gnl|my_center|LOCUS_60260 50960 50037 gene locus_tag LOCUS_60270 50960 50037 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031765.1 protein_id gnl|my_center|LOCUS_60270 51100 51729 gene locus_tag LOCUS_60280 51100 51729 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729092.1 protein_id gnl|my_center|LOCUS_60280 52280 51741 gene locus_tag LOCUS_60290 52280 51741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60290 52764 52327 gene locus_tag LOCUS_60300 52764 52327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974483.1 protein_id gnl|my_center|LOCUS_60300 53306 54622 gene locus_tag LOCUS_60310 gene hemL 53306 54622 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029675.1 protein_id gnl|my_center|LOCUS_60310 54619 55308 gene locus_tag LOCUS_60320 54619 55308 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974480.1 protein_id gnl|my_center|LOCUS_60320 55436 56710 gene locus_tag LOCUS_60330 55436 56710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029676.1 protein_id gnl|my_center|LOCUS_60330 56777 57409 gene locus_tag LOCUS_60340 56777 57409 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029677.1 protein_id gnl|my_center|LOCUS_60340 57420 58178 gene locus_tag LOCUS_60350 57420 58178 CDS product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974477.1 protein_id gnl|my_center|LOCUS_60350 58183 59958 gene locus_tag LOCUS_60360 58183 59958 CDS product cytochrome c biogenesis protein ResB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029679.1 protein_id gnl|my_center|LOCUS_60360 59955 61058 gene locus_tag LOCUS_60370 gene ccsB 59955 61058 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029680.1 protein_id gnl|my_center|LOCUS_60370 61142 61756 gene locus_tag LOCUS_60380 61142 61756 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973087.1 protein_id gnl|my_center|LOCUS_60380 61816 62664 gene locus_tag LOCUS_60390 61816 62664 CDS product CU044_5270 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225196.1 protein_id gnl|my_center|LOCUS_60390 63065 62775 gene locus_tag LOCUS_60400 63065 62775 CDS product PLD nuclease N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029691.1 protein_id gnl|my_center|LOCUS_60400 63133 64590 gene locus_tag LOCUS_60410 63133 64590 CDS product menaquinone biosynthesis decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974459.1 protein_id gnl|my_center|LOCUS_60410 64587 65489 gene locus_tag LOCUS_60420 64587 65489 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029692.1 protein_id gnl|my_center|LOCUS_60420 65562 66203 gene locus_tag LOCUS_60430 65562 66203 CDS product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974457.1 protein_id gnl|my_center|LOCUS_60430 66260 66715 gene locus_tag LOCUS_60440 66260 66715 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974456.1 protein_id gnl|my_center|LOCUS_60440 66797 67960 gene locus_tag LOCUS_60450 gene mqnE 66797 67960 CDS product aminofutalosine synthase MqnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974455.1 protein_id gnl|my_center|LOCUS_60450 68131 68769 gene locus_tag LOCUS_60460 68131 68769 CDS product UdgX family uracil-DNA binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974454.1 protein_id gnl|my_center|LOCUS_60460 68802 69326 gene locus_tag LOCUS_60470 68802 69326 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029694.1 protein_id gnl|my_center|LOCUS_60470 69420 69719 gene locus_tag LOCUS_60480 69420 69719 CDS product DUF4229 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974452.1 protein_id gnl|my_center|LOCUS_60480 70018 71322 gene locus_tag LOCUS_60490 70018 71322 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974451.1 protein_id gnl|my_center|LOCUS_60490 71364 72044 gene locus_tag LOCUS_60500 71364 72044 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029695.1 protein_id gnl|my_center|LOCUS_60500 72962 72111 gene locus_tag LOCUS_60510 72962 72111 CDS product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029696.1 protein_id gnl|my_center|LOCUS_60510 74479 72962 gene locus_tag LOCUS_60520 74479 72962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60520 74541 75878 gene locus_tag LOCUS_60530 74541 75878 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974447.1 protein_id gnl|my_center|LOCUS_60530 76085 78013 gene locus_tag LOCUS_60540 76085 78013 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029698.1 protein_id gnl|my_center|LOCUS_60540 78713 78033 gene locus_tag LOCUS_60550 78713 78033 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974444.1 protein_id gnl|my_center|LOCUS_60550 79042 78839 gene locus_tag LOCUS_60560 79042 78839 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974443.1 protein_id gnl|my_center|LOCUS_60560 79515 80363 gene locus_tag LOCUS_60570 79515 80363 CDS product menaquinone biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974442.1 protein_id gnl|my_center|LOCUS_60570 84987 80398 gene locus_tag LOCUS_60580 84987 80398 CDS product FtsK/SpoIIIE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029700.1 protein_id gnl|my_center|LOCUS_60580 85300 85602 gene locus_tag LOCUS_60590 85300 85602 CDS product WXG100 family type VII secretion target inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326975.1 protein_id gnl|my_center|LOCUS_60590 86476 85733 gene locus_tag LOCUS_60600 86476 85733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974429.1 protein_id gnl|my_center|LOCUS_60600 87399 86482 gene locus_tag LOCUS_60610 87399 86482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226028144.1 protein_id gnl|my_center|LOCUS_60610 88679 87429 gene locus_tag LOCUS_60620 88679 87429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029704.1 protein_id gnl|my_center|LOCUS_60620 88981 88682 gene locus_tag LOCUS_60630 88981 88682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60630 90251 89187 gene locus_tag LOCUS_60640 90251 89187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974421.1 protein_id gnl|my_center|LOCUS_60640 90943 90272 gene locus_tag LOCUS_60650 90943 90272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174855471.1 protein_id gnl|my_center|LOCUS_60650 92112 91069 gene locus_tag LOCUS_60660 92112 91069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974421.1 protein_id gnl|my_center|LOCUS_60660 92753 92100 gene locus_tag LOCUS_60670 92753 92100 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030008.1 protein_id gnl|my_center|LOCUS_60670 93290 94009 gene locus_tag LOCUS_60680 93290 94009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029707.1 protein_id gnl|my_center|LOCUS_60680 94029 94877 gene locus_tag LOCUS_60690 94029 94877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974416.1 protein_id gnl|my_center|LOCUS_60690 94874 96181 gene locus_tag LOCUS_60700 94874 96181 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029708.1 protein_id gnl|my_center|LOCUS_60700 96184 97230 gene locus_tag LOCUS_60710 96184 97230 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029709.1 protein_id gnl|my_center|LOCUS_60710 97227 98147 gene locus_tag LOCUS_60720 97227 98147 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974413.1 protein_id gnl|my_center|LOCUS_60720 98200 98451 gene locus_tag LOCUS_60730 98200 98451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326983.1 protein_id gnl|my_center|LOCUS_60730 98535 98960 gene locus_tag LOCUS_60740 98535 98960 CDS product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030867405.1 protein_id gnl|my_center|LOCUS_60740 98960 99367 gene locus_tag LOCUS_60750 98960 99367 CDS product TadE/TadG family type IV pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974410.1 protein_id gnl|my_center|LOCUS_60750 99364 99837 gene locus_tag LOCUS_60760 99364 99837 CDS product pilus assembly protein TadG-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974409.1 protein_id gnl|my_center|LOCUS_60760 100278 99856 gene locus_tag LOCUS_60770 100278 99856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60770 100603 100262 gene locus_tag LOCUS_60780 100603 100262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029716.1 protein_id gnl|my_center|LOCUS_60780 101220 100624 gene locus_tag LOCUS_60790 101220 100624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029717.1 protein_id gnl|my_center|LOCUS_60790 101677 101273 gene locus_tag LOCUS_60800 101677 101273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60800 102164 101664 gene locus_tag LOCUS_60810 102164 101664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60810 102750 102376 gene locus_tag LOCUS_60820 102750 102376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60820 104316 102754 gene locus_tag LOCUS_60830 104316 102754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029719.1 protein_id gnl|my_center|LOCUS_60830 104556 105437 gene locus_tag LOCUS_60840 104556 105437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029723.1 protein_id gnl|my_center|LOCUS_60840 105655 108525 gene locus_tag LOCUS_60850 105655 108525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60850 108522 109412 gene locus_tag LOCUS_60860 108522 109412 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029725.1 protein_id gnl|my_center|LOCUS_60860 109517 110716 gene locus_tag LOCUS_60870 gene mqnC 109517 110716 CDS product cyclic dehypoxanthinyl futalosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029726.1 protein_id gnl|my_center|LOCUS_60870 110724 111167 gene locus_tag LOCUS_60880 110724 111167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60880 112207 111191 gene locus_tag LOCUS_60890 112207 111191 CDS product chitinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029728.1 protein_id gnl|my_center|LOCUS_60890 112442 112870 gene locus_tag LOCUS_60900 112442 112870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60900 112938 115124 gene locus_tag LOCUS_60910 112938 115124 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974391.1 protein_id gnl|my_center|LOCUS_60910 115124 116227 gene locus_tag LOCUS_60920 115124 116227 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029729.1 protein_id gnl|my_center|LOCUS_60920 116224 116946 gene locus_tag LOCUS_60930 116224 116946 CDS product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974389.1 protein_id gnl|my_center|LOCUS_60930 117325 117011 gene locus_tag LOCUS_60940 117325 117011 CDS product PASTA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029730.1 protein_id gnl|my_center|LOCUS_60940 117958 117452 gene locus_tag LOCUS_60950 117958 117452 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029731.1 protein_id gnl|my_center|LOCUS_60950 118059 119342 gene locus_tag LOCUS_60960 118059 119342 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974386.1 protein_id gnl|my_center|LOCUS_60960 120253 119462 gene locus_tag LOCUS_60970 120253 119462 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029732.1 protein_id gnl|my_center|LOCUS_60970 121060 121419 gene locus_tag LOCUS_60980 121060 121419 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974383.1 protein_id gnl|my_center|LOCUS_60980 121433 121987 gene locus_tag LOCUS_60990 121433 121987 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006133126.1 protein_id gnl|my_center|LOCUS_60990 121984 122730 gene locus_tag LOCUS_61000 121984 122730 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029733.1 protein_id gnl|my_center|LOCUS_61000 122853 124049 gene locus_tag LOCUS_61010 122853 124049 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029734.1 protein_id gnl|my_center|LOCUS_61010 124046 124906 gene locus_tag LOCUS_61020 gene nuoE 124046 124906 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974380.1 protein_id gnl|my_center|LOCUS_61020 124906 126255 gene locus_tag LOCUS_61030 gene nuoF 124906 126255 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974379.1 protein_id gnl|my_center|LOCUS_61030 126258 128756 gene locus_tag LOCUS_61040 126258 128756 CDS product NADH-quinone oxidoreductase subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029735.1 protein_id gnl|my_center|LOCUS_61040 128753 130129 gene locus_tag LOCUS_61050 gene nuoH 128753 130129 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029736.1 protein_id gnl|my_center|LOCUS_61050 130122 130769 gene locus_tag LOCUS_61060 gene nuoI 130122 130769 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327003.1 protein_id gnl|my_center|LOCUS_61060 130766 131623 gene locus_tag LOCUS_61070 130766 131623 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029738.1 protein_id gnl|my_center|LOCUS_61070 131620 131919 gene locus_tag LOCUS_61080 gene nuoK 131620 131919 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974374.1 protein_id gnl|my_center|LOCUS_61080 131934 133898 gene locus_tag LOCUS_61090 gene nuoL 131934 133898 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974373.1 protein_id gnl|my_center|LOCUS_61090 133904 135475 gene locus_tag LOCUS_61100 133904 135475 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974372.1 protein_id gnl|my_center|LOCUS_61100 135472 137130 gene locus_tag LOCUS_61110 gene nuoN 135472 137130 CDS product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974371.1 protein_id gnl|my_center|LOCUS_61110 137326 139359 gene locus_tag LOCUS_61120 gene recQ 137326 139359 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029740.1 protein_id gnl|my_center|LOCUS_61120 141268 139694 gene locus_tag LOCUS_61130 141268 139694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61130 142442 141165 gene locus_tag LOCUS_61140 142442 141165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_61140 143242 142454 gene locus_tag LOCUS_61150 143242 142454 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086062.1 protein_id gnl|my_center|LOCUS_61150 144167 143220 gene locus_tag LOCUS_61160 144167 143220 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086063.1 protein_id gnl|my_center|LOCUS_61160 145594 144164 gene locus_tag LOCUS_61170 145594 144164 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296526.1 protein_id gnl|my_center|LOCUS_61170 145837 145610 gene locus_tag LOCUS_61180 145837 145610 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005058882.1 protein_id gnl|my_center|LOCUS_61180 146659 145871 gene locus_tag LOCUS_61190 146659 145871 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005091866.1 protein_id gnl|my_center|LOCUS_61190 147877 146939 gene locus_tag LOCUS_61200 147877 146939 CDS product M56 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029742.1 protein_id gnl|my_center|LOCUS_61200 149267 148056 gene locus_tag LOCUS_61210 gene fahA 149267 148056 CDS product fumarylacetoacetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029743.1 protein_id gnl|my_center|LOCUS_61210 149648 151147 gene locus_tag LOCUS_61220 149648 151147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61220 151140 153506 gene locus_tag LOCUS_61230 151140 153506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61230 153624 155537 gene locus_tag LOCUS_61240 153624 155537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61240 155554 155997 gene locus_tag LOCUS_61250 155554 155997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61250 155994 157127 gene locus_tag LOCUS_61260 155994 157127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61260 157976 157134 gene locus_tag LOCUS_61270 157976 157134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61270 159376 157973 gene locus_tag LOCUS_61280 159376 157973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61280 160482 159385 gene locus_tag LOCUS_61290 160482 159385 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878505.1 protein_id gnl|my_center|LOCUS_61290 160692 161495 gene locus_tag LOCUS_61300 160692 161495 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974366.1 protein_id gnl|my_center|LOCUS_61300 162024 161506 gene locus_tag LOCUS_61310 162024 161506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61310 162415 162753 gene locus_tag LOCUS_61320 162415 162753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61320 162858 163868 gene locus_tag LOCUS_61330 162858 163868 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974364.1 protein_id gnl|my_center|LOCUS_61330 164251 165480 gene locus_tag LOCUS_61340 164251 165480 CDS product outer membrane lipoprotein carrier protein LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974363.1 protein_id gnl|my_center|LOCUS_61340 165522 166553 gene locus_tag LOCUS_61350 165522 166553 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974362.1 protein_id gnl|my_center|LOCUS_61350 166540 167442 gene locus_tag LOCUS_61360 166540 167442 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030867471.1 protein_id gnl|my_center|LOCUS_61360 168731 167514 gene locus_tag LOCUS_61370 168731 167514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61370 168949 169953 gene locus_tag LOCUS_61380 168949 169953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61380 170452 169964 gene locus_tag LOCUS_61390 170452 169964 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974357.1 protein_id gnl|my_center|LOCUS_61390 171494 170457 gene locus_tag LOCUS_61400 gene rarD 171494 170457 CDS product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029749.1 protein_id gnl|my_center|LOCUS_61400 172459 171605 gene locus_tag LOCUS_61410 172459 171605 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974354.1 protein_id gnl|my_center|LOCUS_61410 172561 172935 gene locus_tag LOCUS_61420 172561 172935 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029382.1 protein_id gnl|my_center|LOCUS_61420 >Feature sequence17 316 918 gene locus_tag LOCUS_61430 316 918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_61430 876 1211 gene locus_tag LOCUS_61440 876 1211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61440 1695 1477 gene locus_tag LOCUS_61450 1695 1477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61450 2615 1695 gene locus_tag LOCUS_61460 2615 1695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61460 3218 2676 gene locus_tag LOCUS_61470 3218 2676 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029694.1 protein_id gnl|my_center|LOCUS_61470 4146 3280 gene locus_tag LOCUS_61480 4146 3280 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161693833.1 protein_id gnl|my_center|LOCUS_61480 4588 4175 gene locus_tag LOCUS_61490 4588 4175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039381.1 protein_id gnl|my_center|LOCUS_61490 5515 4592 gene locus_tag LOCUS_61500 5515 4592 CDS product DUF6192 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039380.1 protein_id gnl|my_center|LOCUS_61500 7104 6580 gene locus_tag LOCUS_61510 7104 6580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61510 8896 7439 gene locus_tag LOCUS_61520 8896 7439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61520 9276 10106 gene locus_tag LOCUS_61530 9276 10106 CDS product IS5-like element ISSco3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026846.1 protein_id gnl|my_center|LOCUS_61530 10553 10176 gene locus_tag LOCUS_61540 10553 10176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61540 11239 10655 gene locus_tag LOCUS_61550 11239 10655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61550 11620 11318 gene locus_tag LOCUS_61560 11620 11318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_61560 11930 11748 gene locus_tag LOCUS_61570 11930 11748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189554797.1 protein_id gnl|my_center|LOCUS_61570 12880 12029 gene locus_tag LOCUS_61580 12880 12029 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_199889868.1 protein_id gnl|my_center|LOCUS_61580 13089 12910 gene locus_tag LOCUS_61590 13089 12910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_61590 13064 13246 gene locus_tag LOCUS_61600 13064 13246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61600 13188 13673 gene locus_tag LOCUS_61610 13188 13673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61610 13797 13982 gene locus_tag LOCUS_61620 13797 13982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61620 14057 14755 gene locus_tag LOCUS_61630 14057 14755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61630 15057 15323 gene locus_tag LOCUS_61640 15057 15323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61640 15596 15742 gene locus_tag LOCUS_61650 15596 15742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61650 15791 16264 gene locus_tag LOCUS_61660 15791 16264 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027861.1 protein_id gnl|my_center|LOCUS_61660 16926 16369 gene locus_tag LOCUS_61670 16926 16369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971403.1 protein_id gnl|my_center|LOCUS_61670 18621 16939 gene locus_tag LOCUS_61680 18621 16939 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031868.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_61680 21115 20594 gene locus_tag LOCUS_61690 21115 20594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61690 21539 21207 gene locus_tag LOCUS_61700 21539 21207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61700 22016 21765 gene locus_tag LOCUS_61710 22016 21765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61710 22249 22383 gene locus_tag LOCUS_61720 22249 22383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61720 22480 22644 gene locus_tag LOCUS_61730 22480 22644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61730 24803 23157 gene locus_tag LOCUS_61740 24803 23157 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831451.1 protein_id gnl|my_center|LOCUS_61740 25572 25306 gene locus_tag LOCUS_61750 25572 25306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61750 25866 26606 gene locus_tag LOCUS_61760 25866 26606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_61760 26676 26888 gene locus_tag LOCUS_61770 26676 26888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_61770 27315 27046 gene locus_tag LOCUS_61780 27315 27046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61780 27314 28021 gene locus_tag LOCUS_61790 27314 28021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61790 28229 28525 gene locus_tag LOCUS_61800 28229 28525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_61800 28562 29038 gene locus_tag LOCUS_61810 28562 29038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_61810 29388 29696 gene locus_tag LOCUS_61820 29388 29696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_61820 29785 30255 gene locus_tag LOCUS_61830 29785 30255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61830 30663 31847 gene locus_tag LOCUS_61840 30663 31847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61840 31924 32121 gene locus_tag LOCUS_61850 31924 32121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61850 36084 32749 gene locus_tag LOCUS_61860 36084 32749 CDS product RHS repeat-associated core domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223968.1 protein_id gnl|my_center|LOCUS_61860 36843 36268 gene locus_tag LOCUS_61870 36843 36268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61870 37436 37290 gene locus_tag LOCUS_61880 37436 37290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61880 38561 38334 gene locus_tag LOCUS_61890 38561 38334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61890 38518 38946 gene locus_tag LOCUS_61900 38518 38946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61900 39378 39929 gene locus_tag LOCUS_61910 39378 39929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61910 40260 40946 gene locus_tag LOCUS_61920 40260 40946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61920 41529 42029 gene locus_tag LOCUS_61930 41529 42029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61930 42177 42524 gene locus_tag LOCUS_61940 42177 42524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61940 42515 42706 gene locus_tag LOCUS_61950 42515 42706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61950 42907 43680 gene locus_tag LOCUS_61960 42907 43680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61960 44803 44414 gene locus_tag LOCUS_61970 44803 44414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61970 45465 45181 gene locus_tag LOCUS_61980 45465 45181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61980 48819 45625 gene locus_tag LOCUS_61990 48819 45625 CDS product type 2 lanthipeptide synthetase LanM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226577.1 protein_id gnl|my_center|LOCUS_61990 49071 48892 gene locus_tag LOCUS_62000 49071 48892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62000 49344 49937 gene locus_tag LOCUS_62010 49344 49937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_62010 50527 51975 gene locus_tag LOCUS_62020 50527 51975 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063688.1 protein_id gnl|my_center|LOCUS_62020 52625 52218 gene locus_tag LOCUS_62030 52625 52218 CDS product four-helix bundle copper-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975554.1 protein_id gnl|my_center|LOCUS_62030 53234 52653 gene locus_tag LOCUS_62040 53234 52653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62040 54777 53311 gene locus_tag LOCUS_62050 54777 53311 CDS product glycosyl hydrolase family 18 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030596.1 protein_id gnl|my_center|LOCUS_62050 55303 55587 gene locus_tag LOCUS_62060 55303 55587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62060 56525 55926 gene locus_tag LOCUS_62070 56525 55926 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228137.1 protein_id gnl|my_center|LOCUS_62070 56572 57045 gene locus_tag LOCUS_62080 56572 57045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62080 57624 57878 gene locus_tag LOCUS_62090 57624 57878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62090 57915 58790 gene locus_tag LOCUS_62100 57915 58790 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031159.1 protein_id gnl|my_center|LOCUS_62100 58853 59053 gene locus_tag LOCUS_62110 58853 59053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62110 60294 59269 gene locus_tag LOCUS_62120 60294 59269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62120 61439 60291 gene locus_tag LOCUS_62130 61439 60291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190196107.1 protein_id gnl|my_center|LOCUS_62130 61398 61577 gene locus_tag LOCUS_62140 61398 61577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62140 62712 61579 gene locus_tag LOCUS_62150 62712 61579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62150 63037 62795 gene locus_tag LOCUS_62160 63037 62795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62160 63378 63791 gene locus_tag LOCUS_62170 63378 63791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62170 64536 63733 gene locus_tag LOCUS_62180 64536 63733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62180 64535 65557 gene locus_tag LOCUS_62190 64535 65557 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096845.1 protein_id gnl|my_center|LOCUS_62190 67127 65637 gene locus_tag LOCUS_62200 67127 65637 CDS product alpha-L-arabinofuranosidase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225389.1 protein_id gnl|my_center|LOCUS_62200 67018 67251 gene locus_tag LOCUS_62210 67018 67251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62210 67972 67550 gene locus_tag LOCUS_62220 67972 67550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62220 69054 68218 gene locus_tag LOCUS_62230 69054 68218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62230 69017 69781 gene locus_tag LOCUS_62240 69017 69781 CDS product TipAS antibiotic-recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230943.1 protein_id gnl|my_center|LOCUS_62240 70095 69733 gene locus_tag LOCUS_62250 70095 69733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62250 70490 70098 gene locus_tag LOCUS_62260 70490 70098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62260 71189 70545 gene locus_tag LOCUS_62270 71189 70545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62270 71140 71373 gene locus_tag LOCUS_62280 71140 71373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62280 71850 72338 gene locus_tag LOCUS_62290 71850 72338 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730233.1 protein_id gnl|my_center|LOCUS_62290 72726 72322 gene locus_tag LOCUS_62300 72726 72322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62300 72613 73467 gene locus_tag LOCUS_62310 72613 73467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62310 74708 73815 gene locus_tag LOCUS_62320 74708 73815 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284765.1 protein_id gnl|my_center|LOCUS_62320 74809 75897 gene locus_tag LOCUS_62330 74809 75897 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467622.1 protein_id gnl|my_center|LOCUS_62330 77088 76144 gene locus_tag LOCUS_62340 77088 76144 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727741.1 protein_id gnl|my_center|LOCUS_62340 77217 77834 gene locus_tag LOCUS_62350 77217 77834 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093947468.1 protein_id gnl|my_center|LOCUS_62350 78015 85970 gene locus_tag LOCUS_62360 78015 85970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62360 85977 86462 gene locus_tag LOCUS_62370 85977 86462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62370 86459 87874 gene locus_tag LOCUS_62380 86459 87874 CDS product NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028353.1 protein_id gnl|my_center|LOCUS_62380 98694 87937 gene locus_tag LOCUS_62390 98694 87937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62390 108766 98753 gene locus_tag LOCUS_62400 108766 98753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_62400 115491 108808 gene locus_tag LOCUS_62410 115491 108808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62410 130363 115553 gene locus_tag LOCUS_62420 130363 115553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_62420 139808 130422 gene locus_tag LOCUS_62430 139808 130422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62430 153255 139864 gene locus_tag LOCUS_62440 153255 139864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62440 153361 156606 gene locus_tag LOCUS_62450 153361 156606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62450 156697 157179 gene locus_tag LOCUS_62460 156697 157179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62460 157693 159936 gene locus_tag LOCUS_62470 157693 159936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62470 161590 162942 gene locus_tag LOCUS_62480 161590 162942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62480 162946 167340 gene locus_tag LOCUS_62490 162946 167340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62490 168173 168400 gene locus_tag LOCUS_62500 168173 168400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62500 >Feature sequence18 207 815 gene locus_tag LOCUS_62510 207 815 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_221514425.1 protein_id gnl|my_center|LOCUS_62510 991 3426 gene locus_tag LOCUS_62520 991 3426 CDS product mannose-1-phosphate guanyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027759.1 protein_id gnl|my_center|LOCUS_62520 3593 4429 gene locus_tag LOCUS_62530 3593 4429 CDS product DUF881 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977439.1 protein_id gnl|my_center|LOCUS_62530 4426 4758 gene locus_tag LOCUS_62540 4426 4758 CDS product small basic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977440.1 protein_id gnl|my_center|LOCUS_62540 4764 5600 gene locus_tag LOCUS_62550 4764 5600 CDS product DUF881 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027758.1 protein_id gnl|my_center|LOCUS_62550 5970 5737 gene locus_tag LOCUS_62560 5970 5737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62560 6061 6597 gene locus_tag LOCUS_62570 6061 6597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62570 6645 7382 gene locus_tag LOCUS_62580 6645 7382 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027756.1 protein_id gnl|my_center|LOCUS_62580 7503 7940 gene locus_tag LOCUS_62590 7503 7940 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977444.1 protein_id gnl|my_center|LOCUS_62590 8251 8751 gene locus_tag LOCUS_62600 8251 8751 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805153.1 protein_id gnl|my_center|LOCUS_62600 8852 10273 gene locus_tag LOCUS_62610 8852 10273 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027755.1 protein_id gnl|my_center|LOCUS_62610 10725 10351 gene locus_tag LOCUS_62620 10725 10351 CDS product PRC-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173668708.1 protein_id gnl|my_center|LOCUS_62620 11125 14010 gene locus_tag LOCUS_62630 gene gcvP 11125 14010 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027754.1 protein_id gnl|my_center|LOCUS_62630 15228 14116 gene locus_tag LOCUS_62640 15228 14116 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029178.1 protein_id gnl|my_center|LOCUS_62640 16025 15225 gene locus_tag LOCUS_62650 16025 15225 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029177.1 protein_id gnl|my_center|LOCUS_62650 16837 16022 gene locus_tag LOCUS_62660 gene modA 16837 16022 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029176.1 protein_id gnl|my_center|LOCUS_62660 17388 16999 gene locus_tag LOCUS_62670 17388 16999 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975235.1 protein_id gnl|my_center|LOCUS_62670 17763 19427 gene locus_tag LOCUS_62680 gene kdpA 17763 19427 CDS product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029188.1 protein_id gnl|my_center|LOCUS_62680 19424 21556 gene locus_tag LOCUS_62690 gene kdpB 19424 21556 CDS product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029187.1 protein_id gnl|my_center|LOCUS_62690 21562 22230 gene locus_tag LOCUS_62700 21562 22230 CDS product potassium-transporting ATPase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029186.1 protein_id gnl|my_center|LOCUS_62700 22555 23847 gene locus_tag LOCUS_62710 22555 23847 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024310853.1 protein_id gnl|my_center|LOCUS_62710 23854 24852 gene locus_tag LOCUS_62720 23854 24852 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226352.1 protein_id gnl|my_center|LOCUS_62720 24849 25706 gene locus_tag LOCUS_62730 24849 25706 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226353.1 protein_id gnl|my_center|LOCUS_62730 25756 26835 gene locus_tag LOCUS_62740 25756 26835 CDS product endo-1,4-beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086845572.1 protein_id gnl|my_center|LOCUS_62740 27094 26864 gene locus_tag LOCUS_62750 27094 26864 CDS product DUF5999 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977451.1 protein_id gnl|my_center|LOCUS_62750 27995 27411 gene locus_tag LOCUS_62760 27995 27411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325749.1 protein_id gnl|my_center|LOCUS_62760 28552 30069 gene locus_tag LOCUS_62770 28552 30069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977453.1 protein_id gnl|my_center|LOCUS_62770 30212 31009 gene locus_tag LOCUS_62780 30212 31009 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027753.1 protein_id gnl|my_center|LOCUS_62780 31831 31022 gene locus_tag LOCUS_62790 31831 31022 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027752.1 protein_id gnl|my_center|LOCUS_62790 31983 32612 gene locus_tag LOCUS_62800 31983 32612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62800 32765 33304 gene locus_tag LOCUS_62810 32765 33304 CDS product Clp protease N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977462.1 protein_id gnl|my_center|LOCUS_62810 33378 34382 gene locus_tag LOCUS_62820 33378 34382 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027748.1 protein_id gnl|my_center|LOCUS_62820 34660 35676 gene locus_tag LOCUS_62830 34660 35676 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027747.1 protein_id gnl|my_center|LOCUS_62830 36341 35658 gene locus_tag LOCUS_62840 36341 35658 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977465.1 protein_id gnl|my_center|LOCUS_62840 36377 37708 gene locus_tag LOCUS_62850 36377 37708 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027746.1 protein_id gnl|my_center|LOCUS_62850 38237 37785 gene locus_tag LOCUS_62860 38237 37785 CDS product Rieske (2Fe-2S) protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977470.1 protein_id gnl|my_center|LOCUS_62860 38428 39192 gene locus_tag LOCUS_62870 38428 39192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977478.1 protein_id gnl|my_center|LOCUS_62870 39189 39638 gene locus_tag LOCUS_62880 39189 39638 CDS product DUF3037 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027736.1 protein_id gnl|my_center|LOCUS_62880 39789 40550 gene locus_tag LOCUS_62890 gene fabG 39789 40550 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027734.1 protein_id gnl|my_center|LOCUS_62890 40563 41321 gene locus_tag LOCUS_62900 40563 41321 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027733.1 protein_id gnl|my_center|LOCUS_62900 41508 43094 gene locus_tag LOCUS_62910 41508 43094 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325733.1 protein_id gnl|my_center|LOCUS_62910 43166 43849 gene locus_tag LOCUS_62920 gene ung 43166 43849 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977484.1 protein_id gnl|my_center|LOCUS_62920 43943 44422 gene locus_tag LOCUS_62930 43943 44422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027732.1 protein_id gnl|my_center|LOCUS_62930 44942 44439 gene locus_tag LOCUS_62940 44942 44439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046247768.1 protein_id gnl|my_center|LOCUS_62940 45185 46090 gene locus_tag LOCUS_62950 45185 46090 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093455728.1 protein_id gnl|my_center|LOCUS_62950 47579 46014 gene locus_tag LOCUS_62960 gene lnt 47579 46014 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027728.1 protein_id gnl|my_center|LOCUS_62960 47736 48476 gene locus_tag LOCUS_62970 47736 48476 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977492.1 protein_id gnl|my_center|LOCUS_62970 48668 48486 gene locus_tag LOCUS_62980 48668 48486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977493.1 protein_id gnl|my_center|LOCUS_62980 49691 48816 gene locus_tag LOCUS_62990 49691 48816 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977503.1 protein_id gnl|my_center|LOCUS_62990 50306 49833 gene locus_tag LOCUS_63000 50306 49833 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027722.1 protein_id gnl|my_center|LOCUS_63000 50461 51630 gene locus_tag LOCUS_63010 50461 51630 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027721.1 protein_id gnl|my_center|LOCUS_63010 52390 51638 gene locus_tag LOCUS_63020 52390 51638 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027720.1 protein_id gnl|my_center|LOCUS_63020 52757 53926 gene locus_tag LOCUS_63030 gene tuf 52757 53926 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977508.1 protein_id gnl|my_center|LOCUS_63030 54015 54860 gene locus_tag LOCUS_63040 54015 54860 CDS product fused MFS/spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027718.1 protein_id gnl|my_center|LOCUS_63040 56129 54822 gene locus_tag LOCUS_63050 56129 54822 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816310.1 protein_id gnl|my_center|LOCUS_63050 57231 56209 gene locus_tag LOCUS_63060 57231 56209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63060 57357 57809 gene locus_tag LOCUS_63070 57357 57809 CDS product DUF4442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977512.1 protein_id gnl|my_center|LOCUS_63070 57960 58598 gene locus_tag LOCUS_63080 57960 58598 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977513.1 protein_id gnl|my_center|LOCUS_63080 59185 58655 gene locus_tag LOCUS_63090 59185 58655 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977514.1 protein_id gnl|my_center|LOCUS_63090 59294 60058 gene locus_tag LOCUS_63100 59294 60058 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977515.1 protein_id gnl|my_center|LOCUS_63100 60150 60722 gene locus_tag LOCUS_63110 60150 60722 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977517.1 protein_id gnl|my_center|LOCUS_63110 60758 61315 gene locus_tag LOCUS_63120 60758 61315 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027714.1 protein_id gnl|my_center|LOCUS_63120 61750 61343 gene locus_tag LOCUS_63130 61750 61343 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027708.1 protein_id gnl|my_center|LOCUS_63130 61844 62554 gene locus_tag LOCUS_63140 61844 62554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168715425.1 protein_id gnl|my_center|LOCUS_63140 62602 63228 gene locus_tag LOCUS_63150 62602 63228 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027706.1 protein_id gnl|my_center|LOCUS_63150 63472 64629 gene locus_tag LOCUS_63160 63472 64629 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977530.1 protein_id gnl|my_center|LOCUS_63160 64632 67619 gene locus_tag LOCUS_63170 64632 67619 CDS product SMC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027705.1 protein_id gnl|my_center|LOCUS_63170 68097 67651 gene locus_tag LOCUS_63180 68097 67651 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977532.1 protein_id gnl|my_center|LOCUS_63180 68226 68699 gene locus_tag LOCUS_63190 68226 68699 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027704.1 protein_id gnl|my_center|LOCUS_63190 68758 69603 gene locus_tag LOCUS_63200 68758 69603 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002182367.1 protein_id gnl|my_center|LOCUS_63200 71309 69621 gene locus_tag LOCUS_63210 71309 69621 CDS product DUF885 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027703.1 protein_id gnl|my_center|LOCUS_63210 72715 71441 gene locus_tag LOCUS_63220 72715 71441 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027701.1 protein_id gnl|my_center|LOCUS_63220 74491 72905 gene locus_tag LOCUS_63230 74491 72905 CDS product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027698.1 protein_id gnl|my_center|LOCUS_63230 76231 74783 gene locus_tag LOCUS_63240 76231 74783 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027697.1 protein_id gnl|my_center|LOCUS_63240 76397 76897 gene locus_tag LOCUS_63250 76397 76897 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027696.1 protein_id gnl|my_center|LOCUS_63250 76881 77843 gene locus_tag LOCUS_63260 76881 77843 CDS product DUF2156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977544.1 protein_id gnl|my_center|LOCUS_63260 77881 79014 gene locus_tag LOCUS_63270 77881 79014 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027695.1 protein_id gnl|my_center|LOCUS_63270 79110 80234 gene locus_tag LOCUS_63280 79110 80234 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027694.1 protein_id gnl|my_center|LOCUS_63280 80231 81496 gene locus_tag LOCUS_63290 80231 81496 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027693.1 protein_id gnl|my_center|LOCUS_63290 81554 82024 gene locus_tag LOCUS_63300 81554 82024 CDS product aromatase/cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027692.1 protein_id gnl|my_center|LOCUS_63300 81996 82577 gene locus_tag LOCUS_63310 81996 82577 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173668705.1 protein_id gnl|my_center|LOCUS_63310 82574 83884 gene locus_tag LOCUS_63320 82574 83884 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027690.1 protein_id gnl|my_center|LOCUS_63320 83938 85182 gene locus_tag LOCUS_63330 83938 85182 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027689.1 protein_id gnl|my_center|LOCUS_63330 86041 85184 gene locus_tag LOCUS_63340 86041 85184 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977552.1 protein_id gnl|my_center|LOCUS_63340 87708 86158 gene locus_tag LOCUS_63350 87708 86158 CDS product AarF/UbiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977553.1 protein_id gnl|my_center|LOCUS_63350 88778 88053 gene locus_tag LOCUS_63360 88778 88053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63360 89234 88848 gene locus_tag LOCUS_63370 89234 88848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63370 91322 89523 gene locus_tag LOCUS_63380 91322 89523 CDS product tryptophan 7-halogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977556.1 protein_id gnl|my_center|LOCUS_63380 92021 91371 gene locus_tag LOCUS_63390 92021 91371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027687.1 protein_id gnl|my_center|LOCUS_63390 92390 92923 gene locus_tag LOCUS_63400 92390 92923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63400 93047 93916 gene locus_tag LOCUS_63410 93047 93916 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027679.1 protein_id gnl|my_center|LOCUS_63410 94746 93868 gene locus_tag LOCUS_63420 94746 93868 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484721.1 protein_id gnl|my_center|LOCUS_63420 94908 95792 gene locus_tag LOCUS_63430 94908 95792 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977567.1 protein_id gnl|my_center|LOCUS_63430 95917 96678 gene locus_tag LOCUS_63440 95917 96678 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027677.1 protein_id gnl|my_center|LOCUS_63440 97835 96681 gene locus_tag LOCUS_63450 97835 96681 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977569.1 protein_id gnl|my_center|LOCUS_63450 98587 97922 gene locus_tag LOCUS_63460 98587 97922 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977570.1 protein_id gnl|my_center|LOCUS_63460 99750 98602 gene locus_tag LOCUS_63470 99750 98602 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027676.1 protein_id gnl|my_center|LOCUS_63470 99859 100779 gene locus_tag LOCUS_63480 99859 100779 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027675.1 protein_id gnl|my_center|LOCUS_63480 100782 101507 gene locus_tag LOCUS_63490 100782 101507 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027674.1 protein_id gnl|my_center|LOCUS_63490 101548 101988 gene locus_tag LOCUS_63500 101548 101988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027673.1 protein_id gnl|my_center|LOCUS_63500 102547 102002 gene locus_tag LOCUS_63510 gene mug 102547 102002 CDS product G/U mismatch-specific DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027672.1 protein_id gnl|my_center|LOCUS_63510 104004 102562 gene locus_tag LOCUS_63520 gene purB 104004 102562 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027671.1 protein_id gnl|my_center|LOCUS_63520 104866 104084 gene locus_tag LOCUS_63530 104866 104084 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977577.1 protein_id gnl|my_center|LOCUS_63530 105946 104933 gene locus_tag LOCUS_63540 105946 104933 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977578.1 protein_id gnl|my_center|LOCUS_63540 107289 105943 gene locus_tag LOCUS_63550 107289 105943 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027670.1 protein_id gnl|my_center|LOCUS_63550 107835 107413 gene locus_tag LOCUS_63560 107835 107413 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027669.1 protein_id gnl|my_center|LOCUS_63560 108809 107919 gene locus_tag LOCUS_63570 108809 107919 CDS product TIGR03621 family F420-dependent LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222573.1 protein_id gnl|my_center|LOCUS_63570 109650 108934 gene locus_tag LOCUS_63580 gene bioD 109650 108934 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027666.1 protein_id gnl|my_center|LOCUS_63580 110932 109652 gene locus_tag LOCUS_63590 110932 109652 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027665.1 protein_id gnl|my_center|LOCUS_63590 112127 110925 gene locus_tag LOCUS_63600 gene bioB 112127 110925 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027664.1 protein_id gnl|my_center|LOCUS_63600 112282 113409 gene locus_tag LOCUS_63610 112282 113409 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977587.1 protein_id gnl|my_center|LOCUS_63610 113680 113453 gene locus_tag LOCUS_63620 113680 113453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63620 114550 113690 gene locus_tag LOCUS_63630 114550 113690 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977589.1 protein_id gnl|my_center|LOCUS_63630 114768 115235 gene locus_tag LOCUS_63640 114768 115235 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027663.1 protein_id gnl|my_center|LOCUS_63640 115959 115258 gene locus_tag LOCUS_63650 115959 115258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63650 116530 116057 gene locus_tag LOCUS_63660 116530 116057 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977591.1 protein_id gnl|my_center|LOCUS_63660 117283 117585 gene locus_tag LOCUS_63670 117283 117585 CDS product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977595.1 protein_id gnl|my_center|LOCUS_63670 117598 117909 gene locus_tag LOCUS_63680 117598 117909 CDS product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977596.1 protein_id gnl|my_center|LOCUS_63680 117902 119623 gene locus_tag LOCUS_63690 117902 119623 CDS product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977597.1 protein_id gnl|my_center|LOCUS_63690 119623 120297 gene locus_tag LOCUS_63700 119623 120297 CDS product urease accessory UreF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027662.1 protein_id gnl|my_center|LOCUS_63700 120427 121110 gene locus_tag LOCUS_63710 gene ureG 120427 121110 CDS product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977599.1 protein_id gnl|my_center|LOCUS_63710 121107 121862 gene locus_tag LOCUS_63720 121107 121862 CDS product urease accessory protein UreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027661.1 protein_id gnl|my_center|LOCUS_63720 122049 123599 gene locus_tag LOCUS_63730 122049 123599 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027660.1 protein_id gnl|my_center|LOCUS_63730 124638 123664 gene locus_tag LOCUS_63740 124638 123664 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325683.1 protein_id gnl|my_center|LOCUS_63740 125465 124746 gene locus_tag LOCUS_63750 125465 124746 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977603.1 protein_id gnl|my_center|LOCUS_63750 125750 125929 gene locus_tag LOCUS_63760 125750 125929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63760 127492 125972 gene locus_tag LOCUS_63770 127492 125972 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977606.1 protein_id gnl|my_center|LOCUS_63770 127606 128061 gene locus_tag LOCUS_63780 127606 128061 CDS product RpiB/LacA/LacB family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027656.1 protein_id gnl|my_center|LOCUS_63780 129291 128071 gene locus_tag LOCUS_63790 gene rocD 129291 128071 CDS product ornithine--oxo-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977608.1 protein_id gnl|my_center|LOCUS_63790 130109 129288 gene locus_tag LOCUS_63800 130109 129288 CDS product arginine deiminase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977609.1 protein_id gnl|my_center|LOCUS_63800 130739 130236 gene locus_tag LOCUS_63810 130739 130236 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977610.1 protein_id gnl|my_center|LOCUS_63810 130818 131567 gene locus_tag LOCUS_63820 130818 131567 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977611.1 protein_id gnl|my_center|LOCUS_63820 131570 131938 gene locus_tag LOCUS_63830 131570 131938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977612.1 protein_id gnl|my_center|LOCUS_63830 131944 133662 gene locus_tag LOCUS_63840 131944 133662 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027655.1 protein_id gnl|my_center|LOCUS_63840 133659 134864 gene locus_tag LOCUS_63850 133659 134864 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037667486.1 protein_id gnl|my_center|LOCUS_63850 135038 134868 gene locus_tag LOCUS_63860 135038 134868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325678.1 protein_id gnl|my_center|LOCUS_63860 136179 135094 gene locus_tag LOCUS_63870 136179 135094 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977616.1 protein_id gnl|my_center|LOCUS_63870 137229 136204 gene locus_tag LOCUS_63880 137229 136204 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977617.1 protein_id gnl|my_center|LOCUS_63880 138123 137395 gene locus_tag LOCUS_63890 138123 137395 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977618.1 protein_id gnl|my_center|LOCUS_63890 139388 138150 gene locus_tag LOCUS_63900 139388 138150 CDS product MurT ligase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977619.1 protein_id gnl|my_center|LOCUS_63900 139547 140089 gene locus_tag LOCUS_63910 gene def 139547 140089 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325677.1 protein_id gnl|my_center|LOCUS_63910 140759 140112 gene locus_tag LOCUS_63920 140759 140112 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977621.1 protein_id gnl|my_center|LOCUS_63920 140919 142145 gene locus_tag LOCUS_63930 140919 142145 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977622.1 protein_id gnl|my_center|LOCUS_63930 142692 142171 gene locus_tag LOCUS_63940 142692 142171 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027654.1 protein_id gnl|my_center|LOCUS_63940 143941 142700 gene locus_tag LOCUS_63950 143941 142700 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977624.1 protein_id gnl|my_center|LOCUS_63950 145014 143938 gene locus_tag LOCUS_63960 145014 143938 CDS product 1,3,6,8-tetrahydroxynaphthalene synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027653.1 protein_id gnl|my_center|LOCUS_63960 145156 145875 gene locus_tag LOCUS_63970 145156 145875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229430.1 protein_id gnl|my_center|LOCUS_63970 146099 145863 gene locus_tag LOCUS_63980 146099 145863 CDS product DUF6213 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977626.1 protein_id gnl|my_center|LOCUS_63980 147511 146126 gene locus_tag LOCUS_63990 147511 146126 CDS product NADP-dependent succinic semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027651.1 protein_id gnl|my_center|LOCUS_63990 148046 147588 gene locus_tag LOCUS_64000 148046 147588 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977628.1 protein_id gnl|my_center|LOCUS_64000 149581 148043 gene locus_tag LOCUS_64010 149581 148043 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027650.1 protein_id gnl|my_center|LOCUS_64010 150690 149713 gene locus_tag LOCUS_64020 150690 149713 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027649.1 protein_id gnl|my_center|LOCUS_64020 150741 151313 gene locus_tag LOCUS_64030 150741 151313 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027648.1 protein_id gnl|my_center|LOCUS_64030 151409 152374 gene locus_tag LOCUS_64040 151409 152374 CDS product NADPH:quinone oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977632.1 protein_id gnl|my_center|LOCUS_64040 152371 153552 gene locus_tag LOCUS_64050 152371 153552 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027647.1 protein_id gnl|my_center|LOCUS_64050 153549 154631 gene locus_tag LOCUS_64060 153549 154631 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027646.1 protein_id gnl|my_center|LOCUS_64060 154808 155671 gene locus_tag LOCUS_64070 154808 155671 CDS product phosphatidylinositol-specific phospholipase C/glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027645.1 protein_id gnl|my_center|LOCUS_64070 155793 155987 gene locus_tag LOCUS_64080 155793 155987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977636.1 protein_id gnl|my_center|LOCUS_64080 157257 156016 gene locus_tag LOCUS_64090 157257 156016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_64090 157944 157555 gene locus_tag LOCUS_64100 157944 157555 CDS product DUF5519 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977642.1 protein_id gnl|my_center|LOCUS_64100 159157 158069 gene locus_tag LOCUS_64110 159157 158069 CDS product lytic polysaccharide monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027640.1 protein_id gnl|my_center|LOCUS_64110 160529 159399 gene locus_tag LOCUS_64120 160529 159399 CDS product cellulose binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027639.1 protein_id gnl|my_center|LOCUS_64120 162023 160992 gene locus_tag LOCUS_64130 162023 160992 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027638.1 protein_id gnl|my_center|LOCUS_64130 162832 162230 gene locus_tag LOCUS_64140 162832 162230 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977659.1 protein_id gnl|my_center|LOCUS_64140 163919 162906 gene locus_tag LOCUS_64150 163919 162906 CDS product acetamidase/formamidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895776.1 protein_id gnl|my_center|LOCUS_64150 165475 164267 gene locus_tag LOCUS_64160 165475 164267 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977660.1 protein_id gnl|my_center|LOCUS_64160 166976 165528 gene locus_tag LOCUS_64170 gene xylB 166976 165528 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027626.1 protein_id gnl|my_center|LOCUS_64170 >Feature sequence19 986 345 gene locus_tag LOCUS_64180 986 345 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977030.1 protein_id gnl|my_center|LOCUS_64180 1137 1919 gene locus_tag LOCUS_64190 1137 1919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64190 1960 2499 gene locus_tag LOCUS_64200 1960 2499 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977028.1 protein_id gnl|my_center|LOCUS_64200 2646 3152 gene locus_tag LOCUS_64210 2646 3152 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977027.1 protein_id gnl|my_center|LOCUS_64210 4210 3257 gene locus_tag LOCUS_64220 4210 3257 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027982.1 protein_id gnl|my_center|LOCUS_64220 4791 4360 gene locus_tag LOCUS_64230 4791 4360 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977025.1 protein_id gnl|my_center|LOCUS_64230 5610 4846 gene locus_tag LOCUS_64240 5610 4846 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977024.1 protein_id gnl|my_center|LOCUS_64240 5795 6574 gene locus_tag LOCUS_64250 5795 6574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027983.1 protein_id gnl|my_center|LOCUS_64250 7390 6734 gene locus_tag LOCUS_64260 7390 6734 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007388333.1 protein_id gnl|my_center|LOCUS_64260 8528 7383 gene locus_tag LOCUS_64270 8528 7383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64270 8735 9439 gene locus_tag LOCUS_64280 8735 9439 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027986.1 protein_id gnl|my_center|LOCUS_64280 9436 10542 gene locus_tag LOCUS_64290 9436 10542 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027987.1 protein_id gnl|my_center|LOCUS_64290 10843 11574 gene locus_tag LOCUS_64300 10843 11574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64300 14190 11665 gene locus_tag LOCUS_64310 14190 11665 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030872986.1 protein_id gnl|my_center|LOCUS_64310 14666 15889 gene locus_tag LOCUS_64320 gene serB 14666 15889 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977014.1 protein_id gnl|my_center|LOCUS_64320 16477 15959 gene locus_tag LOCUS_64330 16477 15959 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977013.1 protein_id gnl|my_center|LOCUS_64330 16799 16593 gene locus_tag LOCUS_64340 16799 16593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977012.1 protein_id gnl|my_center|LOCUS_64340 18608 17181 gene locus_tag LOCUS_64350 18608 17181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64350 18691 19389 gene locus_tag LOCUS_64360 18691 19389 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977010.1 protein_id gnl|my_center|LOCUS_64360 19887 19537 gene locus_tag LOCUS_64370 19887 19537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64370 20821 20054 gene locus_tag LOCUS_64380 gene fabI 20821 20054 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977009.1 protein_id gnl|my_center|LOCUS_64380 21531 20827 gene locus_tag LOCUS_64390 gene fabG 21531 20827 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977008.1 protein_id gnl|my_center|LOCUS_64390 21788 23344 gene locus_tag LOCUS_64400 21788 23344 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729853.1 protein_id gnl|my_center|LOCUS_64400 23341 24744 gene locus_tag LOCUS_64410 23341 24744 CDS product metallopeptidase TldD-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027992.1 protein_id gnl|my_center|LOCUS_64410 24789 26057 gene locus_tag LOCUS_64420 gene tyrS 24789 26057 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027993.1 protein_id gnl|my_center|LOCUS_64420 26605 26321 gene locus_tag LOCUS_64430 26605 26321 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977004.1 protein_id gnl|my_center|LOCUS_64430 26864 27262 gene locus_tag LOCUS_64440 26864 27262 CDS product DUF3099 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486044.1 protein_id gnl|my_center|LOCUS_64440 27207 27512 gene locus_tag LOCUS_64450 27207 27512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64450 27525 27803 gene locus_tag LOCUS_64460 27525 27803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64460 28789 27800 gene locus_tag LOCUS_64470 gene moaA 28789 27800 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106977887.1 protein_id gnl|my_center|LOCUS_64470 30574 28949 gene locus_tag LOCUS_64480 30574 28949 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977000.1 protein_id gnl|my_center|LOCUS_64480 30927 30571 gene locus_tag LOCUS_64490 30927 30571 CDS product DUF485 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976999.1 protein_id gnl|my_center|LOCUS_64490 31184 32701 gene locus_tag LOCUS_64500 31184 32701 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027994.1 protein_id gnl|my_center|LOCUS_64500 32766 34280 gene locus_tag LOCUS_64510 32766 34280 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027994.1 protein_id gnl|my_center|LOCUS_64510 34370 35380 gene locus_tag LOCUS_64520 34370 35380 CDS product CopD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027996.1 protein_id gnl|my_center|LOCUS_64520 35496 36482 gene locus_tag LOCUS_64530 35496 36482 CDS product DEDDh family exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027997.1 protein_id gnl|my_center|LOCUS_64530 36615 36848 gene locus_tag LOCUS_64540 36615 36848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976994.1 protein_id gnl|my_center|LOCUS_64540 36873 37691 gene locus_tag LOCUS_64550 36873 37691 CDS product SURF1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030872966.1 protein_id gnl|my_center|LOCUS_64550 37741 39522 gene locus_tag LOCUS_64560 37741 39522 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027999.1 protein_id gnl|my_center|LOCUS_64560 39528 40283 gene locus_tag LOCUS_64570 39528 40283 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976991.1 protein_id gnl|my_center|LOCUS_64570 40871 40293 gene locus_tag LOCUS_64580 gene amaP 40871 40293 CDS product alkaline shock response membrane anchor protein AmaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028000.1 protein_id gnl|my_center|LOCUS_64580 41521 40877 gene locus_tag LOCUS_64590 41521 40877 CDS product DUF6286 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486046.1 protein_id gnl|my_center|LOCUS_64590 41892 41518 gene locus_tag LOCUS_64600 41892 41518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976988.1 protein_id gnl|my_center|LOCUS_64600 42083 41898 gene locus_tag LOCUS_64610 42083 41898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64610 42601 42119 gene locus_tag LOCUS_64620 42601 42119 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976986.1 protein_id gnl|my_center|LOCUS_64620 42719 43420 gene locus_tag LOCUS_64630 42719 43420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028002.1 protein_id gnl|my_center|LOCUS_64630 44257 43445 gene locus_tag LOCUS_64640 44257 43445 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028003.1 protein_id gnl|my_center|LOCUS_64640 44626 44405 gene locus_tag LOCUS_64650 44626 44405 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976983.1 protein_id gnl|my_center|LOCUS_64650 46560 44962 gene locus_tag LOCUS_64660 46560 44962 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976982.1 protein_id gnl|my_center|LOCUS_64660 48150 46747 gene locus_tag LOCUS_64670 48150 46747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976980.1 protein_id gnl|my_center|LOCUS_64670 49450 48332 gene locus_tag LOCUS_64680 49450 48332 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976978.1 protein_id gnl|my_center|LOCUS_64680 50192 49515 gene locus_tag LOCUS_64690 50192 49515 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028005.1 protein_id gnl|my_center|LOCUS_64690 50398 51636 gene locus_tag LOCUS_64700 gene pitH 50398 51636 CDS product low-affinity phosphate transporter PitH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976976.1 protein_id gnl|my_center|LOCUS_64700 51677 51898 gene locus_tag LOCUS_64710 51677 51898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976975.1 protein_id gnl|my_center|LOCUS_64710 52253 53206 gene locus_tag LOCUS_64720 52253 53206 CDS product cobalamin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028006.1 protein_id gnl|my_center|LOCUS_64720 53203 54711 gene locus_tag LOCUS_64730 53203 54711 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028007.1 protein_id gnl|my_center|LOCUS_64730 54726 58364 gene locus_tag LOCUS_64740 gene cobN 54726 58364 CDS product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028008.1 protein_id gnl|my_center|LOCUS_64740 58361 60379 gene locus_tag LOCUS_64750 58361 60379 CDS product putative cobaltochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228817.1 protein_id gnl|my_center|LOCUS_64750 60379 60978 gene locus_tag LOCUS_64760 gene cobO 60379 60978 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976969.1 protein_id gnl|my_center|LOCUS_64760 60972 62354 gene locus_tag LOCUS_64770 60972 62354 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028009.1 protein_id gnl|my_center|LOCUS_64770 62351 63082 gene locus_tag LOCUS_64780 gene cobI 62351 63082 CDS product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028010.1 protein_id gnl|my_center|LOCUS_64780 63837 63112 gene locus_tag LOCUS_64790 63837 63112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64790 64009 64824 gene locus_tag LOCUS_64800 gene cobM 64009 64824 CDS product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976965.1 protein_id gnl|my_center|LOCUS_64800 64821 66053 gene locus_tag LOCUS_64810 64821 66053 CDS product bifunctional cobalt-precorrin-7 (C(5))-methyltransferase/cobalt-precorrin-6B (C(15))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868658.1 protein_id gnl|my_center|LOCUS_64810 66050 67723 gene locus_tag LOCUS_64820 gene cobJ 66050 67723 CDS product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162483898.1 protein_id gnl|my_center|LOCUS_64820 67720 68304 gene locus_tag LOCUS_64830 67720 68304 CDS product cobalt-precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056028.1 protein_id gnl|my_center|LOCUS_64830 68301 69224 gene locus_tag LOCUS_64840 68301 69224 CDS product CbiX/SirB N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028014.1 protein_id gnl|my_center|LOCUS_64840 69214 70275 gene locus_tag LOCUS_64850 gene cobC 69214 70275 CDS product Rv2231c family pyridoxal phosphate-dependent protein CobC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037897661.1 protein_id gnl|my_center|LOCUS_64850 71214 70300 gene locus_tag LOCUS_64860 71214 70300 CDS product SCO1860 family LAETG-anchored protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486091.1 protein_id gnl|my_center|LOCUS_64860 72498 71407 gene locus_tag LOCUS_64870 72498 71407 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976959.1 protein_id gnl|my_center|LOCUS_64870 72750 73853 gene locus_tag LOCUS_64880 72750 73853 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972854.1 protein_id gnl|my_center|LOCUS_64880 74202 74672 gene locus_tag LOCUS_64890 gene ectA 74202 74672 CDS product diaminobutyrate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976956.1 protein_id gnl|my_center|LOCUS_64890 74743 76014 gene locus_tag LOCUS_64900 gene ectB 74743 76014 CDS product diaminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976955.1 protein_id gnl|my_center|LOCUS_64900 76068 76472 gene locus_tag LOCUS_64910 76068 76472 CDS product ectoine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976954.1 protein_id gnl|my_center|LOCUS_64910 76480 77373 gene locus_tag LOCUS_64920 gene thpD 76480 77373 CDS product ectoine hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976953.1 protein_id gnl|my_center|LOCUS_64920 78525 77446 gene locus_tag LOCUS_64930 78525 77446 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028020.1 protein_id gnl|my_center|LOCUS_64930 80103 78559 gene locus_tag LOCUS_64940 80103 78559 CDS product aldehyde dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028022.1 protein_id gnl|my_center|LOCUS_64940 80205 80978 gene locus_tag LOCUS_64950 80205 80978 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976948.1 protein_id gnl|my_center|LOCUS_64950 81060 82514 gene locus_tag LOCUS_64960 81060 82514 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976945.1 protein_id gnl|my_center|LOCUS_64960 82530 83237 gene locus_tag LOCUS_64970 82530 83237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64970 84286 83228 gene locus_tag LOCUS_64980 84286 83228 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815394.1 protein_id gnl|my_center|LOCUS_64980 85385 84276 gene locus_tag LOCUS_64990 85385 84276 CDS product pectinesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028027.1 protein_id gnl|my_center|LOCUS_64990 86780 85455 gene locus_tag LOCUS_65000 86780 85455 CDS product polysaccharide lyase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028028.1 protein_id gnl|my_center|LOCUS_65000 87587 86814 gene locus_tag LOCUS_65010 87587 86814 CDS product rhamnogalacturonan acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028029.1 protein_id gnl|my_center|LOCUS_65010 89055 87694 gene locus_tag LOCUS_65020 89055 87694 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325939.1 protein_id gnl|my_center|LOCUS_65020 90633 89128 gene locus_tag LOCUS_65030 90633 89128 CDS product glycoside hydrolase 43 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776888.1 protein_id gnl|my_center|LOCUS_65030 91475 90630 gene locus_tag LOCUS_65040 91475 90630 CDS product PmoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976936.1 protein_id gnl|my_center|LOCUS_65040 92629 91472 gene locus_tag LOCUS_65050 92629 91472 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028031.1 protein_id gnl|my_center|LOCUS_65050 93522 92626 gene locus_tag LOCUS_65060 93522 92626 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976934.1 protein_id gnl|my_center|LOCUS_65060 94454 93519 gene locus_tag LOCUS_65070 94454 93519 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976933.1 protein_id gnl|my_center|LOCUS_65070 96277 94556 gene locus_tag LOCUS_65080 gene araD 96277 94556 CDS product L-arabinonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028032.1 protein_id gnl|my_center|LOCUS_65080 97182 96274 gene locus_tag LOCUS_65090 97182 96274 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976931.1 protein_id gnl|my_center|LOCUS_65090 97841 97179 gene locus_tag LOCUS_65100 97841 97179 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028033.1 protein_id gnl|my_center|LOCUS_65100 99337 98171 gene locus_tag LOCUS_65110 99337 98171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028037.1 protein_id gnl|my_center|LOCUS_65110 100293 99334 gene locus_tag LOCUS_65120 100293 99334 CDS product 5-dehydro-4-deoxyglucarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976924.1 protein_id gnl|my_center|LOCUS_65120 100513 101322 gene locus_tag LOCUS_65130 100513 101322 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976923.1 protein_id gnl|my_center|LOCUS_65130 101585 102355 gene locus_tag LOCUS_65140 101585 102355 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976922.1 protein_id gnl|my_center|LOCUS_65140 102434 103804 gene locus_tag LOCUS_65150 102434 103804 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976921.1 protein_id gnl|my_center|LOCUS_65150 103801 104742 gene locus_tag LOCUS_65160 103801 104742 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976920.1 protein_id gnl|my_center|LOCUS_65160 104739 105563 gene locus_tag LOCUS_65170 104739 105563 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028038.1 protein_id gnl|my_center|LOCUS_65170 105560 106549 gene locus_tag LOCUS_65180 105560 106549 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976918.1 protein_id gnl|my_center|LOCUS_65180 106782 107981 gene locus_tag LOCUS_65190 106782 107981 CDS product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028040.1 protein_id gnl|my_center|LOCUS_65190 108166 108396 gene locus_tag LOCUS_65200 108166 108396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65200 109909 108479 gene locus_tag LOCUS_65210 109909 108479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976912.1 protein_id gnl|my_center|LOCUS_65210 110189 112006 gene locus_tag LOCUS_65220 110189 112006 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976911.1 protein_id gnl|my_center|LOCUS_65220 112714 112010 gene locus_tag LOCUS_65230 112714 112010 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028043.1 protein_id gnl|my_center|LOCUS_65230 113252 112848 gene locus_tag LOCUS_65240 113252 112848 CDS product DUF3618 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028044.1 protein_id gnl|my_center|LOCUS_65240 113668 113249 gene locus_tag LOCUS_65250 113668 113249 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976908.1 protein_id gnl|my_center|LOCUS_65250 114408 113749 gene locus_tag LOCUS_65260 114408 113749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65260 114545 114405 gene locus_tag LOCUS_65270 114545 114405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65270 114676 115596 gene locus_tag LOCUS_65280 gene dapA 114676 115596 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173943917.1 protein_id gnl|my_center|LOCUS_65280 116819 115605 gene locus_tag LOCUS_65290 116819 115605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65290 117367 116816 gene locus_tag LOCUS_65300 117367 116816 CDS product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222154.1 protein_id gnl|my_center|LOCUS_65300 118555 117566 gene locus_tag LOCUS_65310 gene dapD 118555 117566 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976903.1 protein_id gnl|my_center|LOCUS_65310 118967 118638 gene locus_tag LOCUS_65320 118967 118638 CDS product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976901.1 protein_id gnl|my_center|LOCUS_65320 119361 119047 gene locus_tag LOCUS_65330 119361 119047 CDS product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894514.1 protein_id gnl|my_center|LOCUS_65330 119843 119376 gene locus_tag LOCUS_65340 119843 119376 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976899.1 protein_id gnl|my_center|LOCUS_65340 121111 119855 gene locus_tag LOCUS_65350 121111 119855 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976898.1 protein_id gnl|my_center|LOCUS_65350 121872 121108 gene locus_tag LOCUS_65360 gene sufC 121872 121108 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976897.1 protein_id gnl|my_center|LOCUS_65360 122197 121880 gene locus_tag LOCUS_65370 122197 121880 CDS product non-heme iron oxygenase ferredoxin subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976896.1 protein_id gnl|my_center|LOCUS_65370 123384 122194 gene locus_tag LOCUS_65380 gene sufD 123384 122194 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976895.1 protein_id gnl|my_center|LOCUS_65380 124862 123441 gene locus_tag LOCUS_65390 gene sufB 124862 123441 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976894.1 protein_id gnl|my_center|LOCUS_65390 125617 124859 gene locus_tag LOCUS_65400 125617 124859 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976893.1 protein_id gnl|my_center|LOCUS_65400 125743 126555 gene locus_tag LOCUS_65410 125743 126555 CDS product AAC(3) family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976892.1 protein_id gnl|my_center|LOCUS_65410 126587 127510 gene locus_tag LOCUS_65420 126587 127510 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976891.1 protein_id gnl|my_center|LOCUS_65420 127507 128286 gene locus_tag LOCUS_65430 127507 128286 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976890.1 protein_id gnl|my_center|LOCUS_65430 128301 129329 gene locus_tag LOCUS_65440 128301 129329 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037897656.1 protein_id gnl|my_center|LOCUS_65440 130453 129347 gene locus_tag LOCUS_65450 130453 129347 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028051.1 protein_id gnl|my_center|LOCUS_65450 130867 130544 gene locus_tag LOCUS_65460 130867 130544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038534985.1 protein_id gnl|my_center|LOCUS_65460 131914 130991 gene locus_tag LOCUS_65470 131914 130991 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976885.1 protein_id gnl|my_center|LOCUS_65470 132399 134486 gene locus_tag LOCUS_65480 gene tkt 132399 134486 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976883.1 protein_id gnl|my_center|LOCUS_65480 134521 135639 gene locus_tag LOCUS_65490 gene tal 134521 135639 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976882.1 protein_id gnl|my_center|LOCUS_65490 >Feature sequence20 1228 893 gene locus_tag LOCUS_65500 1228 893 CDS product RNA polymerase-binding protein RbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976875.1 protein_id gnl|my_center|LOCUS_65500 1671 1435 gene locus_tag LOCUS_65510 gene secG 1671 1435 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325957.1 protein_id gnl|my_center|LOCUS_65510 2555 1779 gene locus_tag LOCUS_65520 gene tpiA 2555 1779 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976873.1 protein_id gnl|my_center|LOCUS_65520 3773 2562 gene locus_tag LOCUS_65530 3773 2562 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028057.1 protein_id gnl|my_center|LOCUS_65530 4905 3898 gene locus_tag LOCUS_65540 gene gap 4905 3898 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976871.1 protein_id gnl|my_center|LOCUS_65540 8085 5131 gene locus_tag LOCUS_65550 8085 5131 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028058.1 protein_id gnl|my_center|LOCUS_65550 9457 8468 gene locus_tag LOCUS_65560 gene whiA 9457 8468 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976869.1 protein_id gnl|my_center|LOCUS_65560 10515 9448 gene locus_tag LOCUS_65570 gene yvcK 10515 9448 CDS product uridine diphosphate-N-acetylglucosamine-binding protein YvcK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028061.1 protein_id gnl|my_center|LOCUS_65570 11681 10512 gene locus_tag LOCUS_65580 gene rapZ 11681 10512 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093455885.1 protein_id gnl|my_center|LOCUS_65580 13843 11678 gene locus_tag LOCUS_65590 gene uvrC 13843 11678 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028063.1 protein_id gnl|my_center|LOCUS_65590 14145 15128 gene locus_tag LOCUS_65600 14145 15128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976865.1 protein_id gnl|my_center|LOCUS_65600 15626 15198 gene locus_tag LOCUS_65610 15626 15198 CDS product Rieske (2Fe-2S) protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976864.1 protein_id gnl|my_center|LOCUS_65610 15902 17065 gene locus_tag LOCUS_65620 15902 17065 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028064.1 protein_id gnl|my_center|LOCUS_65620 17046 17954 gene locus_tag LOCUS_65630 17046 17954 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028065.1 protein_id gnl|my_center|LOCUS_65630 18825 17959 gene locus_tag LOCUS_65640 18825 17959 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971433.1 protein_id gnl|my_center|LOCUS_65640 18927 19511 gene locus_tag LOCUS_65650 18927 19511 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112465.1 protein_id gnl|my_center|LOCUS_65650 22668 19579 gene locus_tag LOCUS_65660 gene uvrA 22668 19579 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028066.1 protein_id gnl|my_center|LOCUS_65660 22881 23567 gene locus_tag LOCUS_65670 22881 23567 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028067.1 protein_id gnl|my_center|LOCUS_65670 23621 24277 gene locus_tag LOCUS_65680 23621 24277 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976859.1 protein_id gnl|my_center|LOCUS_65680 24826 24353 gene locus_tag LOCUS_65690 gene aroQ 24826 24353 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976858.1 protein_id gnl|my_center|LOCUS_65690 25028 26302 gene locus_tag LOCUS_65700 25028 26302 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194886.1 protein_id gnl|my_center|LOCUS_65700 27437 26448 gene locus_tag LOCUS_65710 27437 26448 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976856.1 protein_id gnl|my_center|LOCUS_65710 29768 27723 gene locus_tag LOCUS_65720 29768 27723 CDS product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028068.1 protein_id gnl|my_center|LOCUS_65720 30408 29830 gene locus_tag LOCUS_65730 30408 29830 CDS product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976854.1 protein_id gnl|my_center|LOCUS_65730 32698 30551 gene locus_tag LOCUS_65740 gene uvrB 32698 30551 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028069.1 protein_id gnl|my_center|LOCUS_65740 33608 32739 gene locus_tag LOCUS_65750 33608 32739 CDS product MHYT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028070.1 protein_id gnl|my_center|LOCUS_65750 33888 34775 gene locus_tag LOCUS_65760 33888 34775 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028071.1 protein_id gnl|my_center|LOCUS_65760 34925 35479 gene locus_tag LOCUS_65770 34925 35479 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028072.1 protein_id gnl|my_center|LOCUS_65770 35976 35512 gene locus_tag LOCUS_65780 35976 35512 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030866702.1 protein_id gnl|my_center|LOCUS_65780 36052 36948 gene locus_tag LOCUS_65790 36052 36948 CDS product pseudouridine-5'-phosphate glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976848.1 protein_id gnl|my_center|LOCUS_65790 36945 37913 gene locus_tag LOCUS_65800 36945 37913 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976847.1 protein_id gnl|my_center|LOCUS_65800 38893 38099 gene locus_tag LOCUS_65810 38893 38099 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976846.1 protein_id gnl|my_center|LOCUS_65810 39138 40265 gene locus_tag LOCUS_65820 39138 40265 CDS product magnesium and cobalt transport protein CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030090.1 protein_id gnl|my_center|LOCUS_65820 40920 40288 gene locus_tag LOCUS_65830 40920 40288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976844.1 protein_id gnl|my_center|LOCUS_65830 41229 42719 gene locus_tag LOCUS_65840 41229 42719 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028074.1 protein_id gnl|my_center|LOCUS_65840 43670 42867 gene locus_tag LOCUS_65850 43670 42867 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972443.1 protein_id gnl|my_center|LOCUS_65850 44077 43802 gene locus_tag LOCUS_65860 44077 43802 CDS product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976841.1 protein_id gnl|my_center|LOCUS_65860 44938 44078 gene locus_tag LOCUS_65870 44938 44078 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976840.1 protein_id gnl|my_center|LOCUS_65870 45200 46015 gene locus_tag LOCUS_65880 45200 46015 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028075.1 protein_id gnl|my_center|LOCUS_65880 46006 46446 gene locus_tag LOCUS_65890 46006 46446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136209006.1 protein_id gnl|my_center|LOCUS_65890 46658 46473 gene locus_tag LOCUS_65900 46658 46473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976837.1 protein_id gnl|my_center|LOCUS_65900 47516 46827 gene locus_tag LOCUS_65910 47516 46827 CDS product DUF899 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976836.1 protein_id gnl|my_center|LOCUS_65910 48968 47658 gene locus_tag LOCUS_65920 48968 47658 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028077.1 protein_id gnl|my_center|LOCUS_65920 51108 49240 gene locus_tag LOCUS_65930 51108 49240 CDS product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028078.1 protein_id gnl|my_center|LOCUS_65930 52135 51356 gene locus_tag LOCUS_65940 52135 51356 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028079.1 protein_id gnl|my_center|LOCUS_65940 53195 52227 gene locus_tag LOCUS_65950 gene pip 53195 52227 CDS product prolyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028082.1 protein_id gnl|my_center|LOCUS_65950 54020 53205 gene locus_tag LOCUS_65960 54020 53205 CDS product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976828.1 protein_id gnl|my_center|LOCUS_65960 54075 54713 gene locus_tag LOCUS_65970 54075 54713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65970 55210 57084 gene locus_tag LOCUS_65980 55210 57084 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484403.1 protein_id gnl|my_center|LOCUS_65980 57825 57145 gene locus_tag LOCUS_65990 57825 57145 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028084.1 protein_id gnl|my_center|LOCUS_65990 58029 58355 gene locus_tag LOCUS_66000 58029 58355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66000 58861 58481 gene locus_tag LOCUS_66010 58861 58481 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976823.1 protein_id gnl|my_center|LOCUS_66010 59549 58944 gene locus_tag LOCUS_66020 gene coaE 59549 58944 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976822.1 protein_id gnl|my_center|LOCUS_66020 60631 59693 gene locus_tag LOCUS_66030 60631 59693 CDS product PAC2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976821.1 protein_id gnl|my_center|LOCUS_66030 62385 60883 gene locus_tag LOCUS_66040 gene rpsA 62385 60883 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976820.1 protein_id gnl|my_center|LOCUS_66040 62531 62746 gene locus_tag LOCUS_66050 62531 62746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66050 62712 63572 gene locus_tag LOCUS_66060 62712 63572 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976818.1 protein_id gnl|my_center|LOCUS_66060 63577 66063 gene locus_tag LOCUS_66070 gene hrpB 63577 66063 CDS product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223186.1 protein_id gnl|my_center|LOCUS_66070 67875 66121 gene locus_tag LOCUS_66080 67875 66121 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028087.1 protein_id gnl|my_center|LOCUS_66080 68583 68194 gene locus_tag LOCUS_66090 68583 68194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66090 71681 68955 gene locus_tag LOCUS_66100 gene polA 71681 68955 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467407.1 protein_id gnl|my_center|LOCUS_66100 72149 74428 gene locus_tag LOCUS_66110 72149 74428 CDS product FdhF/YdeP family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028088.1 protein_id gnl|my_center|LOCUS_66110 74484 74972 gene locus_tag LOCUS_66120 74484 74972 CDS product hotdog fold thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976812.1 protein_id gnl|my_center|LOCUS_66120 75043 75447 gene locus_tag LOCUS_66130 75043 75447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66130 75396 76037 gene locus_tag LOCUS_66140 75396 76037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028091.1 protein_id gnl|my_center|LOCUS_66140 76326 77558 gene locus_tag LOCUS_66150 76326 77558 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976809.1 protein_id gnl|my_center|LOCUS_66150 77672 78604 gene locus_tag LOCUS_66160 77672 78604 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028093.1 protein_id gnl|my_center|LOCUS_66160 78610 80436 gene locus_tag LOCUS_66170 78610 80436 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028094.1 protein_id gnl|my_center|LOCUS_66170 80442 81398 gene locus_tag LOCUS_66180 80442 81398 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976806.1 protein_id gnl|my_center|LOCUS_66180 81395 82111 gene locus_tag LOCUS_66190 81395 82111 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028095.1 protein_id gnl|my_center|LOCUS_66190 82839 82183 gene locus_tag LOCUS_66200 82839 82183 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976804.1 protein_id gnl|my_center|LOCUS_66200 82943 83027 gene locus_tag LOCUS_t00940 82943 83027 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 83112 83900 gene locus_tag LOCUS_66210 83112 83900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66210 85325 83901 gene locus_tag LOCUS_66220 gene pyk 85325 83901 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028096.1 protein_id gnl|my_center|LOCUS_66220 85569 87371 gene locus_tag LOCUS_66230 85569 87371 CDS product 5'-nucleotidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028097.1 protein_id gnl|my_center|LOCUS_66230 88799 87396 gene locus_tag LOCUS_66240 88799 87396 CDS product SidA/IucD/PvdA family monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976800.1 protein_id gnl|my_center|LOCUS_66240 90157 88796 gene locus_tag LOCUS_66250 90157 88796 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028098.1 protein_id gnl|my_center|LOCUS_66250 93166 90665 gene locus_tag LOCUS_66260 gene pepN 93166 90665 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189283751.1 protein_id gnl|my_center|LOCUS_66260 93818 93216 gene locus_tag LOCUS_66270 93818 93216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66270 94325 93975 gene locus_tag LOCUS_66280 94325 93975 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976797.1 protein_id gnl|my_center|LOCUS_66280 94443 95336 gene locus_tag LOCUS_66290 94443 95336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028100.1 protein_id gnl|my_center|LOCUS_66290 96911 95448 gene locus_tag LOCUS_66300 96911 95448 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976791.1 protein_id gnl|my_center|LOCUS_66300 101415 96904 gene locus_tag LOCUS_66310 gene gltB 101415 96904 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028104.1 protein_id gnl|my_center|LOCUS_66310 102605 101874 gene locus_tag LOCUS_66320 102605 101874 CDS product VIT1/CCC1 transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976789.1 protein_id gnl|my_center|LOCUS_66320 102846 103856 gene locus_tag LOCUS_66330 102846 103856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_66330 103853 105187 gene locus_tag LOCUS_66340 103853 105187 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028106.1 protein_id gnl|my_center|LOCUS_66340 105184 106347 gene locus_tag LOCUS_66350 105184 106347 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028107.1 protein_id gnl|my_center|LOCUS_66350 106436 107800 gene locus_tag LOCUS_66360 106436 107800 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028108.1 protein_id gnl|my_center|LOCUS_66360 107797 108993 gene locus_tag LOCUS_66370 107797 108993 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041861981.1 protein_id gnl|my_center|LOCUS_66370 108990 109805 gene locus_tag LOCUS_66380 108990 109805 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028109.1 protein_id gnl|my_center|LOCUS_66380 110859 109873 gene locus_tag LOCUS_66390 gene lgt 110859 109873 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976782.1 protein_id gnl|my_center|LOCUS_66390 111721 110945 gene locus_tag LOCUS_66400 111721 110945 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168715374.1 protein_id gnl|my_center|LOCUS_66400 112600 111785 gene locus_tag LOCUS_66410 gene trpA 112600 111785 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976780.1 protein_id gnl|my_center|LOCUS_66410 113880 112597 gene locus_tag LOCUS_66420 gene trpB 113880 112597 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976779.1 protein_id gnl|my_center|LOCUS_66420 115020 114211 gene locus_tag LOCUS_66430 gene trpC 115020 114211 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028110.1 protein_id gnl|my_center|LOCUS_66430 115594 115142 gene locus_tag LOCUS_66440 115594 115142 CDS product DUF2752 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028111.1 protein_id gnl|my_center|LOCUS_66440 115942 115685 gene locus_tag LOCUS_66450 115942 115685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028112.1 protein_id gnl|my_center|LOCUS_66450 115869 116051 gene locus_tag LOCUS_66460 115869 116051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66460 116770 116129 gene locus_tag LOCUS_66470 116770 116129 CDS product TIGR02234 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028113.1 protein_id gnl|my_center|LOCUS_66470 118301 116823 gene locus_tag LOCUS_66480 118301 116823 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976773.1 protein_id gnl|my_center|LOCUS_66480 118711 118313 gene locus_tag LOCUS_66490 gene hisI 118711 118313 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976772.1 protein_id gnl|my_center|LOCUS_66490 118786 119421 gene locus_tag LOCUS_66500 118786 119421 CDS product TIGR03085 family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028115.1 protein_id gnl|my_center|LOCUS_66500 120283 119528 gene locus_tag LOCUS_66510 gene hisF 120283 119528 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976768.1 protein_id gnl|my_center|LOCUS_66510 120693 120280 gene locus_tag LOCUS_66520 120693 120280 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976767.1 protein_id gnl|my_center|LOCUS_66520 121415 120690 gene locus_tag LOCUS_66530 gene priA 121415 120690 CDS product bifunctional 1-(5-phosphoribosyl)-5-((5-phosphoribosylamino)methylideneamino)imidazole-4-carboxamide isomerase/phosphoribosylanthranilate isomerase PriA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976766.1 protein_id gnl|my_center|LOCUS_66530 122064 121420 gene locus_tag LOCUS_66540 gene hisH 122064 121420 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976765.1 protein_id gnl|my_center|LOCUS_66540 122225 122061 gene locus_tag LOCUS_66550 122225 122061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66550 122815 122222 gene locus_tag LOCUS_66560 gene hisB 122815 122222 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976763.1 protein_id gnl|my_center|LOCUS_66560 123924 122812 gene locus_tag LOCUS_66570 123924 122812 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976762.1 protein_id gnl|my_center|LOCUS_66570 125246 123921 gene locus_tag LOCUS_66580 gene hisD 125246 123921 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028117.1 protein_id gnl|my_center|LOCUS_66580 125416 127002 gene locus_tag LOCUS_66590 125416 127002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028118.1 protein_id gnl|my_center|LOCUS_66590 127199 128218 gene locus_tag LOCUS_66600 127199 128218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028119.1 protein_id gnl|my_center|LOCUS_66600 128230 128970 gene locus_tag LOCUS_66610 128230 128970 CDS product LON peptidase substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028120.1 protein_id gnl|my_center|LOCUS_66610 128994 129494 gene locus_tag LOCUS_66620 gene ybaK 128994 129494 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976757.1 protein_id gnl|my_center|LOCUS_66620 >Feature sequence21 110 1363 gene locus_tag LOCUS_66630 110 1363 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484811.1 protein_id gnl|my_center|LOCUS_66630 1376 2329 gene locus_tag LOCUS_66640 1376 2329 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270459.1 protein_id gnl|my_center|LOCUS_66640 2335 3189 gene locus_tag LOCUS_66650 2335 3189 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977772.1 protein_id gnl|my_center|LOCUS_66650 3222 4601 gene locus_tag LOCUS_66660 3222 4601 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027550.1 protein_id gnl|my_center|LOCUS_66660 5961 4720 gene locus_tag LOCUS_66670 5961 4720 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027551.1 protein_id gnl|my_center|LOCUS_66670 6124 7332 gene locus_tag LOCUS_66680 6124 7332 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027555.1 protein_id gnl|my_center|LOCUS_66680 7427 8161 gene locus_tag LOCUS_66690 7427 8161 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027556.1 protein_id gnl|my_center|LOCUS_66690 8203 8496 gene locus_tag LOCUS_66700 8203 8496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66700 9122 8457 gene locus_tag LOCUS_66710 9122 8457 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027558.1 protein_id gnl|my_center|LOCUS_66710 10372 9119 gene locus_tag LOCUS_66720 10372 9119 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027559.1 protein_id gnl|my_center|LOCUS_66720 11779 10463 gene locus_tag LOCUS_66730 11779 10463 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977757.1 protein_id gnl|my_center|LOCUS_66730 11939 13294 gene locus_tag LOCUS_66740 11939 13294 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977756.1 protein_id gnl|my_center|LOCUS_66740 14349 13279 gene locus_tag LOCUS_66750 14349 13279 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977755.1 protein_id gnl|my_center|LOCUS_66750 14666 14493 gene locus_tag LOCUS_66760 14666 14493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66760 15848 14895 gene locus_tag LOCUS_66770 15848 14895 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027561.1 protein_id gnl|my_center|LOCUS_66770 16109 17161 gene locus_tag LOCUS_66780 16109 17161 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977752.1 protein_id gnl|my_center|LOCUS_66780 17168 18016 gene locus_tag LOCUS_66790 17168 18016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977751.1 protein_id gnl|my_center|LOCUS_66790 19238 17949 gene locus_tag LOCUS_66800 19238 17949 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027563.1 protein_id gnl|my_center|LOCUS_66800 20373 19411 gene locus_tag LOCUS_66810 20373 19411 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027564.1 protein_id gnl|my_center|LOCUS_66810 21192 20428 gene locus_tag LOCUS_66820 21192 20428 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027565.1 protein_id gnl|my_center|LOCUS_66820 21955 21446 gene locus_tag LOCUS_66830 21955 21446 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977747.1 protein_id gnl|my_center|LOCUS_66830 22415 22095 gene locus_tag LOCUS_66840 22415 22095 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977746.1 protein_id gnl|my_center|LOCUS_66840 22654 23382 gene locus_tag LOCUS_66850 22654 23382 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977745.1 protein_id gnl|my_center|LOCUS_66850 23995 23390 gene locus_tag LOCUS_66860 23995 23390 CDS product transglutaminase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162495104.1 protein_id gnl|my_center|LOCUS_66860 25141 24071 gene locus_tag LOCUS_66870 25141 24071 CDS product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027566.1 protein_id gnl|my_center|LOCUS_66870 25923 25138 gene locus_tag LOCUS_66880 25923 25138 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325632.1 protein_id gnl|my_center|LOCUS_66880 27257 25920 gene locus_tag LOCUS_66890 27257 25920 CDS product DUF6421 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977741.1 protein_id gnl|my_center|LOCUS_66890 27526 28209 gene locus_tag LOCUS_66900 27526 28209 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027567.1 protein_id gnl|my_center|LOCUS_66900 28761 28213 gene locus_tag LOCUS_66910 28761 28213 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027568.1 protein_id gnl|my_center|LOCUS_66910 29050 29229 gene locus_tag LOCUS_66920 29050 29229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66920 30146 29211 gene locus_tag LOCUS_66930 30146 29211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66930 30809 30252 gene locus_tag LOCUS_66940 30809 30252 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027573.1 protein_id gnl|my_center|LOCUS_66940 32482 30806 gene locus_tag LOCUS_66950 32482 30806 CDS product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037897270.1 protein_id gnl|my_center|LOCUS_66950 32666 33211 gene locus_tag LOCUS_66960 32666 33211 CDS product DUF5134 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027575.1 protein_id gnl|my_center|LOCUS_66960 33208 33963 gene locus_tag LOCUS_66970 33208 33963 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977730.1 protein_id gnl|my_center|LOCUS_66970 34177 34845 gene locus_tag LOCUS_66980 34177 34845 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977728.1 protein_id gnl|my_center|LOCUS_66980 36335 34833 gene locus_tag LOCUS_66990 36335 34833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977727.1 protein_id gnl|my_center|LOCUS_66990 36643 36332 gene locus_tag LOCUS_67000 36643 36332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67000 36528 37193 gene locus_tag LOCUS_67010 36528 37193 CDS product DUF305 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977726.1 protein_id gnl|my_center|LOCUS_67010 37685 37230 gene locus_tag LOCUS_67020 37685 37230 CDS product DUF6214 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027578.1 protein_id gnl|my_center|LOCUS_67020 37883 39226 gene locus_tag LOCUS_67030 37883 39226 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479549.1 protein_id gnl|my_center|LOCUS_67030 39365 40765 gene locus_tag LOCUS_67040 39365 40765 CDS product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006718507.1 protein_id gnl|my_center|LOCUS_67040 41041 40685 gene locus_tag LOCUS_67050 41041 40685 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977724.1 protein_id gnl|my_center|LOCUS_67050 41404 42207 gene locus_tag LOCUS_67060 41404 42207 CDS product pectate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027579.1 protein_id gnl|my_center|LOCUS_67060 43002 42253 gene locus_tag LOCUS_67070 43002 42253 CDS product PaaX family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173668803.1 protein_id gnl|my_center|LOCUS_67070 43075 44742 gene locus_tag LOCUS_67080 43075 44742 CDS product DNA alkylation response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027581.1 protein_id gnl|my_center|LOCUS_67080 44796 45950 gene locus_tag LOCUS_67090 44796 45950 CDS product sialidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484633.1 protein_id gnl|my_center|LOCUS_67090 46663 45986 gene locus_tag LOCUS_67100 46663 45986 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027583.1 protein_id gnl|my_center|LOCUS_67100 46777 47784 gene locus_tag LOCUS_67110 46777 47784 CDS product BadF/BadG/BcrA/BcrD ATPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027584.1 protein_id gnl|my_center|LOCUS_67110 47964 48845 gene locus_tag LOCUS_67120 47964 48845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027585.1 protein_id gnl|my_center|LOCUS_67120 49950 48910 gene locus_tag LOCUS_67130 49950 48910 CDS product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977714.1 protein_id gnl|my_center|LOCUS_67130 51490 50000 gene locus_tag LOCUS_67140 51490 50000 CDS product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027586.1 protein_id gnl|my_center|LOCUS_67140 51742 52218 gene locus_tag LOCUS_67150 51742 52218 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977712.1 protein_id gnl|my_center|LOCUS_67150 52472 53218 gene locus_tag LOCUS_67160 52472 53218 CDS product DUF4142 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027588.1 protein_id gnl|my_center|LOCUS_67160 53974 53237 gene locus_tag LOCUS_67170 53974 53237 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027589.1 protein_id gnl|my_center|LOCUS_67170 54095 54490 gene locus_tag LOCUS_67180 54095 54490 CDS product DUF5997 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977708.1 protein_id gnl|my_center|LOCUS_67180 55079 54504 gene locus_tag LOCUS_67190 55079 54504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67190 55537 55046 gene locus_tag LOCUS_67200 55537 55046 CDS product DUF1360 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027590.1 protein_id gnl|my_center|LOCUS_67200 55943 55524 gene locus_tag LOCUS_67210 55943 55524 CDS product DUF2267 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977706.1 protein_id gnl|my_center|LOCUS_67210 57163 55955 gene locus_tag LOCUS_67220 57163 55955 CDS product galactosyldiacylglycerol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484813.1 protein_id gnl|my_center|LOCUS_67220 57507 57292 gene locus_tag LOCUS_67230 57507 57292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67230 57404 58258 gene locus_tag LOCUS_67240 57404 58258 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325650.1 protein_id gnl|my_center|LOCUS_67240 58265 59230 gene locus_tag LOCUS_67250 58265 59230 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027594.1 protein_id gnl|my_center|LOCUS_67250 59227 60156 gene locus_tag LOCUS_67260 59227 60156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67260 61234 60104 gene locus_tag LOCUS_67270 61234 60104 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027597.1 protein_id gnl|my_center|LOCUS_67270 63350 61227 gene locus_tag LOCUS_67280 63350 61227 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027598.1 protein_id gnl|my_center|LOCUS_67280 64339 63347 gene locus_tag LOCUS_67290 64339 63347 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027599.1 protein_id gnl|my_center|LOCUS_67290 64914 64336 gene locus_tag LOCUS_67300 64914 64336 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027600.1 protein_id gnl|my_center|LOCUS_67300 65141 65722 gene locus_tag LOCUS_67310 gene xdhR 65141 65722 CDS product purine salvage operon transcriptional regulator XdhR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977696.1 protein_id gnl|my_center|LOCUS_67310 65999 67402 gene locus_tag LOCUS_67320 65999 67402 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229564.1 protein_id gnl|my_center|LOCUS_67320 67450 68478 gene locus_tag LOCUS_67330 67450 68478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67330 68989 71895 gene locus_tag LOCUS_67340 68989 71895 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031112.1 protein_id gnl|my_center|LOCUS_67340 72757 71981 gene locus_tag LOCUS_67350 72757 71981 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977695.1 protein_id gnl|my_center|LOCUS_67350 72947 73930 gene locus_tag LOCUS_67360 72947 73930 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168715268.1 protein_id gnl|my_center|LOCUS_67360 73927 74454 gene locus_tag LOCUS_67370 73927 74454 CDS product tripartite tricarboxylate transporter TctB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027603.1 protein_id gnl|my_center|LOCUS_67370 74456 75940 gene locus_tag LOCUS_67380 74456 75940 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027604.1 protein_id gnl|my_center|LOCUS_67380 76167 77855 gene locus_tag LOCUS_67390 76167 77855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67390 77865 80777 gene locus_tag LOCUS_67400 77865 80777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67400 80680 80874 gene locus_tag LOCUS_67410 80680 80874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67410 80871 82085 gene locus_tag LOCUS_67420 80871 82085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67420 82568 82146 gene locus_tag LOCUS_67430 82568 82146 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977690.1 protein_id gnl|my_center|LOCUS_67430 82633 83712 gene locus_tag LOCUS_67440 82633 83712 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027605.1 protein_id gnl|my_center|LOCUS_67440 84501 83725 gene locus_tag LOCUS_67450 gene mltG 84501 83725 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027606.1 protein_id gnl|my_center|LOCUS_67450 84539 84928 gene locus_tag LOCUS_67460 84539 84928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67460 86771 84969 gene locus_tag LOCUS_67470 86771 84969 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977687.1 protein_id gnl|my_center|LOCUS_67470 86896 87402 gene locus_tag LOCUS_67480 86896 87402 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027607.1 protein_id gnl|my_center|LOCUS_67480 87592 89463 gene locus_tag LOCUS_67490 87592 89463 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030253.1 protein_id gnl|my_center|LOCUS_67490 89460 91241 gene locus_tag LOCUS_67500 89460 91241 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027610.1 protein_id gnl|my_center|LOCUS_67500 91564 91208 gene locus_tag LOCUS_67510 91564 91208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67510 91668 91943 gene locus_tag LOCUS_67520 91668 91943 CDS product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027612.1 protein_id gnl|my_center|LOCUS_67520 92773 91979 gene locus_tag LOCUS_67530 92773 91979 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977680.1 protein_id gnl|my_center|LOCUS_67530 92919 95432 gene locus_tag LOCUS_67540 92919 95432 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027613.1 protein_id gnl|my_center|LOCUS_67540 95452 96318 gene locus_tag LOCUS_67550 95452 96318 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027614.1 protein_id gnl|my_center|LOCUS_67550 97406 96354 gene locus_tag LOCUS_67560 97406 96354 CDS product DUF6397 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027615.1 protein_id gnl|my_center|LOCUS_67560 97958 97554 gene locus_tag LOCUS_67570 97958 97554 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977676.1 protein_id gnl|my_center|LOCUS_67570 98061 98489 gene locus_tag LOCUS_67580 98061 98489 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027616.1 protein_id gnl|my_center|LOCUS_67580 98610 99218 gene locus_tag LOCUS_67590 98610 99218 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027620.1 protein_id gnl|my_center|LOCUS_67590 99520 99786 gene locus_tag LOCUS_67600 99520 99786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_150469750.1 protein_id gnl|my_center|LOCUS_67600 99921 100859 gene locus_tag LOCUS_67610 99921 100859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027623.1 protein_id gnl|my_center|LOCUS_67610 101083 102468 gene locus_tag LOCUS_67620 101083 102468 CDS product tannase/feruloyl esterase family alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227742.1 protein_id gnl|my_center|LOCUS_67620 102667 102485 gene locus_tag LOCUS_67630 102667 102485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325661.1 protein_id gnl|my_center|LOCUS_67630 103003 105801 gene locus_tag LOCUS_67640 103003 105801 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030777.1 protein_id gnl|my_center|LOCUS_67640 105798 107072 gene locus_tag LOCUS_67650 105798 107072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027625.1 protein_id gnl|my_center|LOCUS_67650 107382 107089 gene locus_tag LOCUS_67660 107382 107089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67660 >Feature sequence22 712 119 gene locus_tag LOCUS_67670 712 119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028121.1 protein_id gnl|my_center|LOCUS_67670 1730 822 gene locus_tag LOCUS_67680 1730 822 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109031846.1 protein_id gnl|my_center|LOCUS_67680 2701 1727 gene locus_tag LOCUS_67690 2701 1727 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028123.1 protein_id gnl|my_center|LOCUS_67690 4046 2835 gene locus_tag LOCUS_67700 4046 2835 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028124.1 protein_id gnl|my_center|LOCUS_67700 4269 4433 gene locus_tag LOCUS_67710 4269 4433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976752.1 protein_id gnl|my_center|LOCUS_67710 8062 4523 gene locus_tag LOCUS_67720 gene dnaE 8062 4523 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976751.1 protein_id gnl|my_center|LOCUS_67720 8299 9624 gene locus_tag LOCUS_67730 8299 9624 CDS product DUF2252 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976750.1 protein_id gnl|my_center|LOCUS_67730 9705 10409 gene locus_tag LOCUS_67740 9705 10409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976749.1 protein_id gnl|my_center|LOCUS_67740 10488 11300 gene locus_tag LOCUS_67750 10488 11300 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976748.1 protein_id gnl|my_center|LOCUS_67750 11388 13097 gene locus_tag LOCUS_67760 11388 13097 CDS product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014996.1 protein_id gnl|my_center|LOCUS_67760 13700 13125 gene locus_tag LOCUS_67770 13700 13125 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976746.1 protein_id gnl|my_center|LOCUS_67770 13806 14924 gene locus_tag LOCUS_67780 13806 14924 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976745.1 protein_id gnl|my_center|LOCUS_67780 16532 14946 gene locus_tag LOCUS_67790 16532 14946 CDS product Na+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028126.1 protein_id gnl|my_center|LOCUS_67790 17025 16621 gene locus_tag LOCUS_67800 17025 16621 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189283762.1 protein_id gnl|my_center|LOCUS_67800 18059 17085 gene locus_tag LOCUS_67810 18059 17085 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976742.1 protein_id gnl|my_center|LOCUS_67810 18708 18088 gene locus_tag LOCUS_67820 gene lspA 18708 18088 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028127.1 protein_id gnl|my_center|LOCUS_67820 19229 18759 gene locus_tag LOCUS_67830 19229 18759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67830 19790 22936 gene locus_tag LOCUS_67840 gene ileS 19790 22936 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976739.1 protein_id gnl|my_center|LOCUS_67840 24283 23093 gene locus_tag LOCUS_67850 gene divIVA 24283 23093 CDS product apical growth/hyphal branching protein DivIVA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976738.1 protein_id gnl|my_center|LOCUS_67850 24623 24339 gene locus_tag LOCUS_67860 24623 24339 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976737.1 protein_id gnl|my_center|LOCUS_67860 25312 24671 gene locus_tag LOCUS_67870 gene sepF 25312 24671 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976736.1 protein_id gnl|my_center|LOCUS_67870 26161 25442 gene locus_tag LOCUS_67880 26161 25442 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028129.1 protein_id gnl|my_center|LOCUS_67880 26905 26168 gene locus_tag LOCUS_67890 gene pgeF 26905 26168 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028130.1 protein_id gnl|my_center|LOCUS_67890 28104 26902 gene locus_tag LOCUS_67900 gene ftsZ 28104 26902 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976733.1 protein_id gnl|my_center|LOCUS_67900 29197 28403 gene locus_tag LOCUS_67910 gene ftsQ 29197 28403 CDS product cell division protein FtsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976732.1 protein_id gnl|my_center|LOCUS_67910 30317 29223 gene locus_tag LOCUS_67920 gene murG 30317 29223 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976731.1 protein_id gnl|my_center|LOCUS_67920 31694 30324 gene locus_tag LOCUS_67930 gene ftsW 31694 30324 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976730.1 protein_id gnl|my_center|LOCUS_67930 33191 31770 gene locus_tag LOCUS_67940 gene murD 33191 31770 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976729.1 protein_id gnl|my_center|LOCUS_67940 34282 33188 gene locus_tag LOCUS_67950 gene mraY 34282 33188 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976728.1 protein_id gnl|my_center|LOCUS_67950 35685 34279 gene locus_tag LOCUS_67960 35685 34279 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976727.1 protein_id gnl|my_center|LOCUS_67960 37234 35714 gene locus_tag LOCUS_67970 37234 35714 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028131.1 protein_id gnl|my_center|LOCUS_67970 37115 37423 gene locus_tag LOCUS_67980 37115 37423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67980 39377 37407 gene locus_tag LOCUS_67990 gene ftsI 39377 37407 CDS product cell division protein FtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028132.1 protein_id gnl|my_center|LOCUS_67990 39832 39383 gene locus_tag LOCUS_68000 39832 39383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_68000 40805 39876 gene locus_tag LOCUS_68010 gene rsmH 40805 39876 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976723.1 protein_id gnl|my_center|LOCUS_68010 41579 42592 gene locus_tag LOCUS_68020 41579 42592 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976721.1 protein_id gnl|my_center|LOCUS_68020 42592 43974 gene locus_tag LOCUS_68030 42592 43974 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486197.1 protein_id gnl|my_center|LOCUS_68030 44012 46507 gene locus_tag LOCUS_68040 44012 46507 CDS product DUF3488 and transglutaminase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486200.1 protein_id gnl|my_center|LOCUS_68040 47110 46709 gene locus_tag LOCUS_68050 47110 46709 CDS product spore wall synthesis complex protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028137.1 protein_id gnl|my_center|LOCUS_68050 48167 47388 gene locus_tag LOCUS_68060 48167 47388 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028138.1 protein_id gnl|my_center|LOCUS_68060 48869 48306 gene locus_tag LOCUS_68070 48869 48306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68070 49525 51048 gene locus_tag LOCUS_68080 49525 51048 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028141.1 protein_id gnl|my_center|LOCUS_68080 52124 51150 gene locus_tag LOCUS_68090 52124 51150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028142.1 protein_id gnl|my_center|LOCUS_68090 53050 52181 gene locus_tag LOCUS_68100 gene metF 53050 52181 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028143.1 protein_id gnl|my_center|LOCUS_68100 53862 53170 gene locus_tag LOCUS_68110 gene thiE 53862 53170 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976712.1 protein_id gnl|my_center|LOCUS_68110 54434 54069 gene locus_tag LOCUS_68120 54434 54069 CDS product Rv2175c family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805032.1 protein_id gnl|my_center|LOCUS_68120 55740 54499 gene locus_tag LOCUS_68130 55740 54499 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486236.1 protein_id gnl|my_center|LOCUS_68130 55984 57162 gene locus_tag LOCUS_68140 gene thiO 55984 57162 CDS product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421597.1 protein_id gnl|my_center|LOCUS_68140 57159 57359 gene locus_tag LOCUS_68150 gene thiS 57159 57359 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976708.1 protein_id gnl|my_center|LOCUS_68150 57363 58157 gene locus_tag LOCUS_68160 57363 58157 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976707.1 protein_id gnl|my_center|LOCUS_68160 58387 60318 gene locus_tag LOCUS_68170 gene pknB 58387 60318 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486214.1 protein_id gnl|my_center|LOCUS_68170 60430 61254 gene locus_tag LOCUS_68180 60430 61254 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976705.1 protein_id gnl|my_center|LOCUS_68180 61923 61276 gene locus_tag LOCUS_68190 61923 61276 CDS product sulfite oxidase-like oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976704.1 protein_id gnl|my_center|LOCUS_68190 62105 62599 gene locus_tag LOCUS_68200 gene bfr 62105 62599 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976703.1 protein_id gnl|my_center|LOCUS_68200 62843 62619 gene locus_tag LOCUS_68210 62843 62619 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976702.1 protein_id gnl|my_center|LOCUS_68210 64269 63019 gene locus_tag LOCUS_68220 64269 63019 CDS product 3-deoxy-7-phosphoheptulonate synthase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976701.1 protein_id gnl|my_center|LOCUS_68220 64640 66520 gene locus_tag LOCUS_68230 64640 66520 CDS product phenazine-specific anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028148.1 protein_id gnl|my_center|LOCUS_68230 67467 66472 gene locus_tag LOCUS_68240 67467 66472 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976697.1 protein_id gnl|my_center|LOCUS_68240 68590 67562 gene locus_tag LOCUS_68250 68590 67562 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976696.1 protein_id gnl|my_center|LOCUS_68250 69322 68645 gene locus_tag LOCUS_68260 69322 68645 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976695.1 protein_id gnl|my_center|LOCUS_68260 70559 69315 gene locus_tag LOCUS_68270 70559 69315 CDS product DUF5931 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976694.1 protein_id gnl|my_center|LOCUS_68270 71463 70585 gene locus_tag LOCUS_68280 71463 70585 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167469516.1 protein_id gnl|my_center|LOCUS_68280 71622 72422 gene locus_tag LOCUS_68290 71622 72422 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028151.1 protein_id gnl|my_center|LOCUS_68290 72415 73056 gene locus_tag LOCUS_68300 72415 73056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976691.1 protein_id gnl|my_center|LOCUS_68300 73841 73086 gene locus_tag LOCUS_68310 73841 73086 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976690.1 protein_id gnl|my_center|LOCUS_68310 74909 73956 gene locus_tag LOCUS_68320 74909 73956 CDS product ROK family glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976689.1 protein_id gnl|my_center|LOCUS_68320 75507 74977 gene locus_tag LOCUS_68330 75507 74977 CDS product carbon catabolit repression protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028152.1 protein_id gnl|my_center|LOCUS_68330 76737 75565 gene locus_tag LOCUS_68340 76737 75565 CDS product ArsA-related P-loop ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976687.1 protein_id gnl|my_center|LOCUS_68340 77279 76839 gene locus_tag LOCUS_68350 77279 76839 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976686.1 protein_id gnl|my_center|LOCUS_68350 78185 77394 gene locus_tag LOCUS_68360 78185 77394 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028154.1 protein_id gnl|my_center|LOCUS_68360 78475 80271 gene locus_tag LOCUS_68370 78475 80271 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028155.1 protein_id gnl|my_center|LOCUS_68370 81507 80365 gene locus_tag LOCUS_68380 81507 80365 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486225.1 protein_id gnl|my_center|LOCUS_68380 81629 82873 gene locus_tag LOCUS_68390 81629 82873 CDS product glycosyltransferase family 87 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326026.1 protein_id gnl|my_center|LOCUS_68390 84061 82892 gene locus_tag LOCUS_68400 84061 82892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030869422.1 protein_id gnl|my_center|LOCUS_68400 85156 84143 gene locus_tag LOCUS_68410 85156 84143 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976680.1 protein_id gnl|my_center|LOCUS_68410 86370 85363 gene locus_tag LOCUS_68420 86370 85363 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028159.1 protein_id gnl|my_center|LOCUS_68420 87993 86650 gene locus_tag LOCUS_68430 87993 86650 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028160.1 protein_id gnl|my_center|LOCUS_68430 88267 88028 gene locus_tag LOCUS_68440 88267 88028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976677.1 protein_id gnl|my_center|LOCUS_68440 88503 89180 gene locus_tag LOCUS_68450 88503 89180 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028161.1 protein_id gnl|my_center|LOCUS_68450 89177 89458 gene locus_tag LOCUS_68460 89177 89458 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976675.1 protein_id gnl|my_center|LOCUS_68460 90854 89493 gene locus_tag LOCUS_68470 90854 89493 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028165.1 protein_id gnl|my_center|LOCUS_68470 92248 91184 gene locus_tag LOCUS_68480 gene trpD 92248 91184 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028166.1 protein_id gnl|my_center|LOCUS_68480 94015 92378 gene locus_tag LOCUS_68490 94015 92378 CDS product cytochrome bc complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028167.1 protein_id gnl|my_center|LOCUS_68490 95100 94012 gene locus_tag LOCUS_68500 95100 94012 CDS product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976666.1 protein_id gnl|my_center|LOCUS_68500 95870 95061 gene locus_tag LOCUS_68510 95870 95061 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976665.1 protein_id gnl|my_center|LOCUS_68510 96556 95936 gene locus_tag LOCUS_68520 96556 95936 CDS product heme-copper oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976664.1 protein_id gnl|my_center|LOCUS_68520 96734 97135 gene locus_tag LOCUS_68530 96734 97135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976663.1 protein_id gnl|my_center|LOCUS_68530 98422 97148 gene locus_tag LOCUS_68540 98422 97148 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976662.1 protein_id gnl|my_center|LOCUS_68540 98950 98552 gene locus_tag LOCUS_68550 98950 98552 CDS product cytochrome c oxidase subunit 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976661.1 protein_id gnl|my_center|LOCUS_68550 >Feature sequence23 288 476 gene locus_tag LOCUS_68560 288 476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68560 2211 385 gene locus_tag LOCUS_68570 2211 385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_68570 2921 3265 gene locus_tag LOCUS_68580 2921 3265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68580 3418 3915 gene locus_tag LOCUS_68590 3418 3915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68590 4013 4468 gene locus_tag LOCUS_68600 4013 4468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68600 4960 5604 gene locus_tag LOCUS_68610 4960 5604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68610 5635 5850 gene locus_tag LOCUS_68620 5635 5850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68620 6145 7077 gene locus_tag LOCUS_68630 6145 7077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_68630 6981 7304 gene locus_tag LOCUS_68640 6981 7304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68640 7544 8161 gene locus_tag LOCUS_68650 7544 8161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68650 8372 8599 gene locus_tag LOCUS_68660 8372 8599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68660 9059 9529 gene locus_tag LOCUS_68670 9059 9529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68670 9783 10382 gene locus_tag LOCUS_68680 9783 10382 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259737.1 protein_id gnl|my_center|LOCUS_68680 10884 11048 gene locus_tag LOCUS_68690 10884 11048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68690 11515 11120 gene locus_tag LOCUS_68700 11515 11120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68700 12346 12122 gene locus_tag LOCUS_68710 12346 12122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68710 12580 12771 gene locus_tag LOCUS_68720 12580 12771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_68720 12884 13726 gene locus_tag LOCUS_68730 12884 13726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189786725.1 protein_id gnl|my_center|LOCUS_68730 14079 14555 gene locus_tag LOCUS_68740 14079 14555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68740 22364 14907 gene locus_tag LOCUS_68750 22364 14907 CDS product type I polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550042.1 protein_id gnl|my_center|LOCUS_68750 22835 23974 gene locus_tag LOCUS_68760 22835 23974 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484788.1 protein_id gnl|my_center|LOCUS_68760 24699 24025 gene locus_tag LOCUS_68770 24699 24025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68770 25085 24696 gene locus_tag LOCUS_68780 25085 24696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68780 25711 25076 gene locus_tag LOCUS_68790 25711 25076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68790 26032 25799 gene locus_tag LOCUS_68800 26032 25799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68800 26396 26199 gene locus_tag LOCUS_68810 26396 26199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68810 27064 26918 gene locus_tag LOCUS_68820 27064 26918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68820 28509 27307 gene locus_tag LOCUS_68830 28509 27307 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_150490919.1 protein_id gnl|my_center|LOCUS_68830 29021 29455 gene locus_tag LOCUS_68840 29021 29455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68840 29539 29913 gene locus_tag LOCUS_68850 29539 29913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68850 30090 30410 gene locus_tag LOCUS_68860 30090 30410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68860 30386 31132 gene locus_tag LOCUS_68870 30386 31132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68870 31123 31755 gene locus_tag LOCUS_68880 31123 31755 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929897.1 protein_id gnl|my_center|LOCUS_68880 31752 33299 gene locus_tag LOCUS_68890 31752 33299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68890 34058 33885 gene locus_tag LOCUS_68900 34058 33885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68900 34327 34001 gene locus_tag LOCUS_68910 34327 34001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68910 34350 34595 gene locus_tag LOCUS_68920 34350 34595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68920 35130 34978 gene locus_tag LOCUS_68930 35130 34978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68930 36100 35873 gene locus_tag LOCUS_68940 36100 35873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68940 36739 37359 gene locus_tag LOCUS_68950 36739 37359 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028485.1 protein_id gnl|my_center|LOCUS_68950 37376 37738 gene locus_tag LOCUS_68960 37376 37738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68960 37804 37938 gene locus_tag LOCUS_68970 37804 37938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68970 37935 38558 gene locus_tag LOCUS_68980 37935 38558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68980 39446 38943 gene locus_tag LOCUS_68990 39446 38943 CDS product flavodoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226004.1 protein_id gnl|my_center|LOCUS_68990 40191 39460 gene locus_tag LOCUS_69000 40191 39460 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026928.1 protein_id gnl|my_center|LOCUS_69000 42900 40204 gene locus_tag LOCUS_69010 42900 40204 CDS product bifunctional GNAT family N-acetyltransferase/acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227290.1 protein_id gnl|my_center|LOCUS_69010 45258 43516 gene locus_tag LOCUS_69020 45258 43516 CDS product two-component system sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026923.1 protein_id gnl|my_center|LOCUS_69020 46402 45377 gene locus_tag LOCUS_69030 gene gap 46402 45377 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976871.1 protein_id gnl|my_center|LOCUS_69030 46873 47058 gene locus_tag LOCUS_69040 46873 47058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69040 48426 47524 gene locus_tag LOCUS_69050 48426 47524 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978666.1 protein_id gnl|my_center|LOCUS_69050 48733 49482 gene locus_tag LOCUS_69060 48733 49482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69060 49835 50299 gene locus_tag LOCUS_69070 49835 50299 CDS product cyclic nucleotide-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030862045.1 protein_id gnl|my_center|LOCUS_69070 50323 50988 gene locus_tag LOCUS_69080 50323 50988 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030862048.1 protein_id gnl|my_center|LOCUS_69080 51550 51110 gene locus_tag LOCUS_69090 51550 51110 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026920.1 protein_id gnl|my_center|LOCUS_69090 51716 52033 gene locus_tag LOCUS_69100 51716 52033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69100 52206 52988 gene locus_tag LOCUS_69110 52206 52988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69110 54075 53212 gene locus_tag LOCUS_69120 54075 53212 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026921.1 protein_id gnl|my_center|LOCUS_69120 55103 54081 gene locus_tag LOCUS_69130 gene adhP 55103 54081 CDS product alcohol dehydrogenase AdhP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978667.1 protein_id gnl|my_center|LOCUS_69130 56040 55135 gene locus_tag LOCUS_69140 56040 55135 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978666.1 protein_id gnl|my_center|LOCUS_69140 56861 56187 gene locus_tag LOCUS_69150 56861 56187 CDS product DoxX family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173668689.1 protein_id gnl|my_center|LOCUS_69150 57087 58070 gene locus_tag LOCUS_69160 57087 58070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026922.1 protein_id gnl|my_center|LOCUS_69160 58510 58884 gene locus_tag LOCUS_69170 58510 58884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69170 59114 58827 gene locus_tag LOCUS_69180 59114 58827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69180 59958 59344 gene locus_tag LOCUS_69190 59958 59344 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026924.1 protein_id gnl|my_center|LOCUS_69190 60884 60135 gene locus_tag LOCUS_69200 gene pflA 60884 60135 CDS product pyruvate formate-lyase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068217.1 protein_id gnl|my_center|LOCUS_69200 63142 60881 gene locus_tag LOCUS_69210 gene pflB 63142 60881 CDS product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056834.1 protein_id gnl|my_center|LOCUS_69210 64314 63397 gene locus_tag LOCUS_69220 64314 63397 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978666.1 protein_id gnl|my_center|LOCUS_69220 65448 64504 gene locus_tag LOCUS_69230 65448 64504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69230 65686 68382 gene locus_tag LOCUS_69240 gene ppdK 65686 68382 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026926.1 protein_id gnl|my_center|LOCUS_69240 68513 68896 gene locus_tag LOCUS_69250 68513 68896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026927.1 protein_id gnl|my_center|LOCUS_69250 68976 69752 gene locus_tag LOCUS_69260 68976 69752 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026928.1 protein_id gnl|my_center|LOCUS_69260 69808 72450 gene locus_tag LOCUS_69270 gene adhE 69808 72450 CDS product bifunctional acetaldehyde-CoA/alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000137036.1 protein_id gnl|my_center|LOCUS_69270 72699 73034 gene locus_tag LOCUS_69280 72699 73034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69280 73664 73362 gene locus_tag LOCUS_69290 73664 73362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69290 74232 74609 gene locus_tag LOCUS_69300 74232 74609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69300 75014 75409 gene locus_tag LOCUS_69310 75014 75409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69310 76633 77208 gene locus_tag LOCUS_69320 76633 77208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69320 77486 78337 gene locus_tag LOCUS_69330 77486 78337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69330 78483 78821 gene locus_tag LOCUS_69340 78483 78821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69340 79229 79351 gene locus_tag LOCUS_69350 79229 79351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69350 79348 79806 gene locus_tag LOCUS_69360 79348 79806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189749536.1 protein_id gnl|my_center|LOCUS_69360 79803 80327 gene locus_tag LOCUS_69370 79803 80327 CDS product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189749538.1 protein_id gnl|my_center|LOCUS_69370 80337 80882 gene locus_tag LOCUS_69380 80337 80882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69380 80870 81202 gene locus_tag LOCUS_69390 80870 81202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69390 81322 81684 gene locus_tag LOCUS_69400 81322 81684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69400 82739 81909 gene locus_tag LOCUS_69410 82739 81909 CDS product barstar family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086604761.1 protein_id gnl|my_center|LOCUS_69410 83022 83570 gene locus_tag LOCUS_69420 83022 83570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69420 84468 84839 gene locus_tag LOCUS_69430 84468 84839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191849873.1 protein_id gnl|my_center|LOCUS_69430 84954 85898 gene locus_tag LOCUS_69440 84954 85898 CDS product phage Gp37/Gp68 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339629.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_69440 86031 86240 gene locus_tag LOCUS_69450 86031 86240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69450 86984 86349 gene locus_tag LOCUS_69460 86984 86349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69460 87594 87986 gene locus_tag LOCUS_69470 87594 87986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_69470 88968 88459 gene locus_tag LOCUS_69480 88968 88459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69480 89559 89170 gene locus_tag LOCUS_69490 89559 89170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_69490 90214 89474 gene locus_tag LOCUS_69500 90214 89474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_69500 91157 90858 gene locus_tag LOCUS_69510 91157 90858 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026850.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_69510 >Feature sequence24 7134 5059 gene locus_tag LOCUS_69520 7134 5059 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031376.1 protein_id gnl|my_center|LOCUS_69520 7424 7164 gene locus_tag LOCUS_69530 7424 7164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69530 8899 7898 gene locus_tag LOCUS_69540 8899 7898 CDS product ParB N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173142140.1 protein_id gnl|my_center|LOCUS_69540 10157 9546 gene locus_tag LOCUS_69550 10157 9546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69550 10392 10649 gene locus_tag LOCUS_69560 10392 10649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69560 10734 11870 gene locus_tag LOCUS_69570 10734 11870 CDS product biotin/lipoate A/B protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327718.1 protein_id gnl|my_center|LOCUS_69570 12081 12755 gene locus_tag LOCUS_69580 12081 12755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030904.1 protein_id gnl|my_center|LOCUS_69580 13796 12774 gene locus_tag LOCUS_69590 13796 12774 CDS product TIGR03842 family LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030901.1 protein_id gnl|my_center|LOCUS_69590 15248 13845 gene locus_tag LOCUS_69600 gene hydA 15248 13845 CDS product dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030900.1 protein_id gnl|my_center|LOCUS_69600 16560 15277 gene locus_tag LOCUS_69610 16560 15277 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222142.1 protein_id gnl|my_center|LOCUS_69610 17399 16557 gene locus_tag LOCUS_69620 17399 16557 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972568.1 protein_id gnl|my_center|LOCUS_69620 18913 17561 gene locus_tag LOCUS_69630 18913 17561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69630 19275 21806 gene locus_tag LOCUS_69640 19275 21806 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030897.1 protein_id gnl|my_center|LOCUS_69640 23661 21856 gene locus_tag LOCUS_69650 gene ggt 23661 21856 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030896.1 protein_id gnl|my_center|LOCUS_69650 26092 23852 gene locus_tag LOCUS_69660 26092 23852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69660 27277 26870 gene locus_tag LOCUS_69670 27277 26870 CDS product DUF6278 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972582.1 protein_id gnl|my_center|LOCUS_69670 27367 29247 gene locus_tag LOCUS_69680 27367 29247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69680 30103 29324 gene locus_tag LOCUS_69690 30103 29324 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030841.1 protein_id gnl|my_center|LOCUS_69690 30779 30141 gene locus_tag LOCUS_69700 30779 30141 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972584.1 protein_id gnl|my_center|LOCUS_69700 32106 30811 gene locus_tag LOCUS_69710 32106 30811 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030840.1 protein_id gnl|my_center|LOCUS_69710 32781 32287 gene locus_tag LOCUS_69720 32781 32287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69720 33811 32828 gene locus_tag LOCUS_69730 33811 32828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69730 35270 33918 gene locus_tag LOCUS_69740 35270 33918 CDS product YbfB/YjiJ family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091313186.1 protein_id gnl|my_center|LOCUS_69740 35635 35390 gene locus_tag LOCUS_69750 35635 35390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69750 35875 37461 gene locus_tag LOCUS_69760 35875 37461 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030930.1 protein_id gnl|my_center|LOCUS_69760 37458 38453 gene locus_tag LOCUS_69770 37458 38453 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270309.1 protein_id gnl|my_center|LOCUS_69770 38551 39324 gene locus_tag LOCUS_69780 38551 39324 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167469199.1 protein_id gnl|my_center|LOCUS_69780 39321 40304 gene locus_tag LOCUS_69790 39321 40304 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030933.1 protein_id gnl|my_center|LOCUS_69790 40297 41034 gene locus_tag LOCUS_69800 40297 41034 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972523.1 protein_id gnl|my_center|LOCUS_69800 41526 41080 gene locus_tag LOCUS_69810 41526 41080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69810 41625 42086 gene locus_tag LOCUS_69820 41625 42086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69820 42690 42223 gene locus_tag LOCUS_69830 42690 42223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69830 43391 42825 gene locus_tag LOCUS_69840 43391 42825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69840 44934 43456 gene locus_tag LOCUS_69850 44934 43456 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229408.1 protein_id gnl|my_center|LOCUS_69850 46074 45031 gene locus_tag LOCUS_69860 46074 45031 CDS product medium chain dehydrogenase/reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226261.1 protein_id gnl|my_center|LOCUS_69860 46240 46905 gene locus_tag LOCUS_69870 46240 46905 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974661.1 protein_id gnl|my_center|LOCUS_69870 47953 47045 gene locus_tag LOCUS_69880 47953 47045 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029308.1 protein_id gnl|my_center|LOCUS_69880 48061 48765 gene locus_tag LOCUS_69890 48061 48765 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041170061.1 protein_id gnl|my_center|LOCUS_69890 49459 48899 gene locus_tag LOCUS_69900 49459 48899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69900 49851 49546 gene locus_tag LOCUS_69910 49851 49546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69910 50115 50285 gene locus_tag LOCUS_69920 gene rpmF 50115 50285 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978430.1 protein_id gnl|my_center|LOCUS_69920 50804 50478 gene locus_tag LOCUS_69930 50804 50478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69930 51157 51852 gene locus_tag LOCUS_69940 51157 51852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69940 52230 52006 gene locus_tag LOCUS_69950 52230 52006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69950 52376 53260 gene locus_tag LOCUS_69960 52376 53260 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222519.1 protein_id gnl|my_center|LOCUS_69960 53538 54938 gene locus_tag LOCUS_69970 53538 54938 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976504.1 protein_id gnl|my_center|LOCUS_69970 55047 57476 gene locus_tag LOCUS_69980 55047 57476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69980 57561 58049 gene locus_tag LOCUS_69990 57561 58049 CDS product hotdog domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977376.1 protein_id gnl|my_center|LOCUS_69990 60484 58151 gene locus_tag LOCUS_70000 60484 58151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70000 60851 61480 gene locus_tag LOCUS_70010 gene sigL 60851 61480 CDS product sigma-70 family RNA polymerase sigma factor SigL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403731.1 protein_id gnl|my_center|LOCUS_70010 61550 63511 gene locus_tag LOCUS_70020 61550 63511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70020 63667 64104 gene locus_tag LOCUS_70030 63667 64104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70030 64225 64425 gene locus_tag LOCUS_70040 64225 64425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70040 65890 64511 gene locus_tag LOCUS_70050 65890 64511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70050 69302 65985 gene locus_tag LOCUS_70060 69302 65985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70060 69509 70705 gene locus_tag LOCUS_70070 69509 70705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70070 70835 71086 gene locus_tag LOCUS_70080 70835 71086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70080 71083 73629 gene locus_tag LOCUS_70090 71083 73629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70090 74905 73679 gene locus_tag LOCUS_70100 74905 73679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70100 75044 77095 gene locus_tag LOCUS_70110 75044 77095 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143126.1 protein_id gnl|my_center|LOCUS_70110 77543 78886 gene locus_tag LOCUS_70120 77543 78886 CDS product carotenoid oxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731135.1 protein_id gnl|my_center|LOCUS_70120 78948 79391 gene locus_tag LOCUS_70130 78948 79391 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225192.1 protein_id gnl|my_center|LOCUS_70130 79384 81324 gene locus_tag LOCUS_70140 79384 81324 CDS product multicopper oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084425723.1 protein_id gnl|my_center|LOCUS_70140 83389 81341 gene locus_tag LOCUS_70150 83389 81341 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143126.1 protein_id gnl|my_center|LOCUS_70150 >Feature sequence25 542 1576 gene locus_tag LOCUS_70160 gene tgdA 542 1576 CDS product transglycosylase TgdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029455.1 protein_id gnl|my_center|LOCUS_70160 2779 1637 gene locus_tag LOCUS_70170 2779 1637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70170 4560 2794 gene locus_tag LOCUS_70180 4560 2794 CDS product relaxase/mobilization nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031300.1 protein_id gnl|my_center|LOCUS_70180 5045 4557 gene locus_tag LOCUS_70190 5045 4557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70190 5193 5618 gene locus_tag LOCUS_70200 5193 5618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70200 6145 5930 gene locus_tag LOCUS_70210 6145 5930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70210 6576 6142 gene locus_tag LOCUS_70220 6576 6142 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189999469.1 protein_id gnl|my_center|LOCUS_70220 7962 6685 gene locus_tag LOCUS_70230 7962 6685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70230 9721 8066 gene locus_tag LOCUS_70240 9721 8066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70240 10968 10327 gene locus_tag LOCUS_70250 10968 10327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70250 11745 11131 gene locus_tag LOCUS_70260 11745 11131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70260 12718 11840 gene locus_tag LOCUS_70270 12718 11840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70270 13836 12808 gene locus_tag LOCUS_70280 13836 12808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70280 14525 14022 gene locus_tag LOCUS_70290 14525 14022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70290 15233 14664 gene locus_tag LOCUS_70300 15233 14664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70300 15668 15324 gene locus_tag LOCUS_70310 15668 15324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70310 16549 16253 gene locus_tag LOCUS_70320 16549 16253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70320 16832 16542 gene locus_tag LOCUS_70330 16832 16542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70330 17107 16829 gene locus_tag LOCUS_70340 17107 16829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70340 18470 17073 gene locus_tag LOCUS_70350 gene dnaB 18470 17073 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975021.1 protein_id gnl|my_center|LOCUS_70350 19863 18559 gene locus_tag LOCUS_70360 19863 18559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70360 21007 20420 gene locus_tag LOCUS_70370 21007 20420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70370 21804 21004 gene locus_tag LOCUS_70380 21804 21004 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029278.1 protein_id gnl|my_center|LOCUS_70380 22299 22685 gene locus_tag LOCUS_70390 22299 22685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70390 22798 23100 gene locus_tag LOCUS_70400 22798 23100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70400 23159 24970 gene locus_tag LOCUS_70410 23159 24970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70410 25055 25612 gene locus_tag LOCUS_70420 25055 25612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149561543.1 protein_id gnl|my_center|LOCUS_70420 25616 25840 gene locus_tag LOCUS_70430 25616 25840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70430 25970 28291 gene locus_tag LOCUS_70440 25970 28291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_70440 28303 28782 gene locus_tag LOCUS_70450 28303 28782 CDS product conjugal transfer protein TraB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_155074350.1 protein_id gnl|my_center|LOCUS_70450 28896 31265 gene locus_tag LOCUS_70460 28896 31265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149561540.1 protein_id gnl|my_center|LOCUS_70460 31351 31851 gene locus_tag LOCUS_70470 31351 31851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70470 31863 32201 gene locus_tag LOCUS_70480 31863 32201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70480 32306 32767 gene locus_tag LOCUS_70490 32306 32767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70490 32868 33122 gene locus_tag LOCUS_70500 32868 33122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70500 34077 33178 gene locus_tag LOCUS_70510 34077 33178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70510 34844 34077 gene locus_tag LOCUS_70520 34844 34077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70520 35719 35027 gene locus_tag LOCUS_70530 35719 35027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70530 36038 36328 gene locus_tag LOCUS_70540 36038 36328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70540 36808 49416 gene locus_tag LOCUS_70550 36808 49416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70550 50149 49754 gene locus_tag LOCUS_70560 50149 49754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70560 50450 51154 gene locus_tag LOCUS_70570 50450 51154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70570 51176 51859 gene locus_tag LOCUS_70580 51176 51859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70580 51976 52326 gene locus_tag LOCUS_70590 51976 52326 CDS product DUF6233 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_185906780.1 protein_id gnl|my_center|LOCUS_70590 53862 52501 gene locus_tag LOCUS_70600 53862 52501 CDS product IS4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229317.1 protein_id gnl|my_center|LOCUS_70600 54026 54583 gene locus_tag LOCUS_70610 54026 54583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70610 56054 54921 gene locus_tag LOCUS_70620 56054 54921 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226521.1 protein_id gnl|my_center|LOCUS_70620 57058 56051 gene locus_tag LOCUS_70630 57058 56051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70630 57438 57055 gene locus_tag LOCUS_70640 57438 57055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70640 58082 57435 gene locus_tag LOCUS_70650 58082 57435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70650 58741 58079 gene locus_tag LOCUS_70660 58741 58079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70660 60384 58747 gene locus_tag LOCUS_70670 60384 58747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70670 60578 60381 gene locus_tag LOCUS_70680 60578 60381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70680 61567 60575 gene locus_tag LOCUS_70690 61567 60575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70690 61881 62561 gene locus_tag LOCUS_70700 61881 62561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70700 62564 62860 gene locus_tag LOCUS_70710 62564 62860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70710 62857 63165 gene locus_tag LOCUS_70720 62857 63165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70720 63162 63362 gene locus_tag LOCUS_70730 63162 63362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70730 63359 63781 gene locus_tag LOCUS_70740 63359 63781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70740 63778 64224 gene locus_tag LOCUS_70750 63778 64224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70750 64247 65161 gene locus_tag LOCUS_70760 64247 65161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70760 65199 65804 gene locus_tag LOCUS_70770 65199 65804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70770 65801 65971 gene locus_tag LOCUS_70780 65801 65971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70780 65968 66753 gene locus_tag LOCUS_70790 65968 66753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70790 66799 67242 gene locus_tag LOCUS_70800 66799 67242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70800 68421 67585 gene locus_tag LOCUS_70810 68421 67585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70810 68571 68891 gene locus_tag LOCUS_70820 68571 68891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70820 69542 68961 gene locus_tag LOCUS_70830 69542 68961 CDS product DUF4913 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029066.1 protein_id gnl|my_center|LOCUS_70830 71277 69532 gene locus_tag LOCUS_70840 71277 69532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70840 72866 71274 gene locus_tag LOCUS_70850 72866 71274 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080790597.1 protein_id gnl|my_center|LOCUS_70850 74305 72869 gene locus_tag LOCUS_70860 74305 72869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70860 75858 74317 gene locus_tag LOCUS_70870 75858 74317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70870 76646 75855 gene locus_tag LOCUS_70880 76646 75855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70880 76923 76654 gene locus_tag LOCUS_70890 76923 76654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70890 >Feature sequence26 21673 10760 gene locus_tag LOCUS_70900 21673 10760 CDS product non-ribosomal peptide synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028843.1 protein_id gnl|my_center|LOCUS_70900 26331 21772 gene locus_tag LOCUS_70910 26331 21772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_70910 37748 26328 gene locus_tag LOCUS_70920 37748 26328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_70920 >Feature sequence27 19102 15113 gene locus_tag LOCUS_70930 19102 15113 CDS product type VII secretion protein EccC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030426.1 protein_id gnl|my_center|LOCUS_70930 19571 20971 gene locus_tag LOCUS_70940 gene eccD 19571 20971 CDS product type VII secretion integral membrane protein EccD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270242.1 protein_id gnl|my_center|LOCUS_70940 21004 22470 gene locus_tag LOCUS_70950 gene eccB 21004 22470 CDS product type VII secretion protein EccB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224123.1 protein_id gnl|my_center|LOCUS_70950 22661 22987 gene locus_tag LOCUS_70960 22661 22987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70960 23022 23345 gene locus_tag LOCUS_70970 23022 23345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70970 23429 23905 gene locus_tag LOCUS_70980 23429 23905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70980 23957 26998 gene locus_tag LOCUS_70990 23957 26998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70990 27039 27503 gene locus_tag LOCUS_71000 27039 27503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71000 27496 27855 gene locus_tag LOCUS_71010 27496 27855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71010 27963 29390 gene locus_tag LOCUS_71020 27963 29390 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051218217.1 protein_id gnl|my_center|LOCUS_71020 29387 30073 gene locus_tag LOCUS_71030 29387 30073 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270392.1 protein_id gnl|my_center|LOCUS_71030 32112 30004 gene locus_tag LOCUS_71040 32112 30004 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143126.1 protein_id gnl|my_center|LOCUS_71040 33278 32607 gene locus_tag LOCUS_71050 33278 32607 CDS product type VII secretion system-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230749.1 protein_id gnl|my_center|LOCUS_71050 >Feature sequence28 545 1108 gene locus_tag LOCUS_71060 545 1108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71060 1300 3822 gene locus_tag LOCUS_71070 1300 3822 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201843320.1 protein_id gnl|my_center|LOCUS_71070 4436 3879 gene locus_tag LOCUS_71080 4436 3879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71080 6937 4433 gene locus_tag LOCUS_71090 6937 4433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71090 8091 6934 gene locus_tag LOCUS_71100 8091 6934 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877954.1 protein_id gnl|my_center|LOCUS_71100 8243 11182 gene locus_tag LOCUS_71110 8243 11182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71110 11399 12325 gene locus_tag LOCUS_71120 11399 12325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71120 13066 12761 gene locus_tag LOCUS_71130 13066 12761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71130 13439 13155 gene locus_tag LOCUS_71140 13439 13155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71140 13735 13454 gene locus_tag LOCUS_71150 13735 13454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71150 >Feature sequence29 199 429 gene locus_tag LOCUS_71160 199 429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71160 422 1420 gene locus_tag LOCUS_71170 422 1420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71170 1681 1490 gene locus_tag LOCUS_71180 1681 1490 CDS product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029810.1 protein_id gnl|my_center|LOCUS_71180 2571 1678 gene locus_tag LOCUS_71190 2571 1678 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226025318.1 protein_id gnl|my_center|LOCUS_71190 2891 3115 gene locus_tag LOCUS_71200 2891 3115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71200 3198 3665 gene locus_tag LOCUS_71210 3198 3665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71210 3754 4194 gene locus_tag LOCUS_71220 3754 4194 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030759.1 protein_id gnl|my_center|LOCUS_71220 4821 4237 gene locus_tag LOCUS_71230 4821 4237 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974527.1 protein_id gnl|my_center|LOCUS_71230 4997 5557 gene locus_tag LOCUS_71240 4997 5557 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225840.1 protein_id gnl|my_center|LOCUS_71240 5657 6070 gene locus_tag LOCUS_71250 5657 6070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71250 >Feature sequence30 >Feature sequence31 238 1760 gene locus_tag LOCUS_r00020 238 1760 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 1785 1881 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1937 5056 gene locus_tag LOCUS_r00030 1937 5056 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence32 <1 1246 gene locus_tag LOCUS_71260 <1 1246 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_108988152.1:2-oxoacid:acceptor oxidoreductase subunit alpha >Feature sequence33 149 1201 gene locus_tag LOCUS_71270 gene opcA 149 1201 CDS product glucose-6-phosphate dehydrogenase assembly protein OpcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976880.1 protein_id gnl|my_center|LOCUS_71270 1198 1986 gene locus_tag LOCUS_71280 gene pgl 1198 1986 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976879.1 protein_id gnl|my_center|LOCUS_71280 >Feature sequence34 <1474 918 gene locus_tag LOCUS_71290 <1474 918 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011031595.1:alpha-1,4-glucan--maltose-1-phosphate maltosyltransferase >Feature sequence35 <1 554 gene locus_tag LOCUS_71300 <1 554 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030248.1:alpha-1,4-glucan--maltose-1-phosphate maltosyltransferase >Feature sequence36 >Feature sequence37 149 1075 gene locus_tag LOCUS_71310 gene opcA 149 1075 CDS product glucose-6-phosphate dehydrogenase assembly protein OpcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972335.1 protein_id gnl|my_center|LOCUS_71310 >Feature sequence38 >Feature sequence39 >Feature sequence40 >Feature sequence41 >Feature sequence42 >Feature sequence43 >Feature sequence44 >Feature sequence45