>Feature sequence01 1754 2185 gene locus_tag LOCUS_00010 1754 2185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 2495 2908 gene locus_tag LOCUS_00020 2495 2908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 3333 4202 gene locus_tag LOCUS_00030 3333 4202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 5776 4301 gene locus_tag LOCUS_00040 5776 4301 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964225.1 protein_id gnl|my_center|LOCUS_00040 6225 8993 gene locus_tag LOCUS_00050 6225 8993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 9030 10106 gene locus_tag LOCUS_00060 gene nadR 9030 10106 CDS product multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001532645.1 protein_id gnl|my_center|LOCUS_00060 11292 10129 gene locus_tag LOCUS_00070 gene corA 11292 10129 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141025.1 protein_id gnl|my_center|LOCUS_00070 11458 12474 gene locus_tag LOCUS_00080 11458 12474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 12563 13840 gene locus_tag LOCUS_00090 12563 13840 CDS product O-antigen translocase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036849.1 protein_id gnl|my_center|LOCUS_00090 13859 14830 gene locus_tag LOCUS_00100 13859 14830 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868277.1 protein_id gnl|my_center|LOCUS_00100 15184 16881 gene locus_tag LOCUS_00110 15184 16881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 17071 18036 gene locus_tag LOCUS_00120 17071 18036 CDS product acyl-ACP desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962232.1 protein_id gnl|my_center|LOCUS_00120 18331 19617 gene locus_tag LOCUS_00130 18331 19617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 20578 19667 gene locus_tag LOCUS_00140 20578 19667 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020273.1 protein_id gnl|my_center|LOCUS_00140 21041 20760 gene locus_tag LOCUS_00150 21041 20760 CDS product DUF427 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887568.1 protein_id gnl|my_center|LOCUS_00150 21219 22325 gene locus_tag LOCUS_00160 21219 22325 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404921.1 protein_id gnl|my_center|LOCUS_00160 23211 25016 gene locus_tag LOCUS_00170 23211 25016 CDS product choice-of-anchor Q domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259743.1 protein_id gnl|my_center|LOCUS_00170 25827 25210 gene locus_tag LOCUS_00180 25827 25210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 26390 25893 gene locus_tag LOCUS_00190 26390 25893 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405237.1 protein_id gnl|my_center|LOCUS_00190 26590 28110 gene locus_tag LOCUS_00200 26590 28110 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405041.1 protein_id gnl|my_center|LOCUS_00200 30463 28706 gene locus_tag LOCUS_00210 30463 28706 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142469.1 protein_id gnl|my_center|LOCUS_00210 30660 31526 gene locus_tag LOCUS_00220 gene surE 30660 31526 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964421.1 protein_id gnl|my_center|LOCUS_00220 32260 31571 gene locus_tag LOCUS_00230 32260 31571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 32573 34099 gene locus_tag LOCUS_00240 32573 34099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 34122 34310 gene locus_tag LOCUS_00250 34122 34310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 34417 35016 gene locus_tag LOCUS_00260 34417 35016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 35079 36536 gene locus_tag LOCUS_00270 35079 36536 CDS product M28 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962644.1 protein_id gnl|my_center|LOCUS_00270 36769 38601 gene locus_tag LOCUS_00280 36769 38601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 38598 39368 gene locus_tag LOCUS_00290 38598 39368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 39639 40202 gene locus_tag LOCUS_00300 39639 40202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 40308 40928 gene locus_tag LOCUS_00310 40308 40928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 41205 41876 gene locus_tag LOCUS_00320 41205 41876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 42226 44325 gene locus_tag LOCUS_00330 gene ligA 42226 44325 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765723.1 protein_id gnl|my_center|LOCUS_00330 44791 45330 gene locus_tag LOCUS_00340 44791 45330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 46442 45642 gene locus_tag LOCUS_00350 46442 45642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 46360 46611 gene locus_tag LOCUS_00360 46360 46611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 46691 47575 gene locus_tag LOCUS_00370 gene dapA 46691 47575 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963941.1 protein_id gnl|my_center|LOCUS_00370 47591 48148 gene locus_tag LOCUS_00380 47591 48148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 49023 48271 gene locus_tag LOCUS_00390 49023 48271 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_150234528.1 protein_id gnl|my_center|LOCUS_00390 49895 49044 gene locus_tag LOCUS_00400 49895 49044 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963928.1 protein_id gnl|my_center|LOCUS_00400 50445 50260 gene locus_tag LOCUS_00410 50445 50260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 50398 51654 gene locus_tag LOCUS_00420 50398 51654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 52495 51686 gene locus_tag LOCUS_00430 52495 51686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 52673 52942 gene locus_tag LOCUS_00440 52673 52942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 52935 53273 gene locus_tag LOCUS_00450 52935 53273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 53357 54010 gene locus_tag LOCUS_00460 53357 54010 CDS product heme-copper oxidase subunit III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394318.1 protein_id gnl|my_center|LOCUS_00460 56501 54237 gene locus_tag LOCUS_00470 56501 54237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 56859 58865 gene locus_tag LOCUS_00480 56859 58865 CDS product M1 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962262.1 protein_id gnl|my_center|LOCUS_00480 59657 59022 gene locus_tag LOCUS_00490 59657 59022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 60304 59864 gene locus_tag LOCUS_00500 60304 59864 CDS product DUF2147 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043223.1 protein_id gnl|my_center|LOCUS_00500 61441 61031 gene locus_tag LOCUS_00510 61441 61031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 61812 63626 gene locus_tag LOCUS_00520 61812 63626 CDS product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259046.1 protein_id gnl|my_center|LOCUS_00520 65822 63873 gene locus_tag LOCUS_00530 65822 63873 CDS product KUP/HAK/KT family potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962780.1 protein_id gnl|my_center|LOCUS_00530 66677 65946 gene locus_tag LOCUS_00540 66677 65946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 67316 66687 gene locus_tag LOCUS_00550 67316 66687 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071372.1 protein_id gnl|my_center|LOCUS_00550 68495 68070 gene locus_tag LOCUS_00560 68495 68070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 68379 68720 gene locus_tag LOCUS_00570 68379 68720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 69841 68876 gene locus_tag LOCUS_00580 69841 68876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 71560 70154 gene locus_tag LOCUS_00590 71560 70154 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112884.1 protein_id gnl|my_center|LOCUS_00590 73138 71654 gene locus_tag LOCUS_00600 73138 71654 CDS product exonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964019.1 protein_id gnl|my_center|LOCUS_00600 73988 73515 gene locus_tag LOCUS_00610 73988 73515 CDS product PA2169 family four-helix-bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003314059.1 protein_id gnl|my_center|LOCUS_00610 75278 74085 gene locus_tag LOCUS_00620 75278 74085 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393149.1 protein_id gnl|my_center|LOCUS_00620 75460 77397 gene locus_tag LOCUS_00630 75460 77397 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962807.1 protein_id gnl|my_center|LOCUS_00630 78150 81092 gene locus_tag LOCUS_00640 78150 81092 CDS product DNA gyrase/topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091514757.1 protein_id gnl|my_center|LOCUS_00640 81258 82193 gene locus_tag LOCUS_00650 81258 82193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 82383 83492 gene locus_tag LOCUS_00660 82383 83492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 83712 85643 gene locus_tag LOCUS_00670 gene thrS 83712 85643 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786570.1 protein_id gnl|my_center|LOCUS_00670 85892 86536 gene locus_tag LOCUS_00680 gene infC 85892 86536 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768315.1 protein_id gnl|my_center|LOCUS_00680 86619 86813 gene locus_tag LOCUS_00690 gene rpmI 86619 86813 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963049.1 protein_id gnl|my_center|LOCUS_00690 87024 87368 gene locus_tag LOCUS_00700 gene rplT 87024 87368 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963048.1 protein_id gnl|my_center|LOCUS_00700 87639 87565 gene locus_tag LOCUS_t00010 87639 87565 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 87771 88184 gene locus_tag LOCUS_00710 87771 88184 CDS product START-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964105.1 protein_id gnl|my_center|LOCUS_00710 88340 89785 gene locus_tag LOCUS_00720 88340 89785 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784513.1 protein_id gnl|my_center|LOCUS_00720 89969 90244 gene locus_tag LOCUS_00730 gene rpsO 89969 90244 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964145.1 protein_id gnl|my_center|LOCUS_00730 90446 92617 gene locus_tag LOCUS_00740 gene pnp 90446 92617 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791373.1 protein_id gnl|my_center|LOCUS_00740 92738 93601 gene locus_tag LOCUS_00750 92738 93601 CDS product RNA polymerase sigma factor RpoD/SigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002561589.1 protein_id gnl|my_center|LOCUS_00750 93698 93964 gene locus_tag LOCUS_00760 93698 93964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 94050 94985 gene locus_tag LOCUS_00770 gene trxB 94050 94985 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962776.1 protein_id gnl|my_center|LOCUS_00770 95107 96234 gene locus_tag LOCUS_00780 95107 96234 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770039.1 protein_id gnl|my_center|LOCUS_00780 96340 97059 gene locus_tag LOCUS_00790 gene bshB1 96340 97059 CDS product bacillithiol biosynthesis deacetylase BshB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962816.1 protein_id gnl|my_center|LOCUS_00790 97659 98057 gene locus_tag LOCUS_00800 97659 98057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 98195 98653 gene locus_tag LOCUS_00810 98195 98653 CDS product RES family NAD+ phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169553.1 protein_id gnl|my_center|LOCUS_00810 99627 98893 gene locus_tag LOCUS_00820 99627 98893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 101168 99657 gene locus_tag LOCUS_00830 gene accC 101168 99657 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403246.1 protein_id gnl|my_center|LOCUS_00830 101580 102827 gene locus_tag LOCUS_00840 101580 102827 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963911.1 protein_id gnl|my_center|LOCUS_00840 103081 103350 gene locus_tag LOCUS_00850 103081 103350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 104802 103429 gene locus_tag LOCUS_00860 gene tyrS 104802 103429 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783655.1 protein_id gnl|my_center|LOCUS_00860 104947 106005 gene locus_tag LOCUS_00870 gene holA 104947 106005 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765717.1 protein_id gnl|my_center|LOCUS_00870 106066 106800 gene locus_tag LOCUS_00880 106066 106800 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000262039.1 protein_id gnl|my_center|LOCUS_00880 106985 110266 gene locus_tag LOCUS_00890 106985 110266 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797422.1 protein_id gnl|my_center|LOCUS_00890 110359 112104 gene locus_tag LOCUS_00900 110359 112104 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962685.1 protein_id gnl|my_center|LOCUS_00900 112226 113437 gene locus_tag LOCUS_00910 112226 113437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 113446 114141 gene locus_tag LOCUS_00920 113446 114141 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791129.1 protein_id gnl|my_center|LOCUS_00920 114267 114686 gene locus_tag LOCUS_00930 114267 114686 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962706.1 protein_id gnl|my_center|LOCUS_00930 114829 115710 gene locus_tag LOCUS_00940 114829 115710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 115872 117182 gene locus_tag LOCUS_00950 115872 117182 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788733.1 protein_id gnl|my_center|LOCUS_00950 117268 117933 gene locus_tag LOCUS_00960 gene trmB 117268 117933 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962539.1 protein_id gnl|my_center|LOCUS_00960 118054 118473 gene locus_tag LOCUS_00970 118054 118473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 118551 119021 gene locus_tag LOCUS_00980 118551 119021 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229703.1 protein_id gnl|my_center|LOCUS_00980 119897 119082 gene locus_tag LOCUS_00990 119897 119082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 120428 120646 gene locus_tag LOCUS_01000 120428 120646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01000 120736 122232 gene locus_tag LOCUS_01010 120736 122232 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230189.1 protein_id gnl|my_center|LOCUS_01010 122381 123850 gene locus_tag LOCUS_01020 122381 123850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 124344 124171 gene locus_tag LOCUS_01030 124344 124171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 124790 124428 gene locus_tag LOCUS_01040 124790 124428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 126295 125261 gene locus_tag LOCUS_01050 gene adhP 126295 125261 CDS product alcohol dehydrogenase AdhP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096816.1 protein_id gnl|my_center|LOCUS_01050 127401 126805 gene locus_tag LOCUS_01060 127401 126805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139517245.1 protein_id gnl|my_center|LOCUS_01060 127539 128261 gene locus_tag LOCUS_01070 gene rpe 127539 128261 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964149.1 protein_id gnl|my_center|LOCUS_01070 128397 130892 gene locus_tag LOCUS_01080 128397 130892 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839861.1 protein_id gnl|my_center|LOCUS_01080 131622 130903 gene locus_tag LOCUS_01090 131622 130903 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102692.1 protein_id gnl|my_center|LOCUS_01090 132285 131719 gene locus_tag LOCUS_01100 132285 131719 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786786.1 protein_id gnl|my_center|LOCUS_01100 132735 133586 gene locus_tag LOCUS_01110 gene hisG 132735 133586 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789131.1 protein_id gnl|my_center|LOCUS_01110 133598 136030 gene locus_tag LOCUS_01120 133598 136030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 136117 137217 gene locus_tag LOCUS_01130 gene hisB 136117 137217 CDS product bifunctional histidinol-phosphatase/imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766230.1 protein_id gnl|my_center|LOCUS_01130 137316 137903 gene locus_tag LOCUS_01140 gene hisH 137316 137903 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803062.1 protein_id gnl|my_center|LOCUS_01140 137924 138640 gene locus_tag LOCUS_01150 gene hisA 137924 138640 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764911.1 protein_id gnl|my_center|LOCUS_01150 138719 139474 gene locus_tag LOCUS_01160 gene hisF 138719 139474 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963102.1 protein_id gnl|my_center|LOCUS_01160 139567 140235 gene locus_tag LOCUS_01170 gene hisIE 139567 140235 CDS product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762399.1 protein_id gnl|my_center|LOCUS_01170 140683 140300 gene locus_tag LOCUS_01180 140683 140300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 140801 141634 gene locus_tag LOCUS_01190 140801 141634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 142792 141776 gene locus_tag LOCUS_01200 142792 141776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 144541 144747 gene locus_tag LOCUS_01210 144541 144747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 145819 145016 gene locus_tag LOCUS_01220 145819 145016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 147350 146190 gene locus_tag LOCUS_01230 147350 146190 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787888.1 protein_id gnl|my_center|LOCUS_01230 150141 147550 gene locus_tag LOCUS_01240 gene gyrA 150141 147550 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962907.1 protein_id gnl|my_center|LOCUS_01240 150447 150286 gene locus_tag LOCUS_01250 150447 150286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 151252 150578 gene locus_tag LOCUS_01260 151252 150578 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962231.1 protein_id gnl|my_center|LOCUS_01260 152295 154409 gene locus_tag LOCUS_01270 152295 154409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 154824 154751 gene locus_tag LOCUS_t00020 154824 154751 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 157378 154955 gene locus_tag LOCUS_01280 157378 154955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 158026 157469 gene locus_tag LOCUS_01290 158026 157469 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403273.1 protein_id gnl|my_center|LOCUS_01290 158340 158990 gene locus_tag LOCUS_01300 gene pdxH 158340 158990 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403320.1 protein_id gnl|my_center|LOCUS_01300 159152 160471 gene locus_tag LOCUS_01310 159152 160471 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931831.1 protein_id gnl|my_center|LOCUS_01310 160531 161082 gene locus_tag LOCUS_01320 160531 161082 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107938.1 protein_id gnl|my_center|LOCUS_01320 161095 162870 gene locus_tag LOCUS_01330 161095 162870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 163081 164856 gene locus_tag LOCUS_01340 163081 164856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 165288 164863 gene locus_tag LOCUS_01350 165288 164863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 166210 165338 gene locus_tag LOCUS_01360 166210 165338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 167242 166220 gene locus_tag LOCUS_01370 167242 166220 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759775.1 protein_id gnl|my_center|LOCUS_01370 168824 167418 gene locus_tag LOCUS_01380 168824 167418 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964215.1 protein_id gnl|my_center|LOCUS_01380 170501 168942 gene locus_tag LOCUS_01390 170501 168942 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964214.1 protein_id gnl|my_center|LOCUS_01390 171257 170577 gene locus_tag LOCUS_01400 gene sdaAB 171257 170577 CDS product L-serine ammonia-lyase, iron-sulfur-dependent subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228158.1 protein_id gnl|my_center|LOCUS_01400 171574 172578 gene locus_tag LOCUS_01410 171574 172578 CDS product tryptophan 2,3-dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962404.1 protein_id gnl|my_center|LOCUS_01410 172726 173163 gene locus_tag LOCUS_01420 172726 173163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 173428 174213 gene locus_tag LOCUS_01430 173428 174213 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002182367.1 protein_id gnl|my_center|LOCUS_01430 174385 174672 gene locus_tag LOCUS_01440 174385 174672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 174970 174680 gene locus_tag LOCUS_01450 174970 174680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 175034 175300 gene locus_tag LOCUS_01460 175034 175300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 178021 175514 gene locus_tag LOCUS_01470 178021 175514 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108886.1 protein_id gnl|my_center|LOCUS_01470 179002 178667 gene locus_tag LOCUS_01480 179002 178667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 179783 178926 gene locus_tag LOCUS_01490 179783 178926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 180478 179831 gene locus_tag LOCUS_01500 180478 179831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 180578 180826 gene locus_tag LOCUS_01510 180578 180826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 181161 180898 gene locus_tag LOCUS_01520 181161 180898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 181382 182959 gene locus_tag LOCUS_01530 181382 182959 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963361.1 protein_id gnl|my_center|LOCUS_01530 183438 183169 gene locus_tag LOCUS_01540 183438 183169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 183879 184229 gene locus_tag LOCUS_01550 183879 184229 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963707.1 protein_id gnl|my_center|LOCUS_01550 184213 184713 gene locus_tag LOCUS_01560 184213 184713 CDS product DUF6428 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963708.1 protein_id gnl|my_center|LOCUS_01560 184786 185280 gene locus_tag LOCUS_01570 184786 185280 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205378591.1 protein_id gnl|my_center|LOCUS_01570 >Feature sequence02 7414 4244 gene locus_tag LOCUS_01580 7414 4244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 8445 9713 gene locus_tag LOCUS_01590 8445 9713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 10416 13562 gene locus_tag LOCUS_01600 10416 13562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 13742 13999 gene locus_tag LOCUS_01610 13742 13999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 14045 14575 gene locus_tag LOCUS_01620 14045 14575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 14653 14853 gene locus_tag LOCUS_01630 14653 14853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 14829 15104 gene locus_tag LOCUS_01640 14829 15104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 15424 15101 gene locus_tag LOCUS_01650 15424 15101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 16528 15671 gene locus_tag LOCUS_01660 16528 15671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 16642 16824 gene locus_tag LOCUS_01670 16642 16824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 16898 17194 gene locus_tag LOCUS_01680 16898 17194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 17191 17562 gene locus_tag LOCUS_01690 17191 17562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01690 17678 17845 gene locus_tag LOCUS_01700 17678 17845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 17858 18532 gene locus_tag LOCUS_01710 17858 18532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 18532 19350 gene locus_tag LOCUS_01720 18532 19350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 19357 20784 gene locus_tag LOCUS_01730 gene dnaB 19357 20784 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962775.1 protein_id gnl|my_center|LOCUS_01730 20784 21041 gene locus_tag LOCUS_01740 20784 21041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 20981 21241 gene locus_tag LOCUS_01750 20981 21241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 21244 21774 gene locus_tag LOCUS_01760 21244 21774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 22044 22775 gene locus_tag LOCUS_01770 22044 22775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 23248 22802 gene locus_tag LOCUS_01780 23248 22802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 25192 23636 gene locus_tag LOCUS_01790 25192 23636 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256724.1 protein_id gnl|my_center|LOCUS_01790 26130 25189 gene locus_tag LOCUS_01800 26130 25189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 26968 26672 gene locus_tag LOCUS_01810 26968 26672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 27199 27026 gene locus_tag LOCUS_01820 27199 27026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 27500 27183 gene locus_tag LOCUS_01830 27500 27183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 29064 28666 gene locus_tag LOCUS_01840 29064 28666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 29532 29822 gene locus_tag LOCUS_01850 29532 29822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 29825 30004 gene locus_tag LOCUS_01860 29825 30004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 30053 30442 gene locus_tag LOCUS_01870 30053 30442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 30521 31222 gene locus_tag LOCUS_01880 30521 31222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 31291 31728 gene locus_tag LOCUS_01890 31291 31728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 31733 32452 gene locus_tag LOCUS_01900 31733 32452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 33098 33472 gene locus_tag LOCUS_01910 33098 33472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 33533 39148 gene locus_tag LOCUS_01920 33533 39148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 39148 39531 gene locus_tag LOCUS_01930 39148 39531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 39607 40611 gene locus_tag LOCUS_01940 39607 40611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 40668 41156 gene locus_tag LOCUS_01950 40668 41156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 41359 41562 gene locus_tag LOCUS_01960 41359 41562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 44845 41690 gene locus_tag LOCUS_01970 44845 41690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 46904 45390 gene locus_tag LOCUS_01980 46904 45390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 47308 46976 gene locus_tag LOCUS_01990 47308 46976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 47580 47443 gene locus_tag LOCUS_02000 47580 47443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 47797 47934 gene locus_tag LOCUS_02010 47797 47934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 48470 48174 gene locus_tag LOCUS_02020 48470 48174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 48848 48636 gene locus_tag LOCUS_02030 48848 48636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 49464 48991 gene locus_tag LOCUS_02040 49464 48991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 50062 49808 gene locus_tag LOCUS_02050 50062 49808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 51107 50895 gene locus_tag LOCUS_02060 51107 50895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 51469 51263 gene locus_tag LOCUS_02070 51469 51263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 52342 51704 gene locus_tag LOCUS_02080 52342 51704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 53037 52465 gene locus_tag LOCUS_02090 53037 52465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 53745 53143 gene locus_tag LOCUS_02100 53745 53143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 53891 54097 gene locus_tag LOCUS_02110 53891 54097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 54142 54498 gene locus_tag LOCUS_02120 54142 54498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 55736 54429 gene locus_tag LOCUS_02130 55736 54429 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005677642.1 protein_id gnl|my_center|LOCUS_02130 55968 55885 gene locus_tag LOCUS_t00030 55968 55885 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 56572 56497 gene locus_tag LOCUS_t00040 56572 56497 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 59511 56704 gene locus_tag LOCUS_02140 gene mutS 59511 56704 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108646.1 protein_id gnl|my_center|LOCUS_02140 59681 60199 gene locus_tag LOCUS_02150 59681 60199 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962566.1 protein_id gnl|my_center|LOCUS_02150 60260 60679 gene locus_tag LOCUS_02160 60260 60679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 61678 60908 gene locus_tag LOCUS_02170 61678 60908 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000422110.1 protein_id gnl|my_center|LOCUS_02170 62269 61778 gene locus_tag LOCUS_02180 62269 61778 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939267.1 protein_id gnl|my_center|LOCUS_02180 62376 62861 gene locus_tag LOCUS_02190 62376 62861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 63307 62945 gene locus_tag LOCUS_02200 63307 62945 CDS product DUF4260 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384085.1 protein_id gnl|my_center|LOCUS_02200 64017 63421 gene locus_tag LOCUS_02210 64017 63421 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763969.1 protein_id gnl|my_center|LOCUS_02210 64397 64885 gene locus_tag LOCUS_02220 64397 64885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 66053 65043 gene locus_tag LOCUS_02230 66053 65043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 67176 66436 gene locus_tag LOCUS_02240 67176 66436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 67388 70804 gene locus_tag LOCUS_02250 gene mfd 67388 70804 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962369.1 protein_id gnl|my_center|LOCUS_02250 70889 71233 gene locus_tag LOCUS_02260 70889 71233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 71489 75067 gene locus_tag LOCUS_02270 71489 75067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 76188 75481 gene locus_tag LOCUS_02280 gene frnE 76188 75481 CDS product protein disulfide isomerase FrnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887304.1 protein_id gnl|my_center|LOCUS_02280 76864 76367 gene locus_tag LOCUS_02290 76864 76367 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038765.1 protein_id gnl|my_center|LOCUS_02290 77510 77019 gene locus_tag LOCUS_02300 77510 77019 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038765.1 protein_id gnl|my_center|LOCUS_02300 78042 77893 gene locus_tag LOCUS_02310 78042 77893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 78612 78049 gene locus_tag LOCUS_02320 78612 78049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 78914 80005 gene locus_tag LOCUS_02330 gene proB 78914 80005 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933124.1 protein_id gnl|my_center|LOCUS_02330 80008 81258 gene locus_tag LOCUS_02340 80008 81258 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108943.1 protein_id gnl|my_center|LOCUS_02340 81265 81750 gene locus_tag LOCUS_02350 81265 81750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 82207 81776 gene locus_tag LOCUS_02360 82207 81776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 83960 82473 gene locus_tag LOCUS_02370 83960 82473 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337079.1 protein_id gnl|my_center|LOCUS_02370 84251 84862 gene locus_tag LOCUS_02380 84251 84862 CDS product cysteine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001064627.1 protein_id gnl|my_center|LOCUS_02380 85031 86362 gene locus_tag LOCUS_02390 85031 86362 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964035.1 protein_id gnl|my_center|LOCUS_02390 86576 86971 gene locus_tag LOCUS_02400 86576 86971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 87704 87159 gene locus_tag LOCUS_02410 87704 87159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 90745 87869 gene locus_tag LOCUS_02420 90745 87869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157307892.1 protein_id gnl|my_center|LOCUS_02420 90881 91096 gene locus_tag LOCUS_02430 90881 91096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 92097 91066 gene locus_tag LOCUS_02440 92097 91066 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527614.1 protein_id gnl|my_center|LOCUS_02440 93396 92392 gene locus_tag LOCUS_02450 93396 92392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 93890 93492 gene locus_tag LOCUS_02460 93890 93492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 94455 95090 gene locus_tag LOCUS_02470 gene msrA 94455 95090 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089780.1 protein_id gnl|my_center|LOCUS_02470 95408 100105 gene locus_tag LOCUS_02480 95408 100105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 100253 101404 gene locus_tag LOCUS_02490 100253 101404 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097611.1 protein_id gnl|my_center|LOCUS_02490 101635 102420 gene locus_tag LOCUS_02500 101635 102420 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106646.1 protein_id gnl|my_center|LOCUS_02500 104996 102702 gene locus_tag LOCUS_02510 104996 102702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 105231 106526 gene locus_tag LOCUS_02520 105231 106526 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108918.1 protein_id gnl|my_center|LOCUS_02520 107121 106576 gene locus_tag LOCUS_02530 gene rfbC 107121 106576 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107717.1 protein_id gnl|my_center|LOCUS_02530 108347 107232 gene locus_tag LOCUS_02540 108347 107232 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550082.1 protein_id gnl|my_center|LOCUS_02540 108502 108798 gene locus_tag LOCUS_02550 108502 108798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 110401 110691 gene locus_tag LOCUS_02560 110401 110691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 110741 112282 gene locus_tag LOCUS_02570 110741 112282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 112730 114049 gene locus_tag LOCUS_02580 gene hflX 112730 114049 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759581.1 protein_id gnl|my_center|LOCUS_02580 114165 115286 gene locus_tag LOCUS_02590 114165 115286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 116319 115522 gene locus_tag LOCUS_02600 116319 115522 CDS product DUF547 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404636.1 protein_id gnl|my_center|LOCUS_02600 118038 116674 gene locus_tag LOCUS_02610 118038 116674 CDS product erythromycin esterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000726836.1 protein_id gnl|my_center|LOCUS_02610 118882 118163 gene locus_tag LOCUS_02620 118882 118163 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107709.1 protein_id gnl|my_center|LOCUS_02620 119873 118869 gene locus_tag LOCUS_02630 119873 118869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 120220 121266 gene locus_tag LOCUS_02640 gene arsS 120220 121266 CDS product arsenosugar biosynthesis radical SAM protein ArsS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257184.1 protein_id gnl|my_center|LOCUS_02640 121474 121719 gene locus_tag LOCUS_02650 121474 121719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 121722 122018 gene locus_tag LOCUS_02660 121722 122018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 124075 122021 gene locus_tag LOCUS_02670 gene ppk1 124075 122021 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370393.1 protein_id gnl|my_center|LOCUS_02670 124665 124171 gene locus_tag LOCUS_02680 124665 124171 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852934.1 protein_id gnl|my_center|LOCUS_02680 124984 125943 gene locus_tag LOCUS_02690 124984 125943 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_098061990.1 protein_id gnl|my_center|LOCUS_02690 126154 126426 gene locus_tag LOCUS_02700 126154 126426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02700 126514 127104 gene locus_tag LOCUS_02710 126514 127104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02710 127082 127288 gene locus_tag LOCUS_02720 127082 127288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 130539 127285 gene locus_tag LOCUS_02730 130539 127285 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103421.1 protein_id gnl|my_center|LOCUS_02730 131622 130549 gene locus_tag LOCUS_02740 131622 130549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 132981 131629 gene locus_tag LOCUS_02750 132981 131629 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926902.1 protein_id gnl|my_center|LOCUS_02750 134704 132971 gene locus_tag LOCUS_02760 134704 132971 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039057.1 protein_id gnl|my_center|LOCUS_02760 136530 135232 gene locus_tag LOCUS_02770 136530 135232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 141085 137099 gene locus_tag LOCUS_02780 141085 137099 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163515044.1 protein_id gnl|my_center|LOCUS_02780 141286 142620 gene locus_tag LOCUS_02790 141286 142620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 143943 145565 gene locus_tag LOCUS_02800 143943 145565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 145724 145587 gene locus_tag LOCUS_02810 145724 145587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 145916 145761 gene locus_tag LOCUS_02820 145916 145761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 146311 146383 gene locus_tag LOCUS_t00050 146311 146383 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 147268 146756 gene locus_tag LOCUS_02830 147268 146756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 148735 150300 gene locus_tag LOCUS_02840 148735 150300 CDS product family 43 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109097.1 protein_id gnl|my_center|LOCUS_02840 151355 150732 gene locus_tag LOCUS_02850 151355 150732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 157675 151484 gene locus_tag LOCUS_02860 157675 151484 CDS product alpha-2-macroglobulin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122194.1 protein_id gnl|my_center|LOCUS_02860 157966 157769 gene locus_tag LOCUS_02870 157966 157769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 158211 158903 gene locus_tag LOCUS_02880 158211 158903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 159749 159153 gene locus_tag LOCUS_02890 159749 159153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 >Feature sequence03 1010 294 gene locus_tag LOCUS_02900 1010 294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 3106 1343 gene locus_tag LOCUS_02910 3106 1343 CDS product M61 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920396.1 protein_id gnl|my_center|LOCUS_02910 4553 3843 gene locus_tag LOCUS_02920 4553 3843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 4747 4829 gene locus_tag LOCUS_t00060 4747 4829 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 4922 5599 gene locus_tag LOCUS_02930 4922 5599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 7995 5647 gene locus_tag LOCUS_02940 7995 5647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 8616 8071 gene locus_tag LOCUS_02950 8616 8071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 9360 8725 gene locus_tag LOCUS_02960 9360 8725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 11189 9852 gene locus_tag LOCUS_02970 gene gltP 11189 9852 CDS product glutamate/aspartate:proton symporter GltP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209033.1 protein_id gnl|my_center|LOCUS_02970 12096 11617 gene locus_tag LOCUS_02980 12096 11617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 12329 13336 gene locus_tag LOCUS_02990 12329 13336 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903344.1 protein_id gnl|my_center|LOCUS_02990 13554 13345 gene locus_tag LOCUS_03000 13554 13345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 14164 15066 gene locus_tag LOCUS_03010 14164 15066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 15097 15249 gene locus_tag LOCUS_03020 15097 15249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 16101 15508 gene locus_tag LOCUS_03030 16101 15508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 16228 16716 gene locus_tag LOCUS_03040 16228 16716 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962680.1 protein_id gnl|my_center|LOCUS_03040 16830 17474 gene locus_tag LOCUS_03050 16830 17474 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962678.1 protein_id gnl|my_center|LOCUS_03050 17978 17481 gene locus_tag LOCUS_03060 17978 17481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 18429 18824 gene locus_tag LOCUS_03070 18429 18824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 18840 19229 gene locus_tag LOCUS_03080 18840 19229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 21022 21549 gene locus_tag LOCUS_03090 21022 21549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 21607 22254 gene locus_tag LOCUS_03100 21607 22254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 22251 23375 gene locus_tag LOCUS_03110 22251 23375 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839729.1 protein_id gnl|my_center|LOCUS_03110 23528 24445 gene locus_tag LOCUS_03120 23528 24445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 25551 24574 gene locus_tag LOCUS_03130 gene trpS 25551 24574 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964337.1 protein_id gnl|my_center|LOCUS_03130 26172 25561 gene locus_tag LOCUS_03140 26172 25561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 26521 26279 gene locus_tag LOCUS_03150 26521 26279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 27186 26587 gene locus_tag LOCUS_03160 27186 26587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 28047 27301 gene locus_tag LOCUS_03170 28047 27301 CDS product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016944168.1 protein_id gnl|my_center|LOCUS_03170 29039 28209 gene locus_tag LOCUS_03180 29039 28209 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801215.1 protein_id gnl|my_center|LOCUS_03180 28920 29207 gene locus_tag LOCUS_03190 28920 29207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 29632 29258 gene locus_tag LOCUS_03200 29632 29258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 30573 29704 gene locus_tag LOCUS_03210 30573 29704 CDS product DUF4198 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928847.1 protein_id gnl|my_center|LOCUS_03210 31136 30639 gene locus_tag LOCUS_03220 31136 30639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 33006 31168 gene locus_tag LOCUS_03230 33006 31168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 33202 33831 gene locus_tag LOCUS_03240 33202 33831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 35899 34004 gene locus_tag LOCUS_03250 35899 34004 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921313.1 protein_id gnl|my_center|LOCUS_03250 36451 36858 gene locus_tag LOCUS_03260 36451 36858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 38809 41121 gene locus_tag LOCUS_03270 38809 41121 CDS product carbohydrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031477.1 protein_id gnl|my_center|LOCUS_03270 42777 41428 gene locus_tag LOCUS_03280 gene yfcC 42777 41428 CDS product putative basic amino acid antiporter YfcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016083.1 protein_id gnl|my_center|LOCUS_03280 44073 42904 gene locus_tag LOCUS_03290 44073 42904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_123815508.1 protein_id gnl|my_center|LOCUS_03290 45115 44114 gene locus_tag LOCUS_03300 45115 44114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 45205 45459 gene locus_tag LOCUS_03310 45205 45459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 45517 45960 gene locus_tag LOCUS_03320 45517 45960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 45957 46715 gene locus_tag LOCUS_03330 45957 46715 CDS product tRNA(His) guanylyltransferase Thg1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060935.1 protein_id gnl|my_center|LOCUS_03330 47354 47097 gene locus_tag LOCUS_03340 47354 47097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 47589 49115 gene locus_tag LOCUS_03350 47589 49115 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110052.1 protein_id gnl|my_center|LOCUS_03350 49783 49265 gene locus_tag LOCUS_03360 49783 49265 CDS product 2'-5' RNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073392055.1 protein_id gnl|my_center|LOCUS_03360 49981 51102 gene locus_tag LOCUS_03370 gene splB 49981 51102 CDS product spore photoproduct lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009879610.1 protein_id gnl|my_center|LOCUS_03370 51158 52492 gene locus_tag LOCUS_03380 gene hutI 51158 52492 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256863.1 protein_id gnl|my_center|LOCUS_03380 52486 52944 gene locus_tag LOCUS_03390 52486 52944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 53914 53177 gene locus_tag LOCUS_03400 53914 53177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 55347 54778 gene locus_tag LOCUS_03410 55347 54778 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962711.1 protein_id gnl|my_center|LOCUS_03410 55632 56459 gene locus_tag LOCUS_03420 55632 56459 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092159.1 protein_id gnl|my_center|LOCUS_03420 57097 56456 gene locus_tag LOCUS_03430 gene ruvC 57097 56456 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_199350787.1 protein_id gnl|my_center|LOCUS_03430 57296 58240 gene locus_tag LOCUS_03440 57296 58240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 58237 59505 gene locus_tag LOCUS_03450 58237 59505 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962387.1 protein_id gnl|my_center|LOCUS_03450 59571 60128 gene locus_tag LOCUS_03460 59571 60128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 60858 60088 gene locus_tag LOCUS_03470 60858 60088 CDS product phosphodiester glycosidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532085.1 protein_id gnl|my_center|LOCUS_03470 60939 61196 gene locus_tag LOCUS_03480 60939 61196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 61199 62404 gene locus_tag LOCUS_03490 61199 62404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 62453 63754 gene locus_tag LOCUS_03500 62453 63754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 63754 64323 gene locus_tag LOCUS_03510 63754 64323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 66809 65325 gene locus_tag LOCUS_03520 66809 65325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 67888 66806 gene locus_tag LOCUS_03530 67888 66806 CDS product Wzz/FepE/Etk N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942498.1 protein_id gnl|my_center|LOCUS_03530 67978 69501 gene locus_tag LOCUS_03540 67978 69501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 69609 70757 gene locus_tag LOCUS_03550 69609 70757 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255994.1 protein_id gnl|my_center|LOCUS_03550 70834 71376 gene locus_tag LOCUS_03560 70834 71376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 71382 72062 gene locus_tag LOCUS_03570 71382 72062 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962465.1 protein_id gnl|my_center|LOCUS_03570 72059 73165 gene locus_tag LOCUS_03580 72059 73165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 73564 74331 gene locus_tag LOCUS_03590 73564 74331 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478755.1 protein_id gnl|my_center|LOCUS_03590 75466 74498 gene locus_tag LOCUS_03600 75466 74498 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000645267.1 protein_id gnl|my_center|LOCUS_03600 75836 78043 gene locus_tag LOCUS_03610 75836 78043 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963765.1 protein_id gnl|my_center|LOCUS_03610 78176 79414 gene locus_tag LOCUS_03620 78176 79414 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478434.1 protein_id gnl|my_center|LOCUS_03620 79427 80059 gene locus_tag LOCUS_03630 79427 80059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 80692 81390 gene locus_tag LOCUS_03640 80692 81390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 81469 82611 gene locus_tag LOCUS_03650 81469 82611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 82825 83622 gene locus_tag LOCUS_03660 82825 83622 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963759.1 protein_id gnl|my_center|LOCUS_03660 84238 83654 gene locus_tag LOCUS_03670 84238 83654 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141366.1 protein_id gnl|my_center|LOCUS_03670 85109 84279 gene locus_tag LOCUS_03680 85109 84279 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107611.1 protein_id gnl|my_center|LOCUS_03680 85589 85125 gene locus_tag LOCUS_03690 85589 85125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 86721 85702 gene locus_tag LOCUS_03700 86721 85702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 87729 86881 gene locus_tag LOCUS_03710 87729 86881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 88271 87828 gene locus_tag LOCUS_03720 88271 87828 CDS product ABA4-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222821.1 protein_id gnl|my_center|LOCUS_03720 89738 88632 gene locus_tag LOCUS_03730 89738 88632 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786035.1 protein_id gnl|my_center|LOCUS_03730 90255 89800 gene locus_tag LOCUS_03740 90255 89800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 91081 90386 gene locus_tag LOCUS_03750 91081 90386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 92542 91571 gene locus_tag LOCUS_03760 92542 91571 CDS product sodium-dependent bicarbonate transport family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124396.1 protein_id gnl|my_center|LOCUS_03760 93250 93050 gene locus_tag LOCUS_03770 93250 93050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 93744 93463 gene locus_tag LOCUS_03780 93744 93463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 94678 93812 gene locus_tag LOCUS_03790 94678 93812 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788892.1 protein_id gnl|my_center|LOCUS_03790 95816 94992 gene locus_tag LOCUS_03800 gene menB 95816 94992 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795543.1 protein_id gnl|my_center|LOCUS_03800 97641 95917 gene locus_tag LOCUS_03810 gene menD 97641 95917 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963786.1 protein_id gnl|my_center|LOCUS_03810 98976 97747 gene locus_tag LOCUS_03820 98976 97747 CDS product isochorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202358.1 protein_id gnl|my_center|LOCUS_03820 99407 98976 gene locus_tag LOCUS_03830 99407 98976 CDS product hotdog fold thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957885.1 protein_id gnl|my_center|LOCUS_03830 99594 100226 gene locus_tag LOCUS_03840 99594 100226 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549678.1 protein_id gnl|my_center|LOCUS_03840 100339 102060 gene locus_tag LOCUS_03850 100339 102060 CDS product pyruvate dehydrogenase complex dihydrolipoamide acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963512.1 protein_id gnl|my_center|LOCUS_03850 102451 102990 gene locus_tag LOCUS_03860 gene hslV 102451 102990 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062117.1 protein_id gnl|my_center|LOCUS_03860 103149 104120 gene locus_tag LOCUS_03870 103149 104120 CDS product deoxyhypusine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256447.1 protein_id gnl|my_center|LOCUS_03870 104448 104218 gene locus_tag LOCUS_03880 104448 104218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 104929 104465 gene locus_tag LOCUS_03890 104929 104465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 105803 105138 gene locus_tag LOCUS_03900 105803 105138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 107089 106169 gene locus_tag LOCUS_03910 107089 106169 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962433.1 protein_id gnl|my_center|LOCUS_03910 106985 107200 gene locus_tag LOCUS_03920 106985 107200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 107397 107765 gene locus_tag LOCUS_03930 107397 107765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 108032 109132 gene locus_tag LOCUS_03940 gene ychF 108032 109132 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108642.1 protein_id gnl|my_center|LOCUS_03940 109634 109239 gene locus_tag LOCUS_03950 109634 109239 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119424.1 protein_id gnl|my_center|LOCUS_03950 111206 109782 gene locus_tag LOCUS_03960 111206 109782 CDS product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046312529.1 protein_id gnl|my_center|LOCUS_03960 112688 111402 gene locus_tag LOCUS_03970 112688 111402 CDS product DUF5103 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962586.1 protein_id gnl|my_center|LOCUS_03970 112881 113828 gene locus_tag LOCUS_03980 112881 113828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000220886.1 protein_id gnl|my_center|LOCUS_03980 113921 114154 gene locus_tag LOCUS_03990 113921 114154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 114214 115890 gene locus_tag LOCUS_04000 114214 115890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 115911 116819 gene locus_tag LOCUS_04010 115911 116819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 116822 118651 gene locus_tag LOCUS_04020 116822 118651 CDS product cytochrome c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962729.1 protein_id gnl|my_center|LOCUS_04020 120582 118687 gene locus_tag LOCUS_04030 120582 118687 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932067.1 protein_id gnl|my_center|LOCUS_04030 121108 121665 gene locus_tag LOCUS_04040 121108 121665 CDS product DUF1572 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000435830.1 protein_id gnl|my_center|LOCUS_04040 121668 122300 gene locus_tag LOCUS_04050 121668 122300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 123147 122515 gene locus_tag LOCUS_04060 123147 122515 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142016.1 protein_id gnl|my_center|LOCUS_04060 123829 123140 gene locus_tag LOCUS_04070 123829 123140 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402807.1 protein_id gnl|my_center|LOCUS_04070 124967 123894 gene locus_tag LOCUS_04080 124967 123894 CDS product GntG family PLP-dependent aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142473.1 protein_id gnl|my_center|LOCUS_04080 125201 125632 gene locus_tag LOCUS_04090 125201 125632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 126298 125795 gene locus_tag LOCUS_04100 126298 125795 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203414.1 protein_id gnl|my_center|LOCUS_04100 126433 127137 gene locus_tag LOCUS_04110 126433 127137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 127951 128430 gene locus_tag LOCUS_04120 127951 128430 CDS product DUF1203 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328359.1 protein_id gnl|my_center|LOCUS_04120 128434 129078 gene locus_tag LOCUS_04130 gene paiB 128434 129078 CDS product protease synthase/sporulation negative transcriptional regulator PaiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244329.1 protein_id gnl|my_center|LOCUS_04130 131759 129285 gene locus_tag LOCUS_04140 131759 129285 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840170.1 protein_id gnl|my_center|LOCUS_04140 132411 131773 gene locus_tag LOCUS_04150 132411 131773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 132743 133804 gene locus_tag LOCUS_04160 132743 133804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 133801 134538 gene locus_tag LOCUS_04170 133801 134538 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764714.1 protein_id gnl|my_center|LOCUS_04170 135052 134585 gene locus_tag LOCUS_04180 gene coaD 135052 134585 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356693.1 protein_id gnl|my_center|LOCUS_04180 135938 135117 gene locus_tag LOCUS_04190 135938 135117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 136897 136325 gene locus_tag LOCUS_04200 gene cobC 136897 136325 CDS product alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000424906.1 protein_id gnl|my_center|LOCUS_04200 137697 136894 gene locus_tag LOCUS_04210 137697 136894 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963577.1 protein_id gnl|my_center|LOCUS_04210 138960 137911 gene locus_tag LOCUS_04220 gene cobT 138960 137911 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193123.1 protein_id gnl|my_center|LOCUS_04220 139568 138960 gene locus_tag LOCUS_04230 139568 138960 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555647.1 protein_id gnl|my_center|LOCUS_04230 140164 139661 gene locus_tag LOCUS_04240 gene cobU 140164 139661 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963579.1 protein_id gnl|my_center|LOCUS_04240 142405 140255 gene locus_tag LOCUS_04250 142405 140255 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926859.1 protein_id gnl|my_center|LOCUS_04250 143564 142533 gene locus_tag LOCUS_04260 143564 142533 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932103.1 protein_id gnl|my_center|LOCUS_04260 144662 143571 gene locus_tag LOCUS_04270 144662 143571 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932102.1 protein_id gnl|my_center|LOCUS_04270 145873 144659 gene locus_tag LOCUS_04280 145873 144659 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926854.1 protein_id gnl|my_center|LOCUS_04280 146679 146146 gene locus_tag LOCUS_04290 146679 146146 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932608.1 protein_id gnl|my_center|LOCUS_04290 147892 146933 gene locus_tag LOCUS_04300 gene cbiB 147892 146933 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803605.1 protein_id gnl|my_center|LOCUS_04300 148770 147871 gene locus_tag LOCUS_04310 gene cobD 148770 147871 CDS product threonine-phosphate decarboxylase CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768909.1 protein_id gnl|my_center|LOCUS_04310 150391 148919 gene locus_tag LOCUS_04320 150391 148919 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787973.1 protein_id gnl|my_center|LOCUS_04320 151232 150714 gene locus_tag LOCUS_04330 151232 150714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 151773 152216 gene locus_tag LOCUS_04340 151773 152216 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530371.1 protein_id gnl|my_center|LOCUS_04340 >Feature sequence04 1844 651 gene locus_tag LOCUS_04350 1844 651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 3221 2076 gene locus_tag LOCUS_04360 3221 2076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088279.1 protein_id gnl|my_center|LOCUS_04360 4747 3419 gene locus_tag LOCUS_04370 4747 3419 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405033.1 protein_id gnl|my_center|LOCUS_04370 5415 4888 gene locus_tag LOCUS_04380 5415 4888 CDS product DUF2480 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964474.1 protein_id gnl|my_center|LOCUS_04380 6204 5494 gene locus_tag LOCUS_04390 gene tsaB 6204 5494 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790587.1 protein_id gnl|my_center|LOCUS_04390 6819 6298 gene locus_tag LOCUS_04400 6819 6298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 8620 6926 gene locus_tag LOCUS_04410 8620 6926 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765353.1 protein_id gnl|my_center|LOCUS_04410 9086 8646 gene locus_tag LOCUS_04420 9086 8646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 9307 9149 gene locus_tag LOCUS_04430 gene rpmH 9307 9149 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004292199.1 protein_id gnl|my_center|LOCUS_04430 9444 11177 gene locus_tag LOCUS_04440 9444 11177 CDS product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524104.1 protein_id gnl|my_center|LOCUS_04440 11721 11431 gene locus_tag LOCUS_04450 11721 11431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 12811 11816 gene locus_tag LOCUS_04460 12811 11816 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962374.1 protein_id gnl|my_center|LOCUS_04460 12986 12912 gene locus_tag LOCUS_t00070 12986 12912 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 13136 14548 gene locus_tag LOCUS_04470 13136 14548 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786517.1 protein_id gnl|my_center|LOCUS_04470 15144 14566 gene locus_tag LOCUS_04480 15144 14566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 15632 15216 gene locus_tag LOCUS_04490 15632 15216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 16564 15845 gene locus_tag LOCUS_04500 gene upp 16564 15845 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964558.1 protein_id gnl|my_center|LOCUS_04500 16838 18820 gene locus_tag LOCUS_04510 16838 18820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 18824 19174 gene locus_tag LOCUS_04520 18824 19174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975153.1 protein_id gnl|my_center|LOCUS_04520 19195 21039 gene locus_tag LOCUS_04530 19195 21039 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108810.1 protein_id gnl|my_center|LOCUS_04530 21128 21340 gene locus_tag LOCUS_04540 21128 21340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 21428 21916 gene locus_tag LOCUS_04550 21428 21916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 21982 22572 gene locus_tag LOCUS_04560 gene lpcA 21982 22572 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705469.1 protein_id gnl|my_center|LOCUS_04560 24469 22940 gene locus_tag LOCUS_04570 24469 22940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 26310 24895 gene locus_tag LOCUS_04580 26310 24895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 28599 26848 gene locus_tag LOCUS_04590 28599 26848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 30461 28809 gene locus_tag LOCUS_04600 30461 28809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 31118 32653 gene locus_tag LOCUS_04610 31118 32653 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008661626.1 protein_id gnl|my_center|LOCUS_04610 32781 33848 gene locus_tag LOCUS_04620 32781 33848 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963929.1 protein_id gnl|my_center|LOCUS_04620 34476 33790 gene locus_tag LOCUS_04630 34476 33790 CDS product DUF2306 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918185.1 protein_id gnl|my_center|LOCUS_04630 35577 34603 gene locus_tag LOCUS_04640 35577 34603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 36064 36813 gene locus_tag LOCUS_04650 36064 36813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 37590 38264 gene locus_tag LOCUS_04660 37590 38264 CDS product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402867.1 protein_id gnl|my_center|LOCUS_04660 38437 39033 gene locus_tag LOCUS_04670 38437 39033 CDS product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402867.1 protein_id gnl|my_center|LOCUS_04670 39260 39559 gene locus_tag LOCUS_04680 39260 39559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 39734 40300 gene locus_tag LOCUS_04690 39734 40300 CDS product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964236.1 protein_id gnl|my_center|LOCUS_04690 40693 41298 gene locus_tag LOCUS_04700 40693 41298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 42805 41441 gene locus_tag LOCUS_04710 42805 41441 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962327.1 protein_id gnl|my_center|LOCUS_04710 43546 42908 gene locus_tag LOCUS_04720 gene plsY 43546 42908 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775062.1 protein_id gnl|my_center|LOCUS_04720 49289 43764 gene locus_tag LOCUS_04730 49289 43764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 49717 50739 gene locus_tag LOCUS_04740 49717 50739 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038536.1 protein_id gnl|my_center|LOCUS_04740 52821 51139 gene locus_tag LOCUS_04750 52821 51139 CDS product sodium/sugar symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005422351.1 protein_id gnl|my_center|LOCUS_04750 55689 53179 gene locus_tag LOCUS_04760 55689 53179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 56757 55927 gene locus_tag LOCUS_04770 gene prmA 56757 55927 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963788.1 protein_id gnl|my_center|LOCUS_04770 57246 56860 gene locus_tag LOCUS_04780 57246 56860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 57463 57254 gene locus_tag LOCUS_04790 57463 57254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 57499 57705 gene locus_tag LOCUS_04800 57499 57705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 57702 58142 gene locus_tag LOCUS_04810 57702 58142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 58385 58987 gene locus_tag LOCUS_04820 58385 58987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 59287 59481 gene locus_tag LOCUS_04830 59287 59481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 59471 59812 gene locus_tag LOCUS_04840 59471 59812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 59848 60129 gene locus_tag LOCUS_04850 59848 60129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 60652 60891 gene locus_tag LOCUS_04860 60652 60891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 61729 60962 gene locus_tag LOCUS_04870 gene tpiA 61729 60962 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791115.1 protein_id gnl|my_center|LOCUS_04870 62375 63103 gene locus_tag LOCUS_04880 62375 63103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 64141 63254 gene locus_tag LOCUS_04890 64141 63254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229185.1 protein_id gnl|my_center|LOCUS_04890 67139 64281 gene locus_tag LOCUS_04900 gene uvrA 67139 64281 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963246.1 protein_id gnl|my_center|LOCUS_04900 67503 68912 gene locus_tag LOCUS_04910 67503 68912 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839972.1 protein_id gnl|my_center|LOCUS_04910 69411 68998 gene locus_tag LOCUS_04920 69411 68998 CDS product YvaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001080905.1 protein_id gnl|my_center|LOCUS_04920 70368 71705 gene locus_tag LOCUS_04930 70368 71705 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839972.1 protein_id gnl|my_center|LOCUS_04930 72046 73017 gene locus_tag LOCUS_04940 72046 73017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 74359 73073 gene locus_tag LOCUS_04950 74359 73073 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000195122.1 protein_id gnl|my_center|LOCUS_04950 74610 74912 gene locus_tag LOCUS_04960 74610 74912 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125585.1 protein_id gnl|my_center|LOCUS_04960 74967 75263 gene locus_tag LOCUS_04970 74967 75263 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125585.1 protein_id gnl|my_center|LOCUS_04970 75324 75677 gene locus_tag LOCUS_04980 75324 75677 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125585.1 protein_id gnl|my_center|LOCUS_04980 76216 76851 gene locus_tag LOCUS_04990 76216 76851 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963245.1 protein_id gnl|my_center|LOCUS_04990 76790 77017 gene locus_tag LOCUS_05000 76790 77017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 77170 77847 gene locus_tag LOCUS_05010 gene nth 77170 77847 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767855.1 protein_id gnl|my_center|LOCUS_05010 79353 78145 gene locus_tag LOCUS_05020 79353 78145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 80418 79456 gene locus_tag LOCUS_05030 80418 79456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 80563 81240 gene locus_tag LOCUS_05040 80563 81240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 83118 81511 gene locus_tag LOCUS_05050 83118 81511 CDS product ribonuclease E/G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963779.1 protein_id gnl|my_center|LOCUS_05050 83513 83331 gene locus_tag LOCUS_05060 83513 83331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 84467 83547 gene locus_tag LOCUS_05070 84467 83547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 84941 84630 gene locus_tag LOCUS_05080 84941 84630 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762277.1 protein_id gnl|my_center|LOCUS_05080 85132 86214 gene locus_tag LOCUS_05090 gene mutY 85132 86214 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303166.1 protein_id gnl|my_center|LOCUS_05090 86355 86789 gene locus_tag LOCUS_05100 86355 86789 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943738.1 protein_id gnl|my_center|LOCUS_05100 86874 87518 gene locus_tag LOCUS_05110 gene gldD 86874 87518 CDS product gliding motility lipoprotein GldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963775.1 protein_id gnl|my_center|LOCUS_05110 87619 89715 gene locus_tag LOCUS_05120 gene recG 87619 89715 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963155.1 protein_id gnl|my_center|LOCUS_05120 90002 89775 gene locus_tag LOCUS_05130 90002 89775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 90364 91818 gene locus_tag LOCUS_05140 90364 91818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 93676 91886 gene locus_tag LOCUS_05150 93676 91886 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963836.1 protein_id gnl|my_center|LOCUS_05150 94167 93841 gene locus_tag LOCUS_05160 94167 93841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 95887 94706 gene locus_tag LOCUS_05170 95887 94706 CDS product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963835.1 protein_id gnl|my_center|LOCUS_05170 98442 96034 gene locus_tag LOCUS_05180 98442 96034 CDS product 3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963833.1 protein_id gnl|my_center|LOCUS_05180 98982 98503 gene locus_tag LOCUS_05190 98982 98503 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963832.1 protein_id gnl|my_center|LOCUS_05190 99901 99113 gene locus_tag LOCUS_05200 99901 99113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 101778 100000 gene locus_tag LOCUS_05210 101778 100000 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026955981.1 protein_id gnl|my_center|LOCUS_05210 101971 103128 gene locus_tag LOCUS_05220 101971 103128 CDS product formimidoylglutamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964076.1 protein_id gnl|my_center|LOCUS_05220 103144 103419 gene locus_tag LOCUS_05230 103144 103419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 103494 104297 gene locus_tag LOCUS_05240 gene murQ 103494 104297 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962884.1 protein_id gnl|my_center|LOCUS_05240 104862 104344 gene locus_tag LOCUS_05250 104862 104344 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254447.1 protein_id gnl|my_center|LOCUS_05250 105046 105924 gene locus_tag LOCUS_05260 105046 105924 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088611.1 protein_id gnl|my_center|LOCUS_05260 106004 106573 gene locus_tag LOCUS_05270 106004 106573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 106907 106656 gene locus_tag LOCUS_05280 106907 106656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 108411 107083 gene locus_tag LOCUS_05290 gene der 108411 107083 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964065.1 protein_id gnl|my_center|LOCUS_05290 109445 108549 gene locus_tag LOCUS_05300 gene era 109445 108549 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964066.1 protein_id gnl|my_center|LOCUS_05300 109845 110888 gene locus_tag LOCUS_05310 gene hemH 109845 110888 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444837.1 protein_id gnl|my_center|LOCUS_05310 111371 110922 gene locus_tag LOCUS_05320 111371 110922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 111984 111460 gene locus_tag LOCUS_05330 111984 111460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 112960 112379 gene locus_tag LOCUS_05340 112960 112379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 114492 113350 gene locus_tag LOCUS_05350 114492 113350 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008588454.1 protein_id gnl|my_center|LOCUS_05350 115964 114648 gene locus_tag LOCUS_05360 gene glmM 115964 114648 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009194034.1 protein_id gnl|my_center|LOCUS_05360 116118 116975 gene locus_tag LOCUS_05370 gene mazG 116118 116975 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963865.1 protein_id gnl|my_center|LOCUS_05370 117208 116954 gene locus_tag LOCUS_05380 117208 116954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 117251 118132 gene locus_tag LOCUS_05390 117251 118132 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792006.1 protein_id gnl|my_center|LOCUS_05390 118277 118909 gene locus_tag LOCUS_05400 118277 118909 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964299.1 protein_id gnl|my_center|LOCUS_05400 118967 119503 gene locus_tag LOCUS_05410 118967 119503 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964298.1 protein_id gnl|my_center|LOCUS_05410 119500 120327 gene locus_tag LOCUS_05420 119500 120327 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763546.1 protein_id gnl|my_center|LOCUS_05420 120679 120951 gene locus_tag LOCUS_05430 120679 120951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 120944 121939 gene locus_tag LOCUS_05440 120944 121939 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791999.1 protein_id gnl|my_center|LOCUS_05440 121996 123627 gene locus_tag LOCUS_05450 121996 123627 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203594.1 protein_id gnl|my_center|LOCUS_05450 124899 123847 gene locus_tag LOCUS_05460 124899 123847 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962812.1 protein_id gnl|my_center|LOCUS_05460 125607 124975 gene locus_tag LOCUS_05470 125607 124975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 126349 125648 gene locus_tag LOCUS_05480 126349 125648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 128912 126387 gene locus_tag LOCUS_05490 gene bamA 128912 126387 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034100221.1 protein_id gnl|my_center|LOCUS_05490 129668 128922 gene locus_tag LOCUS_05500 129668 128922 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766989.1 protein_id gnl|my_center|LOCUS_05500 130556 129801 gene locus_tag LOCUS_05510 130556 129801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 131521 130607 gene locus_tag LOCUS_05520 131521 130607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 132549 131656 gene locus_tag LOCUS_05530 132549 131656 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964192.1 protein_id gnl|my_center|LOCUS_05530 134054 132630 gene locus_tag LOCUS_05540 134054 132630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 134768 134094 gene locus_tag LOCUS_05550 134768 134094 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839781.1 protein_id gnl|my_center|LOCUS_05550 135693 134911 gene locus_tag LOCUS_05560 135693 134911 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403300.1 protein_id gnl|my_center|LOCUS_05560 136409 135816 gene locus_tag LOCUS_05570 136409 135816 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035720.1 protein_id gnl|my_center|LOCUS_05570 137142 136603 gene locus_tag LOCUS_05580 137142 136603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 137784 137326 gene locus_tag LOCUS_05590 137784 137326 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964151.1 protein_id gnl|my_center|LOCUS_05590 138832 137804 gene locus_tag LOCUS_05600 138832 137804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 139011 139739 gene locus_tag LOCUS_05610 139011 139739 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964190.1 protein_id gnl|my_center|LOCUS_05610 139795 140823 gene locus_tag LOCUS_05620 gene mnmH 139795 140823 CDS product tRNA 2-selenouridine(34) synthase MnmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937872.1 protein_id gnl|my_center|LOCUS_05620 142076 141078 gene locus_tag LOCUS_05630 142076 141078 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404896.1 protein_id gnl|my_center|LOCUS_05630 142842 143303 gene locus_tag LOCUS_05640 142842 143303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 143402 143848 gene locus_tag LOCUS_05650 143402 143848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 144296 143871 gene locus_tag LOCUS_05660 144296 143871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 145555 144293 gene locus_tag LOCUS_05670 145555 144293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 145998 145591 gene locus_tag LOCUS_05680 145998 145591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 147371 145995 gene locus_tag LOCUS_05690 147371 145995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 148017 147631 gene locus_tag LOCUS_05700 148017 147631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 150497 148050 gene locus_tag LOCUS_05710 150497 148050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 151114 150668 gene locus_tag LOCUS_05720 151114 150668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 151446 151114 gene locus_tag LOCUS_05730 151446 151114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 >Feature sequence05 540 1037 gene locus_tag LOCUS_05740 540 1037 CDS product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384659.1 protein_id gnl|my_center|LOCUS_05740 2355 1297 gene locus_tag LOCUS_05750 2355 1297 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206578673.1 protein_id gnl|my_center|LOCUS_05750 2953 2528 gene locus_tag LOCUS_05760 2953 2528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 6522 3376 gene locus_tag LOCUS_05770 6522 3376 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765563.1 protein_id gnl|my_center|LOCUS_05770 9918 6703 gene locus_tag LOCUS_05780 9918 6703 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765563.1 protein_id gnl|my_center|LOCUS_05780 11101 10022 gene locus_tag LOCUS_05790 11101 10022 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765562.1 protein_id gnl|my_center|LOCUS_05790 12455 11223 gene locus_tag LOCUS_05800 12455 11223 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817697.1 protein_id gnl|my_center|LOCUS_05800 13992 12625 gene locus_tag LOCUS_05810 13992 12625 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765778.1 protein_id gnl|my_center|LOCUS_05810 14892 14218 gene locus_tag LOCUS_05820 14892 14218 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941118.1 protein_id gnl|my_center|LOCUS_05820 16244 14976 gene locus_tag LOCUS_05830 16244 14976 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105667.1 protein_id gnl|my_center|LOCUS_05830 19375 16742 gene locus_tag LOCUS_05840 19375 16742 CDS product glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141168.1 protein_id gnl|my_center|LOCUS_05840 20432 19620 gene locus_tag LOCUS_05850 20432 19620 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141114.1 protein_id gnl|my_center|LOCUS_05850 21866 20853 gene locus_tag LOCUS_05860 21866 20853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05860 22675 23319 gene locus_tag LOCUS_05870 22675 23319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 23915 24136 gene locus_tag LOCUS_05880 23915 24136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 24837 25256 gene locus_tag LOCUS_05890 24837 25256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 25569 26513 gene locus_tag LOCUS_05900 25569 26513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027540.1 protein_id gnl|my_center|LOCUS_05900 26839 27189 gene locus_tag LOCUS_05910 26839 27189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 29154 27415 gene locus_tag LOCUS_05920 29154 27415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 30444 29560 gene locus_tag LOCUS_05930 30444 29560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 31933 31259 gene locus_tag LOCUS_05940 31933 31259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 32402 32554 gene locus_tag LOCUS_05950 32402 32554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 32816 33565 gene locus_tag LOCUS_05960 32816 33565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 33562 34176 gene locus_tag LOCUS_05970 33562 34176 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167392103.1 protein_id gnl|my_center|LOCUS_05970 34173 34994 gene locus_tag LOCUS_05980 34173 34994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 35122 35415 gene locus_tag LOCUS_05990 35122 35415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 35983 35911 gene locus_tag LOCUS_t00080 35983 35911 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 36299 37306 gene locus_tag LOCUS_06000 gene gap 36299 37306 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933146.1 protein_id gnl|my_center|LOCUS_06000 37514 38383 gene locus_tag LOCUS_06010 37514 38383 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761539.1 protein_id gnl|my_center|LOCUS_06010 38738 39073 gene locus_tag LOCUS_06020 38738 39073 CDS product translation initiation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791744.1 protein_id gnl|my_center|LOCUS_06020 39399 39827 gene locus_tag LOCUS_06030 39399 39827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 40573 39824 gene locus_tag LOCUS_06040 gene kdsB 40573 39824 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761419.1 protein_id gnl|my_center|LOCUS_06040 40850 41707 gene locus_tag LOCUS_06050 40850 41707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 41795 42871 gene locus_tag LOCUS_06060 41795 42871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 42912 43664 gene locus_tag LOCUS_06070 42912 43664 CDS product TIGR02757 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038503931.1 protein_id gnl|my_center|LOCUS_06070 43770 46214 gene locus_tag LOCUS_06080 43770 46214 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109374.1 protein_id gnl|my_center|LOCUS_06080 46312 46713 gene locus_tag LOCUS_06090 46312 46713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 46862 48682 gene locus_tag LOCUS_06100 46862 48682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 49946 48912 gene locus_tag LOCUS_06110 gene murB 49946 48912 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106928.1 protein_id gnl|my_center|LOCUS_06110 50015 50560 gene locus_tag LOCUS_06120 50015 50560 CDS product RNA 2'-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029338.1 protein_id gnl|my_center|LOCUS_06120 52012 50594 gene locus_tag LOCUS_06130 gene fucP 52012 50594 CDS product L-fucose:H+ symporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036694.1 protein_id gnl|my_center|LOCUS_06130 52082 53233 gene locus_tag LOCUS_06140 52082 53233 CDS product THUMP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144029.1 protein_id gnl|my_center|LOCUS_06140 53944 56172 gene locus_tag LOCUS_06150 gene recQ 53944 56172 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055229616.1 protein_id gnl|my_center|LOCUS_06150 56709 57536 gene locus_tag LOCUS_06160 56709 57536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 57666 58388 gene locus_tag LOCUS_06170 57666 58388 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522523.1 protein_id gnl|my_center|LOCUS_06170 59245 58682 gene locus_tag LOCUS_06180 59245 58682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 62005 59282 gene locus_tag LOCUS_06190 62005 59282 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962291.1 protein_id gnl|my_center|LOCUS_06190 64088 63177 gene locus_tag LOCUS_06200 64088 63177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 64421 65293 gene locus_tag LOCUS_06210 64421 65293 CDS product fasciclin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405131.1 protein_id gnl|my_center|LOCUS_06210 65543 66940 gene locus_tag LOCUS_06220 65543 66940 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022878.1 protein_id gnl|my_center|LOCUS_06220 68832 66979 gene locus_tag LOCUS_06230 68832 66979 CDS product M2 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072459.1 protein_id gnl|my_center|LOCUS_06230 69407 69021 gene locus_tag LOCUS_06240 69407 69021 CDS product low molecular weight protein tyrosine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528628.1 protein_id gnl|my_center|LOCUS_06240 70843 69407 gene locus_tag LOCUS_06250 gene dbpA 70843 69407 CDS product ATP-dependent RNA helicase DbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037426.1 protein_id gnl|my_center|LOCUS_06250 71160 72050 gene locus_tag LOCUS_06260 71160 72050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 73429 72491 gene locus_tag LOCUS_06270 73429 72491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 73522 74052 gene locus_tag LOCUS_06280 73522 74052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 74488 74946 gene locus_tag LOCUS_06290 74488 74946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 76450 75284 gene locus_tag LOCUS_06300 76450 75284 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205624253.1 protein_id gnl|my_center|LOCUS_06300 77478 76642 gene locus_tag LOCUS_06310 77478 76642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 78342 77815 gene locus_tag LOCUS_06320 78342 77815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 79898 78672 gene locus_tag LOCUS_06330 79898 78672 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141490.1 protein_id gnl|my_center|LOCUS_06330 80975 80220 gene locus_tag LOCUS_06340 80975 80220 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257749.1 protein_id gnl|my_center|LOCUS_06340 83054 81120 gene locus_tag LOCUS_06350 83054 81120 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257750.1 protein_id gnl|my_center|LOCUS_06350 83859 83158 gene locus_tag LOCUS_06360 83859 83158 CDS product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927180.1 protein_id gnl|my_center|LOCUS_06360 84195 87140 gene locus_tag LOCUS_06370 84195 87140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 87480 90377 gene locus_tag LOCUS_06380 87480 90377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 90606 91511 gene locus_tag LOCUS_06390 gene fabD 90606 91511 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793967.1 protein_id gnl|my_center|LOCUS_06390 91760 91557 gene locus_tag LOCUS_06400 91760 91557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 92908 92048 gene locus_tag LOCUS_06410 92908 92048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 93013 94023 gene locus_tag LOCUS_06420 93013 94023 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964177.1 protein_id gnl|my_center|LOCUS_06420 94476 94183 gene locus_tag LOCUS_06430 94476 94183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 94613 96019 gene locus_tag LOCUS_06440 94613 96019 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258472.1 protein_id gnl|my_center|LOCUS_06440 96807 96313 gene locus_tag LOCUS_06450 96807 96313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 97855 97058 gene locus_tag LOCUS_06460 97855 97058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 98194 98027 gene locus_tag LOCUS_06470 98194 98027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 98966 98373 gene locus_tag LOCUS_06480 98966 98373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 100352 99114 gene locus_tag LOCUS_06490 100352 99114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 101415 100825 gene locus_tag LOCUS_06500 101415 100825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 102302 101436 gene locus_tag LOCUS_06510 102302 101436 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962636.1 protein_id gnl|my_center|LOCUS_06510 103725 102433 gene locus_tag LOCUS_06520 103725 102433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 103987 106278 gene locus_tag LOCUS_06530 103987 106278 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863308.1 protein_id gnl|my_center|LOCUS_06530 106576 107364 gene locus_tag LOCUS_06540 106576 107364 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207498.1 protein_id gnl|my_center|LOCUS_06540 108521 107769 gene locus_tag LOCUS_06550 108521 107769 CDS product EcsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454391.1 protein_id gnl|my_center|LOCUS_06550 109374 108616 gene locus_tag LOCUS_06560 109374 108616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 110170 109409 gene locus_tag LOCUS_06570 110170 109409 CDS product FkbM family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017276633.1 protein_id gnl|my_center|LOCUS_06570 110738 111700 gene locus_tag LOCUS_06580 110738 111700 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963796.1 protein_id gnl|my_center|LOCUS_06580 112063 112467 gene locus_tag LOCUS_06590 gene yiaA 112063 112467 CDS product inner membrane protein YiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524062.1 protein_id gnl|my_center|LOCUS_06590 112512 113201 gene locus_tag LOCUS_06600 112512 113201 CDS product TIGR02117 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938028.1 protein_id gnl|my_center|LOCUS_06600 114258 113344 gene locus_tag LOCUS_06610 114258 113344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325235.1 protein_id gnl|my_center|LOCUS_06610 114701 114453 gene locus_tag LOCUS_06620 114701 114453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 115512 115102 gene locus_tag LOCUS_06630 115512 115102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 118539 115744 gene locus_tag LOCUS_06640 118539 115744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 118847 120502 gene locus_tag LOCUS_06650 gene paaN 118847 120502 CDS product phenylacetic acid degradation protein PaaN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813288.1 protein_id gnl|my_center|LOCUS_06650 121022 120720 gene locus_tag LOCUS_06660 121022 120720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 122137 121583 gene locus_tag LOCUS_06670 122137 121583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 122758 123612 gene locus_tag LOCUS_06680 122758 123612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 125700 123778 gene locus_tag LOCUS_06690 125700 123778 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962749.1 protein_id gnl|my_center|LOCUS_06690 126640 127134 gene locus_tag LOCUS_06700 126640 127134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 127118 130048 gene locus_tag LOCUS_06710 127118 130048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 134405 130314 gene locus_tag LOCUS_06720 134405 130314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 138092 135558 gene locus_tag LOCUS_06730 138092 135558 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403467.1 protein_id gnl|my_center|LOCUS_06730 139309 138626 gene locus_tag LOCUS_06740 139309 138626 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103923.1 protein_id gnl|my_center|LOCUS_06740 139493 140212 gene locus_tag LOCUS_06750 139493 140212 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839642.1 protein_id gnl|my_center|LOCUS_06750 140458 140688 gene locus_tag LOCUS_06760 140458 140688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 141954 140824 gene locus_tag LOCUS_06770 141954 140824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 142559 142747 gene locus_tag LOCUS_06780 142559 142747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 143404 142673 gene locus_tag LOCUS_06790 143404 142673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 143484 143783 gene locus_tag LOCUS_06800 143484 143783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 144977 143919 gene locus_tag LOCUS_06810 144977 143919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 >Feature sequence06 <1 568 gene locus_tag LOCUS_06820 <1 568 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011172908.1:response regulator 733 2658 gene locus_tag LOCUS_06830 733 2658 CDS product propionyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104354.1 protein_id gnl|my_center|LOCUS_06830 2846 4756 gene locus_tag LOCUS_06840 gene acs 2846 4756 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963090.1 protein_id gnl|my_center|LOCUS_06840 5876 4836 gene locus_tag LOCUS_06850 5876 4836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 8072 6198 gene locus_tag LOCUS_06860 8072 6198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 10067 8166 gene locus_tag LOCUS_06870 10067 8166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 12108 10225 gene locus_tag LOCUS_06880 12108 10225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 12871 13419 gene locus_tag LOCUS_06890 12871 13419 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362025.1 protein_id gnl|my_center|LOCUS_06890 13981 13766 gene locus_tag LOCUS_06900 13981 13766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 14440 14153 gene locus_tag LOCUS_06910 14440 14153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 15066 14644 gene locus_tag LOCUS_06920 15066 14644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 15228 15067 gene locus_tag LOCUS_06930 15228 15067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 16547 15627 gene locus_tag LOCUS_06940 16547 15627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 20244 16600 gene locus_tag LOCUS_06950 20244 16600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 22878 21763 gene locus_tag LOCUS_06960 22878 21763 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010536536.1 protein_id gnl|my_center|LOCUS_06960 25274 22941 gene locus_tag LOCUS_06970 25274 22941 CDS product DUF5682 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029876.1 protein_id gnl|my_center|LOCUS_06970 25799 25284 gene locus_tag LOCUS_06980 25799 25284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 26418 26089 gene locus_tag LOCUS_06990 26418 26089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 27515 26418 gene locus_tag LOCUS_07000 27515 26418 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227757.1 protein_id gnl|my_center|LOCUS_07000 30593 27519 gene locus_tag LOCUS_07010 30593 27519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 31112 30963 gene locus_tag LOCUS_07020 31112 30963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 32000 31146 gene locus_tag LOCUS_07030 32000 31146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 32151 33938 gene locus_tag LOCUS_07040 gene lepA 32151 33938 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964332.1 protein_id gnl|my_center|LOCUS_07040 34389 34027 gene locus_tag LOCUS_07050 34389 34027 CDS product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933244.1 protein_id gnl|my_center|LOCUS_07050 34488 35414 gene locus_tag LOCUS_07060 gene folD 34488 35414 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005780414.1 protein_id gnl|my_center|LOCUS_07060 35519 36196 gene locus_tag LOCUS_07070 35519 36196 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964290.1 protein_id gnl|my_center|LOCUS_07070 36262 38181 gene locus_tag LOCUS_07080 36262 38181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 38524 38904 gene locus_tag LOCUS_07090 38524 38904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 40653 39367 gene locus_tag LOCUS_07100 40653 39367 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000852462.1 protein_id gnl|my_center|LOCUS_07100 42404 40980 gene locus_tag LOCUS_07110 gene mnmE 42404 40980 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962791.1 protein_id gnl|my_center|LOCUS_07110 43182 42484 gene locus_tag LOCUS_07120 43182 42484 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962258.1 protein_id gnl|my_center|LOCUS_07120 44510 43500 gene locus_tag LOCUS_07130 44510 43500 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963619.1 protein_id gnl|my_center|LOCUS_07130 45631 44618 gene locus_tag LOCUS_07140 45631 44618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 45882 46703 gene locus_tag LOCUS_07150 45882 46703 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963740.1 protein_id gnl|my_center|LOCUS_07150 47474 46944 gene locus_tag LOCUS_07160 gene msrA 47474 46944 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257533.1 protein_id gnl|my_center|LOCUS_07160 48605 47718 gene locus_tag LOCUS_07170 48605 47718 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964015.1 protein_id gnl|my_center|LOCUS_07170 48808 48966 gene locus_tag LOCUS_07180 48808 48966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 49604 49053 gene locus_tag LOCUS_07190 49604 49053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 51561 49939 gene locus_tag LOCUS_07200 51561 49939 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232344.1 protein_id gnl|my_center|LOCUS_07200 51846 52328 gene locus_tag LOCUS_07210 51846 52328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 52514 52918 gene locus_tag LOCUS_07220 52514 52918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 53408 52959 gene locus_tag LOCUS_07230 53408 52959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 53561 54307 gene locus_tag LOCUS_07240 53561 54307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 54424 55236 gene locus_tag LOCUS_07250 54424 55236 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928819.1 protein_id gnl|my_center|LOCUS_07250 56139 55504 gene locus_tag LOCUS_07260 56139 55504 CDS product LON peptidase substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403957.1 protein_id gnl|my_center|LOCUS_07260 56282 57046 gene locus_tag LOCUS_07270 gene mtgA 56282 57046 CDS product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037989.1 protein_id gnl|my_center|LOCUS_07270 57076 57519 gene locus_tag LOCUS_07280 57076 57519 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929165.1 protein_id gnl|my_center|LOCUS_07280 57963 59903 gene locus_tag LOCUS_07290 57963 59903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 60579 63584 gene locus_tag LOCUS_07300 60579 63584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 64747 63620 gene locus_tag LOCUS_07310 64747 63620 CDS product App1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887835.1 protein_id gnl|my_center|LOCUS_07310 65148 66257 gene locus_tag LOCUS_07320 65148 66257 CDS product DNA topoisomerase IB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007247147.1 protein_id gnl|my_center|LOCUS_07320 67845 66295 gene locus_tag LOCUS_07330 67845 66295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 69542 67935 gene locus_tag LOCUS_07340 69542 67935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 69842 71317 gene locus_tag LOCUS_07350 69842 71317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 71776 72291 gene locus_tag LOCUS_07360 71776 72291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 73130 72432 gene locus_tag LOCUS_07370 73130 72432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 73909 73400 gene locus_tag LOCUS_07380 73909 73400 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119906.1 protein_id gnl|my_center|LOCUS_07380 74018 74626 gene locus_tag LOCUS_07390 74018 74626 CDS product acyl carrier protein phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963009.1 protein_id gnl|my_center|LOCUS_07390 75357 74842 gene locus_tag LOCUS_07400 75357 74842 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790721.1 protein_id gnl|my_center|LOCUS_07400 77752 75767 gene locus_tag LOCUS_07410 77752 75767 CDS product AAA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062695901.1 protein_id gnl|my_center|LOCUS_07410 78678 78319 gene locus_tag LOCUS_07420 78678 78319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 79314 78694 gene locus_tag LOCUS_07430 79314 78694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 79328 79795 gene locus_tag LOCUS_07440 79328 79795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 79993 83592 gene locus_tag LOCUS_07450 79993 83592 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202182.1 protein_id gnl|my_center|LOCUS_07450 86834 83826 gene locus_tag LOCUS_07460 86834 83826 CDS product DUF6493 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108576.1 protein_id gnl|my_center|LOCUS_07460 88272 86935 gene locus_tag LOCUS_07470 88272 86935 CDS product SWIM zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108575.1 protein_id gnl|my_center|LOCUS_07470 89215 88757 gene locus_tag LOCUS_07480 89215 88757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 90023 89205 gene locus_tag LOCUS_07490 90023 89205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 90969 90127 gene locus_tag LOCUS_07500 90969 90127 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100978.1 protein_id gnl|my_center|LOCUS_07500 92028 91042 gene locus_tag LOCUS_07510 92028 91042 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905879.1 protein_id gnl|my_center|LOCUS_07510 92705 92220 gene locus_tag LOCUS_07520 92705 92220 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020425.1 protein_id gnl|my_center|LOCUS_07520 93416 92919 gene locus_tag LOCUS_07530 93416 92919 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942914.1 protein_id gnl|my_center|LOCUS_07530 95033 93624 gene locus_tag LOCUS_07540 95033 93624 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118827171.1 protein_id gnl|my_center|LOCUS_07540 97668 95356 gene locus_tag LOCUS_07550 97668 95356 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964341.1 protein_id gnl|my_center|LOCUS_07550 97848 98054 gene locus_tag LOCUS_07560 97848 98054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 98144 98803 gene locus_tag LOCUS_07570 98144 98803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 99099 99938 gene locus_tag LOCUS_07580 99099 99938 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889254.1 protein_id gnl|my_center|LOCUS_07580 101274 100468 gene locus_tag LOCUS_07590 101274 100468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 102454 101327 gene locus_tag LOCUS_07600 gene dprA 102454 101327 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172795629.1 protein_id gnl|my_center|LOCUS_07600 102954 102592 gene locus_tag LOCUS_07610 102954 102592 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964047.1 protein_id gnl|my_center|LOCUS_07610 103034 105715 gene locus_tag LOCUS_07620 gene alaS 103034 105715 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109057.1 protein_id gnl|my_center|LOCUS_07620 106109 106861 gene locus_tag LOCUS_07630 106109 106861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 106898 107866 gene locus_tag LOCUS_07640 106898 107866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 107950 109413 gene locus_tag LOCUS_07650 gene gatB 107950 109413 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058226.1 protein_id gnl|my_center|LOCUS_07650 109669 110823 gene locus_tag LOCUS_07660 109669 110823 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815367.1 protein_id gnl|my_center|LOCUS_07660 112544 111822 gene locus_tag LOCUS_07670 112544 111822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 113112 112594 gene locus_tag LOCUS_07680 113112 112594 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964526.1 protein_id gnl|my_center|LOCUS_07680 113816 113247 gene locus_tag LOCUS_07690 113816 113247 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964013.1 protein_id gnl|my_center|LOCUS_07690 114062 115483 gene locus_tag LOCUS_07700 114062 115483 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256942.1 protein_id gnl|my_center|LOCUS_07700 115647 116768 gene locus_tag LOCUS_07710 gene mnmA 115647 116768 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405206.1 protein_id gnl|my_center|LOCUS_07710 116800 117600 gene locus_tag LOCUS_07720 116800 117600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 117856 117629 gene locus_tag LOCUS_07730 117856 117629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 117744 119342 gene locus_tag LOCUS_07740 117744 119342 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799138.1 protein_id gnl|my_center|LOCUS_07740 119477 119800 gene locus_tag LOCUS_07750 119477 119800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 119958 120554 gene locus_tag LOCUS_07760 119958 120554 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964472.1 protein_id gnl|my_center|LOCUS_07760 120615 120815 gene locus_tag LOCUS_07770 120615 120815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974312.1 protein_id gnl|my_center|LOCUS_07770 121536 120925 gene locus_tag LOCUS_07780 121536 120925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 122616 121696 gene locus_tag LOCUS_07790 gene hemF 122616 121696 CDS product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920736.1 protein_id gnl|my_center|LOCUS_07790 122757 124940 gene locus_tag LOCUS_07800 122757 124940 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871691.1 protein_id gnl|my_center|LOCUS_07800 125349 126113 gene locus_tag LOCUS_07810 125349 126113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 129393 126847 gene locus_tag LOCUS_07820 129393 126847 CDS product BamA/TamA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203587.1 protein_id gnl|my_center|LOCUS_07820 129498 130256 gene locus_tag LOCUS_07830 129498 130256 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000624136.1 protein_id gnl|my_center|LOCUS_07830 131666 130521 gene locus_tag LOCUS_07840 131666 130521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 132734 131685 gene locus_tag LOCUS_07850 132734 131685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 133300 132743 gene locus_tag LOCUS_07860 133300 132743 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964176.1 protein_id gnl|my_center|LOCUS_07860 136096 133799 gene locus_tag LOCUS_07870 136096 133799 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256479.1 protein_id gnl|my_center|LOCUS_07870 136396 137394 gene locus_tag LOCUS_07880 136396 137394 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963622.1 protein_id gnl|my_center|LOCUS_07880 138034 137675 gene locus_tag LOCUS_07890 138034 137675 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963434.1 protein_id gnl|my_center|LOCUS_07890 139319 140152 gene locus_tag LOCUS_07900 139319 140152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 141013 141573 gene locus_tag LOCUS_07910 141013 141573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 >Feature sequence07 685 245 gene locus_tag LOCUS_07920 685 245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 1284 712 gene locus_tag LOCUS_07930 1284 712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 1949 1284 gene locus_tag LOCUS_07940 1949 1284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 2784 2275 gene locus_tag LOCUS_07950 2784 2275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 3447 2968 gene locus_tag LOCUS_07960 3447 2968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 4526 3570 gene locus_tag LOCUS_07970 gene metF 4526 3570 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792069.1 protein_id gnl|my_center|LOCUS_07970 8475 4669 gene locus_tag LOCUS_07980 gene metH 8475 4669 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113602.1 protein_id gnl|my_center|LOCUS_07980 9144 8743 gene locus_tag LOCUS_07990 9144 8743 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435954.1 protein_id gnl|my_center|LOCUS_07990 9260 9853 gene locus_tag LOCUS_08000 9260 9853 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004549943.1 protein_id gnl|my_center|LOCUS_08000 11387 10170 gene locus_tag LOCUS_08010 11387 10170 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057204.1 protein_id gnl|my_center|LOCUS_08010 11766 12257 gene locus_tag LOCUS_08020 gene moaC 11766 12257 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036201.1 protein_id gnl|my_center|LOCUS_08020 12266 13462 gene locus_tag LOCUS_08030 12266 13462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 13617 14378 gene locus_tag LOCUS_08040 13617 14378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 15269 14847 gene locus_tag LOCUS_08050 15269 14847 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144350.1 protein_id gnl|my_center|LOCUS_08050 15620 15303 gene locus_tag LOCUS_08060 15620 15303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 15678 16727 gene locus_tag LOCUS_08070 gene moaA 15678 16727 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937883.1 protein_id gnl|my_center|LOCUS_08070 16864 17721 gene locus_tag LOCUS_08080 16864 17721 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258021.1 protein_id gnl|my_center|LOCUS_08080 17842 18012 gene locus_tag LOCUS_08090 17842 18012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 18009 19169 gene locus_tag LOCUS_08100 18009 19169 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765765.1 protein_id gnl|my_center|LOCUS_08100 20471 19299 gene locus_tag LOCUS_08110 20471 19299 CDS product putative sulfate/molybdate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057197.1 protein_id gnl|my_center|LOCUS_08110 21859 20603 gene locus_tag LOCUS_08120 21859 20603 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001223621.1 protein_id gnl|my_center|LOCUS_08120 22073 22948 gene locus_tag LOCUS_08130 gene fdhD 22073 22948 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891497.1 protein_id gnl|my_center|LOCUS_08130 23147 23470 gene locus_tag LOCUS_08140 23147 23470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 23721 26273 gene locus_tag LOCUS_08150 23721 26273 CDS product FdhF/YdeP family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729998.1 protein_id gnl|my_center|LOCUS_08150 27269 26532 gene locus_tag LOCUS_08160 27269 26532 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036631.1 protein_id gnl|my_center|LOCUS_08160 28217 27345 gene locus_tag LOCUS_08170 28217 27345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 30270 29095 gene locus_tag LOCUS_08180 30270 29095 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005072555.1 protein_id gnl|my_center|LOCUS_08180 31731 30457 gene locus_tag LOCUS_08190 gene hemA 31731 30457 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933093.1 protein_id gnl|my_center|LOCUS_08190 32096 31836 gene locus_tag LOCUS_08200 32096 31836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 32101 32919 gene locus_tag LOCUS_08210 32101 32919 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963784.1 protein_id gnl|my_center|LOCUS_08210 33522 32968 gene locus_tag LOCUS_08220 33522 32968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 34126 35553 gene locus_tag LOCUS_08230 34126 35553 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001288614.1 protein_id gnl|my_center|LOCUS_08230 35560 35970 gene locus_tag LOCUS_08240 35560 35970 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012319.1 protein_id gnl|my_center|LOCUS_08240 37052 35967 gene locus_tag LOCUS_08250 37052 35967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 39038 37263 gene locus_tag LOCUS_08260 39038 37263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 39212 39943 gene locus_tag LOCUS_08270 39212 39943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 40022 40723 gene locus_tag LOCUS_08280 40022 40723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 40785 41924 gene locus_tag LOCUS_08290 40785 41924 CDS product lipocalin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942826.1 protein_id gnl|my_center|LOCUS_08290 43468 42263 gene locus_tag LOCUS_08300 43468 42263 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964438.1 protein_id gnl|my_center|LOCUS_08300 44558 43569 gene locus_tag LOCUS_08310 gene dusB 44558 43569 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964342.1 protein_id gnl|my_center|LOCUS_08310 44758 45738 gene locus_tag LOCUS_08320 44758 45738 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840143.1 protein_id gnl|my_center|LOCUS_08320 45830 46741 gene locus_tag LOCUS_08330 45830 46741 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764240.1 protein_id gnl|my_center|LOCUS_08330 47072 48358 gene locus_tag LOCUS_08340 47072 48358 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403282.1 protein_id gnl|my_center|LOCUS_08340 48607 49269 gene locus_tag LOCUS_08350 48607 49269 CDS product phosphatidylserine decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962767.1 protein_id gnl|my_center|LOCUS_08350 50633 49458 gene locus_tag LOCUS_08360 50633 49458 CDS product glutathionylspermidine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858689.1 protein_id gnl|my_center|LOCUS_08360 51154 50816 gene locus_tag LOCUS_08370 51154 50816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 52209 51514 gene locus_tag LOCUS_08380 52209 51514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 52860 52378 gene locus_tag LOCUS_08390 52860 52378 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107997.1 protein_id gnl|my_center|LOCUS_08390 54181 52976 gene locus_tag LOCUS_08400 54181 52976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 55118 54186 gene locus_tag LOCUS_08410 55118 54186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 56001 55123 gene locus_tag LOCUS_08420 56001 55123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 57150 56116 gene locus_tag LOCUS_08430 gene ribD 57150 56116 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784375.1 protein_id gnl|my_center|LOCUS_08430 57212 58069 gene locus_tag LOCUS_08440 gene prmC 57212 58069 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766986.1 protein_id gnl|my_center|LOCUS_08440 58229 59908 gene locus_tag LOCUS_08450 gene katA 58229 59908 CDS product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888631.1 protein_id gnl|my_center|LOCUS_08450 62570 60333 gene locus_tag LOCUS_08460 62570 60333 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964428.1 protein_id gnl|my_center|LOCUS_08460 62673 63671 gene locus_tag LOCUS_08470 62673 63671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 65346 63772 gene locus_tag LOCUS_08480 65346 63772 CDS product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405255.1 protein_id gnl|my_center|LOCUS_08480 66778 65432 gene locus_tag LOCUS_08490 66778 65432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086594646.1 protein_id gnl|my_center|LOCUS_08490 67004 68479 gene locus_tag LOCUS_08500 gene proS 67004 68479 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963521.1 protein_id gnl|my_center|LOCUS_08500 68581 69039 gene locus_tag LOCUS_08510 68581 69039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 69084 70085 gene locus_tag LOCUS_08520 gene floA 69084 70085 CDS product flotillin-like protein FloA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760314.1 protein_id gnl|my_center|LOCUS_08520 70363 71313 gene locus_tag LOCUS_08530 70363 71313 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_182921959.1 protein_id gnl|my_center|LOCUS_08530 71336 72067 gene locus_tag LOCUS_08540 71336 72067 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000676633.1 protein_id gnl|my_center|LOCUS_08540 72332 72081 gene locus_tag LOCUS_08550 72332 72081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 72907 72518 gene locus_tag LOCUS_08560 72907 72518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 73025 73207 gene locus_tag LOCUS_08570 73025 73207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 73396 73608 gene locus_tag LOCUS_08580 73396 73608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 73692 76172 gene locus_tag LOCUS_08590 73692 76172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 76262 76999 gene locus_tag LOCUS_08600 76262 76999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 76996 78237 gene locus_tag LOCUS_08610 76996 78237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 78234 79421 gene locus_tag LOCUS_08620 78234 79421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 79471 80703 gene locus_tag LOCUS_08630 79471 80703 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929836.1 protein_id gnl|my_center|LOCUS_08630 81297 82643 gene locus_tag LOCUS_08640 81297 82643 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941790.1 protein_id gnl|my_center|LOCUS_08640 82680 86261 gene locus_tag LOCUS_08650 82680 86261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 86482 86784 gene locus_tag LOCUS_08660 86482 86784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 86781 87059 gene locus_tag LOCUS_08670 86781 87059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 87446 92779 gene locus_tag LOCUS_08680 87446 92779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 92904 94013 gene locus_tag LOCUS_08690 92904 94013 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790532.1 protein_id gnl|my_center|LOCUS_08690 94959 94750 gene locus_tag LOCUS_08700 94959 94750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 95534 94989 gene locus_tag LOCUS_08710 95534 94989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 97196 95892 gene locus_tag LOCUS_08720 97196 95892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 98393 97251 gene locus_tag LOCUS_08730 98393 97251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 99873 98596 gene locus_tag LOCUS_08740 99873 98596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 102014 99870 gene locus_tag LOCUS_08750 102014 99870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 102784 102017 gene locus_tag LOCUS_08760 102784 102017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 103275 102781 gene locus_tag LOCUS_08770 103275 102781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 106266 104185 gene locus_tag LOCUS_08780 106266 104185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 109553 106731 gene locus_tag LOCUS_08790 109553 106731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 111278 109698 gene locus_tag LOCUS_08800 gene rpoN 111278 109698 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964339.1 protein_id gnl|my_center|LOCUS_08800 111446 112432 gene locus_tag LOCUS_08810 111446 112432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 112534 112806 gene locus_tag LOCUS_08820 112534 112806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 112799 114286 gene locus_tag LOCUS_08830 gene asnS 112799 114286 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760798.1 protein_id gnl|my_center|LOCUS_08830 115147 114467 gene locus_tag LOCUS_08840 115147 114467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 115968 115444 gene locus_tag LOCUS_08850 115968 115444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 116287 119331 gene locus_tag LOCUS_08860 gene uvrA 116287 119331 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963005.1 protein_id gnl|my_center|LOCUS_08860 120110 119418 gene locus_tag LOCUS_08870 120110 119418 CDS product TMEM175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174854958.1 protein_id gnl|my_center|LOCUS_08870 120885 120217 gene locus_tag LOCUS_08880 120885 120217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 121835 121224 gene locus_tag LOCUS_08890 121835 121224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 121985 122902 gene locus_tag LOCUS_08900 121985 122902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 123910 123125 gene locus_tag LOCUS_08910 gene paaG 123910 123125 CDS product 2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase PaaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086528139.1 protein_id gnl|my_center|LOCUS_08910 124668 124003 gene locus_tag LOCUS_08920 124668 124003 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109021.1 protein_id gnl|my_center|LOCUS_08920 125881 124832 gene locus_tag LOCUS_08930 gene queA 125881 124832 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962415.1 protein_id gnl|my_center|LOCUS_08930 126132 127394 gene locus_tag LOCUS_08940 126132 127394 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964503.1 protein_id gnl|my_center|LOCUS_08940 127491 128609 gene locus_tag LOCUS_08950 127491 128609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 129592 128705 gene locus_tag LOCUS_08960 129592 128705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 129841 129918 gene locus_tag LOCUS_t00090 129841 129918 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 129996 130073 gene locus_tag LOCUS_t00100 129996 130073 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 130157 130711 gene locus_tag LOCUS_08970 130157 130711 CDS product Panacea domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004308669.1 protein_id gnl|my_center|LOCUS_08970 130725 131054 gene locus_tag LOCUS_08980 130725 131054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 131304 131675 gene locus_tag LOCUS_08990 131304 131675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08990 131672 132553 gene locus_tag LOCUS_09000 131672 132553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09000 133459 132731 gene locus_tag LOCUS_09010 133459 132731 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762319.1 protein_id gnl|my_center|LOCUS_09010 134550 133540 gene locus_tag LOCUS_09020 134550 133540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 135293 134637 gene locus_tag LOCUS_09030 135293 134637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 135900 136085 gene locus_tag LOCUS_09040 135900 136085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 137913 136837 gene locus_tag LOCUS_09050 137913 136837 CDS product type I restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962872.1 protein_id gnl|my_center|LOCUS_09050 >Feature sequence08 709 1482 gene locus_tag LOCUS_09060 709 1482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 1703 2158 gene locus_tag LOCUS_09070 1703 2158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 2151 2519 gene locus_tag LOCUS_09080 2151 2519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 2568 3029 gene locus_tag LOCUS_09090 2568 3029 CDS product YbjN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944499.1 protein_id gnl|my_center|LOCUS_09090 3545 4219 gene locus_tag LOCUS_09100 3545 4219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 4343 4837 gene locus_tag LOCUS_09110 4343 4837 CDS product DUF4385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126352787.1 protein_id gnl|my_center|LOCUS_09110 4972 5457 gene locus_tag LOCUS_09120 4972 5457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 7046 5643 gene locus_tag LOCUS_09130 7046 5643 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770788.1 protein_id gnl|my_center|LOCUS_09130 7210 8787 gene locus_tag LOCUS_09140 7210 8787 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964517.1 protein_id gnl|my_center|LOCUS_09140 9019 11454 gene locus_tag LOCUS_09150 9019 11454 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964341.1 protein_id gnl|my_center|LOCUS_09150 11620 15411 gene locus_tag LOCUS_09160 11620 15411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 15414 16247 gene locus_tag LOCUS_09170 15414 16247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 16320 16985 gene locus_tag LOCUS_09180 16320 16985 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962395.1 protein_id gnl|my_center|LOCUS_09180 17085 18941 gene locus_tag LOCUS_09190 17085 18941 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920781.1 protein_id gnl|my_center|LOCUS_09190 19142 21616 gene locus_tag LOCUS_09200 gene rnr 19142 21616 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161889612.1 protein_id gnl|my_center|LOCUS_09200 21664 22635 gene locus_tag LOCUS_09210 21664 22635 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203421.1 protein_id gnl|my_center|LOCUS_09210 22886 23548 gene locus_tag LOCUS_09220 22886 23548 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000631577.1 protein_id gnl|my_center|LOCUS_09220 23651 23920 gene locus_tag LOCUS_09230 23651 23920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 24641 24024 gene locus_tag LOCUS_09240 24641 24024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 25999 26385 gene locus_tag LOCUS_09250 25999 26385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 27457 27098 gene locus_tag LOCUS_09260 27457 27098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 28590 27478 gene locus_tag LOCUS_09270 gene recF 28590 27478 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964102.1 protein_id gnl|my_center|LOCUS_09270 28664 29830 gene locus_tag LOCUS_09280 gene pdhA 28664 29830 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963513.1 protein_id gnl|my_center|LOCUS_09280 29967 30740 gene locus_tag LOCUS_09290 29967 30740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 30821 31297 gene locus_tag LOCUS_09300 gene ribH 30821 31297 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785230.1 protein_id gnl|my_center|LOCUS_09300 31484 31867 gene locus_tag LOCUS_09310 31484 31867 CDS product TraR/DksA C4-type zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005931903.1 protein_id gnl|my_center|LOCUS_09310 32061 34016 gene locus_tag LOCUS_09320 32061 34016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 34039 34779 gene locus_tag LOCUS_09330 34039 34779 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202250.1 protein_id gnl|my_center|LOCUS_09330 34784 36091 gene locus_tag LOCUS_09340 34784 36091 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964521.1 protein_id gnl|my_center|LOCUS_09340 36156 36698 gene locus_tag LOCUS_09350 36156 36698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 36771 37034 gene locus_tag LOCUS_09360 36771 37034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 37291 39414 gene locus_tag LOCUS_09370 37291 39414 CDS product SurA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016194724.1 protein_id gnl|my_center|LOCUS_09370 39641 41470 gene locus_tag LOCUS_09380 39641 41470 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962252.1 protein_id gnl|my_center|LOCUS_09380 41826 43565 gene locus_tag LOCUS_09390 gene recJ 41826 43565 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203525.1 protein_id gnl|my_center|LOCUS_09390 43935 45095 gene locus_tag LOCUS_09400 43935 45095 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964032.1 protein_id gnl|my_center|LOCUS_09400 45253 46179 gene locus_tag LOCUS_09410 45253 46179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 47096 46305 gene locus_tag LOCUS_09420 47096 46305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 47486 48616 gene locus_tag LOCUS_09430 47486 48616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 48801 50015 gene locus_tag LOCUS_09440 48801 50015 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000845169.1 protein_id gnl|my_center|LOCUS_09440 50184 51338 gene locus_tag LOCUS_09450 50184 51338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 51664 53487 gene locus_tag LOCUS_09460 51664 53487 CDS product M1 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962262.1 protein_id gnl|my_center|LOCUS_09460 53993 53634 gene locus_tag LOCUS_09470 53993 53634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 54325 55020 gene locus_tag LOCUS_09480 54325 55020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 55552 55884 gene locus_tag LOCUS_09490 55552 55884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 57288 56296 gene locus_tag LOCUS_09500 57288 56296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 57743 57285 gene locus_tag LOCUS_09510 57743 57285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 59026 58007 gene locus_tag LOCUS_09520 59026 58007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 60101 59049 gene locus_tag LOCUS_09530 60101 59049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 66705 60106 gene locus_tag LOCUS_09540 66705 60106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 68482 66782 gene locus_tag LOCUS_09550 68482 66782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 69873 68524 gene locus_tag LOCUS_09560 69873 68524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 71277 69913 gene locus_tag LOCUS_09570 71277 69913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 74495 71274 gene locus_tag LOCUS_09580 74495 71274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 76521 74521 gene locus_tag LOCUS_09590 76521 74521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 80995 76631 gene locus_tag LOCUS_09600 80995 76631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 82093 81845 gene locus_tag LOCUS_09610 82093 81845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 83098 83322 gene locus_tag LOCUS_09620 83098 83322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 84948 84202 gene locus_tag LOCUS_09630 84948 84202 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044233954.1 protein_id gnl|my_center|LOCUS_09630 86162 85095 gene locus_tag LOCUS_09640 86162 85095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 87028 90954 gene locus_tag LOCUS_09650 87028 90954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 91143 92204 gene locus_tag LOCUS_09660 91143 92204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 92201 92995 gene locus_tag LOCUS_09670 92201 92995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 93148 93762 gene locus_tag LOCUS_09680 93148 93762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 93801 98630 gene locus_tag LOCUS_09690 93801 98630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 98627 101416 gene locus_tag LOCUS_09700 98627 101416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 101448 102110 gene locus_tag LOCUS_09710 101448 102110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 102192 103700 gene locus_tag LOCUS_09720 102192 103700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 103752 111305 gene locus_tag LOCUS_09730 103752 111305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 112273 112983 gene locus_tag LOCUS_09740 112273 112983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 115580 113130 gene locus_tag LOCUS_09750 115580 113130 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259579.1 protein_id gnl|my_center|LOCUS_09750 116483 115755 gene locus_tag LOCUS_09760 116483 115755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 116967 117884 gene locus_tag LOCUS_09770 116967 117884 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257664.1 protein_id gnl|my_center|LOCUS_09770 118501 117881 gene locus_tag LOCUS_09780 118501 117881 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839642.1 protein_id gnl|my_center|LOCUS_09780 118895 118593 gene locus_tag LOCUS_09790 118895 118593 CDS product DUF4286 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962251.1 protein_id gnl|my_center|LOCUS_09790 119555 119109 gene locus_tag LOCUS_09800 119555 119109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 120096 119686 gene locus_tag LOCUS_09810 120096 119686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 121430 120195 gene locus_tag LOCUS_09820 121430 120195 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021355.1 protein_id gnl|my_center|LOCUS_09820 121480 121641 gene locus_tag LOCUS_09830 121480 121641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 125835 121870 gene locus_tag LOCUS_09840 125835 121870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 128881 126410 gene locus_tag LOCUS_09850 128881 126410 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962686.1 protein_id gnl|my_center|LOCUS_09850 129693 129118 gene locus_tag LOCUS_09860 129693 129118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 132150 129721 gene locus_tag LOCUS_09870 132150 129721 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203288.1 protein_id gnl|my_center|LOCUS_09870 132620 132261 gene locus_tag LOCUS_09880 132620 132261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 132769 133275 gene locus_tag LOCUS_09890 132769 133275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 133429 135261 gene locus_tag LOCUS_09900 gene htpG 133429 135261 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963627.1 protein_id gnl|my_center|LOCUS_09900 136610 136092 gene locus_tag LOCUS_09910 136610 136092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 136930 137331 gene locus_tag LOCUS_09920 136930 137331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 >Feature sequence09 534 376 gene locus_tag LOCUS_09930 534 376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09930 1695 625 gene locus_tag LOCUS_09940 1695 625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 1847 4003 gene locus_tag LOCUS_09950 1847 4003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 4993 4079 gene locus_tag LOCUS_09960 4993 4079 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201850.1 protein_id gnl|my_center|LOCUS_09960 5121 6086 gene locus_tag LOCUS_09970 5121 6086 CDS product YpdA family putative bacillithiol disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403438.1 protein_id gnl|my_center|LOCUS_09970 7623 6196 gene locus_tag LOCUS_09980 7623 6196 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962292.1 protein_id gnl|my_center|LOCUS_09980 8922 7654 gene locus_tag LOCUS_09990 8922 7654 CDS product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839408.1 protein_id gnl|my_center|LOCUS_09990 9079 9810 gene locus_tag LOCUS_10000 gene lptB 9079 9810 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963369.1 protein_id gnl|my_center|LOCUS_10000 10045 11562 gene locus_tag LOCUS_10010 10045 11562 CDS product GH3 auxin-responsive promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783832.1 protein_id gnl|my_center|LOCUS_10010 11769 11996 gene locus_tag LOCUS_10020 11769 11996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 12801 12019 gene locus_tag LOCUS_10030 12801 12019 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072060.1 protein_id gnl|my_center|LOCUS_10030 13496 13263 gene locus_tag LOCUS_10040 13496 13263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 15717 13624 gene locus_tag LOCUS_10050 15717 13624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 17594 17139 gene locus_tag LOCUS_10060 17594 17139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 19841 17742 gene locus_tag LOCUS_10070 19841 17742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 21999 20458 gene locus_tag LOCUS_10080 gene gltX 21999 20458 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765418.1 protein_id gnl|my_center|LOCUS_10080 22492 22286 gene locus_tag LOCUS_10090 22492 22286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10090 23186 22419 gene locus_tag LOCUS_10100 23186 22419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10100 23578 23387 gene locus_tag LOCUS_10110 23578 23387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 24064 23678 gene locus_tag LOCUS_10120 24064 23678 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393004.1 protein_id gnl|my_center|LOCUS_10120 24114 24821 gene locus_tag LOCUS_10130 24114 24821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 25058 24888 gene locus_tag LOCUS_10140 25058 24888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 27003 25168 gene locus_tag LOCUS_10150 gene glmS 27003 25168 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962290.1 protein_id gnl|my_center|LOCUS_10150 28534 27080 gene locus_tag LOCUS_10160 28534 27080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 29330 28518 gene locus_tag LOCUS_10170 29330 28518 CDS product glycogen/starch synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767986.1 protein_id gnl|my_center|LOCUS_10170 29451 30299 gene locus_tag LOCUS_10180 gene panC 29451 30299 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202230.1 protein_id gnl|my_center|LOCUS_10180 30328 31413 gene locus_tag LOCUS_10190 30328 31413 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073173113.1 protein_id gnl|my_center|LOCUS_10190 31775 32539 gene locus_tag LOCUS_10200 31775 32539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 32708 33193 gene locus_tag LOCUS_10210 gene rfaE2 32708 33193 CDS product D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931903.1 protein_id gnl|my_center|LOCUS_10210 33289 33966 gene locus_tag LOCUS_10220 33289 33966 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964453.1 protein_id gnl|my_center|LOCUS_10220 36017 34353 gene locus_tag LOCUS_10230 gene ettA 36017 34353 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776885.1 protein_id gnl|my_center|LOCUS_10230 36359 37678 gene locus_tag LOCUS_10240 36359 37678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 37779 38000 gene locus_tag LOCUS_10250 37779 38000 CDS product DUF2795 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558131.1 protein_id gnl|my_center|LOCUS_10250 39467 38259 gene locus_tag LOCUS_10260 39467 38259 CDS product lycopene cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257690.1 protein_id gnl|my_center|LOCUS_10260 40645 39776 gene locus_tag LOCUS_10270 40645 39776 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963001.1 protein_id gnl|my_center|LOCUS_10270 42242 41013 gene locus_tag LOCUS_10280 42242 41013 CDS product Glu/Leu/Phe/Val dehydrogenase dimerization domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964029.1 protein_id gnl|my_center|LOCUS_10280 42616 42936 gene locus_tag LOCUS_10290 42616 42936 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938934.1 protein_id gnl|my_center|LOCUS_10290 43618 43013 gene locus_tag LOCUS_10300 gene coaE 43618 43013 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764748.1 protein_id gnl|my_center|LOCUS_10300 44348 43626 gene locus_tag LOCUS_10310 44348 43626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 44680 44351 gene locus_tag LOCUS_10320 gene yajC 44680 44351 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931759.1 protein_id gnl|my_center|LOCUS_10320 45265 44699 gene locus_tag LOCUS_10330 45265 44699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 46360 45362 gene locus_tag LOCUS_10340 46360 45362 CDS product isocitrate/isopropylmalate family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404422.1 protein_id gnl|my_center|LOCUS_10340 46807 46496 gene locus_tag LOCUS_10350 46807 46496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 48153 46957 gene locus_tag LOCUS_10360 48153 46957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 49423 48332 gene locus_tag LOCUS_10370 49423 48332 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962697.1 protein_id gnl|my_center|LOCUS_10370 49618 51402 gene locus_tag LOCUS_10380 49618 51402 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043552510.1 protein_id gnl|my_center|LOCUS_10380 52186 51764 gene locus_tag LOCUS_10390 52186 51764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 52380 52454 gene locus_tag LOCUS_t00110 52380 52454 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 52554 52631 gene locus_tag LOCUS_t00120 52554 52631 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 53242 52721 gene locus_tag LOCUS_10400 53242 52721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 54409 53255 gene locus_tag LOCUS_10410 54409 53255 CDS product zinc-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727112.1 protein_id gnl|my_center|LOCUS_10410 55650 55123 gene locus_tag LOCUS_10420 55650 55123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 57538 55706 gene locus_tag LOCUS_10430 57538 55706 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931951.1 protein_id gnl|my_center|LOCUS_10430 58534 57779 gene locus_tag LOCUS_10440 gene truA 58534 57779 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764438.1 protein_id gnl|my_center|LOCUS_10440 59076 58549 gene locus_tag LOCUS_10450 59076 58549 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107442.1 protein_id gnl|my_center|LOCUS_10450 60297 59095 gene locus_tag LOCUS_10460 gene pcaF 60297 59095 CDS product 3-oxoadipyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_075194926.1 protein_id gnl|my_center|LOCUS_10460 60405 60857 gene locus_tag LOCUS_10470 60405 60857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 61824 60967 gene locus_tag LOCUS_10480 61824 60967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 63884 62007 gene locus_tag LOCUS_10490 63884 62007 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964499.1 protein_id gnl|my_center|LOCUS_10490 64549 64037 gene locus_tag LOCUS_10500 64549 64037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962916.1 protein_id gnl|my_center|LOCUS_10500 65777 64884 gene locus_tag LOCUS_10510 65777 64884 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962915.1 protein_id gnl|my_center|LOCUS_10510 67328 65868 gene locus_tag LOCUS_10520 67328 65868 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962913.1 protein_id gnl|my_center|LOCUS_10520 67447 67520 gene locus_tag LOCUS_t00130 67447 67520 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 68670 67789 gene locus_tag LOCUS_10530 68670 67789 CDS product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920090.1 protein_id gnl|my_center|LOCUS_10530 69345 71018 gene locus_tag LOCUS_10540 69345 71018 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963474.1 protein_id gnl|my_center|LOCUS_10540 71349 71732 gene locus_tag LOCUS_10550 71349 71732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 72327 72004 gene locus_tag LOCUS_10560 72327 72004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 72608 72333 gene locus_tag LOCUS_10570 72608 72333 CDS product VF530 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168081.1 protein_id gnl|my_center|LOCUS_10570 72782 73558 gene locus_tag LOCUS_10580 72782 73558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 73868 73641 gene locus_tag LOCUS_10590 73868 73641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 73938 74369 gene locus_tag LOCUS_10600 73938 74369 CDS product septal ring lytic transglycosylase RlpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105017.1 protein_id gnl|my_center|LOCUS_10600 74417 74620 gene locus_tag LOCUS_10610 74417 74620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 74800 75354 gene locus_tag LOCUS_10620 74800 75354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 75781 75407 gene locus_tag LOCUS_10630 75781 75407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 76730 76068 gene locus_tag LOCUS_10640 76730 76068 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142493.1 protein_id gnl|my_center|LOCUS_10640 78519 76873 gene locus_tag LOCUS_10650 gene glgP 78519 76873 CDS product alpha-glucan family phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871155.1 protein_id gnl|my_center|LOCUS_10650 79249 78995 gene locus_tag LOCUS_10660 79249 78995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 79137 80528 gene locus_tag LOCUS_10670 79137 80528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 80711 82597 gene locus_tag LOCUS_10680 80711 82597 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839780.1 protein_id gnl|my_center|LOCUS_10680 82667 83050 gene locus_tag LOCUS_10690 82667 83050 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035636367.1 protein_id gnl|my_center|LOCUS_10690 83125 83832 gene locus_tag LOCUS_10700 83125 83832 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405485.1 protein_id gnl|my_center|LOCUS_10700 84064 84876 gene locus_tag LOCUS_10710 84064 84876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 85016 86839 gene locus_tag LOCUS_10720 85016 86839 CDS product alpha-amylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765636.1 protein_id gnl|my_center|LOCUS_10720 87023 88357 gene locus_tag LOCUS_10730 87023 88357 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814920.1 protein_id gnl|my_center|LOCUS_10730 88572 89573 gene locus_tag LOCUS_10740 88572 89573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 91224 89923 gene locus_tag LOCUS_10750 91224 89923 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403490.1 protein_id gnl|my_center|LOCUS_10750 92107 91382 gene locus_tag LOCUS_10760 92107 91382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 93463 92168 gene locus_tag LOCUS_10770 gene thrC 93463 92168 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933690.1 protein_id gnl|my_center|LOCUS_10770 94565 93633 gene locus_tag LOCUS_10780 94565 93633 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933689.1 protein_id gnl|my_center|LOCUS_10780 97109 94671 gene locus_tag LOCUS_10790 gene thrA 97109 94671 CDS product bifunctional aspartate kinase/homoserine dehydrogenase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784545.1 protein_id gnl|my_center|LOCUS_10790 97224 98297 gene locus_tag LOCUS_10800 gene prfA 97224 98297 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964025.1 protein_id gnl|my_center|LOCUS_10800 98528 100072 gene locus_tag LOCUS_10810 98528 100072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962820.1 protein_id gnl|my_center|LOCUS_10810 100890 100339 gene locus_tag LOCUS_10820 100890 100339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 101371 100973 gene locus_tag LOCUS_10830 101371 100973 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483188.1 protein_id gnl|my_center|LOCUS_10830 102918 101392 gene locus_tag LOCUS_10840 gene gpmI 102918 101392 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964233.1 protein_id gnl|my_center|LOCUS_10840 103094 103495 gene locus_tag LOCUS_10850 103094 103495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 103662 104528 gene locus_tag LOCUS_10860 gene nadC 103662 104528 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786213.1 protein_id gnl|my_center|LOCUS_10860 104664 105287 gene locus_tag LOCUS_10870 104664 105287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 105365 105763 gene locus_tag LOCUS_10880 105365 105763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 105899 106648 gene locus_tag LOCUS_10890 105899 106648 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_130094389.1 protein_id gnl|my_center|LOCUS_10890 107000 106671 gene locus_tag LOCUS_10900 107000 106671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 108033 107098 gene locus_tag LOCUS_10910 108033 107098 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789714.1 protein_id gnl|my_center|LOCUS_10910 108133 108345 gene locus_tag LOCUS_10920 108133 108345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 108336 108923 gene locus_tag LOCUS_10930 108336 108923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 109363 110739 gene locus_tag LOCUS_10940 109363 110739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 112308 111019 gene locus_tag LOCUS_10950 112308 111019 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000794551.1 protein_id gnl|my_center|LOCUS_10950 114293 114144 gene locus_tag LOCUS_10960 114293 114144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 115132 117024 gene locus_tag LOCUS_10970 115132 117024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 >Feature sequence10 <1 2615 gene locus_tag LOCUS_10980 <1 2615 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108384.1:TraG family conjugative transposon ATPase 2612 3748 gene locus_tag LOCUS_10990 2612 3748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 3869 4420 gene locus_tag LOCUS_11000 3869 4420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 4469 5224 gene locus_tag LOCUS_11010 4469 5224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 5244 6143 gene locus_tag LOCUS_11020 5244 6143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 6162 7547 gene locus_tag LOCUS_11030 6162 7547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 7579 8469 gene locus_tag LOCUS_11040 7579 8469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 8476 9015 gene locus_tag LOCUS_11050 8476 9015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 9034 9423 gene locus_tag LOCUS_11060 9034 9423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 9449 9826 gene locus_tag LOCUS_11070 9449 9826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 10112 9885 gene locus_tag LOCUS_11080 10112 9885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 10357 10797 gene locus_tag LOCUS_11090 10357 10797 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000791295.1 protein_id gnl|my_center|LOCUS_11090 11861 12304 gene locus_tag LOCUS_11100 11861 12304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 12315 12686 gene locus_tag LOCUS_11110 12315 12686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 12688 13065 gene locus_tag LOCUS_11120 12688 13065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 14569 13241 gene locus_tag LOCUS_11130 14569 13241 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767538.1 protein_id gnl|my_center|LOCUS_11130 15418 14816 gene locus_tag LOCUS_11140 15418 14816 CDS product DUF6088 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007485360.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11140 17547 15850 gene locus_tag LOCUS_11150 17547 15850 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257894.1 protein_id gnl|my_center|LOCUS_11150 18539 17616 gene locus_tag LOCUS_11160 18539 17616 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797826.1 protein_id gnl|my_center|LOCUS_11160 19007 18684 gene locus_tag LOCUS_11170 19007 18684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 19545 19036 gene locus_tag LOCUS_11180 19545 19036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 19725 20222 gene locus_tag LOCUS_11190 19725 20222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 20207 20812 gene locus_tag LOCUS_11200 20207 20812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 20802 21032 gene locus_tag LOCUS_11210 20802 21032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 21169 23718 gene locus_tag LOCUS_11220 21169 23718 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479745.1 protein_id gnl|my_center|LOCUS_11220 23764 24558 gene locus_tag LOCUS_11230 23764 24558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 24685 25530 gene locus_tag LOCUS_11240 24685 25530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 25536 26540 gene locus_tag LOCUS_11250 25536 26540 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038093611.1 protein_id gnl|my_center|LOCUS_11250 27192 26554 gene locus_tag LOCUS_11260 27192 26554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 27762 27244 gene locus_tag LOCUS_11270 27762 27244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 28538 27759 gene locus_tag LOCUS_11280 28538 27759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 29030 29851 gene locus_tag LOCUS_11290 29030 29851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 29957 30445 gene locus_tag LOCUS_11300 29957 30445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 30450 31259 gene locus_tag LOCUS_11310 30450 31259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 31222 31818 gene locus_tag LOCUS_11320 31222 31818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 31815 35429 gene locus_tag LOCUS_11330 gene brxC 31815 35429 CDS product BREX system P-loop protein BrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942753.1 protein_id gnl|my_center|LOCUS_11330 35502 39815 gene locus_tag LOCUS_11340 gene pglX 35502 39815 CDS product BREX-1 system adenine-specific DNA-methyltransferase PglX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942751.1 protein_id gnl|my_center|LOCUS_11340 39971 40714 gene locus_tag LOCUS_11350 39971 40714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 40728 43298 gene locus_tag LOCUS_11360 40728 43298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 43288 45348 gene locus_tag LOCUS_11370 gene brxL 43288 45348 CDS product BREX system Lon protease-like protein BrxL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038874.1 protein_id gnl|my_center|LOCUS_11370 45683 46924 gene locus_tag LOCUS_11380 45683 46924 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209169.1 protein_id gnl|my_center|LOCUS_11380 46937 49426 gene locus_tag LOCUS_11390 46937 49426 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109412.1 protein_id gnl|my_center|LOCUS_11390 49480 51276 gene locus_tag LOCUS_11400 49480 51276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 52665 51286 gene locus_tag LOCUS_11410 52665 51286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 52937 52665 gene locus_tag LOCUS_11420 52937 52665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 55274 53016 gene locus_tag LOCUS_11430 55274 53016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 56349 55312 gene locus_tag LOCUS_11440 56349 55312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 56915 56400 gene locus_tag LOCUS_11450 56915 56400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 57807 58574 gene locus_tag LOCUS_11460 57807 58574 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108210.1 protein_id gnl|my_center|LOCUS_11460 58574 59059 gene locus_tag LOCUS_11470 58574 59059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 59685 59188 gene locus_tag LOCUS_11480 59685 59188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 60002 59682 gene locus_tag LOCUS_11490 60002 59682 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098837.1 protein_id gnl|my_center|LOCUS_11490 60982 61932 gene locus_tag LOCUS_11500 60982 61932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 61942 62934 gene locus_tag LOCUS_11510 61942 62934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 63112 62951 gene locus_tag LOCUS_11520 63112 62951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 63940 63236 gene locus_tag LOCUS_11530 63940 63236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 64996 64145 gene locus_tag LOCUS_11540 64996 64145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 65896 65024 gene locus_tag LOCUS_11550 65896 65024 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226655.1 protein_id gnl|my_center|LOCUS_11550 66599 66015 gene locus_tag LOCUS_11560 66599 66015 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790890.1 protein_id gnl|my_center|LOCUS_11560 67013 67318 gene locus_tag LOCUS_11570 67013 67318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 67420 67743 gene locus_tag LOCUS_11580 67420 67743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 67887 68114 gene locus_tag LOCUS_11590 67887 68114 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681617.1 protein_id gnl|my_center|LOCUS_11590 68111 68443 gene locus_tag LOCUS_11600 68111 68443 CDS product HipA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681615.1 protein_id gnl|my_center|LOCUS_11600 68440 69393 gene locus_tag LOCUS_11610 68440 69393 CDS product HipA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681613.1 protein_id gnl|my_center|LOCUS_11610 69714 69415 gene locus_tag LOCUS_11620 69714 69415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 70062 69811 gene locus_tag LOCUS_11630 70062 69811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 70934 70167 gene locus_tag LOCUS_11640 70934 70167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 71329 71033 gene locus_tag LOCUS_11650 71329 71033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 71562 71413 gene locus_tag LOCUS_11660 71562 71413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 71967 71569 gene locus_tag LOCUS_11670 71967 71569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 72457 72215 gene locus_tag LOCUS_11680 72457 72215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 72984 72655 gene locus_tag LOCUS_11690 72984 72655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 73300 73010 gene locus_tag LOCUS_11700 73300 73010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 74371 73370 gene locus_tag LOCUS_11710 74371 73370 CDS product zincin-like metallopeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000155898.1 protein_id gnl|my_center|LOCUS_11710 74994 76019 gene locus_tag LOCUS_11720 74994 76019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 76262 76029 gene locus_tag LOCUS_11730 76262 76029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 76636 77466 gene locus_tag LOCUS_11740 76636 77466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 77658 78470 gene locus_tag LOCUS_11750 77658 78470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 81606 78478 gene locus_tag LOCUS_11760 81606 78478 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393846.1 protein_id gnl|my_center|LOCUS_11760 82749 81775 gene locus_tag LOCUS_11770 82749 81775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 84132 82804 gene locus_tag LOCUS_11780 84132 82804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 84358 85035 gene locus_tag LOCUS_11790 84358 85035 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107524.1 protein_id gnl|my_center|LOCUS_11790 85032 86279 gene locus_tag LOCUS_11800 85032 86279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 86395 87219 gene locus_tag LOCUS_11810 86395 87219 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083549713.1 protein_id gnl|my_center|LOCUS_11810 87345 87776 gene locus_tag LOCUS_11820 87345 87776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 87933 90302 gene locus_tag LOCUS_11830 87933 90302 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963716.1 protein_id gnl|my_center|LOCUS_11830 90311 91342 gene locus_tag LOCUS_11840 90311 91342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 91360 92016 gene locus_tag LOCUS_11850 91360 92016 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036955.1 protein_id gnl|my_center|LOCUS_11850 92291 94273 gene locus_tag LOCUS_11860 92291 94273 CDS product KUP/HAK/KT family potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962780.1 protein_id gnl|my_center|LOCUS_11860 94320 95681 gene locus_tag LOCUS_11870 94320 95681 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963804.1 protein_id gnl|my_center|LOCUS_11870 96069 95710 gene locus_tag LOCUS_11880 96069 95710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 96333 96683 gene locus_tag LOCUS_11890 96333 96683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 97102 98802 gene locus_tag LOCUS_11900 gene kdpA 97102 98802 CDS product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963802.1 protein_id gnl|my_center|LOCUS_11900 98849 100891 gene locus_tag LOCUS_11910 gene kdpB 98849 100891 CDS product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763738.1 protein_id gnl|my_center|LOCUS_11910 100910 101473 gene locus_tag LOCUS_11920 100910 101473 CDS product K(+)-transporting ATPase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963800.1 protein_id gnl|my_center|LOCUS_11920 101656 103065 gene locus_tag LOCUS_11930 101656 103065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 103139 104311 gene locus_tag LOCUS_11940 103139 104311 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963799.1 protein_id gnl|my_center|LOCUS_11940 104336 105505 gene locus_tag LOCUS_11950 104336 105505 CDS product two-component system sensory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963798.1 protein_id gnl|my_center|LOCUS_11950 105539 107305 gene locus_tag LOCUS_11960 105539 107305 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963797.1 protein_id gnl|my_center|LOCUS_11960 107330 107992 gene locus_tag LOCUS_11970 107330 107992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 108017 109957 gene locus_tag LOCUS_11980 108017 109957 CDS product KUP/HAK/KT family potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962780.1 protein_id gnl|my_center|LOCUS_11980 110260 110580 gene locus_tag LOCUS_11990 110260 110580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 113180 110577 gene locus_tag LOCUS_12000 113180 110577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 113618 113232 gene locus_tag LOCUS_12010 113618 113232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 113867 114541 gene locus_tag LOCUS_12020 113867 114541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 114600 115019 gene locus_tag LOCUS_12030 114600 115019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 115024 115353 gene locus_tag LOCUS_12040 115024 115353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 >Feature sequence11 832 2826 gene locus_tag LOCUS_12050 832 2826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 4523 3048 gene locus_tag LOCUS_12060 4523 3048 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291837.1 protein_id gnl|my_center|LOCUS_12060 5180 9670 gene locus_tag LOCUS_12070 5180 9670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 9912 10883 gene locus_tag LOCUS_12080 9912 10883 CDS product type IX secretion system membrane protein PorP/SprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962491.1 protein_id gnl|my_center|LOCUS_12080 11251 12096 gene locus_tag LOCUS_12090 11251 12096 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225189.1 protein_id gnl|my_center|LOCUS_12090 13329 12385 gene locus_tag LOCUS_12100 13329 12385 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525258.1 protein_id gnl|my_center|LOCUS_12100 13728 13543 gene locus_tag LOCUS_12110 13728 13543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 14848 13874 gene locus_tag LOCUS_12120 14848 13874 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975767.1 protein_id gnl|my_center|LOCUS_12120 16429 14861 gene locus_tag LOCUS_12130 16429 14861 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223211.1 protein_id gnl|my_center|LOCUS_12130 17291 16449 gene locus_tag LOCUS_12140 17291 16449 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975769.1 protein_id gnl|my_center|LOCUS_12140 18403 17651 gene locus_tag LOCUS_12150 18403 17651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 18711 19730 gene locus_tag LOCUS_12160 18711 19730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 21159 19903 gene locus_tag LOCUS_12170 21159 19903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 22251 21469 gene locus_tag LOCUS_12180 22251 21469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 23583 22552 gene locus_tag LOCUS_12190 23583 22552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 23978 25132 gene locus_tag LOCUS_12200 23978 25132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899909.1 protein_id gnl|my_center|LOCUS_12200 25170 26228 gene locus_tag LOCUS_12210 25170 26228 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784057.1 protein_id gnl|my_center|LOCUS_12210 26843 29809 gene locus_tag LOCUS_12220 26843 29809 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103036562.1 protein_id gnl|my_center|LOCUS_12220 29852 31480 gene locus_tag LOCUS_12230 29852 31480 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201972.1 protein_id gnl|my_center|LOCUS_12230 31715 31563 gene locus_tag LOCUS_12240 31715 31563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 31672 32637 gene locus_tag LOCUS_12250 31672 32637 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767698.1 protein_id gnl|my_center|LOCUS_12250 32771 34333 gene locus_tag LOCUS_12260 32771 34333 CDS product family 43 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109097.1 protein_id gnl|my_center|LOCUS_12260 34664 34521 gene locus_tag LOCUS_12270 34664 34521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 34663 35721 gene locus_tag LOCUS_12280 34663 35721 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245976.1 protein_id gnl|my_center|LOCUS_12280 37233 35881 gene locus_tag LOCUS_12290 37233 35881 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202701.1 protein_id gnl|my_center|LOCUS_12290 38578 37223 gene locus_tag LOCUS_12300 38578 37223 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202491.1 protein_id gnl|my_center|LOCUS_12300 38913 40172 gene locus_tag LOCUS_12310 38913 40172 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202492.1 protein_id gnl|my_center|LOCUS_12310 40566 41285 gene locus_tag LOCUS_12320 40566 41285 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761529.1 protein_id gnl|my_center|LOCUS_12320 41362 43794 gene locus_tag LOCUS_12330 41362 43794 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_12330 49064 43986 gene locus_tag LOCUS_12340 49064 43986 CDS product DNA repair ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121034.1 protein_id gnl|my_center|LOCUS_12340 49533 49051 gene locus_tag LOCUS_12350 49533 49051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 51784 49616 gene locus_tag LOCUS_12360 51784 49616 CDS product flotillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121033.1 protein_id gnl|my_center|LOCUS_12360 52488 51838 gene locus_tag LOCUS_12370 52488 51838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 53259 52552 gene locus_tag LOCUS_12380 53259 52552 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930705.1 protein_id gnl|my_center|LOCUS_12380 53678 53271 gene locus_tag LOCUS_12390 53678 53271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 53822 54610 gene locus_tag LOCUS_12400 53822 54610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 54823 54738 gene locus_tag LOCUS_t00140 54823 54738 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 54983 54896 gene locus_tag LOCUS_t00150 54983 54896 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 56085 55105 gene locus_tag LOCUS_12410 56085 55105 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963960.1 protein_id gnl|my_center|LOCUS_12410 56656 56165 gene locus_tag LOCUS_12420 56656 56165 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963339.1 protein_id gnl|my_center|LOCUS_12420 57924 56842 gene locus_tag LOCUS_12430 gene mltG 57924 56842 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202520.1 protein_id gnl|my_center|LOCUS_12430 58131 58763 gene locus_tag LOCUS_12440 58131 58763 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963025.1 protein_id gnl|my_center|LOCUS_12440 60067 59147 gene locus_tag LOCUS_12450 60067 59147 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790934.1 protein_id gnl|my_center|LOCUS_12450 60936 60064 gene locus_tag LOCUS_12460 60936 60064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 61028 61702 gene locus_tag LOCUS_12470 61028 61702 CDS product WbqC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108764.1 protein_id gnl|my_center|LOCUS_12470 61877 64483 gene locus_tag LOCUS_12480 61877 64483 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931885.1 protein_id gnl|my_center|LOCUS_12480 65326 64598 gene locus_tag LOCUS_12490 65326 64598 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107709.1 protein_id gnl|my_center|LOCUS_12490 66320 65295 gene locus_tag LOCUS_12500 66320 65295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 66586 67515 gene locus_tag LOCUS_12510 66586 67515 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402958.1 protein_id gnl|my_center|LOCUS_12510 67512 71132 gene locus_tag LOCUS_12520 67512 71132 CDS product M1 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103037426.1 protein_id gnl|my_center|LOCUS_12520 71435 73003 gene locus_tag LOCUS_12530 71435 73003 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421548.1 protein_id gnl|my_center|LOCUS_12530 73122 74192 gene locus_tag LOCUS_12540 73122 74192 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963217.1 protein_id gnl|my_center|LOCUS_12540 74376 75620 gene locus_tag LOCUS_12550 74376 75620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 75631 76809 gene locus_tag LOCUS_12560 75631 76809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 76819 77706 gene locus_tag LOCUS_12570 76819 77706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 77731 78192 gene locus_tag LOCUS_12580 77731 78192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 78645 79070 gene locus_tag LOCUS_12590 78645 79070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 79217 80014 gene locus_tag LOCUS_12600 79217 80014 CDS product helical backbone metal receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403682.1 protein_id gnl|my_center|LOCUS_12600 81236 79995 gene locus_tag LOCUS_12610 gene aroA 81236 79995 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202121.1 protein_id gnl|my_center|LOCUS_12610 82359 81319 gene locus_tag LOCUS_12620 gene aroB 82359 81319 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963817.1 protein_id gnl|my_center|LOCUS_12620 82509 82937 gene locus_tag LOCUS_12630 82509 82937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 82971 83393 gene locus_tag LOCUS_12640 82971 83393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 84537 83410 gene locus_tag LOCUS_12650 84537 83410 CDS product bifunctional 3-deoxy-7-phosphoheptulonate synthase/chorismate mutase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962424.1 protein_id gnl|my_center|LOCUS_12650 84688 85887 gene locus_tag LOCUS_12660 84688 85887 CDS product proline dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963816.1 protein_id gnl|my_center|LOCUS_12660 86074 86442 gene locus_tag LOCUS_12670 86074 86442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 86826 87599 gene locus_tag LOCUS_12680 86826 87599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 87826 89991 gene locus_tag LOCUS_12690 87826 89991 CDS product carboxy terminal-processing peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964422.1 protein_id gnl|my_center|LOCUS_12690 90226 91311 gene locus_tag LOCUS_12700 90226 91311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 91564 93114 gene locus_tag LOCUS_12710 gene lysS 91564 93114 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802230.1 protein_id gnl|my_center|LOCUS_12710 93921 93562 gene locus_tag LOCUS_12720 93921 93562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 94492 94055 gene locus_tag LOCUS_12730 94492 94055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 94753 94995 gene locus_tag LOCUS_12740 94753 94995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 95007 95945 gene locus_tag LOCUS_12750 95007 95945 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337458.1 protein_id gnl|my_center|LOCUS_12750 96120 96344 gene locus_tag LOCUS_12760 96120 96344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 96859 96326 gene locus_tag LOCUS_12770 96859 96326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 97996 98361 gene locus_tag LOCUS_12780 97996 98361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 98632 98790 gene locus_tag LOCUS_12790 98632 98790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 98980 99177 gene locus_tag LOCUS_12800 98980 99177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 99208 100335 gene locus_tag LOCUS_12810 99208 100335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 100732 101211 gene locus_tag LOCUS_12820 100732 101211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 102565 103197 gene locus_tag LOCUS_12830 102565 103197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 103199 104206 gene locus_tag LOCUS_12840 103199 104206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 104242 106053 gene locus_tag LOCUS_12850 104242 106053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 106113 106550 gene locus_tag LOCUS_12860 106113 106550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 106547 106996 gene locus_tag LOCUS_12870 106547 106996 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941646.1 protein_id gnl|my_center|LOCUS_12870 107090 107275 gene locus_tag LOCUS_12880 107090 107275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 107275 108012 gene locus_tag LOCUS_12890 107275 108012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 108026 109822 gene locus_tag LOCUS_12900 108026 109822 CDS product VgrG-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226667.1 protein_id gnl|my_center|LOCUS_12900 109867 110136 gene locus_tag LOCUS_12910 109867 110136 CDS product PAAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340539.1 protein_id gnl|my_center|LOCUS_12910 110251 110709 gene locus_tag LOCUS_12920 110251 110709 CDS product GPW/gp25 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974730.1 protein_id gnl|my_center|LOCUS_12920 110712 114356 gene locus_tag LOCUS_12930 110712 114356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 114353 118093 gene locus_tag LOCUS_12940 114353 118093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 118130 122719 gene locus_tag LOCUS_12950 118130 122719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 122716 124203 gene locus_tag LOCUS_12960 122716 124203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 124258 127869 gene locus_tag LOCUS_12970 124258 127869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 127866 128360 gene locus_tag LOCUS_12980 127866 128360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 128776 131991 gene locus_tag LOCUS_12990 128776 131991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 132374 133690 gene locus_tag LOCUS_13000 132374 133690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 134414 133785 gene locus_tag LOCUS_13010 134414 133785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 134569 135405 gene locus_tag LOCUS_13020 134569 135405 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027270.1 protein_id gnl|my_center|LOCUS_13020 135667 135455 gene locus_tag LOCUS_13030 135667 135455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 136673 135876 gene locus_tag LOCUS_13040 136673 135876 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206915.1 protein_id gnl|my_center|LOCUS_13040 136986 137672 gene locus_tag LOCUS_13050 136986 137672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 138587 137841 gene locus_tag LOCUS_13060 138587 137841 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114603.1 protein_id gnl|my_center|LOCUS_13060 140137 139313 gene locus_tag LOCUS_13070 140137 139313 CDS product enoyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759864.1 protein_id gnl|my_center|LOCUS_13070 142186 140516 gene locus_tag LOCUS_13080 gene recN 142186 140516 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963946.1 protein_id gnl|my_center|LOCUS_13080 143205 142285 gene locus_tag LOCUS_13090 143205 142285 CDS product DUF4835 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963945.1 protein_id gnl|my_center|LOCUS_13090 143861 143202 gene locus_tag LOCUS_13100 143861 143202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 144586 143987 gene locus_tag LOCUS_13110 144586 143987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 144994 144647 gene locus_tag LOCUS_13120 144994 144647 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788198.1 protein_id gnl|my_center|LOCUS_13120 145952 145122 gene locus_tag LOCUS_13130 gene bamD 145952 145122 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788200.1 protein_id gnl|my_center|LOCUS_13130 147847 146057 gene locus_tag LOCUS_13140 147847 146057 CDS product OstA-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764125.1 protein_id gnl|my_center|LOCUS_13140 148105 149436 gene locus_tag LOCUS_13150 gene tilS 148105 149436 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963738.1 protein_id gnl|my_center|LOCUS_13150 149568 150506 gene locus_tag LOCUS_13160 gene mdh 149568 150506 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404318.1 protein_id gnl|my_center|LOCUS_13160 151614 150709 gene locus_tag LOCUS_13170 151614 150709 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791185.1 protein_id gnl|my_center|LOCUS_13170 152467 151673 gene locus_tag LOCUS_13180 152467 151673 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963286.1 protein_id gnl|my_center|LOCUS_13180 154739 152616 gene locus_tag LOCUS_13190 gene mutL 154739 152616 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404457.1 protein_id gnl|my_center|LOCUS_13190 154998 157958 gene locus_tag LOCUS_13200 154998 157958 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962917.1 protein_id gnl|my_center|LOCUS_13200 158164 158496 gene locus_tag LOCUS_13210 158164 158496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 158645 159781 gene locus_tag LOCUS_13220 gene bshA 158645 159781 CDS product N-acetyl-alpha-D-glucosaminyl L-malate synthase BshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404813.1 protein_id gnl|my_center|LOCUS_13220 160173 159778 gene locus_tag LOCUS_13230 160173 159778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 160729 160193 gene locus_tag LOCUS_13240 160729 160193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963023.1 protein_id gnl|my_center|LOCUS_13240 160964 161311 gene locus_tag LOCUS_13250 160964 161311 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404070.1 protein_id gnl|my_center|LOCUS_13250 161982 162155 gene locus_tag LOCUS_13260 161982 162155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 162873 162367 gene locus_tag LOCUS_13270 162873 162367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 165282 163150 gene locus_tag LOCUS_13280 165282 163150 CDS product glycoside hydrolase family 97 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202310.1 protein_id gnl|my_center|LOCUS_13280 166622 165792 gene locus_tag LOCUS_13290 166622 165792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 167434 166622 gene locus_tag LOCUS_13300 167434 166622 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528434.1 protein_id gnl|my_center|LOCUS_13300 168004 167441 gene locus_tag LOCUS_13310 168004 167441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 168921 168286 gene locus_tag LOCUS_13320 168921 168286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016561.1 protein_id gnl|my_center|LOCUS_13320 170058 169171 gene locus_tag LOCUS_13330 170058 169171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 171748 170357 gene locus_tag LOCUS_13340 171748 170357 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962828.1 protein_id gnl|my_center|LOCUS_13340 172898 171960 gene locus_tag LOCUS_13350 172898 171960 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962829.1 protein_id gnl|my_center|LOCUS_13350 173591 172962 gene locus_tag LOCUS_13360 173591 172962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 174114 173602 gene locus_tag LOCUS_13370 174114 173602 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037773.1 protein_id gnl|my_center|LOCUS_13370 175509 174376 gene locus_tag LOCUS_13380 gene dnaJ 175509 174376 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763399.1 protein_id gnl|my_center|LOCUS_13380 176226 175648 gene locus_tag LOCUS_13390 176226 175648 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962831.1 protein_id gnl|my_center|LOCUS_13390 176633 176469 gene locus_tag LOCUS_13400 176633 176469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 177131 176739 gene locus_tag LOCUS_13410 177131 176739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 177621 177418 gene locus_tag LOCUS_13420 177621 177418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 177596 178315 gene locus_tag LOCUS_13430 177596 178315 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963166.1 protein_id gnl|my_center|LOCUS_13430 179819 178827 gene locus_tag LOCUS_13440 gene obgE 179819 178827 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785536.1 protein_id gnl|my_center|LOCUS_13440 180584 179958 gene locus_tag LOCUS_13450 180584 179958 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785533.1 protein_id gnl|my_center|LOCUS_13450 181200 180661 gene locus_tag LOCUS_13460 gene hpt 181200 180661 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785529.1 protein_id gnl|my_center|LOCUS_13460 183826 181586 gene locus_tag LOCUS_13470 183826 181586 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138432165.1 protein_id gnl|my_center|LOCUS_13470 185047 184133 gene locus_tag LOCUS_13480 185047 184133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 185246 186403 gene locus_tag LOCUS_13490 185246 186403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 186409 187770 gene locus_tag LOCUS_13500 186409 187770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 188837 187767 gene locus_tag LOCUS_13510 188837 187767 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387716.1 protein_id gnl|my_center|LOCUS_13510 189987 188851 gene locus_tag LOCUS_13520 gene rffA 189987 188851 CDS product dTDP-4-amino-4,6-dideoxygalactose transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963398.1 protein_id gnl|my_center|LOCUS_13520 191183 190233 gene locus_tag LOCUS_13530 191183 190233 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256245.1 protein_id gnl|my_center|LOCUS_13530 192258 191344 gene locus_tag LOCUS_13540 192258 191344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 193675 192497 gene locus_tag LOCUS_13550 193675 192497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 195087 193807 gene locus_tag LOCUS_13560 195087 193807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 196459 195257 gene locus_tag LOCUS_13570 196459 195257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 197801 196626 gene locus_tag LOCUS_13580 197801 196626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 200327 198738 gene locus_tag LOCUS_13590 200327 198738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 201034 200324 gene locus_tag LOCUS_13600 201034 200324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 201893 201315 gene locus_tag LOCUS_13610 201893 201315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 202663 201908 gene locus_tag LOCUS_13620 202663 201908 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461011.1 protein_id gnl|my_center|LOCUS_13620 203060 202650 gene locus_tag LOCUS_13630 203060 202650 CDS product FdtA/QdtA family cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461015.1 protein_id gnl|my_center|LOCUS_13630 204486 203440 gene locus_tag LOCUS_13640 204486 203440 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057184.1 protein_id gnl|my_center|LOCUS_13640 205849 204623 gene locus_tag LOCUS_13650 205849 204623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 206839 205859 gene locus_tag LOCUS_13660 206839 205859 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331295.1 protein_id gnl|my_center|LOCUS_13660 208064 206907 gene locus_tag LOCUS_13670 208064 206907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 209272 208085 gene locus_tag LOCUS_13680 209272 208085 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046117184.1 protein_id gnl|my_center|LOCUS_13680 210297 209278 gene locus_tag LOCUS_13690 210297 209278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 211659 210574 gene locus_tag LOCUS_13700 211659 210574 CDS product glycoside hydrolase family 99-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942154.1 protein_id gnl|my_center|LOCUS_13700 212652 211729 gene locus_tag LOCUS_13710 212652 211729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 214663 213395 gene locus_tag LOCUS_13720 214663 213395 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963401.1 protein_id gnl|my_center|LOCUS_13720 215902 214733 gene locus_tag LOCUS_13730 215902 214733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 216866 215946 gene locus_tag LOCUS_13740 216866 215946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 218106 216856 gene locus_tag LOCUS_13750 218106 216856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 219045 218152 gene locus_tag LOCUS_13760 219045 218152 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963402.1 protein_id gnl|my_center|LOCUS_13760 220406 219432 gene locus_tag LOCUS_13770 220406 219432 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001170714.1 protein_id gnl|my_center|LOCUS_13770 221614 220658 gene locus_tag LOCUS_13780 221614 220658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 222018 221587 gene locus_tag LOCUS_13790 222018 221587 CDS product FdtA/QdtA family cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802402.1 protein_id gnl|my_center|LOCUS_13790 223034 222087 gene locus_tag LOCUS_13800 223034 222087 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964564.1 protein_id gnl|my_center|LOCUS_13800 224456 223098 gene locus_tag LOCUS_13810 224456 223098 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787721.1 protein_id gnl|my_center|LOCUS_13810 226542 224638 gene locus_tag LOCUS_13820 gene asnB 226542 224638 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119978.1 protein_id gnl|my_center|LOCUS_13820 226749 227267 gene locus_tag LOCUS_13830 226749 227267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 227339 228985 gene locus_tag LOCUS_13840 227339 228985 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076056374.1 protein_id gnl|my_center|LOCUS_13840 230481 229072 gene locus_tag LOCUS_13850 230481 229072 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962735.1 protein_id gnl|my_center|LOCUS_13850 230557 231168 gene locus_tag LOCUS_13860 230557 231168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 231239 234829 gene locus_tag LOCUS_13870 231239 234829 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404654.1 protein_id gnl|my_center|LOCUS_13870 235016 235092 gene locus_tag LOCUS_t00160 235016 235092 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 236087 235164 gene locus_tag LOCUS_13880 gene cysK 236087 235164 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000645000.1 protein_id gnl|my_center|LOCUS_13880 237055 236222 gene locus_tag LOCUS_13890 237055 236222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 237136 237570 gene locus_tag LOCUS_13900 237136 237570 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143541.1 protein_id gnl|my_center|LOCUS_13900 239835 237799 gene locus_tag LOCUS_13910 239835 237799 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839794.1 protein_id gnl|my_center|LOCUS_13910 241050 239953 gene locus_tag LOCUS_13920 241050 239953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 241413 242342 gene locus_tag LOCUS_13930 241413 242342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 242552 243028 gene locus_tag LOCUS_13940 gene guaD 242552 243028 CDS product guanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245084.1 protein_id gnl|my_center|LOCUS_13940 243261 244802 gene locus_tag LOCUS_13950 gene xdhA 243261 244802 CDS product xanthine dehydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339408.1 protein_id gnl|my_center|LOCUS_13950 244956 247259 gene locus_tag LOCUS_13960 gene xdhB 244956 247259 CDS product xanthine dehydrogenase molybdopterin binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114679.1 protein_id gnl|my_center|LOCUS_13960 247395 248063 gene locus_tag LOCUS_13970 gene cas6 247395 248063 CDS product CRISPR-associated endoribonuclease Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768973.1 protein_id gnl|my_center|LOCUS_13970 248301 248110 gene locus_tag LOCUS_13980 248301 248110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 248539 248231 gene locus_tag LOCUS_13990 248539 248231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 248776 250692 gene locus_tag LOCUS_14000 248776 250692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 250718 251653 gene locus_tag LOCUS_14010 250718 251653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 251666 252535 gene locus_tag LOCUS_14020 251666 252535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 252545 255436 gene locus_tag LOCUS_14030 252545 255436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 255451 255975 gene locus_tag LOCUS_14040 gene cas4 255451 255975 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768968.1 protein_id gnl|my_center|LOCUS_14040 256324 256019 gene locus_tag LOCUS_14050 256324 256019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 256544 257554 gene locus_tag LOCUS_14060 gene cas1b 256544 257554 CDS product type I-B CRISPR-associated endonuclease Cas1b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768967.1 protein_id gnl|my_center|LOCUS_14060 257603 257866 gene locus_tag LOCUS_14070 gene cas2 257603 257866 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202914.1 protein_id gnl|my_center|LOCUS_14070 258069 262251 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gcttcaatcggactgtgaggaattgaaat 263802 262366 gene locus_tag LOCUS_14080 263802 262366 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027563.1 protein_id gnl|my_center|LOCUS_14080 264384 264046 gene locus_tag LOCUS_14090 gene uraH 264384 264046 CDS product hydroxyisourate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852246.1 protein_id gnl|my_center|LOCUS_14090 264890 264381 gene locus_tag LOCUS_14100 gene uraD 264890 264381 CDS product 2-oxo-4-hydroxy-4-carboxy-5-ureidoimidazoline decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727574.1 protein_id gnl|my_center|LOCUS_14100 265904 265158 gene locus_tag LOCUS_14110 gene allE 265904 265158 CDS product (S)-ureidoglycine aminohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887795.1 protein_id gnl|my_center|LOCUS_14110 267668 266406 gene locus_tag LOCUS_14120 gene hpxK 267668 266406 CDS product allantoate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705408.1 protein_id gnl|my_center|LOCUS_14120 269013 267673 gene locus_tag LOCUS_14130 gene allB 269013 267673 CDS product allantoinase AllB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223822.1 protein_id gnl|my_center|LOCUS_14130 269071 269919 gene locus_tag LOCUS_14140 gene pucL 269071 269919 CDS product urate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223818.1 protein_id gnl|my_center|LOCUS_14140 270107 271099 gene locus_tag LOCUS_14150 270107 271099 CDS product XdhC/CoxI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362591.1 protein_id gnl|my_center|LOCUS_14150 276468 271507 gene locus_tag LOCUS_14160 276468 271507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 277821 279206 gene locus_tag LOCUS_14170 277821 279206 CDS product DUF1800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106462662.1 protein_id gnl|my_center|LOCUS_14170 279213 280424 gene locus_tag LOCUS_14180 279213 280424 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963630.1 protein_id gnl|my_center|LOCUS_14180 280520 281242 gene locus_tag LOCUS_14190 280520 281242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 281971 281360 gene locus_tag LOCUS_14200 281971 281360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 284287 282413 gene locus_tag LOCUS_14210 284287 282413 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057672901.1 protein_id gnl|my_center|LOCUS_14210 285171 284839 gene locus_tag LOCUS_14220 285171 284839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 285305 285796 gene locus_tag LOCUS_14230 285305 285796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 286367 285939 gene locus_tag LOCUS_14240 286367 285939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 286627 286385 gene locus_tag LOCUS_14250 286627 286385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 286926 288248 gene locus_tag LOCUS_14260 gene nhaA 286926 288248 CDS product sodium/proton antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001049644.1 protein_id gnl|my_center|LOCUS_14260 288470 289009 gene locus_tag LOCUS_14270 288470 289009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 291797 289152 gene locus_tag LOCUS_14280 291797 289152 CDS product glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141168.1 protein_id gnl|my_center|LOCUS_14280 292557 293357 gene locus_tag LOCUS_14290 292557 293357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 294153 294341 gene locus_tag LOCUS_14300 294153 294341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 294582 295769 gene locus_tag LOCUS_14310 294582 295769 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878822.1 protein_id gnl|my_center|LOCUS_14310 295964 296143 gene locus_tag LOCUS_14320 295964 296143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 296478 298526 gene locus_tag LOCUS_14330 296478 298526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 298688 300616 gene locus_tag LOCUS_14340 298688 300616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 302880 300706 gene locus_tag LOCUS_14350 302880 300706 CDS product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108682.1 protein_id gnl|my_center|LOCUS_14350 303837 302971 gene locus_tag LOCUS_14360 303837 302971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 304001 304735 gene locus_tag LOCUS_14370 304001 304735 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167939808.1 protein_id gnl|my_center|LOCUS_14370 305083 305970 gene locus_tag LOCUS_14380 305083 305970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 306887 306000 gene locus_tag LOCUS_14390 gene lgt 306887 306000 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403744.1 protein_id gnl|my_center|LOCUS_14390 307424 307122 gene locus_tag LOCUS_14400 307424 307122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 308082 307417 gene locus_tag LOCUS_14410 308082 307417 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931970.1 protein_id gnl|my_center|LOCUS_14410 310306 308387 gene locus_tag LOCUS_14420 gene nadE 310306 308387 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192277.1 protein_id gnl|my_center|LOCUS_14420 311291 310593 gene locus_tag LOCUS_14430 311291 310593 CDS product NUMOD4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001006993.1 protein_id gnl|my_center|LOCUS_14430 312318 311698 gene locus_tag LOCUS_14440 312318 311698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 313155 312430 gene locus_tag LOCUS_14450 313155 312430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 314534 313284 gene locus_tag LOCUS_14460 gene fabF 314534 313284 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962377.1 protein_id gnl|my_center|LOCUS_14460 314937 314701 gene locus_tag LOCUS_14470 314937 314701 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291965.1 protein_id gnl|my_center|LOCUS_14470 315112 315540 gene locus_tag LOCUS_14480 315112 315540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 315730 317169 gene locus_tag LOCUS_14490 gene pyk 315730 317169 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962380.1 protein_id gnl|my_center|LOCUS_14490 318903 317416 gene locus_tag LOCUS_14500 318903 317416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 319402 319151 gene locus_tag LOCUS_14510 gene rpsT 319402 319151 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963520.1 protein_id gnl|my_center|LOCUS_14510 319580 320665 gene locus_tag LOCUS_14520 319580 320665 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939508.1 protein_id gnl|my_center|LOCUS_14520 321319 320675 gene locus_tag LOCUS_14530 gene rsmG 321319 320675 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962583.1 protein_id gnl|my_center|LOCUS_14530 322321 321698 gene locus_tag LOCUS_14540 gene sigW 322321 321698 CDS product RNA polymerase sigma factor SigW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234958.1 protein_id gnl|my_center|LOCUS_14540 323466 322312 gene locus_tag LOCUS_14550 323466 322312 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129003072.1 protein_id gnl|my_center|LOCUS_14550 323632 324762 gene locus_tag LOCUS_14560 gene tgt 323632 324762 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962771.1 protein_id gnl|my_center|LOCUS_14560 325034 325750 gene locus_tag LOCUS_14570 325034 325750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 325826 326905 gene locus_tag LOCUS_14580 325826 326905 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787732.1 protein_id gnl|my_center|LOCUS_14580 327015 327917 gene locus_tag LOCUS_14590 327015 327917 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120520.1 protein_id gnl|my_center|LOCUS_14590 328738 327914 gene locus_tag LOCUS_14600 gene ispE 328738 327914 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793430.1 protein_id gnl|my_center|LOCUS_14600 328890 329681 gene locus_tag LOCUS_14610 328890 329681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 329674 330294 gene locus_tag LOCUS_14620 329674 330294 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243002.1 protein_id gnl|my_center|LOCUS_14620 330291 330980 gene locus_tag LOCUS_14630 330291 330980 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986573.1 protein_id gnl|my_center|LOCUS_14630 331248 332390 gene locus_tag LOCUS_14640 331248 332390 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963410.1 protein_id gnl|my_center|LOCUS_14640 332793 333410 gene locus_tag LOCUS_14650 332793 333410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 334100 333471 gene locus_tag LOCUS_14660 334100 333471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124055.1 protein_id gnl|my_center|LOCUS_14660 335431 334301 gene locus_tag LOCUS_14670 335431 334301 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905558.1 protein_id gnl|my_center|LOCUS_14670 336541 335486 gene locus_tag LOCUS_14680 336541 335486 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001290820.1 protein_id gnl|my_center|LOCUS_14680 336924 336679 gene locus_tag LOCUS_14690 336924 336679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933888.1 protein_id gnl|my_center|LOCUS_14690 338537 337032 gene locus_tag LOCUS_14700 gene atpD 338537 337032 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962293.1 protein_id gnl|my_center|LOCUS_14700 338824 338897 gene locus_tag LOCUS_t00170 338824 338897 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 339039 339965 gene locus_tag LOCUS_14710 339039 339965 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962326.1 protein_id gnl|my_center|LOCUS_14710 340179 341243 gene locus_tag LOCUS_14720 340179 341243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 341356 341928 gene locus_tag LOCUS_14730 341356 341928 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962325.1 protein_id gnl|my_center|LOCUS_14730 342122 342688 gene locus_tag LOCUS_14740 gene pth 342122 342688 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764745.1 protein_id gnl|my_center|LOCUS_14740 345042 342946 gene locus_tag LOCUS_14750 gene metG 345042 342946 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791925.1 protein_id gnl|my_center|LOCUS_14750 345220 345969 gene locus_tag LOCUS_14760 345220 345969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 346663 346262 gene locus_tag LOCUS_14770 346663 346262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 347485 346694 gene locus_tag LOCUS_14780 347485 346694 CDS product DUF3050 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_219159941.1 protein_id gnl|my_center|LOCUS_14780 348192 347647 gene locus_tag LOCUS_14790 348192 347647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 348429 350240 gene locus_tag LOCUS_14800 gene typA 348429 350240 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108480.1 protein_id gnl|my_center|LOCUS_14800 350345 350863 gene locus_tag LOCUS_14810 350345 350863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 351799 350978 gene locus_tag LOCUS_14820 351799 350978 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963972.1 protein_id gnl|my_center|LOCUS_14820 351882 353372 gene locus_tag LOCUS_14830 351882 353372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 353466 353876 gene locus_tag LOCUS_14840 353466 353876 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027227489.1 protein_id gnl|my_center|LOCUS_14840 354461 355162 gene locus_tag LOCUS_14850 354461 355162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 355379 356119 gene locus_tag LOCUS_14860 355379 356119 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869727.1 protein_id gnl|my_center|LOCUS_14860 356339 356614 gene locus_tag LOCUS_14870 356339 356614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 356712 357767 gene locus_tag LOCUS_14880 356712 357767 CDS product alkane 1-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004538099.1 protein_id gnl|my_center|LOCUS_14880 359855 357996 gene locus_tag LOCUS_14890 359855 357996 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819023.1 protein_id gnl|my_center|LOCUS_14890 362614 361517 gene locus_tag LOCUS_14900 362614 361517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 362502 363263 gene locus_tag LOCUS_14910 362502 363263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 363365 366367 gene locus_tag LOCUS_14920 363365 366367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 367311 366448 gene locus_tag LOCUS_14930 367311 366448 CDS product M28 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000680714.1 protein_id gnl|my_center|LOCUS_14930 367640 373129 gene locus_tag LOCUS_14940 367640 373129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 373616 375934 gene locus_tag LOCUS_14950 gene pbpC 373616 375934 CDS product penicillin-binding protein 1C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070480.1 protein_id gnl|my_center|LOCUS_14950 378630 376201 gene locus_tag LOCUS_14960 378630 376201 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963607.1 protein_id gnl|my_center|LOCUS_14960 379996 378632 gene locus_tag LOCUS_14970 379996 378632 CDS product HTTM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963606.1 protein_id gnl|my_center|LOCUS_14970 381108 379996 gene locus_tag LOCUS_14980 381108 379996 CDS product imelysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963605.1 protein_id gnl|my_center|LOCUS_14980 382352 381201 gene locus_tag LOCUS_14990 382352 381201 CDS product DUF4856 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963604.1 protein_id gnl|my_center|LOCUS_14990 383055 383945 gene locus_tag LOCUS_15000 383055 383945 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797949.1 protein_id gnl|my_center|LOCUS_15000 384590 384072 gene locus_tag LOCUS_15010 384590 384072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 385741 384647 gene locus_tag LOCUS_15020 385741 384647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 386495 385959 gene locus_tag LOCUS_15030 386495 385959 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001060300.1 protein_id gnl|my_center|LOCUS_15030 386668 387045 gene locus_tag LOCUS_15040 386668 387045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 387077 388234 gene locus_tag LOCUS_15050 387077 388234 CDS product sorbosone dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940868.1 protein_id gnl|my_center|LOCUS_15050 389379 388249 gene locus_tag LOCUS_15060 389379 388249 CDS product glycosyltransferase family 87 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963747.1 protein_id gnl|my_center|LOCUS_15060 389999 390481 gene locus_tag LOCUS_15070 389999 390481 CDS product RimK/LysX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334532.1 protein_id gnl|my_center|LOCUS_15070 390600 391493 gene locus_tag LOCUS_15080 gene rimK 390600 391493 CDS product 30S ribosomal protein S6--L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261388.1 protein_id gnl|my_center|LOCUS_15080 391701 392657 gene locus_tag LOCUS_15090 391701 392657 CDS product succinylglutamate desuccinylase/aspartoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962397.1 protein_id gnl|my_center|LOCUS_15090 393353 394036 gene locus_tag LOCUS_15100 393353 394036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 394187 394474 gene locus_tag LOCUS_15110 394187 394474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 394853 395299 gene locus_tag LOCUS_15120 394853 395299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 395707 395330 gene locus_tag LOCUS_15130 395707 395330 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971972.1 protein_id gnl|my_center|LOCUS_15130 397050 396544 gene locus_tag LOCUS_15140 397050 396544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 397204 397040 gene locus_tag LOCUS_15150 397204 397040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 397681 397301 gene locus_tag LOCUS_15160 397681 397301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 398019 397648 gene locus_tag LOCUS_15170 398019 397648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 398977 398528 gene locus_tag LOCUS_15180 398977 398528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 399609 400844 gene locus_tag LOCUS_15190 399609 400844 CDS product serpin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839735.1 protein_id gnl|my_center|LOCUS_15190 400978 401337 gene locus_tag LOCUS_15200 400978 401337 CDS product DUF3140 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143236.1 protein_id gnl|my_center|LOCUS_15200 402139 401510 gene locus_tag LOCUS_15210 402139 401510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 402851 402174 gene locus_tag LOCUS_15220 402851 402174 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064094285.1 protein_id gnl|my_center|LOCUS_15220 403678 402851 gene locus_tag LOCUS_15230 403678 402851 CDS product S1-like domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108322.1 protein_id gnl|my_center|LOCUS_15230 405021 404341 gene locus_tag LOCUS_15240 405021 404341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 405320 405018 gene locus_tag LOCUS_15250 405320 405018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 407526 405547 gene locus_tag LOCUS_15260 407526 405547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023577041.1 protein_id gnl|my_center|LOCUS_15260 407646 408968 gene locus_tag LOCUS_15270 407646 408968 CDS product putative DNA modification/repair radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207773.1 protein_id gnl|my_center|LOCUS_15270 408968 409246 gene locus_tag LOCUS_15280 408968 409246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 409283 410140 gene locus_tag LOCUS_15290 409283 410140 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403067.1 protein_id gnl|my_center|LOCUS_15290 410325 411239 gene locus_tag LOCUS_15300 410325 411239 CDS product TIGR03915 family putative DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207772.1 protein_id gnl|my_center|LOCUS_15300 411411 412283 gene locus_tag LOCUS_15310 gene rfbD 411411 412283 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767804.1 protein_id gnl|my_center|LOCUS_15310 412494 412291 gene locus_tag LOCUS_15320 412494 412291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 413850 412630 gene locus_tag LOCUS_15330 413850 412630 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193486.1 protein_id gnl|my_center|LOCUS_15330 414050 414601 gene locus_tag LOCUS_15340 gene greB 414050 414601 CDS product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812405.1 protein_id gnl|my_center|LOCUS_15340 415940 415011 gene locus_tag LOCUS_15350 415940 415011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 416112 417641 gene locus_tag LOCUS_15360 416112 417641 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035359.1 protein_id gnl|my_center|LOCUS_15360 417840 418244 gene locus_tag LOCUS_15370 417840 418244 CDS product DUF779 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070936545.1 protein_id gnl|my_center|LOCUS_15370 418895 418428 gene locus_tag LOCUS_15380 418895 418428 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004301986.1 protein_id gnl|my_center|LOCUS_15380 419766 419029 gene locus_tag LOCUS_15390 419766 419029 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135178283.1 protein_id gnl|my_center|LOCUS_15390 421264 419945 gene locus_tag LOCUS_15400 421264 419945 CDS product family 1 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525271.1 protein_id gnl|my_center|LOCUS_15400 422745 422038 gene locus_tag LOCUS_15410 gene cmk 422745 422038 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769932.1 protein_id gnl|my_center|LOCUS_15410 423163 422759 gene locus_tag LOCUS_15420 423163 422759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 423424 423254 gene locus_tag LOCUS_15430 423424 423254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 424140 423979 gene locus_tag LOCUS_15440 424140 423979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 424218 425894 gene locus_tag LOCUS_15450 gene ade 424218 425894 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963204.1 protein_id gnl|my_center|LOCUS_15450 426096 426575 gene locus_tag LOCUS_15460 426096 426575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 427205 426801 gene locus_tag LOCUS_15470 427205 426801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 428253 427276 gene locus_tag LOCUS_15480 428253 427276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 428844 429725 gene locus_tag LOCUS_15490 gene sucD 428844 429725 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963119.1 protein_id gnl|my_center|LOCUS_15490 430082 430438 gene locus_tag LOCUS_15500 430082 430438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 431333 430707 gene locus_tag LOCUS_15510 431333 430707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 432342 431353 gene locus_tag LOCUS_15520 432342 431353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 433805 432669 gene locus_tag LOCUS_15530 433805 432669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 434758 434027 gene locus_tag LOCUS_15540 434758 434027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 434956 436368 gene locus_tag LOCUS_15550 434956 436368 CDS product mercuric reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402863.1 protein_id gnl|my_center|LOCUS_15550 436937 436746 gene locus_tag LOCUS_15560 436937 436746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 >Feature sequence12 600 142 gene locus_tag LOCUS_15570 600 142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 836 1807 gene locus_tag LOCUS_15580 gene pfkA 836 1807 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173968.1 protein_id gnl|my_center|LOCUS_15580 2916 1990 gene locus_tag LOCUS_15590 gene miaA 2916 1990 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202192.1 protein_id gnl|my_center|LOCUS_15590 4117 2960 gene locus_tag LOCUS_15600 4117 2960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 4241 7930 gene locus_tag LOCUS_15610 4241 7930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 7980 8372 gene locus_tag LOCUS_15620 7980 8372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 8522 9289 gene locus_tag LOCUS_15630 8522 9289 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963237.1 protein_id gnl|my_center|LOCUS_15630 9395 11032 gene locus_tag LOCUS_15640 9395 11032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 11251 11169 gene locus_tag LOCUS_t00180 11251 11169 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 11447 11911 gene locus_tag LOCUS_15650 11447 11911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 12740 12018 gene locus_tag LOCUS_15660 12740 12018 CDS product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977779.1 protein_id gnl|my_center|LOCUS_15660 12859 13581 gene locus_tag LOCUS_15670 12859 13581 CDS product VIT1/CCC1 transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962918.1 protein_id gnl|my_center|LOCUS_15670 13788 14618 gene locus_tag LOCUS_15680 13788 14618 CDS product polyphosphate kinase 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886780.1 protein_id gnl|my_center|LOCUS_15680 16647 14872 gene locus_tag LOCUS_15690 16647 14872 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964054.1 protein_id gnl|my_center|LOCUS_15690 17248 16883 gene locus_tag LOCUS_15700 17248 16883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 17625 17906 gene locus_tag LOCUS_15710 17625 17906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 17980 19413 gene locus_tag LOCUS_15720 17980 19413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 20607 19645 gene locus_tag LOCUS_15730 20607 19645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 21246 20620 gene locus_tag LOCUS_15740 21246 20620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 22041 21496 gene locus_tag LOCUS_15750 22041 21496 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362025.1 protein_id gnl|my_center|LOCUS_15750 24215 22314 gene locus_tag LOCUS_15760 24215 22314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 24395 24919 gene locus_tag LOCUS_15770 24395 24919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 25042 27189 gene locus_tag LOCUS_15780 gene pta 25042 27189 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940288.1 protein_id gnl|my_center|LOCUS_15780 27335 28534 gene locus_tag LOCUS_15790 27335 28534 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940289.1 protein_id gnl|my_center|LOCUS_15790 28747 29112 gene locus_tag LOCUS_15800 28747 29112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 29191 31188 gene locus_tag LOCUS_15810 29191 31188 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963992.1 protein_id gnl|my_center|LOCUS_15810 32030 31479 gene locus_tag LOCUS_15820 32030 31479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 32675 32277 gene locus_tag LOCUS_15830 32675 32277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034098264.1 protein_id gnl|my_center|LOCUS_15830 33698 32838 gene locus_tag LOCUS_15840 33698 32838 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963067.1 protein_id gnl|my_center|LOCUS_15840 34064 34648 gene locus_tag LOCUS_15850 34064 34648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15850 35321 36346 gene locus_tag LOCUS_15860 35321 36346 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408265.1 protein_id gnl|my_center|LOCUS_15860 37465 36437 gene locus_tag LOCUS_15870 37465 36437 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766899.1 protein_id gnl|my_center|LOCUS_15870 38168 37719 gene locus_tag LOCUS_15880 38168 37719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046082450.1 protein_id gnl|my_center|LOCUS_15880 39286 38342 gene locus_tag LOCUS_15890 39286 38342 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035526.1 protein_id gnl|my_center|LOCUS_15890 40555 39851 gene locus_tag LOCUS_15900 40555 39851 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107709.1 protein_id gnl|my_center|LOCUS_15900 41718 40552 gene locus_tag LOCUS_15910 41718 40552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 42777 41725 gene locus_tag LOCUS_15920 42777 41725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 43803 43111 gene locus_tag LOCUS_15930 43803 43111 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097308.1 protein_id gnl|my_center|LOCUS_15930 44081 43863 gene locus_tag LOCUS_15940 44081 43863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 45328 44033 gene locus_tag LOCUS_15950 45328 44033 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038503865.1 protein_id gnl|my_center|LOCUS_15950 45405 46607 gene locus_tag LOCUS_15960 45405 46607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 46829 47416 gene locus_tag LOCUS_15970 46829 47416 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459816.1 protein_id gnl|my_center|LOCUS_15970 47516 48157 gene locus_tag LOCUS_15980 47516 48157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 48841 49488 gene locus_tag LOCUS_15990 48841 49488 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036955.1 protein_id gnl|my_center|LOCUS_15990 50089 49556 gene locus_tag LOCUS_16000 50089 49556 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963178.1 protein_id gnl|my_center|LOCUS_16000 51062 55480 gene locus_tag LOCUS_16010 51062 55480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 55580 58312 gene locus_tag LOCUS_16020 55580 58312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 61243 58337 gene locus_tag LOCUS_16030 61243 58337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 61531 62583 gene locus_tag LOCUS_16040 61531 62583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 63016 63423 gene locus_tag LOCUS_16050 63016 63423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 63827 66064 gene locus_tag LOCUS_16060 63827 66064 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923343.1 protein_id gnl|my_center|LOCUS_16060 68852 66354 gene locus_tag LOCUS_16070 68852 66354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 69336 68944 gene locus_tag LOCUS_16080 69336 68944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 69758 70150 gene locus_tag LOCUS_16090 69758 70150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 70451 70816 gene locus_tag LOCUS_16100 70451 70816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 71098 71853 gene locus_tag LOCUS_16110 71098 71853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 72111 73151 gene locus_tag LOCUS_16120 72111 73151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 73148 73900 gene locus_tag LOCUS_16130 73148 73900 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798355.1 protein_id gnl|my_center|LOCUS_16130 75971 74217 gene locus_tag LOCUS_16140 gene ggt 75971 74217 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963831.1 protein_id gnl|my_center|LOCUS_16140 76339 78387 gene locus_tag LOCUS_16150 76339 78387 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861581.1 protein_id gnl|my_center|LOCUS_16150 78743 79198 gene locus_tag LOCUS_16160 78743 79198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 79366 79929 gene locus_tag LOCUS_16170 79366 79929 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020425.1 protein_id gnl|my_center|LOCUS_16170 80039 80884 gene locus_tag LOCUS_16180 80039 80884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 80905 81363 gene locus_tag LOCUS_16190 80905 81363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 81819 82706 gene locus_tag LOCUS_16200 81819 82706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 82808 83236 gene locus_tag LOCUS_16210 82808 83236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 83317 83673 gene locus_tag LOCUS_16220 83317 83673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 84003 83716 gene locus_tag LOCUS_16230 84003 83716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 86131 84266 gene locus_tag LOCUS_16240 86131 84266 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839780.1 protein_id gnl|my_center|LOCUS_16240 86687 86217 gene locus_tag LOCUS_16250 86687 86217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 88192 86873 gene locus_tag LOCUS_16260 88192 86873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 88390 90873 gene locus_tag LOCUS_16270 88390 90873 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140201.1 protein_id gnl|my_center|LOCUS_16270 92019 91099 gene locus_tag LOCUS_16280 92019 91099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 92555 93670 gene locus_tag LOCUS_16290 gene ykfB 92555 93670 CDS product L-Ala-D/L-Glu epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244980.1 protein_id gnl|my_center|LOCUS_16290 93670 94905 gene locus_tag LOCUS_16300 93670 94905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 97008 94933 gene locus_tag LOCUS_16310 97008 94933 CDS product zinc-dependent metalloprotease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819627.1 protein_id gnl|my_center|LOCUS_16310 97937 97515 gene locus_tag LOCUS_16320 97937 97515 CDS product thiol-disulfide oxidoreductase DCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038200.1 protein_id gnl|my_center|LOCUS_16320 98028 98645 gene locus_tag LOCUS_16330 98028 98645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 98757 100286 gene locus_tag LOCUS_16340 98757 100286 CDS product HTTM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902592.1 protein_id gnl|my_center|LOCUS_16340 101850 100636 gene locus_tag LOCUS_16350 101850 100636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 101966 102349 gene locus_tag LOCUS_16360 101966 102349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 102866 103666 gene locus_tag LOCUS_16370 102866 103666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 103762 105759 gene locus_tag LOCUS_16380 103762 105759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 106111 107310 gene locus_tag LOCUS_16390 106111 107310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 108097 107468 gene locus_tag LOCUS_16400 108097 107468 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964140.1 protein_id gnl|my_center|LOCUS_16400 110539 108728 gene locus_tag LOCUS_16410 110539 108728 CDS product DUF885 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036537.1 protein_id gnl|my_center|LOCUS_16410 112160 110814 gene locus_tag LOCUS_16420 112160 110814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 112915 112241 gene locus_tag LOCUS_16430 112915 112241 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582912.1 protein_id gnl|my_center|LOCUS_16430 113913 112939 gene locus_tag LOCUS_16440 113913 112939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 114312 113938 gene locus_tag LOCUS_16450 114312 113938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 >Feature sequence13 320 1456 gene locus_tag LOCUS_16460 gene rodA 320 1456 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964509.1 protein_id gnl|my_center|LOCUS_16460 1693 2808 gene locus_tag LOCUS_16470 1693 2808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 3841 2777 gene locus_tag LOCUS_16480 3841 2777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 5033 3834 gene locus_tag LOCUS_16490 5033 3834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 5231 5392 gene locus_tag LOCUS_16500 5231 5392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 5547 6173 gene locus_tag LOCUS_16510 5547 6173 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763837.1 protein_id gnl|my_center|LOCUS_16510 6225 8618 gene locus_tag LOCUS_16520 6225 8618 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962444.1 protein_id gnl|my_center|LOCUS_16520 8806 9528 gene locus_tag LOCUS_16530 8806 9528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 10520 9567 gene locus_tag LOCUS_16540 10520 9567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 11356 10760 gene locus_tag LOCUS_16550 11356 10760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 12496 11447 gene locus_tag LOCUS_16560 12496 11447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 13581 12535 gene locus_tag LOCUS_16570 13581 12535 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963997.1 protein_id gnl|my_center|LOCUS_16570 14118 14528 gene locus_tag LOCUS_16580 14118 14528 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963530.1 protein_id gnl|my_center|LOCUS_16580 16240 14957 gene locus_tag LOCUS_16590 16240 14957 CDS product nucleoside permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005116082.1 protein_id gnl|my_center|LOCUS_16590 17109 16495 gene locus_tag LOCUS_16600 17109 16495 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962337.1 protein_id gnl|my_center|LOCUS_16600 17646 17215 gene locus_tag LOCUS_16610 17646 17215 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759603.1 protein_id gnl|my_center|LOCUS_16610 18645 18097 gene locus_tag LOCUS_16620 18645 18097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 19158 18718 gene locus_tag LOCUS_16630 19158 18718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 19394 21175 gene locus_tag LOCUS_16640 gene aspS 19394 21175 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765710.1 protein_id gnl|my_center|LOCUS_16640 22626 22117 gene locus_tag LOCUS_16650 22626 22117 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964312.1 protein_id gnl|my_center|LOCUS_16650 23290 22709 gene locus_tag LOCUS_16660 23290 22709 CDS product NADH-quinone oxidoreductase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964313.1 protein_id gnl|my_center|LOCUS_16660 24390 23296 gene locus_tag LOCUS_16670 gene nuoH 24390 23296 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964314.1 protein_id gnl|my_center|LOCUS_16670 25476 24460 gene locus_tag LOCUS_16680 25476 24460 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964315.1 protein_id gnl|my_center|LOCUS_16680 26976 25636 gene locus_tag LOCUS_16690 gene nuoF 26976 25636 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964317.1 protein_id gnl|my_center|LOCUS_16690 27338 27003 gene locus_tag LOCUS_16700 27338 27003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 27915 27343 gene locus_tag LOCUS_16710 27915 27343 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964318.1 protein_id gnl|my_center|LOCUS_16710 29199 27937 gene locus_tag LOCUS_16720 29199 27937 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964319.1 protein_id gnl|my_center|LOCUS_16720 29879 29319 gene locus_tag LOCUS_16730 29879 29319 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964320.1 protein_id gnl|my_center|LOCUS_16730 30550 29996 gene locus_tag LOCUS_16740 30550 29996 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964321.1 protein_id gnl|my_center|LOCUS_16740 31018 30626 gene locus_tag LOCUS_16750 gene ndhC 31018 30626 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964322.1 protein_id gnl|my_center|LOCUS_16750 31148 31759 gene locus_tag LOCUS_16760 31148 31759 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141560.1 protein_id gnl|my_center|LOCUS_16760 33661 31994 gene locus_tag LOCUS_16770 gene pruA 33661 31994 CDS product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962584.1 protein_id gnl|my_center|LOCUS_16770 34311 33919 gene locus_tag LOCUS_16780 34311 33919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 34913 34359 gene locus_tag LOCUS_16790 34913 34359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 35738 35043 gene locus_tag LOCUS_16800 35738 35043 CDS product YjjG family noncanonical pyrimidine nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108200.1 protein_id gnl|my_center|LOCUS_16800 36789 35851 gene locus_tag LOCUS_16810 36789 35851 CDS product geranylgeranylglycerol-phosphate geranylgeranyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963542.1 protein_id gnl|my_center|LOCUS_16810 37117 36923 gene locus_tag LOCUS_16820 37117 36923 CDS product cold shock domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962450.1 protein_id gnl|my_center|LOCUS_16820 37477 37262 gene locus_tag LOCUS_16830 37477 37262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 37980 37645 gene locus_tag LOCUS_16840 37980 37645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 38851 38051 gene locus_tag LOCUS_16850 38851 38051 CDS product DUF2520 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203221.1 protein_id gnl|my_center|LOCUS_16850 41561 38955 gene locus_tag LOCUS_16860 gene ccsA 41561 38955 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404869.1 protein_id gnl|my_center|LOCUS_16860 42373 41945 gene locus_tag LOCUS_16870 42373 41945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 42708 42466 gene locus_tag LOCUS_16880 42708 42466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 43363 42698 gene locus_tag LOCUS_16890 gene ccsA 43363 42698 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404915.1 protein_id gnl|my_center|LOCUS_16890 44225 43470 gene locus_tag LOCUS_16900 44225 43470 CDS product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_183956994.1 protein_id gnl|my_center|LOCUS_16900 44453 44226 gene locus_tag LOCUS_16910 44453 44226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 44744 44484 gene locus_tag LOCUS_16920 44744 44484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 45512 44769 gene locus_tag LOCUS_16930 45512 44769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 46179 45778 gene locus_tag LOCUS_16940 46179 45778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 46462 46169 gene locus_tag LOCUS_16950 46462 46169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 46655 46503 gene locus_tag LOCUS_16960 46655 46503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 47588 46662 gene locus_tag LOCUS_16970 47588 46662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 48200 47757 gene locus_tag LOCUS_16980 48200 47757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 48833 48264 gene locus_tag LOCUS_16990 48833 48264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 49420 49037 gene locus_tag LOCUS_17000 49420 49037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 50835 49420 gene locus_tag LOCUS_17010 50835 49420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 51191 50841 gene locus_tag LOCUS_17020 51191 50841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 52566 51181 gene locus_tag LOCUS_17030 52566 51181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 52785 52615 gene locus_tag LOCUS_17040 52785 52615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 53324 52830 gene locus_tag LOCUS_17050 53324 52830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 58224 53371 gene locus_tag LOCUS_17060 58224 53371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 58914 58285 gene locus_tag LOCUS_17070 58914 58285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17070 59559 59738 gene locus_tag LOCUS_17080 59559 59738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 62977 59735 gene locus_tag LOCUS_17090 62977 59735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 64272 63196 gene locus_tag LOCUS_17100 64272 63196 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964071.1 protein_id gnl|my_center|LOCUS_17100 64550 65194 gene locus_tag LOCUS_17110 64550 65194 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763490.1 protein_id gnl|my_center|LOCUS_17110 65292 66008 gene locus_tag LOCUS_17120 gene pssA 65292 66008 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759605.1 protein_id gnl|my_center|LOCUS_17120 66165 70178 gene locus_tag LOCUS_17130 gene porU 66165 70178 CDS product type IX secretion system sortase PorU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963516.1 protein_id gnl|my_center|LOCUS_17130 70228 71451 gene locus_tag LOCUS_17140 gene porV 70228 71451 CDS product type IX secretion system outer membrane channel protein PorV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963515.1 protein_id gnl|my_center|LOCUS_17140 71582 72874 gene locus_tag LOCUS_17150 71582 72874 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761420.1 protein_id gnl|my_center|LOCUS_17150 74364 72985 gene locus_tag LOCUS_17160 74364 72985 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964035.1 protein_id gnl|my_center|LOCUS_17160 75473 74784 gene locus_tag LOCUS_17170 75473 74784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 75621 75959 gene locus_tag LOCUS_17180 75621 75959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 76033 76353 gene locus_tag LOCUS_17190 76033 76353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 76469 77707 gene locus_tag LOCUS_17200 76469 77707 CDS product BamA/TamA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703897.1 protein_id gnl|my_center|LOCUS_17200 77843 79024 gene locus_tag LOCUS_17210 77843 79024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 79188 80348 gene locus_tag LOCUS_17220 79188 80348 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857806.1 protein_id gnl|my_center|LOCUS_17220 80890 80714 gene locus_tag LOCUS_17230 80890 80714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 80874 82409 gene locus_tag LOCUS_17240 gene purH 80874 82409 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762746.1 protein_id gnl|my_center|LOCUS_17240 82668 83693 gene locus_tag LOCUS_17250 82668 83693 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964505.1 protein_id gnl|my_center|LOCUS_17250 83793 84734 gene locus_tag LOCUS_17260 gene mreC 83793 84734 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034099559.1 protein_id gnl|my_center|LOCUS_17260 84731 85258 gene locus_tag LOCUS_17270 gene mreD 84731 85258 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762749.1 protein_id gnl|my_center|LOCUS_17270 85392 87227 gene locus_tag LOCUS_17280 gene mrdA 85392 87227 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762750.1 protein_id gnl|my_center|LOCUS_17280 87345 88061 gene locus_tag LOCUS_17290 87345 88061 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399223.1 protein_id gnl|my_center|LOCUS_17290 88930 88268 gene locus_tag LOCUS_17300 88930 88268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 90395 88989 gene locus_tag LOCUS_17310 90395 88989 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964308.1 protein_id gnl|my_center|LOCUS_17310 92042 90576 gene locus_tag LOCUS_17320 92042 90576 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964309.1 protein_id gnl|my_center|LOCUS_17320 94088 92502 gene locus_tag LOCUS_17330 94088 92502 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963630.1 protein_id gnl|my_center|LOCUS_17330 95877 94189 gene locus_tag LOCUS_17340 95877 94189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 97859 96276 gene locus_tag LOCUS_17350 97859 96276 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963630.1 protein_id gnl|my_center|LOCUS_17350 99610 97949 gene locus_tag LOCUS_17360 99610 97949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 101775 100189 gene locus_tag LOCUS_17370 101775 100189 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963630.1 protein_id gnl|my_center|LOCUS_17370 103624 101936 gene locus_tag LOCUS_17380 103624 101936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 105799 104213 gene locus_tag LOCUS_17390 105799 104213 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963630.1 protein_id gnl|my_center|LOCUS_17390 107428 105887 gene locus_tag LOCUS_17400 107428 105887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 >Feature sequence14 288 719 gene locus_tag LOCUS_17410 288 719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 810 1493 gene locus_tag LOCUS_17420 810 1493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000682106.1 protein_id gnl|my_center|LOCUS_17420 1522 2313 gene locus_tag LOCUS_17430 1522 2313 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962383.1 protein_id gnl|my_center|LOCUS_17430 2933 2658 gene locus_tag LOCUS_17440 gene rpmA 2933 2658 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759983.1 protein_id gnl|my_center|LOCUS_17440 3343 3038 gene locus_tag LOCUS_17450 3343 3038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 3873 4832 gene locus_tag LOCUS_17460 3873 4832 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962627.1 protein_id gnl|my_center|LOCUS_17460 5685 6299 gene locus_tag LOCUS_17470 5685 6299 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104477.1 protein_id gnl|my_center|LOCUS_17470 6304 7236 gene locus_tag LOCUS_17480 6304 7236 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209769.1 protein_id gnl|my_center|LOCUS_17480 7240 7908 gene locus_tag LOCUS_17490 7240 7908 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209768.1 protein_id gnl|my_center|LOCUS_17490 8079 9854 gene locus_tag LOCUS_17500 8079 9854 CDS product bifunctional alpha/beta hydrolase/class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174564966.1 protein_id gnl|my_center|LOCUS_17500 10234 9878 gene locus_tag LOCUS_17510 10234 9878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 10741 12009 gene locus_tag LOCUS_17520 10741 12009 CDS product phosphatase PAP2/dual specificity phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035750.1 protein_id gnl|my_center|LOCUS_17520 12012 12431 gene locus_tag LOCUS_17530 12012 12431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 13409 12960 gene locus_tag LOCUS_17540 13409 12960 CDS product RES family NAD+ phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141212.1 protein_id gnl|my_center|LOCUS_17540 14327 13872 gene locus_tag LOCUS_17550 14327 13872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 14805 15758 gene locus_tag LOCUS_17560 14805 15758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 15985 18366 gene locus_tag LOCUS_17570 15985 18366 CDS product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962626.1 protein_id gnl|my_center|LOCUS_17570 18435 19265 gene locus_tag LOCUS_17580 18435 19265 CDS product DUF3800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007485361.1 protein_id gnl|my_center|LOCUS_17580 19578 19997 gene locus_tag LOCUS_17590 19578 19997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 20388 22328 gene locus_tag LOCUS_17600 gene pcrA 20388 22328 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002457083.1 protein_id gnl|my_center|LOCUS_17600 22420 22773 gene locus_tag LOCUS_17610 22420 22773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 22848 23093 gene locus_tag LOCUS_17620 22848 23093 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391714.1 protein_id gnl|my_center|LOCUS_17620 23090 23464 gene locus_tag LOCUS_17630 23090 23464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 25046 23979 gene locus_tag LOCUS_17640 25046 23979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 25463 26218 gene locus_tag LOCUS_17650 25463 26218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 26308 26841 gene locus_tag LOCUS_17660 26308 26841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 27020 27628 gene locus_tag LOCUS_17670 27020 27628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 27702 28139 gene locus_tag LOCUS_17680 27702 28139 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928568.1 protein_id gnl|my_center|LOCUS_17680 29508 28507 gene locus_tag LOCUS_17690 29508 28507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 29781 30080 gene locus_tag LOCUS_17700 29781 30080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 31251 30211 gene locus_tag LOCUS_17710 31251 30211 CDS product RNA ligase RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000521551.1 protein_id gnl|my_center|LOCUS_17710 31412 31702 gene locus_tag LOCUS_17720 31412 31702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 32039 32719 gene locus_tag LOCUS_17730 32039 32719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 32785 32943 gene locus_tag LOCUS_17740 32785 32943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 32978 33319 gene locus_tag LOCUS_17750 32978 33319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 33958 35241 gene locus_tag LOCUS_17760 33958 35241 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005677642.1 protein_id gnl|my_center|LOCUS_17760 35272 37050 gene locus_tag LOCUS_17770 35272 37050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 37150 37290 gene locus_tag LOCUS_17780 37150 37290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 37985 37404 gene locus_tag LOCUS_17790 37985 37404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 38209 38427 gene locus_tag LOCUS_17800 38209 38427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 38438 38764 gene locus_tag LOCUS_17810 38438 38764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 38857 39411 gene locus_tag LOCUS_17820 38857 39411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 39440 39592 gene locus_tag LOCUS_17830 39440 39592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 39601 40830 gene locus_tag LOCUS_17840 39601 40830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 40960 42045 gene locus_tag LOCUS_17850 40960 42045 CDS product DUF6371 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172461658.1 protein_id gnl|my_center|LOCUS_17850 42042 42578 gene locus_tag LOCUS_17860 42042 42578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 42628 42864 gene locus_tag LOCUS_17870 42628 42864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 42891 43568 gene locus_tag LOCUS_17880 42891 43568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 43568 43801 gene locus_tag LOCUS_17890 43568 43801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 43827 44111 gene locus_tag LOCUS_17900 43827 44111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 44104 45183 gene locus_tag LOCUS_17910 44104 45183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 45251 45526 gene locus_tag LOCUS_17920 45251 45526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 45733 45569 gene locus_tag LOCUS_17930 45733 45569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 46180 45836 gene locus_tag LOCUS_17940 46180 45836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 46468 47817 gene locus_tag LOCUS_17950 46468 47817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 47916 48206 gene locus_tag LOCUS_17960 47916 48206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 48379 48305 gene locus_tag LOCUS_t00190 48379 48305 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 48916 50169 gene locus_tag LOCUS_17970 48916 50169 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964498.1 protein_id gnl|my_center|LOCUS_17970 50246 50671 gene locus_tag LOCUS_17980 50246 50671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 52173 51133 gene locus_tag LOCUS_17990 52173 51133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 53176 52388 gene locus_tag LOCUS_18000 53176 52388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 54249 53329 gene locus_tag LOCUS_18010 54249 53329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 54758 54249 gene locus_tag LOCUS_18020 54758 54249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 55584 54748 gene locus_tag LOCUS_18030 55584 54748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 56023 55586 gene locus_tag LOCUS_18040 56023 55586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 57448 56027 gene locus_tag LOCUS_18050 57448 56027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 58585 57455 gene locus_tag LOCUS_18060 58585 57455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 58895 58587 gene locus_tag LOCUS_18070 58895 58587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 59187 58882 gene locus_tag LOCUS_18080 59187 58882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 59405 59184 gene locus_tag LOCUS_18090 59405 59184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 59849 59409 gene locus_tag LOCUS_18100 59849 59409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 60850 59849 gene locus_tag LOCUS_18110 60850 59849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 61443 60847 gene locus_tag LOCUS_18120 61443 60847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 63602 61440 gene locus_tag LOCUS_18130 63602 61440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 63834 63664 gene locus_tag LOCUS_18140 63834 63664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 64208 63849 gene locus_tag LOCUS_18150 64208 63849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 64719 64297 gene locus_tag LOCUS_18160 64719 64297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 65970 64720 gene locus_tag LOCUS_18170 65970 64720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 66693 65971 gene locus_tag LOCUS_18180 66693 65971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 67241 66690 gene locus_tag LOCUS_18190 67241 66690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 67669 67247 gene locus_tag LOCUS_18200 67669 67247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 68226 67726 gene locus_tag LOCUS_18210 68226 67726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 69376 68288 gene locus_tag LOCUS_18220 69376 68288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 70485 69469 gene locus_tag LOCUS_18230 70485 69469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 70660 71127 gene locus_tag LOCUS_18240 70660 71127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 71249 72817 gene locus_tag LOCUS_18250 gene terL 71249 72817 CDS product phage terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003751157.1 protein_id gnl|my_center|LOCUS_18250 72819 73328 gene locus_tag LOCUS_18260 72819 73328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 73332 75503 gene locus_tag LOCUS_18270 73332 75503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 75503 76042 gene locus_tag LOCUS_18280 75503 76042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 76064 76321 gene locus_tag LOCUS_18290 76064 76321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 76318 76794 gene locus_tag LOCUS_18300 76318 76794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 76817 77065 gene locus_tag LOCUS_18310 76817 77065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 77435 77094 gene locus_tag LOCUS_18320 77435 77094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 77731 77456 gene locus_tag LOCUS_18330 77731 77456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 77661 77879 gene locus_tag LOCUS_18340 77661 77879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 78510 77929 gene locus_tag LOCUS_18350 78510 77929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 78821 78513 gene locus_tag LOCUS_18360 78821 78513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 79116 78841 gene locus_tag LOCUS_18370 79116 78841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 79553 79113 gene locus_tag LOCUS_18380 79553 79113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 79960 79556 gene locus_tag LOCUS_18390 79960 79556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 80217 80038 gene locus_tag LOCUS_18400 80217 80038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 80505 80302 gene locus_tag LOCUS_18410 80505 80302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 80761 80486 gene locus_tag LOCUS_18420 80761 80486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 81404 80763 gene locus_tag LOCUS_18430 81404 80763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 81845 81411 gene locus_tag LOCUS_18440 81845 81411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 82230 81850 gene locus_tag LOCUS_18450 82230 81850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 83086 82217 gene locus_tag LOCUS_18460 83086 82217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 83986 83087 gene locus_tag LOCUS_18470 83986 83087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 86189 84057 gene locus_tag LOCUS_18480 86189 84057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 86422 86192 gene locus_tag LOCUS_18490 86422 86192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 86547 87503 gene locus_tag LOCUS_18500 86547 87503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 88036 87662 gene locus_tag LOCUS_18510 88036 87662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 88714 90813 gene locus_tag LOCUS_18520 88714 90813 CDS product M13 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948307.1 protein_id gnl|my_center|LOCUS_18520 91701 91084 gene locus_tag LOCUS_18530 91701 91084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 93073 92003 gene locus_tag LOCUS_18540 93073 92003 CDS product bifunctional 3-deoxy-7-phosphoheptulonate synthase/chorismate mutase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791103.1 protein_id gnl|my_center|LOCUS_18540 94029 93184 gene locus_tag LOCUS_18550 94029 93184 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_179240768.1 protein_id gnl|my_center|LOCUS_18550 95581 94367 gene locus_tag LOCUS_18560 95581 94367 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760855.1 protein_id gnl|my_center|LOCUS_18560 96612 95674 gene locus_tag LOCUS_18570 96612 95674 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962426.1 protein_id gnl|my_center|LOCUS_18570 97911 97387 gene locus_tag LOCUS_18580 97911 97387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 >Feature sequence15 1008 247 gene locus_tag LOCUS_18590 1008 247 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368402.1 protein_id gnl|my_center|LOCUS_18590 1783 1094 gene locus_tag LOCUS_18600 1783 1094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 3400 2192 gene locus_tag LOCUS_18610 3400 2192 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963630.1 protein_id gnl|my_center|LOCUS_18610 5123 3561 gene locus_tag LOCUS_18620 5123 3561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 8331 5734 gene locus_tag LOCUS_18630 8331 5734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 9078 10079 gene locus_tag LOCUS_18640 9078 10079 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962688.1 protein_id gnl|my_center|LOCUS_18640 10125 12077 gene locus_tag LOCUS_18650 10125 12077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 12095 12706 gene locus_tag LOCUS_18660 12095 12706 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883143.1 protein_id gnl|my_center|LOCUS_18660 13240 12788 gene locus_tag LOCUS_18670 13240 12788 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704723.1 protein_id gnl|my_center|LOCUS_18670 13385 14779 gene locus_tag LOCUS_18680 13385 14779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 15837 14851 gene locus_tag LOCUS_18690 15837 14851 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011793101.1 protein_id gnl|my_center|LOCUS_18690 16219 17580 gene locus_tag LOCUS_18700 16219 17580 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721929.1 protein_id gnl|my_center|LOCUS_18700 17605 20064 gene locus_tag LOCUS_18710 17605 20064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 20286 20594 gene locus_tag LOCUS_18720 20286 20594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_18720 20649 20879 gene locus_tag LOCUS_18730 20649 20879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 21040 21867 gene locus_tag LOCUS_18740 21040 21867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 22455 22183 gene locus_tag LOCUS_18750 22455 22183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 22614 23213 gene locus_tag LOCUS_18760 22614 23213 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964444.1 protein_id gnl|my_center|LOCUS_18760 23661 24203 gene locus_tag LOCUS_18770 23661 24203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 24884 24369 gene locus_tag LOCUS_18780 24884 24369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 24995 27277 gene locus_tag LOCUS_18790 24995 27277 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963528.1 protein_id gnl|my_center|LOCUS_18790 27436 29001 gene locus_tag LOCUS_18800 27436 29001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 30067 29039 gene locus_tag LOCUS_18810 30067 29039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 30645 30100 gene locus_tag LOCUS_18820 30645 30100 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704154.1 protein_id gnl|my_center|LOCUS_18820 30896 30675 gene locus_tag LOCUS_18830 30896 30675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 31041 31114 gene locus_tag LOCUS_t00200 31041 31114 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 31301 34273 gene locus_tag LOCUS_18840 31301 34273 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058064.1 protein_id gnl|my_center|LOCUS_18840 34266 35282 gene locus_tag LOCUS_18850 34266 35282 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266508.1 protein_id gnl|my_center|LOCUS_18850 35279 36475 gene locus_tag LOCUS_18860 35279 36475 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876574.1 protein_id gnl|my_center|LOCUS_18860 36472 37527 gene locus_tag LOCUS_18870 36472 37527 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262887.1 protein_id gnl|my_center|LOCUS_18870 37557 39176 gene locus_tag LOCUS_18880 37557 39176 CDS product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058062.1 protein_id gnl|my_center|LOCUS_18880 39296 40357 gene locus_tag LOCUS_18890 39296 40357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 40727 41059 gene locus_tag LOCUS_18900 40727 41059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 42354 42767 gene locus_tag LOCUS_18910 42354 42767 CDS product DUF2147 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043223.1 protein_id gnl|my_center|LOCUS_18910 42877 43941 gene locus_tag LOCUS_18920 42877 43941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 46767 44956 gene locus_tag LOCUS_18930 46767 44956 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962713.1 protein_id gnl|my_center|LOCUS_18930 47259 47939 gene locus_tag LOCUS_18940 47259 47939 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764619.1 protein_id gnl|my_center|LOCUS_18940 47926 49110 gene locus_tag LOCUS_18950 47926 49110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 49593 49216 gene locus_tag LOCUS_18960 49593 49216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 49800 51194 gene locus_tag LOCUS_18970 gene fumC 49800 51194 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963718.1 protein_id gnl|my_center|LOCUS_18970 51457 52047 gene locus_tag LOCUS_18980 51457 52047 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962190.1 protein_id gnl|my_center|LOCUS_18980 52299 52913 gene locus_tag LOCUS_18990 52299 52913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 53088 53681 gene locus_tag LOCUS_19000 53088 53681 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962847.1 protein_id gnl|my_center|LOCUS_19000 53853 53620 gene locus_tag LOCUS_19010 53853 53620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 54706 53906 gene locus_tag LOCUS_19020 54706 53906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 55127 56137 gene locus_tag LOCUS_19030 55127 56137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 56155 56850 gene locus_tag LOCUS_19040 56155 56850 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764714.1 protein_id gnl|my_center|LOCUS_19040 58189 57143 gene locus_tag LOCUS_19050 58189 57143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 58891 58232 gene locus_tag LOCUS_19060 58891 58232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 58977 59723 gene locus_tag LOCUS_19070 58977 59723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 59758 60738 gene locus_tag LOCUS_19080 59758 60738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 60752 61873 gene locus_tag LOCUS_19090 60752 61873 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176601.1 protein_id gnl|my_center|LOCUS_19090 62008 63306 gene locus_tag LOCUS_19100 62008 63306 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212583.1 protein_id gnl|my_center|LOCUS_19100 63315 63755 gene locus_tag LOCUS_19110 63315 63755 CDS product DUF2141 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986776.1 protein_id gnl|my_center|LOCUS_19110 64513 64848 gene locus_tag LOCUS_19120 64513 64848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 64856 65266 gene locus_tag LOCUS_19130 64856 65266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 65566 65306 gene locus_tag LOCUS_19140 65566 65306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 65448 65843 gene locus_tag LOCUS_19150 65448 65843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 65933 66421 gene locus_tag LOCUS_19160 gene dinB 65933 66421 CDS product damage-inducible protein DinB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234141.1 protein_id gnl|my_center|LOCUS_19160 66794 66991 gene locus_tag LOCUS_19170 66794 66991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 66904 67368 gene locus_tag LOCUS_19180 66904 67368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19180 67365 67865 gene locus_tag LOCUS_19190 67365 67865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19190 68949 69959 gene locus_tag LOCUS_19200 68949 69959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 70174 70806 gene locus_tag LOCUS_19210 70174 70806 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964444.1 protein_id gnl|my_center|LOCUS_19210 71836 70997 gene locus_tag LOCUS_19220 71836 70997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 75108 72064 gene locus_tag LOCUS_19230 75108 72064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 75530 76513 gene locus_tag LOCUS_19240 75530 76513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 76583 77833 gene locus_tag LOCUS_19250 76583 77833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 78726 78031 gene locus_tag LOCUS_19260 78726 78031 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108487.1 protein_id gnl|my_center|LOCUS_19260 78942 79322 gene locus_tag LOCUS_19270 78942 79322 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963368.1 protein_id gnl|my_center|LOCUS_19270 79319 79690 gene locus_tag LOCUS_19280 79319 79690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962304.1 protein_id gnl|my_center|LOCUS_19280 79900 80667 gene locus_tag LOCUS_19290 79900 80667 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765510.1 protein_id gnl|my_center|LOCUS_19290 80786 84271 gene locus_tag LOCUS_19300 80786 84271 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962182.1 protein_id gnl|my_center|LOCUS_19300 84429 84875 gene locus_tag LOCUS_19310 84429 84875 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942074.1 protein_id gnl|my_center|LOCUS_19310 84882 85379 gene locus_tag LOCUS_19320 gene ybeY 84882 85379 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962183.1 protein_id gnl|my_center|LOCUS_19320 85484 86209 gene locus_tag LOCUS_19330 85484 86209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 86446 88314 gene locus_tag LOCUS_19340 gene mnmG 86446 88314 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962184.1 protein_id gnl|my_center|LOCUS_19340 88484 89389 gene locus_tag LOCUS_19350 88484 89389 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403756.1 protein_id gnl|my_center|LOCUS_19350 89654 91288 gene locus_tag LOCUS_19360 89654 91288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 >Feature sequence16 2575 2763 gene locus_tag LOCUS_19370 2575 2763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 3902 3672 gene locus_tag LOCUS_19380 3902 3672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 3787 8544 gene locus_tag LOCUS_19390 3787 8544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 9056 9649 gene locus_tag LOCUS_19400 9056 9649 CDS product HupE/UreJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962634.1 protein_id gnl|my_center|LOCUS_19400 9920 10378 gene locus_tag LOCUS_19410 9920 10378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 10375 10944 gene locus_tag LOCUS_19420 10375 10944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 10992 11222 gene locus_tag LOCUS_19430 10992 11222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 11709 11371 gene locus_tag LOCUS_19440 11709 11371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 12300 14660 gene locus_tag LOCUS_19450 12300 14660 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120545.1 protein_id gnl|my_center|LOCUS_19450 16896 15076 gene locus_tag LOCUS_19460 16896 15076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 17390 17779 gene locus_tag LOCUS_19470 17390 17779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 18641 17964 gene locus_tag LOCUS_19480 18641 17964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 19897 18638 gene locus_tag LOCUS_19490 19897 18638 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963806.1 protein_id gnl|my_center|LOCUS_19490 20939 19977 gene locus_tag LOCUS_19500 20939 19977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 21860 22378 gene locus_tag LOCUS_19510 21860 22378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 25507 22517 gene locus_tag LOCUS_19520 25507 22517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 25897 26256 gene locus_tag LOCUS_19530 25897 26256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 28434 26761 gene locus_tag LOCUS_19540 gene rny 28434 26761 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963284.1 protein_id gnl|my_center|LOCUS_19540 28871 28578 gene locus_tag LOCUS_19550 28871 28578 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963283.1 protein_id gnl|my_center|LOCUS_19550 29203 28907 gene locus_tag LOCUS_19560 29203 28907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 32390 29412 gene locus_tag LOCUS_19570 32390 29412 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073389.1 protein_id gnl|my_center|LOCUS_19570 34987 32549 gene locus_tag LOCUS_19580 gene pheT 34987 32549 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963186.1 protein_id gnl|my_center|LOCUS_19580 35912 35301 gene locus_tag LOCUS_19590 35912 35301 CDS product DUF1684 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963857.1 protein_id gnl|my_center|LOCUS_19590 36259 36888 gene locus_tag LOCUS_19600 36259 36888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 37826 37080 gene locus_tag LOCUS_19610 gene radC 37826 37080 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963482.1 protein_id gnl|my_center|LOCUS_19610 37974 39188 gene locus_tag LOCUS_19620 37974 39188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 39670 40302 gene locus_tag LOCUS_19630 39670 40302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 40385 41386 gene locus_tag LOCUS_19640 gene uvsE 40385 41386 CDS product UV DNA damage repair endonuclease UvsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000605880.1 protein_id gnl|my_center|LOCUS_19640 41475 41825 gene locus_tag LOCUS_19650 41475 41825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929043.1 protein_id gnl|my_center|LOCUS_19650 41877 42395 gene locus_tag LOCUS_19660 41877 42395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 42948 42571 gene locus_tag LOCUS_19670 42948 42571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 43076 43516 gene locus_tag LOCUS_19680 43076 43516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 43933 44499 gene locus_tag LOCUS_19690 43933 44499 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459288.1 protein_id gnl|my_center|LOCUS_19690 44489 45403 gene locus_tag LOCUS_19700 44489 45403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 45390 46226 gene locus_tag LOCUS_19710 45390 46226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 46244 47107 gene locus_tag LOCUS_19720 46244 47107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 47369 47887 gene locus_tag LOCUS_19730 47369 47887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 48076 48915 gene locus_tag LOCUS_19740 48076 48915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 49092 49859 gene locus_tag LOCUS_19750 49092 49859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 50094 50837 gene locus_tag LOCUS_19760 50094 50837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 51182 53728 gene locus_tag LOCUS_19770 51182 53728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 53786 54580 gene locus_tag LOCUS_19780 53786 54580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794237.1 protein_id gnl|my_center|LOCUS_19780 54558 54941 gene locus_tag LOCUS_19790 54558 54941 CDS product DUF3037 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817730.1 protein_id gnl|my_center|LOCUS_19790 55478 55038 gene locus_tag LOCUS_19800 55478 55038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 56361 55651 gene locus_tag LOCUS_19810 56361 55651 CDS product head GIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839368.1 protein_id gnl|my_center|LOCUS_19810 58519 56510 gene locus_tag LOCUS_19820 58519 56510 CDS product M1 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962262.1 protein_id gnl|my_center|LOCUS_19820 59806 58664 gene locus_tag LOCUS_19830 59806 58664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 60665 60351 gene locus_tag LOCUS_19840 60665 60351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 62800 60896 gene locus_tag LOCUS_19850 62800 60896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 67702 62813 gene locus_tag LOCUS_19860 67702 62813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 70836 67774 gene locus_tag LOCUS_19870 70836 67774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 72827 70842 gene locus_tag LOCUS_19880 72827 70842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 76930 74282 gene locus_tag LOCUS_19890 76930 74282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 78462 78935 gene locus_tag LOCUS_19900 78462 78935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 79472 79272 gene locus_tag LOCUS_19910 79472 79272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 80155 79786 gene locus_tag LOCUS_tm00010 80155 79786 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 80441 82498 gene locus_tag LOCUS_19920 80441 82498 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_090974988.1 protein_id gnl|my_center|LOCUS_19920 82753 85803 gene locus_tag LOCUS_19930 82753 85803 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927048.1 protein_id gnl|my_center|LOCUS_19930 85930 87195 gene locus_tag LOCUS_19940 gene icd 85930 87195 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000206898.1 protein_id gnl|my_center|LOCUS_19940 >Feature sequence17 287 787 gene locus_tag LOCUS_19950 287 787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023517651.1 protein_id gnl|my_center|LOCUS_19950 811 1674 gene locus_tag LOCUS_19960 gene gluQRS 811 1674 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115557.1 protein_id gnl|my_center|LOCUS_19960 2456 1767 gene locus_tag LOCUS_19970 gene nfi 2456 1767 CDS product deoxyribonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258210.1 protein_id gnl|my_center|LOCUS_19970 2608 3189 gene locus_tag LOCUS_19980 2608 3189 CDS product DUF1990 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889489.1 protein_id gnl|my_center|LOCUS_19980 3167 3943 gene locus_tag LOCUS_19990 3167 3943 CDS product DUF1990 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889488.1 protein_id gnl|my_center|LOCUS_19990 4686 4030 gene locus_tag LOCUS_20000 4686 4030 CDS product head GIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258992.1 protein_id gnl|my_center|LOCUS_20000 4959 4735 gene locus_tag LOCUS_20010 4959 4735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 5183 5629 gene locus_tag LOCUS_20020 5183 5629 CDS product SgcJ/EcaC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228426.1 protein_id gnl|my_center|LOCUS_20020 5652 6632 gene locus_tag LOCUS_20030 5652 6632 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963006.1 protein_id gnl|my_center|LOCUS_20030 6754 7803 gene locus_tag LOCUS_20040 6754 7803 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035287.1 protein_id gnl|my_center|LOCUS_20040 9114 8296 gene locus_tag LOCUS_20050 9114 8296 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962213.1 protein_id gnl|my_center|LOCUS_20050 9515 11989 gene locus_tag LOCUS_20060 9515 11989 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963716.1 protein_id gnl|my_center|LOCUS_20060 12902 12132 gene locus_tag LOCUS_20070 12902 12132 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838137.1 protein_id gnl|my_center|LOCUS_20070 13993 12899 gene locus_tag LOCUS_20080 13993 12899 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838136.1 protein_id gnl|my_center|LOCUS_20080 15238 14522 gene locus_tag LOCUS_20090 15238 14522 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764714.1 protein_id gnl|my_center|LOCUS_20090 16230 15271 gene locus_tag LOCUS_20100 16230 15271 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763424.1 protein_id gnl|my_center|LOCUS_20100 16410 16778 gene locus_tag LOCUS_20110 16410 16778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 16790 17683 gene locus_tag LOCUS_20120 16790 17683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 17836 19671 gene locus_tag LOCUS_20130 17836 19671 CDS product peptidase M61 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963061.1 protein_id gnl|my_center|LOCUS_20130 19675 19878 gene locus_tag LOCUS_20140 19675 19878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 19981 20922 gene locus_tag LOCUS_20150 19981 20922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 22585 21323 gene locus_tag LOCUS_20160 22585 21323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 23814 22651 gene locus_tag LOCUS_20170 23814 22651 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113715.1 protein_id gnl|my_center|LOCUS_20170 24601 25890 gene locus_tag LOCUS_20180 24601 25890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 26160 27353 gene locus_tag LOCUS_20190 26160 27353 CDS product carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760358.1 protein_id gnl|my_center|LOCUS_20190 27762 28808 gene locus_tag LOCUS_20200 27762 28808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 28973 30814 gene locus_tag LOCUS_20210 28973 30814 CDS product peptidase M61 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963061.1 protein_id gnl|my_center|LOCUS_20210 31646 32548 gene locus_tag LOCUS_20220 31646 32548 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921395.1 protein_id gnl|my_center|LOCUS_20220 32660 36340 gene locus_tag LOCUS_20230 32660 36340 CDS product M1 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103037426.1 protein_id gnl|my_center|LOCUS_20230 37445 36780 gene locus_tag LOCUS_20240 37445 36780 CDS product SdpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393576.1 protein_id gnl|my_center|LOCUS_20240 37731 37477 gene locus_tag LOCUS_20250 37731 37477 CDS product autorepressor SdpR family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393575.1 protein_id gnl|my_center|LOCUS_20250 40178 39798 gene locus_tag LOCUS_20260 40178 39798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 40858 40289 gene locus_tag LOCUS_20270 40858 40289 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080292718.1 protein_id gnl|my_center|LOCUS_20270 41135 41479 gene locus_tag LOCUS_20280 gene nuoK 41135 41479 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964311.1 protein_id gnl|my_center|LOCUS_20280 41623 43575 gene locus_tag LOCUS_20290 gene nuoL 41623 43575 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964310.1 protein_id gnl|my_center|LOCUS_20290 44175 45773 gene locus_tag LOCUS_20300 44175 45773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 46703 45984 gene locus_tag LOCUS_20310 46703 45984 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880570.1 protein_id gnl|my_center|LOCUS_20310 47383 49506 gene locus_tag LOCUS_20320 47383 49506 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479228.1 protein_id gnl|my_center|LOCUS_20320 50049 50909 gene locus_tag LOCUS_20330 50049 50909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 51596 51006 gene locus_tag LOCUS_20340 51596 51006 CDS product urea carboxylase-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390793.1 protein_id gnl|my_center|LOCUS_20340 52257 51565 gene locus_tag LOCUS_20350 gene gntA 52257 51565 CDS product guanitoxin biosynthesis heme-dependent pre-guanitoxin N-hydroxylase GntA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390792.1 protein_id gnl|my_center|LOCUS_20350 52743 53306 gene locus_tag LOCUS_20360 52743 53306 CDS product rRNA adenine N-6-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001176077.1 protein_id gnl|my_center|LOCUS_20360 54234 53320 gene locus_tag LOCUS_20370 54234 53320 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921014.1 protein_id gnl|my_center|LOCUS_20370 54532 55377 gene locus_tag LOCUS_20380 54532 55377 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061666.1 protein_id gnl|my_center|LOCUS_20380 55583 56584 gene locus_tag LOCUS_20390 55583 56584 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201934.1 protein_id gnl|my_center|LOCUS_20390 56717 57652 gene locus_tag LOCUS_20400 56717 57652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 58389 58967 gene locus_tag LOCUS_20410 58389 58967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014529501.1 protein_id gnl|my_center|LOCUS_20410 59168 59392 gene locus_tag LOCUS_20420 59168 59392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 59615 59460 gene locus_tag LOCUS_20430 59615 59460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 59654 60142 gene locus_tag LOCUS_20440 59654 60142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_20440 60215 60844 gene locus_tag LOCUS_20450 60215 60844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 61229 61471 gene locus_tag LOCUS_20460 61229 61471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 61468 61884 gene locus_tag LOCUS_20470 61468 61884 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943110.1 protein_id gnl|my_center|LOCUS_20470 61944 62246 gene locus_tag LOCUS_20480 61944 62246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 62246 62659 gene locus_tag LOCUS_20490 62246 62659 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281042.1 protein_id gnl|my_center|LOCUS_20490 63477 64232 gene locus_tag LOCUS_20500 63477 64232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 64229 65314 gene locus_tag LOCUS_20510 64229 65314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 65591 65758 gene locus_tag LOCUS_20520 65591 65758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 66102 66326 gene locus_tag LOCUS_20530 66102 66326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 66460 69075 gene locus_tag LOCUS_20540 gene clpB 66460 69075 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785772.1 protein_id gnl|my_center|LOCUS_20540 69698 69138 gene locus_tag LOCUS_20550 69698 69138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 70816 70409 gene locus_tag LOCUS_20560 70816 70409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 71103 70816 gene locus_tag LOCUS_20570 71103 70816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 72046 71453 gene locus_tag LOCUS_20580 72046 71453 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963139.1 protein_id gnl|my_center|LOCUS_20580 72149 72529 gene locus_tag LOCUS_20590 72149 72529 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000773075.1 protein_id gnl|my_center|LOCUS_20590 72844 73083 gene locus_tag LOCUS_20600 72844 73083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 74286 73345 gene locus_tag LOCUS_20610 74286 73345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 74695 75345 gene locus_tag LOCUS_20620 74695 75345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 76506 81677 gene locus_tag LOCUS_20630 76506 81677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 82364 85324 gene locus_tag LOCUS_20640 82364 85324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 <87241 85733 gene locus_tag LOCUS_20650 <87241 85733 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000892827.1:Ig-like domain-containing protein >Feature sequence18 2324 1056 gene locus_tag LOCUS_20660 2324 1056 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789791.1 protein_id gnl|my_center|LOCUS_20660 2809 2462 gene locus_tag LOCUS_20670 2809 2462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 3420 2806 gene locus_tag LOCUS_20680 3420 2806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 3822 3490 gene locus_tag LOCUS_20690 3822 3490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 6287 4080 gene locus_tag LOCUS_20700 6287 4080 CDS product RelA/SpoT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963971.1 protein_id gnl|my_center|LOCUS_20700 8454 6577 gene locus_tag LOCUS_20710 8454 6577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 8496 8939 gene locus_tag LOCUS_20720 8496 8939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 10504 9047 gene locus_tag LOCUS_20730 10504 9047 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962333.1 protein_id gnl|my_center|LOCUS_20730 12546 11785 gene locus_tag LOCUS_20740 12546 11785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 13539 14852 gene locus_tag LOCUS_20750 13539 14852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 16810 15782 gene locus_tag LOCUS_20760 16810 15782 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972679.1 protein_id gnl|my_center|LOCUS_20760 17622 17548 gene locus_tag LOCUS_t00210 17622 17548 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 17818 18477 gene locus_tag LOCUS_20770 17818 18477 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791331.1 protein_id gnl|my_center|LOCUS_20770 18440 19699 gene locus_tag LOCUS_20780 18440 19699 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933368.1 protein_id gnl|my_center|LOCUS_20780 19811 20449 gene locus_tag LOCUS_20790 19811 20449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 20696 21424 gene locus_tag LOCUS_20800 20696 21424 CDS product TIGR04283 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933083.1 protein_id gnl|my_center|LOCUS_20800 21841 22317 gene locus_tag LOCUS_20810 21841 22317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 22455 23297 gene locus_tag LOCUS_20820 22455 23297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 23774 24781 gene locus_tag LOCUS_20830 23774 24781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962741.1 protein_id gnl|my_center|LOCUS_20830 25229 25570 gene locus_tag LOCUS_20840 25229 25570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 27002 25812 gene locus_tag LOCUS_20850 27002 25812 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203214.1 protein_id gnl|my_center|LOCUS_20850 27186 29954 gene locus_tag LOCUS_20860 27186 29954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 29993 30754 gene locus_tag LOCUS_20870 29993 30754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 31094 33022 gene locus_tag LOCUS_20880 31094 33022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 33962 33195 gene locus_tag LOCUS_20890 33962 33195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 34594 34522 gene locus_tag LOCUS_t00220 34594 34522 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 34759 35268 gene locus_tag LOCUS_20900 34759 35268 CDS product organic hydroperoxide resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918800.1 protein_id gnl|my_center|LOCUS_20900 37005 35689 gene locus_tag LOCUS_20910 gene sucC 37005 35689 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963059.1 protein_id gnl|my_center|LOCUS_20910 37202 37861 gene locus_tag LOCUS_20920 37202 37861 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962793.1 protein_id gnl|my_center|LOCUS_20920 38318 39100 gene locus_tag LOCUS_20930 38318 39100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 39503 41452 gene locus_tag LOCUS_20940 39503 41452 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109026.1 protein_id gnl|my_center|LOCUS_20940 41947 41642 gene locus_tag LOCUS_20950 41947 41642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 42135 44477 gene locus_tag LOCUS_20960 42135 44477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 44844 45299 gene locus_tag LOCUS_20970 44844 45299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 45391 45693 gene locus_tag LOCUS_20980 45391 45693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 48098 45969 gene locus_tag LOCUS_20990 48098 45969 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207578.1 protein_id gnl|my_center|LOCUS_20990 50498 48597 gene locus_tag LOCUS_21000 50498 48597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 51815 51141 gene locus_tag LOCUS_21010 51815 51141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 52325 51975 gene locus_tag LOCUS_21020 52325 51975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 52964 52578 gene locus_tag LOCUS_21030 52964 52578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 53122 54255 gene locus_tag LOCUS_21040 gene hppD 53122 54255 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962402.1 protein_id gnl|my_center|LOCUS_21040 54755 56812 gene locus_tag LOCUS_21050 54755 56812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 57225 58961 gene locus_tag LOCUS_21060 57225 58961 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786230.1 protein_id gnl|my_center|LOCUS_21060 59997 60425 gene locus_tag LOCUS_21070 59997 60425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 62128 60440 gene locus_tag LOCUS_21080 62128 60440 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545510.1 protein_id gnl|my_center|LOCUS_21080 62831 62349 gene locus_tag LOCUS_21090 62831 62349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 64178 63204 gene locus_tag LOCUS_21100 64178 63204 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189844.1 protein_id gnl|my_center|LOCUS_21100 65616 64471 gene locus_tag LOCUS_21110 65616 64471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 66417 65749 gene locus_tag LOCUS_21120 66417 65749 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788686.1 protein_id gnl|my_center|LOCUS_21120 67731 66709 gene locus_tag LOCUS_21130 67731 66709 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107514.1 protein_id gnl|my_center|LOCUS_21130 68402 67842 gene locus_tag LOCUS_21140 68402 67842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 69642 68719 gene locus_tag LOCUS_21150 69642 68719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 70537 69635 gene locus_tag LOCUS_21160 70537 69635 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330235.1 protein_id gnl|my_center|LOCUS_21160 70574 70969 gene locus_tag LOCUS_21170 70574 70969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 71596 71252 gene locus_tag LOCUS_21180 71596 71252 CDS product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006316382.1 protein_id gnl|my_center|LOCUS_21180 72280 71624 gene locus_tag LOCUS_21190 72280 71624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 73690 72329 gene locus_tag LOCUS_21200 73690 72329 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762738.1 protein_id gnl|my_center|LOCUS_21200 74914 74027 gene locus_tag LOCUS_21210 gene egtD 74914 74027 CDS product L-histidine N(alpha)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731156.1 protein_id gnl|my_center|LOCUS_21210 76446 75109 gene locus_tag LOCUS_21220 gene egtB 76446 75109 CDS product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812990.1 protein_id gnl|my_center|LOCUS_21220 76735 77004 gene locus_tag LOCUS_21230 76735 77004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 77045 78112 gene locus_tag LOCUS_21240 77045 78112 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766782.1 protein_id gnl|my_center|LOCUS_21240 78203 79453 gene locus_tag LOCUS_21250 78203 79453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 79513 79890 gene locus_tag LOCUS_21260 79513 79890 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144314.1 protein_id gnl|my_center|LOCUS_21260 80881 80339 gene locus_tag LOCUS_21270 80881 80339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 81159 81452 gene locus_tag LOCUS_21280 81159 81452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 <83172 81658 gene locus_tag LOCUS_21290 <83172 81658 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007332588.1:SdrD B-like domain-containing protein >Feature sequence19 928 230 gene locus_tag LOCUS_21300 928 230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 2337 928 gene locus_tag LOCUS_21310 2337 928 CDS product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963483.1 protein_id gnl|my_center|LOCUS_21310 2634 5276 gene locus_tag LOCUS_21320 gene dnaB 2634 5276 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_098061311.1 protein_id gnl|my_center|LOCUS_21320 5280 5726 gene locus_tag LOCUS_21330 5280 5726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 6771 6055 gene locus_tag LOCUS_21340 6771 6055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 6869 7642 gene locus_tag LOCUS_21350 6869 7642 CDS product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994212.1 protein_id gnl|my_center|LOCUS_21350 8878 7679 gene locus_tag LOCUS_21360 8878 7679 CDS product PepSY-associated TM helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964539.1 protein_id gnl|my_center|LOCUS_21360 11406 8908 gene locus_tag LOCUS_21370 11406 8908 CDS product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964026.1 protein_id gnl|my_center|LOCUS_21370 12856 11984 gene locus_tag LOCUS_21380 12856 11984 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790194.1 protein_id gnl|my_center|LOCUS_21380 12966 13922 gene locus_tag LOCUS_21390 12966 13922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 15073 14561 gene locus_tag LOCUS_21400 15073 14561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 15257 16300 gene locus_tag LOCUS_21410 15257 16300 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123665.1 protein_id gnl|my_center|LOCUS_21410 16766 16608 gene locus_tag LOCUS_21420 16766 16608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 17385 16870 gene locus_tag LOCUS_21430 17385 16870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 17713 17378 gene locus_tag LOCUS_21440 17713 17378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 18295 17720 gene locus_tag LOCUS_21450 18295 17720 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931970.1 protein_id gnl|my_center|LOCUS_21450 18546 19097 gene locus_tag LOCUS_21460 18546 19097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 20527 19646 gene locus_tag LOCUS_21470 20527 19646 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403240.1 protein_id gnl|my_center|LOCUS_21470 21554 20640 gene locus_tag LOCUS_21480 21554 20640 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258724.1 protein_id gnl|my_center|LOCUS_21480 22707 21796 gene locus_tag LOCUS_21490 22707 21796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 23129 23593 gene locus_tag LOCUS_21500 23129 23593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963109.1 protein_id gnl|my_center|LOCUS_21500 23749 24264 gene locus_tag LOCUS_21510 23749 24264 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350905.1 protein_id gnl|my_center|LOCUS_21510 24544 28359 gene locus_tag LOCUS_21520 24544 28359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 29996 28596 gene locus_tag LOCUS_21530 29996 28596 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887075.1 protein_id gnl|my_center|LOCUS_21530 31505 30105 gene locus_tag LOCUS_21540 31505 30105 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202983.1 protein_id gnl|my_center|LOCUS_21540 33151 31862 gene locus_tag LOCUS_21550 33151 31862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 33562 33491 gene locus_tag LOCUS_t00230 33562 33491 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 34927 34076 gene locus_tag LOCUS_21560 34927 34076 CDS product TIGR02452 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010884064.1 protein_id gnl|my_center|LOCUS_21560 36730 35204 gene locus_tag LOCUS_21570 36730 35204 CDS product TROVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062695913.1 protein_id gnl|my_center|LOCUS_21570 37951 36788 gene locus_tag LOCUS_21580 37951 36788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 38968 39870 gene locus_tag LOCUS_21590 38968 39870 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257729.1 protein_id gnl|my_center|LOCUS_21590 39916 40938 gene locus_tag LOCUS_21600 39916 40938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 42205 41279 gene locus_tag LOCUS_21610 42205 41279 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975727.1 protein_id gnl|my_center|LOCUS_21610 42881 42279 gene locus_tag LOCUS_21620 42881 42279 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957824.1 protein_id gnl|my_center|LOCUS_21620 43732 43010 gene locus_tag LOCUS_21630 43732 43010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 44045 44932 gene locus_tag LOCUS_21640 44045 44932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 46387 45074 gene locus_tag LOCUS_21650 gene argH 46387 45074 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784384.1 protein_id gnl|my_center|LOCUS_21650 47643 46555 gene locus_tag LOCUS_21660 47643 46555 CDS product M20 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201961.1 protein_id gnl|my_center|LOCUS_21660 48413 47631 gene locus_tag LOCUS_21670 gene argB 48413 47631 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767599.1 protein_id gnl|my_center|LOCUS_21670 48824 49426 gene locus_tag LOCUS_21680 48824 49426 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784400.1 protein_id gnl|my_center|LOCUS_21680 49423 50613 gene locus_tag LOCUS_21690 49423 50613 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762697.1 protein_id gnl|my_center|LOCUS_21690 50603 51583 gene locus_tag LOCUS_21700 gene argC 50603 51583 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762696.1 protein_id gnl|my_center|LOCUS_21700 51651 52910 gene locus_tag LOCUS_21710 51651 52910 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202045.1 protein_id gnl|my_center|LOCUS_21710 53171 54127 gene locus_tag LOCUS_21720 53171 54127 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202024.1 protein_id gnl|my_center|LOCUS_21720 55789 54374 gene locus_tag LOCUS_21730 55789 54374 CDS product DUF4041 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000195116.1 protein_id gnl|my_center|LOCUS_21730 56249 55797 gene locus_tag LOCUS_21740 56249 55797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 56697 56254 gene locus_tag LOCUS_21750 56697 56254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 57665 57240 gene locus_tag LOCUS_21760 57665 57240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 58387 57866 gene locus_tag LOCUS_21770 58387 57866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 58771 58421 gene locus_tag LOCUS_21780 58771 58421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 59679 59921 gene locus_tag LOCUS_21790 59679 59921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 60889 60452 gene locus_tag LOCUS_21800 60889 60452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 61075 61000 gene locus_tag LOCUS_t00240 61075 61000 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 61193 61918 gene locus_tag LOCUS_21810 61193 61918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 62033 62857 gene locus_tag LOCUS_21820 62033 62857 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143074.1 protein_id gnl|my_center|LOCUS_21820 62955 63653 gene locus_tag LOCUS_21830 62955 63653 CDS product DUF2461 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071744.1 protein_id gnl|my_center|LOCUS_21830 64617 63994 gene locus_tag LOCUS_21840 64617 63994 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962436.1 protein_id gnl|my_center|LOCUS_21840 64742 65170 gene locus_tag LOCUS_21850 64742 65170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 65548 65264 gene locus_tag LOCUS_21860 65548 65264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 65868 66395 gene locus_tag LOCUS_21870 65868 66395 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202944.1 protein_id gnl|my_center|LOCUS_21870 66818 67045 gene locus_tag LOCUS_21880 66818 67045 CDS product CDGSH iron-sulfur domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070876731.1 protein_id gnl|my_center|LOCUS_21880 68376 67342 gene locus_tag LOCUS_21890 68376 67342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 68728 68477 gene locus_tag LOCUS_21900 68728 68477 CDS product acyl-CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886812.1 protein_id gnl|my_center|LOCUS_21900 69005 70303 gene locus_tag LOCUS_21910 69005 70303 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639931.1 protein_id gnl|my_center|LOCUS_21910 70452 71783 gene locus_tag LOCUS_21920 gene steT 70452 71783 CDS product serine/threonine exchanger inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244819.1 protein_id gnl|my_center|LOCUS_21920 71847 72404 gene locus_tag LOCUS_21930 71847 72404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 72675 72983 gene locus_tag LOCUS_21940 72675 72983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 73235 74419 gene locus_tag LOCUS_21950 73235 74419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 >Feature sequence20 222 1013 gene locus_tag LOCUS_21960 222 1013 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962230.1 protein_id gnl|my_center|LOCUS_21960 1119 2615 gene locus_tag LOCUS_21970 1119 2615 CDS product polysaccharide biosynthesis C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964538.1 protein_id gnl|my_center|LOCUS_21970 4194 2677 gene locus_tag LOCUS_21980 4194 2677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 4380 4814 gene locus_tag LOCUS_21990 gene dut 4380 4814 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767650.1 protein_id gnl|my_center|LOCUS_21990 4972 5964 gene locus_tag LOCUS_22000 4972 5964 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964536.1 protein_id gnl|my_center|LOCUS_22000 6007 7914 gene locus_tag LOCUS_22010 6007 7914 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108843.1 protein_id gnl|my_center|LOCUS_22010 7907 8713 gene locus_tag LOCUS_22020 7907 8713 CDS product DUF4292 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964528.1 protein_id gnl|my_center|LOCUS_22020 8737 10269 gene locus_tag LOCUS_22030 8737 10269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 11593 10649 gene locus_tag LOCUS_22040 11593 10649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 11868 12185 gene locus_tag LOCUS_22050 11868 12185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 12201 12680 gene locus_tag LOCUS_22060 12201 12680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 12747 14132 gene locus_tag LOCUS_22070 gene gatA 12747 14132 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931960.1 protein_id gnl|my_center|LOCUS_22070 14762 16900 gene locus_tag LOCUS_22080 14762 16900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 17071 19341 gene locus_tag LOCUS_22090 17071 19341 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964222.1 protein_id gnl|my_center|LOCUS_22090 19607 20212 gene locus_tag LOCUS_22100 gene ruvA 19607 20212 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964221.1 protein_id gnl|my_center|LOCUS_22100 20454 27935 gene locus_tag LOCUS_22110 gene sprA 20454 27935 CDS product cell surface protein SprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_100614127.1 protein_id gnl|my_center|LOCUS_22110 28078 28458 gene locus_tag LOCUS_22120 gene gcvH 28078 28458 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964219.1 protein_id gnl|my_center|LOCUS_22120 28488 30239 gene locus_tag LOCUS_22130 28488 30239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 32389 30500 gene locus_tag LOCUS_22140 32389 30500 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531013.1 protein_id gnl|my_center|LOCUS_22140 32759 33070 gene locus_tag LOCUS_22150 32759 33070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 33749 33213 gene locus_tag LOCUS_22160 33749 33213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 34948 34049 gene locus_tag LOCUS_22170 34948 34049 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761103.1 protein_id gnl|my_center|LOCUS_22170 35502 36344 gene locus_tag LOCUS_22180 35502 36344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 36564 37802 gene locus_tag LOCUS_22190 36564 37802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 37837 39117 gene locus_tag LOCUS_22200 37837 39117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 39333 40010 gene locus_tag LOCUS_22210 39333 40010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 41535 40510 gene locus_tag LOCUS_22220 41535 40510 CDS product M28 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797516.1 protein_id gnl|my_center|LOCUS_22220 43216 41660 gene locus_tag LOCUS_22230 gene cysS 43216 41660 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291350.1 protein_id gnl|my_center|LOCUS_22230 44457 43282 gene locus_tag LOCUS_22240 44457 43282 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108504.1 protein_id gnl|my_center|LOCUS_22240 44710 48258 gene locus_tag LOCUS_22250 44710 48258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 48434 52474 gene locus_tag LOCUS_22260 48434 52474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 53560 52652 gene locus_tag LOCUS_22270 53560 52652 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162179062.1 protein_id gnl|my_center|LOCUS_22270 54004 55572 gene locus_tag LOCUS_22280 54004 55572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 55606 56841 gene locus_tag LOCUS_22290 55606 56841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 58178 56919 gene locus_tag LOCUS_22300 58178 56919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 59455 58430 gene locus_tag LOCUS_22310 gene metX 59455 58430 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932292.1 protein_id gnl|my_center|LOCUS_22310 60948 59569 gene locus_tag LOCUS_22320 60948 59569 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932291.1 protein_id gnl|my_center|LOCUS_22320 61651 60992 gene locus_tag LOCUS_22330 61651 60992 CDS product peroxiredoxin-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940744.1 protein_id gnl|my_center|LOCUS_22330 62886 62542 gene locus_tag LOCUS_22340 62886 62542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 63019 63438 gene locus_tag LOCUS_22350 63019 63438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 64701 63613 gene locus_tag LOCUS_22360 64701 63613 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555792.1 protein_id gnl|my_center|LOCUS_22360 67815 64870 gene locus_tag LOCUS_22370 67815 64870 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784143.1 protein_id gnl|my_center|LOCUS_22370 >Feature sequence21 2106 2801 gene locus_tag LOCUS_22380 2106 2801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 3230 3925 gene locus_tag LOCUS_22390 3230 3925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 6958 4283 gene locus_tag LOCUS_22400 6958 4283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 7532 8749 gene locus_tag LOCUS_22410 7532 8749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 10114 8954 gene locus_tag LOCUS_22420 10114 8954 CDS product zinc-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272517.1 protein_id gnl|my_center|LOCUS_22420 11023 10220 gene locus_tag LOCUS_22430 11023 10220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 11936 11154 gene locus_tag LOCUS_22440 11936 11154 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964460.1 protein_id gnl|my_center|LOCUS_22440 12813 12169 gene locus_tag LOCUS_22450 12813 12169 CDS product lactate utilization protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192015.1 protein_id gnl|my_center|LOCUS_22450 15369 13237 gene locus_tag LOCUS_22460 gene ftsH 15369 13237 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962764.1 protein_id gnl|my_center|LOCUS_22460 15797 15477 gene locus_tag LOCUS_22470 gene rsfS 15797 15477 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962763.1 protein_id gnl|my_center|LOCUS_22470 15880 16683 gene locus_tag LOCUS_22480 15880 16683 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769390.1 protein_id gnl|my_center|LOCUS_22480 17281 17592 gene locus_tag LOCUS_22490 17281 17592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 17870 20878 gene locus_tag LOCUS_22500 17870 20878 CDS product DUF2723 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765759.1 protein_id gnl|my_center|LOCUS_22500 21140 20937 gene locus_tag LOCUS_22510 21140 20937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 21399 21058 gene locus_tag LOCUS_22520 21399 21058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 21607 21392 gene locus_tag LOCUS_22530 21607 21392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 21790 23082 gene locus_tag LOCUS_22540 21790 23082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 23019 24092 gene locus_tag LOCUS_22550 23019 24092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 25358 24276 gene locus_tag LOCUS_22560 25358 24276 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791384.1 protein_id gnl|my_center|LOCUS_22560 26549 25536 gene locus_tag LOCUS_22570 26549 25536 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034099197.1 protein_id gnl|my_center|LOCUS_22570 26853 29057 gene locus_tag LOCUS_22580 gene recQ 26853 29057 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764112.1 protein_id gnl|my_center|LOCUS_22580 29571 29143 gene locus_tag LOCUS_22590 29571 29143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 30274 29852 gene locus_tag LOCUS_22600 30274 29852 CDS product BrxA/BrxB family bacilliredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962234.1 protein_id gnl|my_center|LOCUS_22600 30806 30501 gene locus_tag LOCUS_22610 30806 30501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 30781 31785 gene locus_tag LOCUS_22620 30781 31785 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210802.1 protein_id gnl|my_center|LOCUS_22620 31773 33344 gene locus_tag LOCUS_22630 31773 33344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 33446 33979 gene locus_tag LOCUS_22640 33446 33979 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037898.1 protein_id gnl|my_center|LOCUS_22640 34250 35788 gene locus_tag LOCUS_22650 34250 35788 CDS product NCS1 family nucleobase:cation symporter-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920205.1 protein_id gnl|my_center|LOCUS_22650 35797 36156 gene locus_tag LOCUS_22660 35797 36156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 36165 36650 gene locus_tag LOCUS_22670 gene msrB 36165 36650 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000935885.1 protein_id gnl|my_center|LOCUS_22670 38386 36935 gene locus_tag LOCUS_22680 38386 36935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 38710 41259 gene locus_tag LOCUS_22690 gene uvrA 38710 41259 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349876.1 protein_id gnl|my_center|LOCUS_22690 41820 44828 gene locus_tag LOCUS_22700 41820 44828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 46630 45173 gene locus_tag LOCUS_22710 46630 45173 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405092.1 protein_id gnl|my_center|LOCUS_22710 47241 47789 gene locus_tag LOCUS_22720 47241 47789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 48099 49403 gene locus_tag LOCUS_22730 48099 49403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 50833 51393 gene locus_tag LOCUS_22740 50833 51393 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529609.1 protein_id gnl|my_center|LOCUS_22740 51672 52955 gene locus_tag LOCUS_22750 51672 52955 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776724.1 protein_id gnl|my_center|LOCUS_22750 52999 53916 gene locus_tag LOCUS_22760 52999 53916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 54788 54183 gene locus_tag LOCUS_22770 54788 54183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 55166 54903 gene locus_tag LOCUS_22780 55166 54903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 55618 58104 gene locus_tag LOCUS_22790 55618 58104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 58243 58467 gene locus_tag LOCUS_22800 58243 58467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 58709 60178 gene locus_tag LOCUS_22810 58709 60178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 60364 61401 gene locus_tag LOCUS_22820 60364 61401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 61409 62197 gene locus_tag LOCUS_22830 61409 62197 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963759.1 protein_id gnl|my_center|LOCUS_22830 62403 63140 gene locus_tag LOCUS_22840 62403 63140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 64057 64524 gene locus_tag LOCUS_22850 64057 64524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 64824 65291 gene locus_tag LOCUS_22860 64824 65291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 65556 66023 gene locus_tag LOCUS_22870 65556 66023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 67412 66192 gene locus_tag LOCUS_22880 gene lysA 67412 66192 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876948.1 protein_id gnl|my_center|LOCUS_22880 >Feature sequence22 410 21 gene locus_tag LOCUS_22890 410 21 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 1484 489 gene locus_tag LOCUS_22900 gene waaC 1484 489 CDS product lipopolysaccharide heptosyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942882.1 protein_id gnl|my_center|LOCUS_22900 2170 1703 gene locus_tag LOCUS_22910 2170 1703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 2626 2270 gene locus_tag LOCUS_22920 2626 2270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 4438 3098 gene locus_tag LOCUS_22930 gene purB 4438 3098 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760796.1 protein_id gnl|my_center|LOCUS_22930 4572 6725 gene locus_tag LOCUS_22940 4572 6725 CDS product biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962279.1 protein_id gnl|my_center|LOCUS_22940 7686 6919 gene locus_tag LOCUS_22950 7686 6919 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203156.1 protein_id gnl|my_center|LOCUS_22950 9109 7781 gene locus_tag LOCUS_22960 gene hemG 9109 7781 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403969.1 protein_id gnl|my_center|LOCUS_22960 9125 9706 gene locus_tag LOCUS_22970 9125 9706 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870429.1 protein_id gnl|my_center|LOCUS_22970 11933 10539 gene locus_tag LOCUS_22980 11933 10539 CDS product decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963818.1 protein_id gnl|my_center|LOCUS_22980 12250 13224 gene locus_tag LOCUS_22990 gene rocF 12250 13224 CDS product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226959.1 protein_id gnl|my_center|LOCUS_22990 15671 13359 gene locus_tag LOCUS_23000 15671 13359 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196252.1 protein_id gnl|my_center|LOCUS_23000 17560 16409 gene locus_tag LOCUS_23010 17560 16409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946837.1 protein_id gnl|my_center|LOCUS_23010 18003 18599 gene locus_tag LOCUS_23020 18003 18599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 18771 20606 gene locus_tag LOCUS_23030 gene argS 18771 20606 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797416.1 protein_id gnl|my_center|LOCUS_23030 20694 21275 gene locus_tag LOCUS_23040 20694 21275 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109460.1 protein_id gnl|my_center|LOCUS_23040 21558 22130 gene locus_tag LOCUS_23050 21558 22130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 22315 23208 gene locus_tag LOCUS_23060 gene menA 22315 23208 CDS product 1,4-dihydroxy-2-naphthoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649448.1 protein_id gnl|my_center|LOCUS_23060 25022 23334 gene locus_tag LOCUS_23070 25022 23334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 25523 26260 gene locus_tag LOCUS_23080 25523 26260 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943419.1 protein_id gnl|my_center|LOCUS_23080 27170 26613 gene locus_tag LOCUS_23090 27170 26613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 27424 27705 gene locus_tag LOCUS_23100 27424 27705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 27805 28419 gene locus_tag LOCUS_23110 gene recR 27805 28419 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763508.1 protein_id gnl|my_center|LOCUS_23110 28636 30654 gene locus_tag LOCUS_23120 28636 30654 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020404386.1 protein_id gnl|my_center|LOCUS_23120 30891 32111 gene locus_tag LOCUS_23130 30891 32111 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796424.1 protein_id gnl|my_center|LOCUS_23130 32201 33202 gene locus_tag LOCUS_23140 gene rfaE1 32201 33202 CDS product D-glycero-beta-D-manno-heptose-7-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932840.1 protein_id gnl|my_center|LOCUS_23140 33292 33852 gene locus_tag LOCUS_23150 33292 33852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150 36145 34235 gene locus_tag LOCUS_23160 36145 34235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 36505 36266 gene locus_tag LOCUS_23170 36505 36266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 37023 36607 gene locus_tag LOCUS_23180 37023 36607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23180 37219 37037 gene locus_tag LOCUS_23190 37219 37037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23190 38658 37633 gene locus_tag LOCUS_23200 gene hemE 38658 37633 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962222.1 protein_id gnl|my_center|LOCUS_23200 41186 38763 gene locus_tag LOCUS_23210 41186 38763 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963986.1 protein_id gnl|my_center|LOCUS_23210 41890 41459 gene locus_tag LOCUS_23220 41890 41459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 42644 42024 gene locus_tag LOCUS_23230 42644 42024 CDS product MarC family NAAT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963435.1 protein_id gnl|my_center|LOCUS_23230 42765 43337 gene locus_tag LOCUS_23240 gene purE 42765 43337 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249787.1 protein_id gnl|my_center|LOCUS_23240 43355 44476 gene locus_tag LOCUS_23250 43355 44476 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208292.1 protein_id gnl|my_center|LOCUS_23250 46757 44814 gene locus_tag LOCUS_23260 gene dnaK 46757 44814 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963020.1 protein_id gnl|my_center|LOCUS_23260 49987 47249 gene locus_tag LOCUS_23270 49987 47249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 50699 51295 gene locus_tag LOCUS_23280 50699 51295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23280 51401 52159 gene locus_tag LOCUS_23290 51401 52159 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070651736.1 protein_id gnl|my_center|LOCUS_23290 53272 52277 gene locus_tag LOCUS_23300 53272 52277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 54897 53308 gene locus_tag LOCUS_23310 54897 53308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 55730 55125 gene locus_tag LOCUS_23320 55730 55125 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114324.1 protein_id gnl|my_center|LOCUS_23320 56171 55866 gene locus_tag LOCUS_23330 56171 55866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23330 57052 56171 gene locus_tag LOCUS_23340 57052 56171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_23340 57738 57049 gene locus_tag LOCUS_23350 57738 57049 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965313.1 protein_id gnl|my_center|LOCUS_23350 60184 58103 gene locus_tag LOCUS_23360 60184 58103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404150.1 protein_id gnl|my_center|LOCUS_23360 60662 60240 gene locus_tag LOCUS_23370 60662 60240 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680561.1 protein_id gnl|my_center|LOCUS_23370 60907 60659 gene locus_tag LOCUS_23380 60907 60659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 61657 60983 gene locus_tag LOCUS_23390 61657 60983 CDS product YiiX family permuted papain-like enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000797352.1 protein_id gnl|my_center|LOCUS_23390 62190 61654 gene locus_tag LOCUS_23400 62190 61654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 62333 63103 gene locus_tag LOCUS_23410 62333 63103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 63879 63130 gene locus_tag LOCUS_23420 gene fabG 63879 63130 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963112.1 protein_id gnl|my_center|LOCUS_23420 63878 65254 gene locus_tag LOCUS_23430 63878 65254 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974386.1 protein_id gnl|my_center|LOCUS_23430 65354 66061 gene locus_tag LOCUS_23440 65354 66061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 67163 66465 gene locus_tag LOCUS_23450 67163 66465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 67876 67559 gene locus_tag LOCUS_23460 67876 67559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23460 68479 69873 gene locus_tag LOCUS_23470 gene lpdA 68479 69873 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962865.1 protein_id gnl|my_center|LOCUS_23470 71688 70159 gene locus_tag LOCUS_23480 71688 70159 CDS product malate:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963862.1 protein_id gnl|my_center|LOCUS_23480 71875 72960 gene locus_tag LOCUS_23490 71875 72960 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765045.1 protein_id gnl|my_center|LOCUS_23490 73132 73220 gene locus_tag LOCUS_t00250 73132 73220 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 73529 74947 gene locus_tag LOCUS_23500 73529 74947 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963825.1 protein_id gnl|my_center|LOCUS_23500 75018 75536 gene locus_tag LOCUS_23510 75018 75536 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399152.1 protein_id gnl|my_center|LOCUS_23510 77293 75626 gene locus_tag LOCUS_23520 77293 75626 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838626.1 protein_id gnl|my_center|LOCUS_23520 78247 77477 gene locus_tag LOCUS_23530 78247 77477 CDS product AMP nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761555.1 protein_id gnl|my_center|LOCUS_23530 78410 78871 gene locus_tag LOCUS_23540 78410 78871 CDS product type I restriction enzyme HsdR N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103016387.1 protein_id gnl|my_center|LOCUS_23540 79253 78990 gene locus_tag LOCUS_23550 79253 78990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 81535 79631 gene locus_tag LOCUS_23560 81535 79631 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303156.1 protein_id gnl|my_center|LOCUS_23560 82587 81913 gene locus_tag LOCUS_23570 82587 81913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 84645 83518 gene locus_tag LOCUS_23580 gene ald 84645 83518 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795308.1 protein_id gnl|my_center|LOCUS_23580 85317 84799 gene locus_tag LOCUS_23590 85317 84799 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083839.1 protein_id gnl|my_center|LOCUS_23590 86222 85452 gene locus_tag LOCUS_23600 86222 85452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 86460 88883 gene locus_tag LOCUS_23610 86460 88883 CDS product alpha-ketoacid dehydrogenase subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962878.1 protein_id gnl|my_center|LOCUS_23610 89531 88968 gene locus_tag LOCUS_23620 89531 88968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23620 89664 90665 gene locus_tag LOCUS_23630 89664 90665 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034097278.1 protein_id gnl|my_center|LOCUS_23630 91963 90800 gene locus_tag LOCUS_23640 91963 90800 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962827.1 protein_id gnl|my_center|LOCUS_23640 93595 92672 gene locus_tag LOCUS_23650 93595 92672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 95494 93629 gene locus_tag LOCUS_23660 95494 93629 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086595297.1 protein_id gnl|my_center|LOCUS_23660 96768 95563 gene locus_tag LOCUS_23670 96768 95563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23670 97994 97044 gene locus_tag LOCUS_23680 97994 97044 CDS product DUF2279 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963344.1 protein_id gnl|my_center|LOCUS_23680 98170 100983 gene locus_tag LOCUS_23690 98170 100983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 101906 101061 gene locus_tag LOCUS_23700 101906 101061 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767088.1 protein_id gnl|my_center|LOCUS_23700 102154 103242 gene locus_tag LOCUS_23710 102154 103242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 103672 104007 gene locus_tag LOCUS_23720 103672 104007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 105324 104455 gene locus_tag LOCUS_23730 105324 104455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 105840 105334 gene locus_tag LOCUS_23740 105840 105334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 107322 105931 gene locus_tag LOCUS_23750 107322 105931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 110521 107357 gene locus_tag LOCUS_23760 110521 107357 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_185958394.1 protein_id gnl|my_center|LOCUS_23760 111279 111983 gene locus_tag LOCUS_23770 111279 111983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 111995 113194 gene locus_tag LOCUS_23780 111995 113194 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249477.1 protein_id gnl|my_center|LOCUS_23780 113655 113221 gene locus_tag LOCUS_23790 113655 113221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 113928 115379 gene locus_tag LOCUS_23800 113928 115379 CDS product anthranilate synthase component I family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962677.1 protein_id gnl|my_center|LOCUS_23800 115419 115988 gene locus_tag LOCUS_23810 115419 115988 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962676.1 protein_id gnl|my_center|LOCUS_23810 116094 117092 gene locus_tag LOCUS_23820 gene trpD 116094 117092 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803789.1 protein_id gnl|my_center|LOCUS_23820 117202 118020 gene locus_tag LOCUS_23830 gene trpC 117202 118020 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962674.1 protein_id gnl|my_center|LOCUS_23830 118020 118742 gene locus_tag LOCUS_23840 118020 118742 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202963.1 protein_id gnl|my_center|LOCUS_23840 118814 120013 gene locus_tag LOCUS_23850 gene trpB 118814 120013 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962672.1 protein_id gnl|my_center|LOCUS_23850 120130 120927 gene locus_tag LOCUS_23860 gene trpA 120130 120927 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962671.1 protein_id gnl|my_center|LOCUS_23860 121047 122024 gene locus_tag LOCUS_23870 gene aroF 121047 122024 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546648.1 protein_id gnl|my_center|LOCUS_23870 122282 122998 gene locus_tag LOCUS_23880 gene phhA 122282 122998 CDS product phenylalanine 4-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528486.1 protein_id gnl|my_center|LOCUS_23880 123095 124348 gene locus_tag LOCUS_23890 123095 124348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 124445 125140 gene locus_tag LOCUS_23900 124445 125140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 125674 125204 gene locus_tag LOCUS_23910 125674 125204 CDS product DUF962 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843542.1 protein_id gnl|my_center|LOCUS_23910 126661 125789 gene locus_tag LOCUS_23920 126661 125789 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839117.1 protein_id gnl|my_center|LOCUS_23920 127247 126702 gene locus_tag LOCUS_23930 127247 126702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 128518 127328 gene locus_tag LOCUS_23940 128518 127328 CDS product serpin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141968.1 protein_id gnl|my_center|LOCUS_23940 130382 129078 gene locus_tag LOCUS_23950 130382 129078 CDS product AarF/UbiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963623.1 protein_id gnl|my_center|LOCUS_23950 131330 130479 gene locus_tag LOCUS_23960 131330 130479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 132655 131330 gene locus_tag LOCUS_23970 132655 131330 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963159.1 protein_id gnl|my_center|LOCUS_23970 133604 132888 gene locus_tag LOCUS_23980 133604 132888 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963158.1 protein_id gnl|my_center|LOCUS_23980 134161 133529 gene locus_tag LOCUS_23990 134161 133529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23990 134420 137860 gene locus_tag LOCUS_24000 134420 137860 CDS product pyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943065.1 protein_id gnl|my_center|LOCUS_24000 138156 139085 gene locus_tag LOCUS_24010 138156 139085 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076053070.1 protein_id gnl|my_center|LOCUS_24010 139492 140838 gene locus_tag LOCUS_24020 139492 140838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 144610 141092 gene locus_tag LOCUS_24030 144610 141092 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962336.1 protein_id gnl|my_center|LOCUS_24030 145026 144667 gene locus_tag LOCUS_24040 145026 144667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 145551 145138 gene locus_tag LOCUS_24050 145551 145138 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986893.1 protein_id gnl|my_center|LOCUS_24050 145708 145902 gene locus_tag LOCUS_24060 145708 145902 CDS product cold shock domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962450.1 protein_id gnl|my_center|LOCUS_24060 146564 148558 gene locus_tag LOCUS_24070 146564 148558 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437464.1 protein_id gnl|my_center|LOCUS_24070 149141 148695 gene locus_tag LOCUS_24080 149141 148695 CDS product PA2169 family four-helix-bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113661.1 protein_id gnl|my_center|LOCUS_24080 150665 149397 gene locus_tag LOCUS_24090 150665 149397 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056989.1 protein_id gnl|my_center|LOCUS_24090 151490 150702 gene locus_tag LOCUS_24100 151490 150702 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887478.1 protein_id gnl|my_center|LOCUS_24100 151396 151584 gene locus_tag LOCUS_24110 151396 151584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24110 151843 152715 gene locus_tag LOCUS_24120 151843 152715 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034097527.1 protein_id gnl|my_center|LOCUS_24120 153803 152934 gene locus_tag LOCUS_24130 153803 152934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 154166 153867 gene locus_tag LOCUS_24140 154166 153867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 154944 154345 gene locus_tag LOCUS_24150 154944 154345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 155525 155007 gene locus_tag LOCUS_24160 155525 155007 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724156.1 protein_id gnl|my_center|LOCUS_24160 156522 155866 gene locus_tag LOCUS_24170 156522 155866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 158107 156917 gene locus_tag LOCUS_24180 158107 156917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 159071 158247 gene locus_tag LOCUS_24190 159071 158247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 160314 159211 gene locus_tag LOCUS_24200 160314 159211 CDS product carboxylate-amine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259418.1 protein_id gnl|my_center|LOCUS_24200 161540 160410 gene locus_tag LOCUS_24210 161540 160410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255955.1 protein_id gnl|my_center|LOCUS_24210 162394 161690 gene locus_tag LOCUS_24220 162394 161690 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259732.1 protein_id gnl|my_center|LOCUS_24220 162536 164089 gene locus_tag LOCUS_24230 162536 164089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24230 165256 164630 gene locus_tag LOCUS_24240 165256 164630 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013061971.1 protein_id gnl|my_center|LOCUS_24240 165799 165380 gene locus_tag LOCUS_24250 165799 165380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24250 165924 166919 gene locus_tag LOCUS_24260 165924 166919 CDS product isoaspartyl peptidase/L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065126.1 protein_id gnl|my_center|LOCUS_24260 168262 167339 gene locus_tag LOCUS_24270 168262 167339 CDS product cyanophycinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963249.1 protein_id gnl|my_center|LOCUS_24270 170181 168364 gene locus_tag LOCUS_24280 170181 168364 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994158.1 protein_id gnl|my_center|LOCUS_24280 170655 172382 gene locus_tag LOCUS_24290 170655 172382 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986802.1 protein_id gnl|my_center|LOCUS_24290 173243 173428 gene locus_tag LOCUS_24300 173243 173428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 174493 174669 gene locus_tag LOCUS_24310 174493 174669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 175337 174840 gene locus_tag LOCUS_24320 175337 174840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24320 177096 175621 gene locus_tag LOCUS_24330 177096 175621 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786517.1 protein_id gnl|my_center|LOCUS_24330 177665 178411 gene locus_tag LOCUS_24340 177665 178411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24340 179155 178604 gene locus_tag LOCUS_24350 179155 178604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 179782 179513 gene locus_tag LOCUS_24360 179782 179513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 179781 180293 gene locus_tag LOCUS_24370 179781 180293 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974988.1 protein_id gnl|my_center|LOCUS_24370 181529 180369 gene locus_tag LOCUS_24380 181529 180369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 182738 182184 gene locus_tag LOCUS_24390 182738 182184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24390 182898 183218 gene locus_tag LOCUS_24400 182898 183218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 183215 184144 gene locus_tag LOCUS_24410 183215 184144 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962538.1 protein_id gnl|my_center|LOCUS_24410 184252 185277 gene locus_tag LOCUS_24420 184252 185277 CDS product glycosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480521.1 protein_id gnl|my_center|LOCUS_24420 185610 187052 gene locus_tag LOCUS_24430 185610 187052 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229206.1 protein_id gnl|my_center|LOCUS_24430 188426 187146 gene locus_tag LOCUS_24440 188426 187146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24440 189469 191034 gene locus_tag LOCUS_24450 189469 191034 CDS product 3' terminal RNA ribose 2'-O-methyltransferase Hen1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485480.1 protein_id gnl|my_center|LOCUS_24450 191419 191012 gene locus_tag LOCUS_24460 191419 191012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 191729 192025 gene locus_tag LOCUS_24470 191729 192025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 192890 191973 gene locus_tag LOCUS_24480 192890 191973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 193763 193215 gene locus_tag LOCUS_24490 193763 193215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24490 193831 196593 gene locus_tag LOCUS_24500 193831 196593 CDS product polynucleotide kinase-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530161.1 protein_id gnl|my_center|LOCUS_24500 197226 197050 gene locus_tag LOCUS_24510 197226 197050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 198162 197926 gene locus_tag LOCUS_24520 198162 197926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 198256 200955 gene locus_tag LOCUS_24530 198256 200955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 202545 201658 gene locus_tag LOCUS_24540 202545 201658 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962922.1 protein_id gnl|my_center|LOCUS_24540 202670 202981 gene locus_tag LOCUS_24550 202670 202981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 203159 203851 gene locus_tag LOCUS_24560 203159 203851 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973715.1 protein_id gnl|my_center|LOCUS_24560 203962 204873 gene locus_tag LOCUS_24570 203962 204873 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968037.1 protein_id gnl|my_center|LOCUS_24570 204942 205913 gene locus_tag LOCUS_24580 204942 205913 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142817.1 protein_id gnl|my_center|LOCUS_24580 206276 207055 gene locus_tag LOCUS_24590 206276 207055 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816142.1 protein_id gnl|my_center|LOCUS_24590 207246 208328 gene locus_tag LOCUS_24600 207246 208328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 209598 208486 gene locus_tag LOCUS_24610 209598 208486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 211173 209710 gene locus_tag LOCUS_24620 211173 209710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 211610 212527 gene locus_tag LOCUS_24630 211610 212527 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226301.1 protein_id gnl|my_center|LOCUS_24630 212540 213076 gene locus_tag LOCUS_24640 212540 213076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 213546 214637 gene locus_tag LOCUS_24650 213546 214637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 214630 215364 gene locus_tag LOCUS_24660 gene ubiE 214630 215364 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889031.1 protein_id gnl|my_center|LOCUS_24660 217450 215789 gene locus_tag LOCUS_24670 217450 215789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24670 218675 218340 gene locus_tag LOCUS_24680 218675 218340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24680 219468 221219 gene locus_tag LOCUS_24690 219468 221219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 222403 221561 gene locus_tag LOCUS_24700 222403 221561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444911.1 protein_id gnl|my_center|LOCUS_24700 223389 222430 gene locus_tag LOCUS_24710 223389 222430 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249899.1 protein_id gnl|my_center|LOCUS_24710 227013 223783 gene locus_tag LOCUS_24720 gene carB 227013 223783 CDS product carbamoyl-phosphate synthase (glutamine-hydrolyzing) large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107320.1 protein_id gnl|my_center|LOCUS_24720 227675 227175 gene locus_tag LOCUS_24730 227675 227175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 228782 227688 gene locus_tag LOCUS_24740 gene carA 228782 227688 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788241.1 protein_id gnl|my_center|LOCUS_24740 229553 229005 gene locus_tag LOCUS_24750 229553 229005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 230963 229713 gene locus_tag LOCUS_24760 230963 229713 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522681.1 protein_id gnl|my_center|LOCUS_24760 231487 230960 gene locus_tag LOCUS_24770 gene purE 231487 230960 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188932.1 protein_id gnl|my_center|LOCUS_24770 232909 231632 gene locus_tag LOCUS_24780 232909 231632 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460659.1 protein_id gnl|my_center|LOCUS_24780 233972 232989 gene locus_tag LOCUS_24790 233972 232989 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545982.1 protein_id gnl|my_center|LOCUS_24790 235007 235279 gene locus_tag LOCUS_24800 235007 235279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 235422 236780 gene locus_tag LOCUS_24810 235422 236780 CDS product TIGR00341 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762895.1 protein_id gnl|my_center|LOCUS_24810 238258 236855 gene locus_tag LOCUS_24820 238258 236855 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205196.1 protein_id gnl|my_center|LOCUS_24820 238711 238409 gene locus_tag LOCUS_24830 238711 238409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24830 239007 241028 gene locus_tag LOCUS_24840 239007 241028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 241268 241194 gene locus_tag LOCUS_t00260 241268 241194 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 241557 242504 gene locus_tag LOCUS_24850 241557 242504 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962774.1 protein_id gnl|my_center|LOCUS_24850 242603 243451 gene locus_tag LOCUS_24860 242603 243451 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964484.1 protein_id gnl|my_center|LOCUS_24860 243707 244417 gene locus_tag LOCUS_24870 243707 244417 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930865.1 protein_id gnl|my_center|LOCUS_24870 244528 245100 gene locus_tag LOCUS_24880 244528 245100 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228644.1 protein_id gnl|my_center|LOCUS_24880 245137 245661 gene locus_tag LOCUS_24890 245137 245661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24890 247406 246102 gene locus_tag LOCUS_24900 247406 246102 CDS product esterase-like activity of phytase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388984.1 protein_id gnl|my_center|LOCUS_24900 248541 247843 gene locus_tag LOCUS_24910 248541 247843 CDS product DUF4159 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963730.1 protein_id gnl|my_center|LOCUS_24910 248922 250340 gene locus_tag LOCUS_24920 248922 250340 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887075.1 protein_id gnl|my_center|LOCUS_24920 251346 251930 gene locus_tag LOCUS_24930 251346 251930 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966608.1 protein_id gnl|my_center|LOCUS_24930 252026 252739 gene locus_tag LOCUS_24940 252026 252739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 254337 252931 gene locus_tag LOCUS_24950 254337 252931 CDS product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084144.1 protein_id gnl|my_center|LOCUS_24950 254748 256481 gene locus_tag LOCUS_24960 254748 256481 CDS product DUF885 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072522.1 protein_id gnl|my_center|LOCUS_24960 256953 257720 gene locus_tag LOCUS_24970 256953 257720 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057996.1 protein_id gnl|my_center|LOCUS_24970 259281 257887 gene locus_tag LOCUS_24980 259281 257887 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142799.1 protein_id gnl|my_center|LOCUS_24980 259478 260038 gene locus_tag LOCUS_24990 259478 260038 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142702.1 protein_id gnl|my_center|LOCUS_24990 260046 260963 gene locus_tag LOCUS_25000 260046 260963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25000 261141 261839 gene locus_tag LOCUS_25010 261141 261839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 262046 262384 gene locus_tag LOCUS_25020 262046 262384 CDS product arsenosugar biosynthesis-associated peroxidase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986517.1 protein_id gnl|my_center|LOCUS_25020 262768 263652 gene locus_tag LOCUS_25030 262768 263652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25030 265013 263697 gene locus_tag LOCUS_25040 265013 263697 CDS product DUF2029 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838851.1 protein_id gnl|my_center|LOCUS_25040 266539 265085 gene locus_tag LOCUS_25050 266539 265085 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405140.1 protein_id gnl|my_center|LOCUS_25050 267295 266597 gene locus_tag LOCUS_25060 267295 266597 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421621.1 protein_id gnl|my_center|LOCUS_25060 267811 270534 gene locus_tag LOCUS_25070 267811 270534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25070 270762 273248 gene locus_tag LOCUS_25080 270762 273248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 273603 276239 gene locus_tag LOCUS_25090 273603 276239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25090 276524 278962 gene locus_tag LOCUS_25100 276524 278962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25100 279280 281697 gene locus_tag LOCUS_25110 279280 281697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25110 282015 284891 gene locus_tag LOCUS_25120 282015 284891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25120 285551 286015 gene locus_tag LOCUS_25130 285551 286015 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963897.1 protein_id gnl|my_center|LOCUS_25130 286215 287195 gene locus_tag LOCUS_25140 286215 287195 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390103.1 protein_id gnl|my_center|LOCUS_25140 287553 287822 gene locus_tag LOCUS_25150 287553 287822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25150 288051 288473 gene locus_tag LOCUS_25160 288051 288473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 288922 289500 gene locus_tag LOCUS_25170 288922 289500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 289870 290466 gene locus_tag LOCUS_25180 289870 290466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 290733 290903 gene locus_tag LOCUS_25190 290733 290903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25190 290956 291765 gene locus_tag LOCUS_25200 290956 291765 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284332.1 protein_id gnl|my_center|LOCUS_25200 291800 292732 gene locus_tag LOCUS_25210 gene trxB 291800 292732 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962776.1 protein_id gnl|my_center|LOCUS_25210 292921 293049 gene locus_tag LOCUS_25220 292921 293049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25220 293938 293201 gene locus_tag LOCUS_25230 293938 293201 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242574.1 protein_id gnl|my_center|LOCUS_25230 294269 294847 gene locus_tag LOCUS_25240 294269 294847 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454679.1 protein_id gnl|my_center|LOCUS_25240 295886 294939 gene locus_tag LOCUS_25250 295886 294939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25250 297417 296071 gene locus_tag LOCUS_25260 297417 296071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25260 297807 297580 gene locus_tag LOCUS_25270 297807 297580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25270 299254 297917 gene locus_tag LOCUS_25280 299254 297917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25280 299874 301508 gene locus_tag LOCUS_25290 299874 301508 CDS product DUF4139 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962278.1 protein_id gnl|my_center|LOCUS_25290 302196 302624 gene locus_tag LOCUS_25300 302196 302624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25300 303550 304089 gene locus_tag LOCUS_25310 303550 304089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25310 304597 305451 gene locus_tag LOCUS_25320 304597 305451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25320 305899 306870 gene locus_tag LOCUS_25330 305899 306870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25330 >Feature sequence23 562 2226 gene locus_tag LOCUS_25340 562 2226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25340 2416 3192 gene locus_tag LOCUS_25350 2416 3192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 3514 3266 gene locus_tag LOCUS_25360 3514 3266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25360 3915 3532 gene locus_tag LOCUS_25370 3915 3532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 3965 4795 gene locus_tag LOCUS_25380 gene gluA 3965 4795 CDS product glutamate ABC transporter ATP-binding protein GluA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081846.1 protein_id gnl|my_center|LOCUS_25380 5409 4792 gene locus_tag LOCUS_25390 5409 4792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25390 6490 5393 gene locus_tag LOCUS_25400 6490 5393 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215055.1 protein_id gnl|my_center|LOCUS_25400 6541 7896 gene locus_tag LOCUS_25410 6541 7896 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963804.1 protein_id gnl|my_center|LOCUS_25410 8069 9538 gene locus_tag LOCUS_25420 8069 9538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 9910 13206 gene locus_tag LOCUS_25430 9910 13206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25430 15316 13247 gene locus_tag LOCUS_25440 15316 13247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25440 16752 15313 gene locus_tag LOCUS_25450 16752 15313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25450 17203 19674 gene locus_tag LOCUS_25460 17203 19674 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963716.1 protein_id gnl|my_center|LOCUS_25460 22262 20139 gene locus_tag LOCUS_25470 22262 20139 CDS product carboxy terminal-processing peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964422.1 protein_id gnl|my_center|LOCUS_25470 26411 22659 gene locus_tag LOCUS_25480 26411 22659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 27809 26706 gene locus_tag LOCUS_25490 gene dinB 27809 26706 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083683.1 protein_id gnl|my_center|LOCUS_25490 27994 28070 gene locus_tag LOCUS_t00270 27994 28070 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 28845 28222 gene locus_tag LOCUS_25500 28845 28222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 29363 29959 gene locus_tag LOCUS_25510 29363 29959 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029605.1 protein_id gnl|my_center|LOCUS_25510 30528 31604 gene locus_tag LOCUS_25520 30528 31604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932826.1 protein_id gnl|my_center|LOCUS_25520 31721 32527 gene locus_tag LOCUS_25530 31721 32527 CDS product glycosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869429.1 protein_id gnl|my_center|LOCUS_25530 32667 33524 gene locus_tag LOCUS_25540 32667 33524 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000424609.1 protein_id gnl|my_center|LOCUS_25540 33599 34552 gene locus_tag LOCUS_25550 33599 34552 CDS product transketolase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088175.1 protein_id gnl|my_center|LOCUS_25550 34791 36125 gene locus_tag LOCUS_25560 34791 36125 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151613585.1 protein_id gnl|my_center|LOCUS_25560 36267 37073 gene locus_tag LOCUS_25570 36267 37073 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088717.1 protein_id gnl|my_center|LOCUS_25570 37375 38280 gene locus_tag LOCUS_25580 37375 38280 CDS product N-acetylneuraminate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926938.1 protein_id gnl|my_center|LOCUS_25580 38409 39305 gene locus_tag LOCUS_25590 38409 39305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25590 39335 39700 gene locus_tag LOCUS_25600 gene sugE 39335 39700 CDS product quaternary ammonium compound efflux SMR transporter SugE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705814.1 protein_id gnl|my_center|LOCUS_25600 41119 40211 gene locus_tag LOCUS_25610 41119 40211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25610 41427 41509 gene locus_tag LOCUS_t00280 41427 41509 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 41597 42925 gene locus_tag LOCUS_25620 gene tig 41597 42925 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791866.1 protein_id gnl|my_center|LOCUS_25620 43071 43769 gene locus_tag LOCUS_25630 gene clpP 43071 43769 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964184.1 protein_id gnl|my_center|LOCUS_25630 44752 44021 gene locus_tag LOCUS_25640 44752 44021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25640 45883 47052 gene locus_tag LOCUS_25650 gene clpX 45883 47052 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964183.1 protein_id gnl|my_center|LOCUS_25650 47472 49001 gene locus_tag LOCUS_25660 47472 49001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25660 49027 51546 gene locus_tag LOCUS_25670 49027 51546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25670 55398 51655 gene locus_tag LOCUS_25680 55398 51655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25680 56881 55769 gene locus_tag LOCUS_25690 gene lpxB 56881 55769 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089240244.1 protein_id gnl|my_center|LOCUS_25690 57421 57005 gene locus_tag LOCUS_25700 57421 57005 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405497.1 protein_id gnl|my_center|LOCUS_25700 >Feature sequence24 488 1651 gene locus_tag LOCUS_25710 488 1651 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929017.1 protein_id gnl|my_center|LOCUS_25710 1663 3120 gene locus_tag LOCUS_25720 1663 3120 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787747.1 protein_id gnl|my_center|LOCUS_25720 3166 3906 gene locus_tag LOCUS_25730 3166 3906 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786290.1 protein_id gnl|my_center|LOCUS_25730 3999 5258 gene locus_tag LOCUS_25740 3999 5258 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022822805.1 protein_id gnl|my_center|LOCUS_25740 5382 6581 gene locus_tag LOCUS_25750 5382 6581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25750 6774 7481 gene locus_tag LOCUS_25760 6774 7481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 7685 9067 gene locus_tag LOCUS_25770 7685 9067 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786303.1 protein_id gnl|my_center|LOCUS_25770 9185 10495 gene locus_tag LOCUS_25780 9185 10495 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107842.1 protein_id gnl|my_center|LOCUS_25780 10782 11939 gene locus_tag LOCUS_25790 10782 11939 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001055852.1 protein_id gnl|my_center|LOCUS_25790 12707 12480 gene locus_tag LOCUS_25800 12707 12480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 13682 12972 gene locus_tag LOCUS_25810 13682 12972 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524612.1 protein_id gnl|my_center|LOCUS_25810 14483 14019 gene locus_tag LOCUS_25820 14483 14019 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939462.1 protein_id gnl|my_center|LOCUS_25820 14516 14806 gene locus_tag LOCUS_25830 14516 14806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25830 14949 14800 gene locus_tag LOCUS_25840 14949 14800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 15400 15047 gene locus_tag LOCUS_25850 15400 15047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25850 16200 15607 gene locus_tag LOCUS_25860 16200 15607 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786786.1 protein_id gnl|my_center|LOCUS_25860 16713 17012 gene locus_tag LOCUS_25870 16713 17012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25870 17170 18021 gene locus_tag LOCUS_25880 17170 18021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25880 18018 20129 gene locus_tag LOCUS_25890 18018 20129 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092520565.1 protein_id gnl|my_center|LOCUS_25890 20856 20704 gene locus_tag LOCUS_25900 20856 20704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25900 21699 20917 gene locus_tag LOCUS_25910 21699 20917 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964187.1 protein_id gnl|my_center|LOCUS_25910 22962 22042 gene locus_tag LOCUS_25920 22962 22042 CDS product NmrA family NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101889.1 protein_id gnl|my_center|LOCUS_25920 23107 23511 gene locus_tag LOCUS_25930 23107 23511 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000760481.1 protein_id gnl|my_center|LOCUS_25930 23670 25070 gene locus_tag LOCUS_25940 23670 25070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25940 25577 26509 gene locus_tag LOCUS_25950 25577 26509 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880686.1 protein_id gnl|my_center|LOCUS_25950 26650 27114 gene locus_tag LOCUS_25960 26650 27114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25960 27210 27614 gene locus_tag LOCUS_25970 gene arfB 27210 27614 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962361.1 protein_id gnl|my_center|LOCUS_25970 29361 27985 gene locus_tag LOCUS_25980 gene mgtE 29361 27985 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933513.1 protein_id gnl|my_center|LOCUS_25980 29537 30370 gene locus_tag LOCUS_25990 29537 30370 CDS product cyanophycinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525046.1 protein_id gnl|my_center|LOCUS_25990 30514 31548 gene locus_tag LOCUS_26000 30514 31548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26000 31967 31608 gene locus_tag LOCUS_26010 31967 31608 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361979.1 protein_id gnl|my_center|LOCUS_26010 32183 32974 gene locus_tag LOCUS_26020 gene lipB 32183 32974 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963333.1 protein_id gnl|my_center|LOCUS_26020 33040 33456 gene locus_tag LOCUS_26030 33040 33456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962302.1 protein_id gnl|my_center|LOCUS_26030 33568 34620 gene locus_tag LOCUS_26040 33568 34620 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000378318.1 protein_id gnl|my_center|LOCUS_26040 34691 35821 gene locus_tag LOCUS_26050 34691 35821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26050 35900 36730 gene locus_tag LOCUS_26060 35900 36730 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962359.1 protein_id gnl|my_center|LOCUS_26060 36873 37868 gene locus_tag LOCUS_26070 36873 37868 CDS product type IX secretion system membrane protein PorP/SprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964500.1 protein_id gnl|my_center|LOCUS_26070 38208 39140 gene locus_tag LOCUS_26080 38208 39140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26080 39234 40040 gene locus_tag LOCUS_26090 39234 40040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26090 40091 41671 gene locus_tag LOCUS_26100 gene gldM 40091 41671 CDS product gliding motility protein GldM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964073.1 protein_id gnl|my_center|LOCUS_26100 41730 42704 gene locus_tag LOCUS_26110 41730 42704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26110 44617 42788 gene locus_tag LOCUS_26120 gene uvrC 44617 42788 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962398.1 protein_id gnl|my_center|LOCUS_26120 47217 44965 gene locus_tag LOCUS_26130 47217 44965 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962206.1 protein_id gnl|my_center|LOCUS_26130 50511 47428 gene locus_tag LOCUS_26140 50511 47428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26140 50598 50960 gene locus_tag LOCUS_26150 50598 50960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 50967 51362 gene locus_tag LOCUS_26160 50967 51362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26160 51410 52483 gene locus_tag LOCUS_26170 gene atpB 51410 52483 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964549.1 protein_id gnl|my_center|LOCUS_26170 52571 52843 gene locus_tag LOCUS_26180 gene atpE 52571 52843 CDS product ATP synthase F0 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004295758.1 protein_id gnl|my_center|LOCUS_26180 52939 53433 gene locus_tag LOCUS_26190 52939 53433 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964547.1 protein_id gnl|my_center|LOCUS_26190 53533 54093 gene locus_tag LOCUS_26200 gene atpH 53533 54093 CDS product ATP synthase F1 subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036892505.1 protein_id gnl|my_center|LOCUS_26200 54245 55825 gene locus_tag LOCUS_26210 gene atpA 54245 55825 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964545.1 protein_id gnl|my_center|LOCUS_26210 56007 56891 gene locus_tag LOCUS_26220 gene atpG 56007 56891 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964544.1 protein_id gnl|my_center|LOCUS_26220 58431 57946 gene locus_tag LOCUS_26230 58431 57946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 59318 58590 gene locus_tag LOCUS_26240 59318 58590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26240 60394 59681 gene locus_tag LOCUS_26250 60394 59681 CDS product beta-phosphoglucomutase family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927183.1 protein_id gnl|my_center|LOCUS_26250 >Feature sequence25 143 2377 gene locus_tag LOCUS_26260 143 2377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26260 2762 3034 gene locus_tag LOCUS_26270 2762 3034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26270 4487 6520 gene locus_tag LOCUS_26280 4487 6520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26280 7448 10714 gene locus_tag LOCUS_26290 7448 10714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26290 10774 15606 gene locus_tag LOCUS_26300 10774 15606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26300 15668 17590 gene locus_tag LOCUS_26310 15668 17590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26310 17635 19338 gene locus_tag LOCUS_26320 17635 19338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26320 19764 20462 gene locus_tag LOCUS_26330 19764 20462 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943268.1 protein_id gnl|my_center|LOCUS_26330 21099 22391 gene locus_tag LOCUS_26340 21099 22391 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962841.1 protein_id gnl|my_center|LOCUS_26340 22568 23404 gene locus_tag LOCUS_26350 gene tatC 22568 23404 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963367.1 protein_id gnl|my_center|LOCUS_26350 24088 25944 gene locus_tag LOCUS_26360 24088 25944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26360 28108 26006 gene locus_tag LOCUS_26370 28108 26006 CDS product M13 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948307.1 protein_id gnl|my_center|LOCUS_26370 29785 28151 gene locus_tag LOCUS_26380 29785 28151 CDS product NADP-dependent glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208330.1 protein_id gnl|my_center|LOCUS_26380 30030 30461 gene locus_tag LOCUS_26390 30030 30461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403489.1 protein_id gnl|my_center|LOCUS_26390 32325 30625 gene locus_tag LOCUS_26400 32325 30625 CDS product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035282.1 protein_id gnl|my_center|LOCUS_26400 33135 33317 gene locus_tag LOCUS_26410 33135 33317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26410 33914 33420 gene locus_tag LOCUS_26420 33914 33420 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313899.1 protein_id gnl|my_center|LOCUS_26420 34916 34254 gene locus_tag LOCUS_26430 34916 34254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 36485 35025 gene locus_tag LOCUS_26440 gene crtI 36485 35025 CDS product phytoene desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066789316.1 protein_id gnl|my_center|LOCUS_26440 37872 36673 gene locus_tag LOCUS_26450 37872 36673 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785371.1 protein_id gnl|my_center|LOCUS_26450 38514 38068 gene locus_tag LOCUS_26460 38514 38068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26460 39238 38639 gene locus_tag LOCUS_26470 39238 38639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26470 40359 39235 gene locus_tag LOCUS_26480 40359 39235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26480 44494 40475 gene locus_tag LOCUS_26490 44494 40475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26490 45846 44614 gene locus_tag LOCUS_26500 45846 44614 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765300.1 protein_id gnl|my_center|LOCUS_26500 46268 45882 gene locus_tag LOCUS_26510 46268 45882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26510 47174 46365 gene locus_tag LOCUS_26520 47174 46365 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403324.1 protein_id gnl|my_center|LOCUS_26520 47686 47288 gene locus_tag LOCUS_26530 47686 47288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26530 47853 49271 gene locus_tag LOCUS_26540 47853 49271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26540 49990 49397 gene locus_tag LOCUS_26550 49990 49397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 51064 50015 gene locus_tag LOCUS_26560 gene selD 51064 50015 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169286.1 protein_id gnl|my_center|LOCUS_26560 51820 51254 gene locus_tag LOCUS_26570 51820 51254 CDS product DUF2911 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404444.1 protein_id gnl|my_center|LOCUS_26570 52351 52046 gene locus_tag LOCUS_26580 52351 52046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26580 >Feature sequence26 670 1818 gene locus_tag LOCUS_26590 670 1818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26590 2213 4036 gene locus_tag LOCUS_26600 2213 4036 CDS product M1 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962262.1 protein_id gnl|my_center|LOCUS_26600 4234 5202 gene locus_tag LOCUS_26610 gene rfaD 4234 5202 CDS product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015772.1 protein_id gnl|my_center|LOCUS_26610 5346 6731 gene locus_tag LOCUS_26620 5346 6731 CDS product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275186.1 protein_id gnl|my_center|LOCUS_26620 7341 7069 gene locus_tag LOCUS_26630 7341 7069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26630 8493 7486 gene locus_tag LOCUS_26640 8493 7486 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227956.1 protein_id gnl|my_center|LOCUS_26640 11055 10186 gene locus_tag LOCUS_26650 11055 10186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26650 12417 11572 gene locus_tag LOCUS_26660 12417 11572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26660 12571 12837 gene locus_tag LOCUS_26670 12571 12837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26670 13261 13452 gene locus_tag LOCUS_26680 13261 13452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26680 14071 15879 gene locus_tag LOCUS_26690 14071 15879 CDS product family 10 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000635991.1 protein_id gnl|my_center|LOCUS_26690 16214 17875 gene locus_tag LOCUS_26700 gene treA 16214 17875 CDS product alpha,alpha-trehalase TreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895614.1 protein_id gnl|my_center|LOCUS_26700 19387 18128 gene locus_tag LOCUS_26710 19387 18128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26710 21001 19457 gene locus_tag LOCUS_26720 21001 19457 CDS product SusD/RagB family nutrient-binding outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405561.1 protein_id gnl|my_center|LOCUS_26720 24191 21063 gene locus_tag LOCUS_26730 24191 21063 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072714627.1 protein_id gnl|my_center|LOCUS_26730 24578 26512 gene locus_tag LOCUS_26740 24578 26512 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330748.1 protein_id gnl|my_center|LOCUS_26740 27105 28316 gene locus_tag LOCUS_26750 27105 28316 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405142.1 protein_id gnl|my_center|LOCUS_26750 29863 28538 gene locus_tag LOCUS_26760 29863 28538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26760 33136 29939 gene locus_tag LOCUS_26770 33136 29939 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103036562.1 protein_id gnl|my_center|LOCUS_26770 33650 34831 gene locus_tag LOCUS_26780 33650 34831 CDS product DUF5009 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000428415.1 protein_id gnl|my_center|LOCUS_26780 35180 35980 gene locus_tag LOCUS_26790 gene proC 35180 35980 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769432.1 protein_id gnl|my_center|LOCUS_26790 36150 37484 gene locus_tag LOCUS_26800 36150 37484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26800 37840 37409 gene locus_tag LOCUS_26810 37840 37409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26810 39962 37863 gene locus_tag LOCUS_26820 39962 37863 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962595.1 protein_id gnl|my_center|LOCUS_26820 40467 40045 gene locus_tag LOCUS_26830 40467 40045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26830 40769 40578 gene locus_tag LOCUS_26840 40769 40578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26840 42608 40983 gene locus_tag LOCUS_26850 42608 40983 CDS product 3-(methylthio)propionyl-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539668.1 protein_id gnl|my_center|LOCUS_26850 45680 42699 gene locus_tag LOCUS_26860 45680 42699 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962917.1 protein_id gnl|my_center|LOCUS_26860 46526 46113 gene locus_tag LOCUS_26870 46526 46113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26870 47187 48857 gene locus_tag LOCUS_26880 47187 48857 CDS product leucine-rich repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069710.1 protein_id gnl|my_center|LOCUS_26880 48934 51201 gene locus_tag LOCUS_26890 48934 51201 CDS product leucine-rich repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069710.1 protein_id gnl|my_center|LOCUS_26890 >Feature sequence27 158 2296 gene locus_tag LOCUS_26900 158 2296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26900 2776 5406 gene locus_tag LOCUS_26910 2776 5406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26910 5596 8667 gene locus_tag LOCUS_26920 5596 8667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26920 12504 9472 gene locus_tag LOCUS_26930 12504 9472 CDS product chemotaxis protein CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021984.1 protein_id gnl|my_center|LOCUS_26930 12722 13753 gene locus_tag LOCUS_26940 12722 13753 CDS product chemotaxis protein CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525053.1 protein_id gnl|my_center|LOCUS_26940 14921 14025 gene locus_tag LOCUS_26950 14921 14025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26950 15257 16903 gene locus_tag LOCUS_26960 15257 16903 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964003.1 protein_id gnl|my_center|LOCUS_26960 17122 17766 gene locus_tag LOCUS_26970 17122 17766 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004540175.1 protein_id gnl|my_center|LOCUS_26970 17833 18966 gene locus_tag LOCUS_26980 17833 18966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26980 19256 21040 gene locus_tag LOCUS_26990 gene yidC 19256 21040 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763174.1 protein_id gnl|my_center|LOCUS_26990 23172 22726 gene locus_tag LOCUS_27000 23172 22726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27000 23556 24023 gene locus_tag LOCUS_27010 23556 24023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27010 25800 24106 gene locus_tag LOCUS_27020 25800 24106 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868766.1 protein_id gnl|my_center|LOCUS_27020 25977 26786 gene locus_tag LOCUS_27030 25977 26786 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016269488.1 protein_id gnl|my_center|LOCUS_27030 26798 27031 gene locus_tag LOCUS_27040 26798 27031 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142391.1 protein_id gnl|my_center|LOCUS_27040 27028 27363 gene locus_tag LOCUS_27050 27028 27363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27050 27467 28447 gene locus_tag LOCUS_27060 27467 28447 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760916.1 protein_id gnl|my_center|LOCUS_27060 28620 29354 gene locus_tag LOCUS_27070 28620 29354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27070 29438 30166 gene locus_tag LOCUS_27080 gene dapB 29438 30166 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963266.1 protein_id gnl|my_center|LOCUS_27080 30259 31407 gene locus_tag LOCUS_27090 30259 31407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27090 32282 31620 gene locus_tag LOCUS_27100 gene ung 32282 31620 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798174.1 protein_id gnl|my_center|LOCUS_27100 32398 32784 gene locus_tag LOCUS_27110 gene apaG 32398 32784 CDS product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768068.1 protein_id gnl|my_center|LOCUS_27110 32966 33790 gene locus_tag LOCUS_27120 32966 33790 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034100725.1 protein_id gnl|my_center|LOCUS_27120 34321 33809 gene locus_tag LOCUS_27130 34321 33809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27130 35184 34351 gene locus_tag LOCUS_27140 gene kdsA 35184 34351 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785350.1 protein_id gnl|my_center|LOCUS_27140 35888 35280 gene locus_tag LOCUS_27150 35888 35280 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963562.1 protein_id gnl|my_center|LOCUS_27150 36014 36964 gene locus_tag LOCUS_27160 36014 36964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27160 39765 37093 gene locus_tag LOCUS_27170 gene cphA 39765 37093 CDS product cyanophycin synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963250.1 protein_id gnl|my_center|LOCUS_27170 41289 40156 gene locus_tag LOCUS_27180 41289 40156 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028385.1 protein_id gnl|my_center|LOCUS_27180 41566 41832 gene locus_tag LOCUS_27190 41566 41832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 >Feature sequence28 249 1151 gene locus_tag LOCUS_27200 gene sdaAA 249 1151 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548060.1 protein_id gnl|my_center|LOCUS_27200 2289 1231 gene locus_tag LOCUS_27210 2289 1231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27210 3735 2356 gene locus_tag LOCUS_27220 gene lutB 3735 2356 CDS product lactate utilization iron-sulfur protein LutB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228307.1 protein_id gnl|my_center|LOCUS_27220 4220 4017 gene locus_tag LOCUS_27230 4220 4017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27230 5998 4349 gene locus_tag LOCUS_27240 5998 4349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27240 6596 6117 gene locus_tag LOCUS_27250 gene ispF 6596 6117 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791741.1 protein_id gnl|my_center|LOCUS_27250 6912 7523 gene locus_tag LOCUS_27260 6912 7523 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964492.1 protein_id gnl|my_center|LOCUS_27260 7685 9241 gene locus_tag LOCUS_27270 7685 9241 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184492906.1 protein_id gnl|my_center|LOCUS_27270 9275 10399 gene locus_tag LOCUS_27280 9275 10399 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964490.1 protein_id gnl|my_center|LOCUS_27280 10656 14087 gene locus_tag LOCUS_27290 10656 14087 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964489.1 protein_id gnl|my_center|LOCUS_27290 14143 14466 gene locus_tag LOCUS_27300 14143 14466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27300 14779 15384 gene locus_tag LOCUS_27310 14779 15384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27310 16442 15621 gene locus_tag LOCUS_27320 16442 15621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27320 17836 16643 gene locus_tag LOCUS_27330 17836 16643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27330 18538 17930 gene locus_tag LOCUS_27340 18538 17930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27340 18676 18951 gene locus_tag LOCUS_27350 18676 18951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27350 20139 19102 gene locus_tag LOCUS_27360 20139 19102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27360 21517 20213 gene locus_tag LOCUS_27370 21517 20213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27370 22328 21630 gene locus_tag LOCUS_27380 22328 21630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103017756.1 protein_id gnl|my_center|LOCUS_27380 22327 22506 gene locus_tag LOCUS_27390 22327 22506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27390 22643 23620 gene locus_tag LOCUS_27400 22643 23620 CDS product 2-oxoglutarate and iron-dependent oxygenase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963174.1 protein_id gnl|my_center|LOCUS_27400 24052 23762 gene locus_tag LOCUS_27410 24052 23762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27410 24414 24037 gene locus_tag LOCUS_27420 24414 24037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27420 25214 24609 gene locus_tag LOCUS_27430 25214 24609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27430 26487 25288 gene locus_tag LOCUS_27440 26487 25288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27440 27145 26540 gene locus_tag LOCUS_27450 27145 26540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27450 32720 27219 gene locus_tag LOCUS_27460 32720 27219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27460 35335 32810 gene locus_tag LOCUS_27470 35335 32810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27470 36432 36205 gene locus_tag LOCUS_27480 36432 36205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_27480 36950 36615 gene locus_tag LOCUS_27490 36950 36615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_27490 37529 38665 gene locus_tag LOCUS_27500 gene hemW 37529 38665 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962384.1 protein_id gnl|my_center|LOCUS_27500 >Feature sequence29 532 305 gene locus_tag LOCUS_27510 532 305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27510 783 544 gene locus_tag LOCUS_27520 783 544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27520 1744 1007 gene locus_tag LOCUS_27530 1744 1007 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963166.1 protein_id gnl|my_center|LOCUS_27530 5327 1794 gene locus_tag LOCUS_27540 5327 1794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27540 7601 5535 gene locus_tag LOCUS_27550 7601 5535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27550 8801 7713 gene locus_tag LOCUS_27560 8801 7713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27560 9305 9156 gene locus_tag LOCUS_27570 9305 9156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27570 9351 9554 gene locus_tag LOCUS_27580 9351 9554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27580 9857 11731 gene locus_tag LOCUS_27590 gene thiC 9857 11731 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962597.1 protein_id gnl|my_center|LOCUS_27590 11994 12752 gene locus_tag LOCUS_27600 11994 12752 CDS product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962599.1 protein_id gnl|my_center|LOCUS_27600 12848 13471 gene locus_tag LOCUS_27610 12848 13471 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768961.1 protein_id gnl|my_center|LOCUS_27610 13477 14256 gene locus_tag LOCUS_27620 13477 14256 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260916.1 protein_id gnl|my_center|LOCUS_27620 14527 16050 gene locus_tag LOCUS_27630 14527 16050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27630 16281 17402 gene locus_tag LOCUS_27640 gene thiH 16281 17402 CDS product 2-iminoacetate synthase ThiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962602.1 protein_id gnl|my_center|LOCUS_27640 17399 18499 gene locus_tag LOCUS_27650 gene moeB 17399 18499 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259329.1 protein_id gnl|my_center|LOCUS_27650 19090 18485 gene locus_tag LOCUS_27660 19090 18485 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761321.1 protein_id gnl|my_center|LOCUS_27660 19721 19107 gene locus_tag LOCUS_27670 19721 19107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27670 20457 20167 gene locus_tag LOCUS_27680 20457 20167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27680 22193 21396 gene locus_tag LOCUS_27690 22193 21396 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257125.1 protein_id gnl|my_center|LOCUS_27690 23077 25320 gene locus_tag LOCUS_27700 23077 25320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27700 25647 26258 gene locus_tag LOCUS_27710 25647 26258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27710 26375 26211 gene locus_tag LOCUS_27720 26375 26211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27720 26719 26528 gene locus_tag LOCUS_27730 26719 26528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27730 29724 27262 gene locus_tag LOCUS_27740 29724 27262 CDS product DUF5686 and carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107841.1 protein_id gnl|my_center|LOCUS_27740 30467 30135 gene locus_tag LOCUS_27750 30467 30135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27750 31405 31262 gene locus_tag LOCUS_27760 31405 31262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27760 32848 31439 gene locus_tag LOCUS_27770 32848 31439 CDS product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531269.1 protein_id gnl|my_center|LOCUS_27770 34086 33544 gene locus_tag LOCUS_27780 34086 33544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27780 >Feature sequence30 236 961 gene locus_tag LOCUS_27790 236 961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27790 3483 1411 gene locus_tag LOCUS_27800 3483 1411 CDS product M13 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814533.1 protein_id gnl|my_center|LOCUS_27800 4025 5383 gene locus_tag LOCUS_27810 4025 5383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27810 5595 5900 gene locus_tag LOCUS_27820 5595 5900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27820 6645 7415 gene locus_tag LOCUS_27830 6645 7415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27830 7412 7819 gene locus_tag LOCUS_27840 7412 7819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27840 8312 9562 gene locus_tag LOCUS_27850 8312 9562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27850 9794 10753 gene locus_tag LOCUS_27860 9794 10753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27860 10767 11648 gene locus_tag LOCUS_27870 10767 11648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27870 12586 12230 gene locus_tag LOCUS_27880 12586 12230 CDS product MGMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962541.1 protein_id gnl|my_center|LOCUS_27880 12767 13969 gene locus_tag LOCUS_27890 12767 13969 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764016.1 protein_id gnl|my_center|LOCUS_27890 14013 14474 gene locus_tag LOCUS_27900 14013 14474 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206817659.1 protein_id gnl|my_center|LOCUS_27900 14589 17687 gene locus_tag LOCUS_27910 14589 17687 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_119656495.1 protein_id gnl|my_center|LOCUS_27910 17834 19213 gene locus_tag LOCUS_27920 17834 19213 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838343.1 protein_id gnl|my_center|LOCUS_27920 19870 20484 gene locus_tag LOCUS_27930 19870 20484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27930 20735 23326 gene locus_tag LOCUS_27940 20735 23326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27940 23527 26031 gene locus_tag LOCUS_27950 23527 26031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27950 26175 28544 gene locus_tag LOCUS_27960 26175 28544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27960 28648 30072 gene locus_tag LOCUS_27970 28648 30072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27970 >Feature sequence31 1129 260 gene locus_tag LOCUS_27980 1129 260 CDS product cyanophycinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963249.1 protein_id gnl|my_center|LOCUS_27980 2480 1566 gene locus_tag LOCUS_27990 2480 1566 CDS product isoaspartyl peptidase/L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275150.1 protein_id gnl|my_center|LOCUS_27990 6025 3290 gene locus_tag LOCUS_28000 6025 3290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28000 6116 6691 gene locus_tag LOCUS_28010 6116 6691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28010 7321 6854 gene locus_tag LOCUS_28020 gene tnpA 7321 6854 CDS product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120397.1 protein_id gnl|my_center|LOCUS_28020 9510 7600 gene locus_tag LOCUS_28030 9510 7600 CDS product DUF294 nucleotidyltransferase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545360.1 protein_id gnl|my_center|LOCUS_28030 10310 9588 gene locus_tag LOCUS_28040 10310 9588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28040 11647 10619 gene locus_tag LOCUS_28050 11647 10619 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206578673.1 protein_id gnl|my_center|LOCUS_28050 12909 11860 gene locus_tag LOCUS_28060 12909 11860 CDS product UDP-glucose--hexose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909272.1 protein_id gnl|my_center|LOCUS_28060 14351 13161 gene locus_tag LOCUS_28070 gene galK 14351 13161 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107224.1 protein_id gnl|my_center|LOCUS_28070 15087 14653 gene locus_tag LOCUS_28080 15087 14653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28080 15499 15284 gene locus_tag LOCUS_28090 15499 15284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28090 15913 15725 gene locus_tag LOCUS_28100 15913 15725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28100 17277 16180 gene locus_tag LOCUS_28110 17277 16180 CDS product cytochrome c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962740.1 protein_id gnl|my_center|LOCUS_28110 20321 17571 gene locus_tag LOCUS_28120 20321 17571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28120 21542 24661 gene locus_tag LOCUS_28130 21542 24661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28130 >Feature sequence32 202 1641 gene locus_tag LOCUS_28140 202 1641 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230189.1 protein_id gnl|my_center|LOCUS_28140 4231 1676 gene locus_tag LOCUS_28150 4231 1676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28150 5459 4536 gene locus_tag LOCUS_28160 5459 4536 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167512742.1 protein_id gnl|my_center|LOCUS_28160 5606 6109 gene locus_tag LOCUS_28170 5606 6109 CDS product regulatory protein RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964333.1 protein_id gnl|my_center|LOCUS_28170 6885 6250 gene locus_tag LOCUS_28180 6885 6250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28180 6949 8148 gene locus_tag LOCUS_28190 6949 8148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28190 8235 9140 gene locus_tag LOCUS_28200 8235 9140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28200 9311 9033 gene locus_tag LOCUS_28210 9311 9033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28210 10040 9441 gene locus_tag LOCUS_28220 10040 9441 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976315.1 protein_id gnl|my_center|LOCUS_28220 10238 10999 gene locus_tag LOCUS_28230 10238 10999 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974643.1 protein_id gnl|my_center|LOCUS_28230 11991 11104 gene locus_tag LOCUS_28240 11991 11104 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205909.1 protein_id gnl|my_center|LOCUS_28240 14724 12049 gene locus_tag LOCUS_28250 14724 12049 CDS product YfhO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108484.1 protein_id gnl|my_center|LOCUS_28250 15079 14777 gene locus_tag LOCUS_28260 15079 14777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28260 15704 15267 gene locus_tag LOCUS_28270 15704 15267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28270 15842 15916 gene locus_tag LOCUS_t00290 15842 15916 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 17044 16139 gene locus_tag LOCUS_28280 17044 16139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803961.1 protein_id gnl|my_center|LOCUS_28280 20864 18042 gene locus_tag LOCUS_28290 20864 18042 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962291.1 protein_id gnl|my_center|LOCUS_28290 22188 21409 gene locus_tag LOCUS_28300 22188 21409 CDS product geranylgeranylglyceryl/heptaprenylglyceryl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962364.1 protein_id gnl|my_center|LOCUS_28300 23071 22160 gene locus_tag LOCUS_28310 23071 22160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28310 23455 23078 gene locus_tag LOCUS_28320 23455 23078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28320 23588 24775 gene locus_tag LOCUS_28330 23588 24775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28330 25485 24910 gene locus_tag LOCUS_28340 25485 24910 CDS product fasciclin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816758.1 protein_id gnl|my_center|LOCUS_28340 >Feature sequence33 1708 1358 gene locus_tag LOCUS_28350 1708 1358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28350 1799 2125 gene locus_tag LOCUS_28360 1799 2125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28360 3780 3556 gene locus_tag LOCUS_28370 3780 3556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28370 4353 3850 gene locus_tag LOCUS_28380 4353 3850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28380 4471 4731 gene locus_tag LOCUS_28390 4471 4731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28390 4801 5562 gene locus_tag LOCUS_28400 gene rsmI 4801 5562 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108201.1 protein_id gnl|my_center|LOCUS_28400 5534 7255 gene locus_tag LOCUS_28410 gene lnt 5534 7255 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933164.1 protein_id gnl|my_center|LOCUS_28410 7382 8188 gene locus_tag LOCUS_28420 7382 8188 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108488.1 protein_id gnl|my_center|LOCUS_28420 8387 8608 gene locus_tag LOCUS_28430 8387 8608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28430 8741 9082 gene locus_tag LOCUS_28440 8741 9082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28440 9913 9287 gene locus_tag LOCUS_28450 9913 9287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28450 11198 10179 gene locus_tag LOCUS_28460 11198 10179 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957837.1 protein_id gnl|my_center|LOCUS_28460 12864 11314 gene locus_tag LOCUS_28470 12864 11314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28470 14555 13158 gene locus_tag LOCUS_28480 gene radA 14555 13158 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962283.1 protein_id gnl|my_center|LOCUS_28480 15429 14686 gene locus_tag LOCUS_28490 15429 14686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28490 15532 16884 gene locus_tag LOCUS_28500 15532 16884 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141661.1 protein_id gnl|my_center|LOCUS_28500 17126 18784 gene locus_tag LOCUS_28510 17126 18784 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140483.1 protein_id gnl|my_center|LOCUS_28510 19752 18874 gene locus_tag LOCUS_28520 gene rfbA 19752 18874 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002364387.1 protein_id gnl|my_center|LOCUS_28520 20174 19815 gene locus_tag LOCUS_28530 20174 19815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28530 21450 20416 gene locus_tag LOCUS_28540 21450 20416 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937626.1 protein_id gnl|my_center|LOCUS_28540 22571 21516 gene locus_tag LOCUS_28550 gene rfbB 22571 21516 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963426.1 protein_id gnl|my_center|LOCUS_28550 23692 22676 gene locus_tag LOCUS_28560 gene galE 23692 22676 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107362.1 protein_id gnl|my_center|LOCUS_28560 25114 23819 gene locus_tag LOCUS_28570 25114 23819 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942587.1 protein_id gnl|my_center|LOCUS_28570 25782 25150 gene locus_tag LOCUS_28580 25782 25150 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582951.1 protein_id gnl|my_center|LOCUS_28580 27653 26211 gene locus_tag LOCUS_28590 27653 26211 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257240.1 protein_id gnl|my_center|LOCUS_28590 27915 28127 gene locus_tag LOCUS_28600 27915 28127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28600 29635 28691 gene locus_tag LOCUS_28610 29635 28691 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108803.1 protein_id gnl|my_center|LOCUS_28610 32018 31068 gene locus_tag LOCUS_28620 32018 31068 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232632.1 protein_id gnl|my_center|LOCUS_28620 32778 32482 gene locus_tag LOCUS_28630 32778 32482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28630 33915 34421 gene locus_tag LOCUS_28640 33915 34421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28640 34535 35968 gene locus_tag LOCUS_28650 34535 35968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28650 36393 36896 gene locus_tag LOCUS_28660 36393 36896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28660 37453 37148 gene locus_tag LOCUS_28670 37453 37148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28670 37605 37450 gene locus_tag LOCUS_28680 37605 37450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28680 38485 39564 gene locus_tag LOCUS_28690 38485 39564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28690 40263 40802 gene locus_tag LOCUS_28700 40263 40802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28700 40944 42728 gene locus_tag LOCUS_28710 40944 42728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28710 43521 42754 gene locus_tag LOCUS_28720 43521 42754 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868621.1 protein_id gnl|my_center|LOCUS_28720 44383 43589 gene locus_tag LOCUS_28730 44383 43589 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971313.1 protein_id gnl|my_center|LOCUS_28730 46165 44411 gene locus_tag LOCUS_28740 46165 44411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28740 46532 47050 gene locus_tag LOCUS_28750 46532 47050 CDS product 3-hydroxyanthranilate 3,4-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036739.1 protein_id gnl|my_center|LOCUS_28750 47138 48172 gene locus_tag LOCUS_28760 47138 48172 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487479.1 protein_id gnl|my_center|LOCUS_28760 48551 49825 gene locus_tag LOCUS_28770 gene kynU 48551 49825 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964305.1 protein_id gnl|my_center|LOCUS_28770 49909 50601 gene locus_tag LOCUS_28780 49909 50601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28780 50622 51251 gene locus_tag LOCUS_28790 50622 51251 CDS product alpha-ketoglutarate-dependent dioxygenase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115462.1 protein_id gnl|my_center|LOCUS_28790 52155 54836 gene locus_tag LOCUS_28800 52155 54836 CDS product T9SS-dependent M36 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962455.1 protein_id gnl|my_center|LOCUS_28800 58517 55746 gene locus_tag LOCUS_28810 58517 55746 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962291.1 protein_id gnl|my_center|LOCUS_28810 59315 60658 gene locus_tag LOCUS_28820 59315 60658 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964302.1 protein_id gnl|my_center|LOCUS_28820 60826 61635 gene locus_tag LOCUS_28830 60826 61635 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107709.1 protein_id gnl|my_center|LOCUS_28830 62246 61632 gene locus_tag LOCUS_28840 62246 61632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28840 62628 63917 gene locus_tag LOCUS_28850 62628 63917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28850 64330 67017 gene locus_tag LOCUS_28860 64330 67017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28860 68709 67447 gene locus_tag LOCUS_28870 68709 67447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28870 68937 69989 gene locus_tag LOCUS_28880 68937 69989 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107708.1 protein_id gnl|my_center|LOCUS_28880 70041 70763 gene locus_tag LOCUS_28890 70041 70763 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107709.1 protein_id gnl|my_center|LOCUS_28890 71054 73939 gene locus_tag LOCUS_28900 gene polA 71054 73939 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108723.1 protein_id gnl|my_center|LOCUS_28900 76535 74064 gene locus_tag LOCUS_28910 76535 74064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28910 77267 78307 gene locus_tag LOCUS_28920 77267 78307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28920 80981 78852 gene locus_tag LOCUS_28930 80981 78852 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926802.1 protein_id gnl|my_center|LOCUS_28930 81178 82599 gene locus_tag LOCUS_28940 81178 82599 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926801.1 protein_id gnl|my_center|LOCUS_28940 82710 83138 gene locus_tag LOCUS_28950 82710 83138 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932479.1 protein_id gnl|my_center|LOCUS_28950 83249 84364 gene locus_tag LOCUS_28960 83249 84364 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931799.1 protein_id gnl|my_center|LOCUS_28960 84639 86210 gene locus_tag LOCUS_28970 84639 86210 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962666.1 protein_id gnl|my_center|LOCUS_28970 86651 87079 gene locus_tag LOCUS_28980 86651 87079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28980 87147 87527 gene locus_tag LOCUS_28990 87147 87527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28990 87629 88330 gene locus_tag LOCUS_29000 87629 88330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29000 89455 88454 gene locus_tag LOCUS_29010 89455 88454 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943997.1 protein_id gnl|my_center|LOCUS_29010 90386 90649 gene locus_tag LOCUS_29020 90386 90649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29020 91859 90747 gene locus_tag LOCUS_29030 91859 90747 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801569.1 protein_id gnl|my_center|LOCUS_29030 93209 91968 gene locus_tag LOCUS_29040 93209 91968 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784442.1 protein_id gnl|my_center|LOCUS_29040 94566 93325 gene locus_tag LOCUS_29050 94566 93325 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784442.1 protein_id gnl|my_center|LOCUS_29050 95150 94656 gene locus_tag LOCUS_29060 95150 94656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29060 95864 95196 gene locus_tag LOCUS_29070 95864 95196 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765150.1 protein_id gnl|my_center|LOCUS_29070 96503 96691 gene locus_tag LOCUS_29080 96503 96691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29080 97915 97124 gene locus_tag LOCUS_29090 97915 97124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29090 98695 98333 gene locus_tag LOCUS_29100 98695 98333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29100 99960 99199 gene locus_tag LOCUS_29110 99960 99199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29110 100021 100242 gene locus_tag LOCUS_29120 100021 100242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29120 101122 100577 gene locus_tag LOCUS_29130 101122 100577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29130 101970 101260 gene locus_tag LOCUS_29140 101970 101260 CDS product head GIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839368.1 protein_id gnl|my_center|LOCUS_29140 102301 102843 gene locus_tag LOCUS_29150 102301 102843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29150 105055 103013 gene locus_tag LOCUS_29160 gene uvrB 105055 103013 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202946.1 protein_id gnl|my_center|LOCUS_29160 106897 105158 gene locus_tag LOCUS_29170 106897 105158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29170 107534 106887 gene locus_tag LOCUS_29180 107534 106887 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964176.1 protein_id gnl|my_center|LOCUS_29180 107896 108510 gene locus_tag LOCUS_29190 gene wrbA 107896 108510 CDS product NAD(P)H:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941470.1 protein_id gnl|my_center|LOCUS_29190 109525 108782 gene locus_tag LOCUS_29200 109525 108782 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202198.1 protein_id gnl|my_center|LOCUS_29200 110314 109643 gene locus_tag LOCUS_29210 110314 109643 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005071971.1 protein_id gnl|my_center|LOCUS_29210 110783 113536 gene locus_tag LOCUS_29220 110783 113536 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962291.1 protein_id gnl|my_center|LOCUS_29220 113965 113678 gene locus_tag LOCUS_29230 113965 113678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29230 115088 114093 gene locus_tag LOCUS_29240 115088 114093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29240 116330 115335 gene locus_tag LOCUS_29250 116330 115335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29250 119050 116384 gene locus_tag LOCUS_29260 119050 116384 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203489.1 protein_id gnl|my_center|LOCUS_29260 120111 119092 gene locus_tag LOCUS_29270 120111 119092 CDS product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203440.1 protein_id gnl|my_center|LOCUS_29270 120935 120345 gene locus_tag LOCUS_29280 120935 120345 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108164.1 protein_id gnl|my_center|LOCUS_29280 122114 121284 gene locus_tag LOCUS_29290 122114 121284 CDS product phosphosulfolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402811.1 protein_id gnl|my_center|LOCUS_29290 123740 122331 gene locus_tag LOCUS_29300 123740 122331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29300 124922 123900 gene locus_tag LOCUS_29310 124922 123900 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962339.1 protein_id gnl|my_center|LOCUS_29310 125778 125008 gene locus_tag LOCUS_29320 125778 125008 CDS product capsular polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963406.1 protein_id gnl|my_center|LOCUS_29320 128310 125797 gene locus_tag LOCUS_29330 128310 125797 CDS product tyrosine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963407.1 protein_id gnl|my_center|LOCUS_29330 129249 128377 gene locus_tag LOCUS_29340 129249 128377 CDS product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963408.1 protein_id gnl|my_center|LOCUS_29340 129496 130701 gene locus_tag LOCUS_29350 gene acdA 129496 130701 CDS product acyl-CoA dehydrogenase AcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545544.1 protein_id gnl|my_center|LOCUS_29350 130876 131070 gene locus_tag LOCUS_29360 gene rpsU 130876 131070 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963322.1 protein_id gnl|my_center|LOCUS_29360 131234 132112 gene locus_tag LOCUS_29370 gene xerC 131234 132112 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804122.1 protein_id gnl|my_center|LOCUS_29370 132151 132450 gene locus_tag LOCUS_29380 gene raiA 132151 132450 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963320.1 protein_id gnl|my_center|LOCUS_29380 133837 132575 gene locus_tag LOCUS_29390 gene metK 133837 132575 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962442.1 protein_id gnl|my_center|LOCUS_29390 134080 134268 gene locus_tag LOCUS_29400 134080 134268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29400 136730 134265 gene locus_tag LOCUS_29410 136730 134265 CDS product beta-propeller fold lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928482.1 protein_id gnl|my_center|LOCUS_29410 139952 136815 gene locus_tag LOCUS_29420 139952 136815 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404654.1 protein_id gnl|my_center|LOCUS_29420 140299 140475 gene locus_tag LOCUS_29430 140299 140475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29430 141941 140733 gene locus_tag LOCUS_29440 141941 140733 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303089.1 protein_id gnl|my_center|LOCUS_29440 142546 141971 gene locus_tag LOCUS_29450 142546 141971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29450 142754 143557 gene locus_tag LOCUS_29460 142754 143557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29460 143696 145015 gene locus_tag LOCUS_29470 gene ahcY 143696 145015 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962366.1 protein_id gnl|my_center|LOCUS_29470 147277 145217 gene locus_tag LOCUS_29480 147277 145217 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140627.1 protein_id gnl|my_center|LOCUS_29480 145683 145780 gene locus_tag LOCUS_t00300 145683 145780 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 147434 147255 gene locus_tag LOCUS_29490 147434 147255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29490 148700 147567 gene locus_tag LOCUS_29500 148700 147567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29500 149792 148791 gene locus_tag LOCUS_29510 149792 148791 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_130541252.1 protein_id gnl|my_center|LOCUS_29510 150023 150601 gene locus_tag LOCUS_29520 150023 150601 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764419.1 protein_id gnl|my_center|LOCUS_29520 150698 151156 gene locus_tag LOCUS_29530 150698 151156 CDS product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964049.1 protein_id gnl|my_center|LOCUS_29530 151153 152004 gene locus_tag LOCUS_29540 151153 152004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29540 152131 152310 gene locus_tag LOCUS_29550 152131 152310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29550 153095 152397 gene locus_tag LOCUS_29560 153095 152397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29560 153653 153105 gene locus_tag LOCUS_29570 153653 153105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29570 154867 153809 gene locus_tag LOCUS_29580 154867 153809 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525885.1 protein_id gnl|my_center|LOCUS_29580 156274 155117 gene locus_tag LOCUS_29590 156274 155117 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188467563.1 protein_id gnl|my_center|LOCUS_29590 157036 156374 gene locus_tag LOCUS_29600 157036 156374 CDS product DUF1599 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963547.1 protein_id gnl|my_center|LOCUS_29600 157149 157949 gene locus_tag LOCUS_29610 gene folP 157149 157949 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767053.1 protein_id gnl|my_center|LOCUS_29610 158152 158370 gene locus_tag LOCUS_29620 158152 158370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29620 158590 159423 gene locus_tag LOCUS_29630 gene cdaA 158590 159423 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404681.1 protein_id gnl|my_center|LOCUS_29630 159636 159998 gene locus_tag LOCUS_29640 159636 159998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29640 161361 160114 gene locus_tag LOCUS_29650 gene kbl 161361 160114 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962334.1 protein_id gnl|my_center|LOCUS_29650 162051 162686 gene locus_tag LOCUS_29660 162051 162686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29660 162734 162967 gene locus_tag LOCUS_29670 162734 162967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29670 163356 163006 gene locus_tag LOCUS_29680 163356 163006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29680 163662 164657 gene locus_tag LOCUS_29690 163662 164657 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962368.1 protein_id gnl|my_center|LOCUS_29690 165676 164909 gene locus_tag LOCUS_29700 165676 164909 CDS product DUF475 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927143.1 protein_id gnl|my_center|LOCUS_29700 166423 167172 gene locus_tag LOCUS_29710 166423 167172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29710 167492 168460 gene locus_tag LOCUS_29720 167492 168460 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929456.1 protein_id gnl|my_center|LOCUS_29720 168698 169858 gene locus_tag LOCUS_29730 168698 169858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29730 171079 170000 gene locus_tag LOCUS_29740 gene rlmN 171079 170000 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964179.1 protein_id gnl|my_center|LOCUS_29740 171748 172683 gene locus_tag LOCUS_29750 171748 172683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29750 172947 175205 gene locus_tag LOCUS_29760 172947 175205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29760 175776 175348 gene locus_tag LOCUS_29770 175776 175348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29770 175798 176526 gene locus_tag LOCUS_29780 gene mnmD 175798 176526 CDS product tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108715.1 protein_id gnl|my_center|LOCUS_29780 176629 177897 gene locus_tag LOCUS_29790 176629 177897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29790 177890 178462 gene locus_tag LOCUS_29800 177890 178462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29800 179482 178508 gene locus_tag LOCUS_29810 179482 178508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29810 180581 179742 gene locus_tag LOCUS_29820 180581 179742 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763546.1 protein_id gnl|my_center|LOCUS_29820 181579 180752 gene locus_tag LOCUS_29830 181579 180752 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763546.1 protein_id gnl|my_center|LOCUS_29830 182037 181576 gene locus_tag LOCUS_29840 182037 181576 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964298.1 protein_id gnl|my_center|LOCUS_29840 182885 182301 gene locus_tag LOCUS_29850 182885 182301 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962396.1 protein_id gnl|my_center|LOCUS_29850 183791 182898 gene locus_tag LOCUS_29860 183791 182898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29860 185438 183837 gene locus_tag LOCUS_29870 gene bshC 185438 183837 CDS product bacillithiol biosynthesis cysteine-adding enzyme BshC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963529.1 protein_id gnl|my_center|LOCUS_29870 186967 185654 gene locus_tag LOCUS_29880 gene rimO 186967 185654 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963524.1 protein_id gnl|my_center|LOCUS_29880 187905 187201 gene locus_tag LOCUS_29890 187905 187201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29890 188223 187909 gene locus_tag LOCUS_29900 188223 187909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_29900 188609 188415 gene locus_tag LOCUS_29910 188609 188415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_29910 188565 188774 gene locus_tag LOCUS_29920 188565 188774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29920 189492 188803 gene locus_tag LOCUS_29930 189492 188803 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107709.1 protein_id gnl|my_center|LOCUS_29930 190360 189482 gene locus_tag LOCUS_29940 190360 189482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29940 190892 192229 gene locus_tag LOCUS_29950 190892 192229 CDS product erythromycin esterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903324.1 protein_id gnl|my_center|LOCUS_29950 192271 193632 gene locus_tag LOCUS_29960 192271 193632 CDS product erythromycin esterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903324.1 protein_id gnl|my_center|LOCUS_29960 194342 194085 gene locus_tag LOCUS_29970 194342 194085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29970 194656 194847 gene locus_tag LOCUS_29980 194656 194847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_29980 194899 195435 gene locus_tag LOCUS_29990 194899 195435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_29990 196575 195475 gene locus_tag LOCUS_30000 gene pheS 196575 195475 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763378.1 protein_id gnl|my_center|LOCUS_30000 196718 197356 gene locus_tag LOCUS_30010 196718 197356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30010 197580 198008 gene locus_tag LOCUS_30020 197580 198008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30020 198332 198694 gene locus_tag LOCUS_30030 198332 198694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30030 199005 198811 gene locus_tag LOCUS_30040 199005 198811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30040 199232 199537 gene locus_tag LOCUS_30050 199232 199537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30050 199666 200016 gene locus_tag LOCUS_30060 199666 200016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30060 202202 200967 gene locus_tag LOCUS_30070 202202 200967 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792023.1 protein_id gnl|my_center|LOCUS_30070 203526 202570 gene locus_tag LOCUS_30080 203526 202570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30080 204514 206577 gene locus_tag LOCUS_30090 204514 206577 CDS product dehydrogenase E1 component subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839420.1 protein_id gnl|my_center|LOCUS_30090 206760 207326 gene locus_tag LOCUS_30100 206760 207326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30100 207289 207621 gene locus_tag LOCUS_30110 207289 207621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30110 207818 208168 gene locus_tag LOCUS_30120 gene ytxJ 207818 208168 CDS product bacillithiol system redox-active protein YtxJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404063.1 protein_id gnl|my_center|LOCUS_30120 208604 208194 gene locus_tag LOCUS_30130 208604 208194 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964001.1 protein_id gnl|my_center|LOCUS_30130 208712 209542 gene locus_tag LOCUS_30140 208712 209542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30140 209726 210619 gene locus_tag LOCUS_30150 gene lipA 209726 210619 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963587.1 protein_id gnl|my_center|LOCUS_30150 211121 211459 gene locus_tag LOCUS_30160 211121 211459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30160 212144 211548 gene locus_tag LOCUS_30170 212144 211548 CDS product DUF4136 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039427.1 protein_id gnl|my_center|LOCUS_30170 215387 212469 gene locus_tag LOCUS_30180 gene gcvP 215387 212469 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012166094.1 protein_id gnl|my_center|LOCUS_30180 215597 216820 gene locus_tag LOCUS_30190 215597 216820 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962645.1 protein_id gnl|my_center|LOCUS_30190 217276 216866 gene locus_tag LOCUS_30200 217276 216866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30200 217582 217364 gene locus_tag LOCUS_30210 217582 217364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30210 218095 217844 gene locus_tag LOCUS_30220 218095 217844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30220 218896 218207 gene locus_tag LOCUS_30230 218896 218207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30230 219862 219167 gene locus_tag LOCUS_30240 219862 219167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30240 220318 220067 gene locus_tag LOCUS_30250 220318 220067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30250 220543 222114 gene locus_tag LOCUS_30260 220543 222114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30260 222573 222196 gene locus_tag LOCUS_30270 222573 222196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30270 222733 223131 gene locus_tag LOCUS_30280 222733 223131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30280 223247 224263 gene locus_tag LOCUS_30290 223247 224263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30290 224371 225378 gene locus_tag LOCUS_30300 224371 225378 CDS product DUF3089 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919309.1 protein_id gnl|my_center|LOCUS_30300 225706 225410 gene locus_tag LOCUS_30310 225706 225410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30310 226616 225780 gene locus_tag LOCUS_30320 gene tsf 226616 225780 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962622.1 protein_id gnl|my_center|LOCUS_30320 227532 226765 gene locus_tag LOCUS_30330 gene rpsB 227532 226765 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760802.1 protein_id gnl|my_center|LOCUS_30330 227937 227551 gene locus_tag LOCUS_30340 gene rpsI 227937 227551 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791749.1 protein_id gnl|my_center|LOCUS_30340 228491 228039 gene locus_tag LOCUS_30350 gene rplM 228491 228039 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962625.1 protein_id gnl|my_center|LOCUS_30350 228778 230166 gene locus_tag LOCUS_30360 228778 230166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30360 230886 230173 gene locus_tag LOCUS_30370 230886 230173 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680560.1 protein_id gnl|my_center|LOCUS_30370 232021 230951 gene locus_tag LOCUS_30380 232021 230951 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072879556.1 protein_id gnl|my_center|LOCUS_30380 232185 232730 gene locus_tag LOCUS_30390 232185 232730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30390 233499 232804 gene locus_tag LOCUS_30400 233499 232804 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962529.1 protein_id gnl|my_center|LOCUS_30400 234389 233598 gene locus_tag LOCUS_30410 234389 233598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30410 235255 234437 gene locus_tag LOCUS_30420 235255 234437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30420 236517 235420 gene locus_tag LOCUS_30430 gene recA 236517 235420 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964335.1 protein_id gnl|my_center|LOCUS_30430 236729 237931 gene locus_tag LOCUS_30440 236729 237931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30440 238570 238013 gene locus_tag LOCUS_30450 238570 238013 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114799.1 protein_id gnl|my_center|LOCUS_30450 238745 239449 gene locus_tag LOCUS_30460 238745 239449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30460 239498 240130 gene locus_tag LOCUS_30470 239498 240130 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765993.1 protein_id gnl|my_center|LOCUS_30470 240954 240529 gene locus_tag LOCUS_30480 240954 240529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30480 242012 241047 gene locus_tag LOCUS_30490 242012 241047 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963304.1 protein_id gnl|my_center|LOCUS_30490 243603 242140 gene locus_tag LOCUS_30500 243603 242140 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799064.1 protein_id gnl|my_center|LOCUS_30500 246096 243772 gene locus_tag LOCUS_30510 246096 243772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30510 246803 246390 gene locus_tag LOCUS_30520 246803 246390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30520 247282 246953 gene locus_tag LOCUS_30530 247282 246953 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820087.1 protein_id gnl|my_center|LOCUS_30530 249406 247298 gene locus_tag LOCUS_30540 249406 247298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30540 251066 249588 gene locus_tag LOCUS_30550 gene guaB 251066 249588 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404245.1 protein_id gnl|my_center|LOCUS_30550 251305 252156 gene locus_tag LOCUS_30560 251305 252156 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970106.1 protein_id gnl|my_center|LOCUS_30560 252268 253110 gene locus_tag LOCUS_30570 252268 253110 CDS product FRG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017872006.1 protein_id gnl|my_center|LOCUS_30570 256047 253327 gene locus_tag LOCUS_30580 gene hrpB 256047 253327 CDS product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169533525.1 protein_id gnl|my_center|LOCUS_30580 256836 256057 gene locus_tag LOCUS_30590 256836 256057 CDS product DUF2071 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399111.1 protein_id gnl|my_center|LOCUS_30590 257301 256969 gene locus_tag LOCUS_30600 257301 256969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30600 257344 257997 gene locus_tag LOCUS_30610 gene pnuC 257344 257997 CDS product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005088340.1 protein_id gnl|my_center|LOCUS_30610 259161 260051 gene locus_tag LOCUS_30620 259161 260051 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009932949.1 protein_id gnl|my_center|LOCUS_30620 260354 260130 gene locus_tag LOCUS_30630 260354 260130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30630 260846 262081 gene locus_tag LOCUS_30640 260846 262081 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962518.1 protein_id gnl|my_center|LOCUS_30640 262583 262173 gene locus_tag LOCUS_30650 262583 262173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30650 262869 263462 gene locus_tag LOCUS_30660 262869 263462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30660 263702 264049 gene locus_tag LOCUS_30670 263702 264049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30670 264148 265200 gene locus_tag LOCUS_30680 gene ruvB 264148 265200 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964224.1 protein_id gnl|my_center|LOCUS_30680 265405 266337 gene locus_tag LOCUS_30690 gene queG 265405 266337 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964223.1 protein_id gnl|my_center|LOCUS_30690 266753 266541 gene locus_tag LOCUS_30700 266753 266541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30700 267856 266954 gene locus_tag LOCUS_30710 267856 266954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30710 268621 267878 gene locus_tag LOCUS_30720 268621 267878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30720 269728 268775 gene locus_tag LOCUS_30730 269728 268775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30730 270566 269778 gene locus_tag LOCUS_30740 270566 269778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30740 272019 271192 gene locus_tag LOCUS_30750 272019 271192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30750 272795 272052 gene locus_tag LOCUS_30760 272795 272052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30760 273220 272990 gene locus_tag LOCUS_30770 273220 272990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30770 273126 274598 gene locus_tag LOCUS_30780 273126 274598 CDS product BatD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164034966.1 protein_id gnl|my_center|LOCUS_30780 274798 275916 gene locus_tag LOCUS_30790 gene aroC 274798 275916 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802245.1 protein_id gnl|my_center|LOCUS_30790 276134 276736 gene locus_tag LOCUS_30800 276134 276736 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383663.1 protein_id gnl|my_center|LOCUS_30800 277872 276961 gene locus_tag LOCUS_30810 277872 276961 CDS product DUF5777 family beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000576382.1 protein_id gnl|my_center|LOCUS_30810 278502 277912 gene locus_tag LOCUS_30820 278502 277912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30820 278903 278514 gene locus_tag LOCUS_30830 278903 278514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30830 280573 279026 gene locus_tag LOCUS_30840 280573 279026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30840 281171 280557 gene locus_tag LOCUS_30850 281171 280557 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786067.1 protein_id gnl|my_center|LOCUS_30850 284566 281558 gene locus_tag LOCUS_30860 gene secDF 284566 281558 CDS product protein translocase subunit SecDF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797413.1 protein_id gnl|my_center|LOCUS_30860 285127 284753 gene locus_tag LOCUS_30870 285127 284753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30870 285676 285215 gene locus_tag LOCUS_30880 285676 285215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30880 286275 285688 gene locus_tag LOCUS_30890 286275 285688 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141366.1 protein_id gnl|my_center|LOCUS_30890 286978 286352 gene locus_tag LOCUS_30900 gene udk 286978 286352 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963257.1 protein_id gnl|my_center|LOCUS_30900 287827 287234 gene locus_tag LOCUS_30910 287827 287234 CDS product non-canonical purine NTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963926.1 protein_id gnl|my_center|LOCUS_30910 288248 289078 gene locus_tag LOCUS_30920 288248 289078 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048127342.1 protein_id gnl|my_center|LOCUS_30920 289697 289966 gene locus_tag LOCUS_30930 289697 289966 CDS product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038339.1 protein_id gnl|my_center|LOCUS_30930 290395 291600 gene locus_tag LOCUS_30940 290395 291600 CDS product GlmU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963272.1 protein_id gnl|my_center|LOCUS_30940 291690 292820 gene locus_tag LOCUS_30950 291690 292820 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108989.1 protein_id gnl|my_center|LOCUS_30950 292886 293812 gene locus_tag LOCUS_30960 gene hemC 292886 293812 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930577.1 protein_id gnl|my_center|LOCUS_30960 293903 294568 gene locus_tag LOCUS_30970 293903 294568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30970 294722 295648 gene locus_tag LOCUS_30980 gene rfbD 294722 295648 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404591.1 protein_id gnl|my_center|LOCUS_30980 297395 296418 gene locus_tag LOCUS_30990 297395 296418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30990 298453 297383 gene locus_tag LOCUS_31000 298453 297383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31000 299851 298457 gene locus_tag LOCUS_31010 299851 298457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31010 300559 300335 gene locus_tag LOCUS_31020 300559 300335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31020 300994 302436 gene locus_tag LOCUS_31030 300994 302436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31030 302699 303229 gene locus_tag LOCUS_31040 302699 303229 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100847.1 protein_id gnl|my_center|LOCUS_31040 304745 303741 gene locus_tag LOCUS_31050 304745 303741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31050 305364 304759 gene locus_tag LOCUS_31060 305364 304759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31060 >Feature sequence34 195 1565 gene locus_tag LOCUS_31070 195 1565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31070 2011 2982 gene locus_tag LOCUS_31080 2011 2982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31080 3114 6548 gene locus_tag LOCUS_31090 3114 6548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31090 7294 6884 gene locus_tag LOCUS_31100 7294 6884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31100 8225 7353 gene locus_tag LOCUS_31110 8225 7353 CDS product cyanophycinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963249.1 protein_id gnl|my_center|LOCUS_31110 10085 8511 gene locus_tag LOCUS_31120 10085 8511 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064254970.1 protein_id gnl|my_center|LOCUS_31120 10762 10343 gene locus_tag LOCUS_31130 10762 10343 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868364.1 protein_id gnl|my_center|LOCUS_31130 10923 11735 gene locus_tag LOCUS_31140 10923 11735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31140 11943 13439 gene locus_tag LOCUS_31150 11943 13439 CDS product diadenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_150790356.1 protein_id gnl|my_center|LOCUS_31150 14098 13604 gene locus_tag LOCUS_31160 14098 13604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31160 16397 14421 gene locus_tag LOCUS_31170 16397 14421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31170 18480 16627 gene locus_tag LOCUS_31180 18480 16627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31180 19668 19081 gene locus_tag LOCUS_31190 19668 19081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31190 21136 19997 gene locus_tag LOCUS_31200 21136 19997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31200 22020 21283 gene locus_tag LOCUS_31210 22020 21283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31210 22794 22150 gene locus_tag LOCUS_31220 22794 22150 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964176.1 protein_id gnl|my_center|LOCUS_31220 22906 23298 gene locus_tag LOCUS_31230 22906 23298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31230 >Feature sequence35 615 43 gene locus_tag LOCUS_31240 615 43 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31240 1479 721 gene locus_tag LOCUS_31250 1479 721 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963826.1 protein_id gnl|my_center|LOCUS_31250 1699 2313 gene locus_tag LOCUS_31260 1699 2313 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963558.1 protein_id gnl|my_center|LOCUS_31260 2521 4503 gene locus_tag LOCUS_31270 2521 4503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31270 4582 5028 gene locus_tag LOCUS_31280 gene bcp 4582 5028 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932346.1 protein_id gnl|my_center|LOCUS_31280 5566 6450 gene locus_tag LOCUS_31290 5566 6450 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962842.1 protein_id gnl|my_center|LOCUS_31290 6598 7971 gene locus_tag LOCUS_31300 6598 7971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31300 8111 8467 gene locus_tag LOCUS_31310 8111 8467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31310 8620 9576 gene locus_tag LOCUS_31320 8620 9576 CDS product transketolase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962843.1 protein_id gnl|my_center|LOCUS_31320 12405 11539 gene locus_tag LOCUS_31330 12405 11539 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963866.1 protein_id gnl|my_center|LOCUS_31330 13045 12569 gene locus_tag LOCUS_31340 13045 12569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31340 13127 13276 gene locus_tag LOCUS_31350 13127 13276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31350 14022 13384 gene locus_tag LOCUS_31360 14022 13384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31360 14146 14694 gene locus_tag LOCUS_31370 14146 14694 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785402.1 protein_id gnl|my_center|LOCUS_31370 14771 15238 gene locus_tag LOCUS_31380 14771 15238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31380 15252 15734 gene locus_tag LOCUS_31390 15252 15734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31390 15961 17175 gene locus_tag LOCUS_31400 15961 17175 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963881.1 protein_id gnl|my_center|LOCUS_31400 >Feature sequence36 1176 6539 gene locus_tag LOCUS_31410 1176 6539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31410 6543 6938 gene locus_tag LOCUS_31420 6543 6938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31420 7190 7576 gene locus_tag LOCUS_31430 7190 7576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31430 7888 7685 gene locus_tag LOCUS_31440 7888 7685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31440 8629 10047 gene locus_tag LOCUS_31450 8629 10047 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022878.1 protein_id gnl|my_center|LOCUS_31450 11263 10364 gene locus_tag LOCUS_31460 11263 10364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31460 11556 12167 gene locus_tag LOCUS_31470 11556 12167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31470 13456 12557 gene locus_tag LOCUS_31480 13456 12557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31480 13650 13970 gene locus_tag LOCUS_31490 13650 13970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31490 13981 16146 gene locus_tag LOCUS_31500 gene feoB 13981 16146 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962270.1 protein_id gnl|my_center|LOCUS_31500 >Feature sequence37 <1 1178 gene locus_tag LOCUS_31510 <1 1178 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011763077.1:bifunctional alpha,alpha-trehalose-phosphate synthase (UDP-forming)/trehalose-phosphatase 3105 1303 gene locus_tag LOCUS_31520 3105 1303 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038196.1 protein_id gnl|my_center|LOCUS_31520 4944 3445 gene locus_tag LOCUS_31530 4944 3445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31530 7825 4973 gene locus_tag LOCUS_31540 7825 4973 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403216.1 protein_id gnl|my_center|LOCUS_31540 10024 8060 gene locus_tag LOCUS_31550 10024 8060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31550 10821 12593 gene locus_tag LOCUS_31560 10821 12593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31560 12939 13298 gene locus_tag LOCUS_31570 12939 13298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31570 <14803 13626 gene locus_tag LOCUS_31580 <14803 13626 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011763077.1:bifunctional alpha,alpha-trehalose-phosphate synthase (UDP-forming)/trehalose-phosphatase >Feature sequence38 3396 592 gene locus_tag LOCUS_31590 3396 592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31590 3808 3383 gene locus_tag LOCUS_31600 3808 3383 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008664252.1 protein_id gnl|my_center|LOCUS_31600 4389 4009 gene locus_tag LOCUS_31610 gene folB 4389 4009 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964579.1 protein_id gnl|my_center|LOCUS_31610 5879 4818 gene locus_tag LOCUS_31620 5879 4818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31620 6888 5953 gene locus_tag LOCUS_31630 6888 5953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31630 7605 7126 gene locus_tag LOCUS_31640 7605 7126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31640 7805 7978 gene locus_tag LOCUS_31650 7805 7978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31650 8430 9119 gene locus_tag LOCUS_31660 8430 9119 CDS product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303165.1 protein_id gnl|my_center|LOCUS_31660 9156 9740 gene locus_tag LOCUS_31670 9156 9740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31670 10789 9956 gene locus_tag LOCUS_31680 10789 9956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31680 11808 11161 gene locus_tag LOCUS_31690 11808 11161 CDS product ElyC/SanA/YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763153.1 protein_id gnl|my_center|LOCUS_31690 12033 11911 gene locus_tag LOCUS_31700 12033 11911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31700 12661 12065 gene locus_tag LOCUS_31710 12661 12065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31710 >Feature sequence39 258 2036 gene locus_tag LOCUS_31720 258 2036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31720 2189 2965 gene locus_tag LOCUS_31730 2189 2965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31730 2965 3789 gene locus_tag LOCUS_31740 2965 3789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31740 4947 3907 gene locus_tag LOCUS_31750 4947 3907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31750 5341 6354 gene locus_tag LOCUS_31760 5341 6354 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765092.1 protein_id gnl|my_center|LOCUS_31760 6529 8031 gene locus_tag LOCUS_31770 6529 8031 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963433.1 protein_id gnl|my_center|LOCUS_31770 8039 8521 gene locus_tag LOCUS_31780 8039 8521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31780 8645 10480 gene locus_tag LOCUS_31790 8645 10480 CDS product ABC transporter transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962990.1 protein_id gnl|my_center|LOCUS_31790 >Feature sequence40 220 149 gene locus_tag LOCUS_t00310 220 149 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 2428 335 gene locus_tag LOCUS_31800 gene rpsA 2428 335 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775782.1 protein_id gnl|my_center|LOCUS_31800 2707 2967 gene locus_tag LOCUS_31810 2707 2967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31810 2955 3290 gene locus_tag LOCUS_31820 2955 3290 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680107.1 protein_id gnl|my_center|LOCUS_31820 3410 4279 gene locus_tag LOCUS_31830 3410 4279 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768991.1 protein_id gnl|my_center|LOCUS_31830 5287 4391 gene locus_tag LOCUS_31840 5287 4391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31840 6675 5884 gene locus_tag LOCUS_31850 6675 5884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31850 7967 6765 gene locus_tag LOCUS_31860 7967 6765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31860 8113 9021 gene locus_tag LOCUS_31870 8113 9021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31870 10300 9233 gene locus_tag LOCUS_31880 10300 9233 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962582.1 protein_id gnl|my_center|LOCUS_31880 10855 10361 gene locus_tag LOCUS_31890 10855 10361 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403943.1 protein_id gnl|my_center|LOCUS_31890 >Feature sequence41 346 732 gene locus_tag LOCUS_31900 346 732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31900 885 1532 gene locus_tag LOCUS_31910 885 1532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31910 1571 2215 gene locus_tag LOCUS_31920 1571 2215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31920 2219 2548 gene locus_tag LOCUS_31930 2219 2548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31930 2903 5797 gene locus_tag LOCUS_31940 2903 5797 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921585.1 protein_id gnl|my_center|LOCUS_31940 6637 7434 gene locus_tag LOCUS_31950 6637 7434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31950 9916 7766 gene locus_tag LOCUS_31960 9916 7766 CDS product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814008.1 protein_id gnl|my_center|LOCUS_31960 >Feature sequence42 1650 2819 gene locus_tag LOCUS_31970 1650 2819 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927236.1 protein_id gnl|my_center|LOCUS_31970 5151 2866 gene locus_tag LOCUS_31980 5151 2866 CDS product BamA/TamA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766928.1 protein_id gnl|my_center|LOCUS_31980 10548 5284 gene locus_tag LOCUS_31990 10548 5284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31990 11177 12256 gene locus_tag LOCUS_32000 gene rlmG 11177 12256 CDS product 23S rRNA (guanine(1835)-N(2))-methyltransferase RlmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000018695.1 protein_id gnl|my_center|LOCUS_32000 13257 16055 gene locus_tag LOCUS_32010 13257 16055 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203461.1 protein_id gnl|my_center|LOCUS_32010 16796 24241 gene locus_tag LOCUS_32020 16796 24241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32020 24381 25301 gene locus_tag LOCUS_32030 24381 25301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32030 27751 25442 gene locus_tag LOCUS_32040 27751 25442 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032840909.1 protein_id gnl|my_center|LOCUS_32040 30691 28421 gene locus_tag LOCUS_32050 30691 28421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32050 31685 31311 gene locus_tag LOCUS_32060 31685 31311 CDS product DMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760318.1 protein_id gnl|my_center|LOCUS_32060 31877 32800 gene locus_tag LOCUS_32070 31877 32800 CDS product ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964090.1 protein_id gnl|my_center|LOCUS_32070 33885 32851 gene locus_tag LOCUS_32080 33885 32851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32080 34851 34243 gene locus_tag LOCUS_32090 gene def 34851 34243 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963863.1 protein_id gnl|my_center|LOCUS_32090 35385 34960 gene locus_tag LOCUS_32100 gene ruvX 35385 34960 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766074.1 protein_id gnl|my_center|LOCUS_32100 35893 37479 gene locus_tag LOCUS_32110 35893 37479 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303090.1 protein_id gnl|my_center|LOCUS_32110 37807 39012 gene locus_tag LOCUS_32120 37807 39012 CDS product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258372.1 protein_id gnl|my_center|LOCUS_32120 39082 39609 gene locus_tag LOCUS_32130 39082 39609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32130 39839 39651 gene locus_tag LOCUS_32140 39839 39651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32140 40294 40416 gene locus_tag LOCUS_32150 40294 40416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32150 40895 42145 gene locus_tag LOCUS_32160 40895 42145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32160 42617 44437 gene locus_tag LOCUS_32170 42617 44437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32170 46057 44495 gene locus_tag LOCUS_32180 46057 44495 CDS product hydroxymethylglutaryl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405139.1 protein_id gnl|my_center|LOCUS_32180 46556 47371 gene locus_tag LOCUS_32190 46556 47371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32190 47466 48248 gene locus_tag LOCUS_32200 47466 48248 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947156.1 protein_id gnl|my_center|LOCUS_32200 49023 48451 gene locus_tag LOCUS_32210 49023 48451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32210 50270 49443 gene locus_tag LOCUS_32220 50270 49443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32220 50412 50576 gene locus_tag LOCUS_32230 50412 50576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32230 50867 50673 gene locus_tag LOCUS_32240 50867 50673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_32240 51137 50961 gene locus_tag LOCUS_32250 51137 50961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32250 52807 51692 gene locus_tag LOCUS_32260 52807 51692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32260 54044 56491 gene locus_tag LOCUS_32270 54044 56491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32270 57179 56574 gene locus_tag LOCUS_32280 57179 56574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32280 58152 57394 gene locus_tag LOCUS_32290 58152 57394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32290 59288 58827 gene locus_tag LOCUS_32300 59288 58827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32300 59813 59322 gene locus_tag LOCUS_32310 59813 59322 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962214.1 protein_id gnl|my_center|LOCUS_32310 61051 59810 gene locus_tag LOCUS_32320 61051 59810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32320 62213 61266 gene locus_tag LOCUS_32330 62213 61266 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528466.1 protein_id gnl|my_center|LOCUS_32330 62595 63965 gene locus_tag LOCUS_32340 62595 63965 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225277.1 protein_id gnl|my_center|LOCUS_32340 64349 64726 gene locus_tag LOCUS_32350 64349 64726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32350 66132 65146 gene locus_tag LOCUS_32360 gene hemB 66132 65146 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056277.1 protein_id gnl|my_center|LOCUS_32360 66394 66239 gene locus_tag LOCUS_32370 66394 66239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32370 66384 66605 gene locus_tag LOCUS_32380 66384 66605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32380 67971 66832 gene locus_tag LOCUS_32390 67971 66832 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191163231.1 protein_id gnl|my_center|LOCUS_32390 69310 68060 gene locus_tag LOCUS_32400 gene rocD 69310 68060 CDS product ornithine--oxo-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962898.1 protein_id gnl|my_center|LOCUS_32400 70340 69495 gene locus_tag LOCUS_32410 70340 69495 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043629595.1 protein_id gnl|my_center|LOCUS_32410 70929 71168 gene locus_tag LOCUS_32420 gene rpmB 70929 71168 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963554.1 protein_id gnl|my_center|LOCUS_32420 71325 72974 gene locus_tag LOCUS_32430 71325 72974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32430 73243 73425 gene locus_tag LOCUS_32440 gene rpmG 73243 73425 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002560155.1 protein_id gnl|my_center|LOCUS_32440 73434 73598 gene locus_tag LOCUS_32450 73434 73598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32450 73770 74741 gene locus_tag LOCUS_32460 gene ftsY 73770 74741 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787934.1 protein_id gnl|my_center|LOCUS_32460 74934 75785 gene locus_tag LOCUS_32470 74934 75785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32470 75778 76272 gene locus_tag LOCUS_32480 75778 76272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32480 76383 76457 gene locus_tag LOCUS_t00320 76383 76457 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 76943 78784 gene locus_tag LOCUS_32490 76943 78784 CDS product KAP family P-loop domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010884100.1 protein_id gnl|my_center|LOCUS_32490 78789 79667 gene locus_tag LOCUS_32500 78789 79667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32500 79680 81086 gene locus_tag LOCUS_32510 79680 81086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32510 81089 81838 gene locus_tag LOCUS_32520 81089 81838 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974283.1 protein_id gnl|my_center|LOCUS_32520 82172 82930 gene locus_tag LOCUS_32530 82172 82930 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880570.1 protein_id gnl|my_center|LOCUS_32530 84053 83184 gene locus_tag LOCUS_32540 84053 83184 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225309.1 protein_id gnl|my_center|LOCUS_32540 84543 84121 gene locus_tag LOCUS_32550 84543 84121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32550 85467 84553 gene locus_tag LOCUS_32560 85467 84553 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765597.1 protein_id gnl|my_center|LOCUS_32560 86093 85785 gene locus_tag LOCUS_32570 86093 85785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32570 86723 86133 gene locus_tag LOCUS_32580 86723 86133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32580 87175 87741 gene locus_tag LOCUS_32590 87175 87741 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530118.1 protein_id gnl|my_center|LOCUS_32590 88093 87893 gene locus_tag LOCUS_32600 88093 87893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32600 88550 88633 gene locus_tag LOCUS_t00330 88550 88633 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 88639 88711 gene locus_tag LOCUS_t00340 88639 88711 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 88717 88788 gene locus_tag LOCUS_t00350 88717 88788 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 88793 88876 gene locus_tag LOCUS_t00360 88793 88876 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 88881 88965 gene locus_tag LOCUS_t00370 88881 88965 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 90202 89108 gene locus_tag LOCUS_32610 90202 89108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32610 90846 91499 gene locus_tag LOCUS_32620 gene mubP 90846 91499 CDS product mutanobactin A biosynthesis phosphopantetheinyl transferase MubP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002267537.1 protein_id gnl|my_center|LOCUS_32620 93362 91722 gene locus_tag LOCUS_32630 93362 91722 CDS product cyclic peptide export ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057486.1 protein_id gnl|my_center|LOCUS_32630 94461 93433 gene locus_tag LOCUS_32640 94461 93433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32640 102966 94495 gene locus_tag LOCUS_32650 102966 94495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32650 107760 103267 gene locus_tag LOCUS_32660 107760 103267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32660 110945 107781 gene locus_tag LOCUS_32670 110945 107781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32670 117934 110957 gene locus_tag LOCUS_32680 117934 110957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32680 119770 119045 gene locus_tag LOCUS_32690 119770 119045 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525108.1 protein_id gnl|my_center|LOCUS_32690 120922 121443 gene locus_tag LOCUS_32700 120922 121443 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203441.1 protein_id gnl|my_center|LOCUS_32700 121569 122300 gene locus_tag LOCUS_32710 121569 122300 CDS product head GIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956832.1 protein_id gnl|my_center|LOCUS_32710 122402 123457 gene locus_tag LOCUS_32720 122402 123457 CDS product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108957.1 protein_id gnl|my_center|LOCUS_32720 124038 125243 gene locus_tag LOCUS_32730 124038 125243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32730 125593 125270 gene locus_tag LOCUS_32740 125593 125270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32740 126577 126221 gene locus_tag LOCUS_32750 126577 126221 CDS product glyoxalase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000632398.1 protein_id gnl|my_center|LOCUS_32750 127879 127319 gene locus_tag LOCUS_32760 127879 127319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32760 128571 128389 gene locus_tag LOCUS_32770 128571 128389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32770 129061 128582 gene locus_tag LOCUS_32780 129061 128582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_32780 129384 129187 gene locus_tag LOCUS_32790 129384 129187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32790 132129 129388 gene locus_tag LOCUS_32800 132129 129388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32800 133125 133343 gene locus_tag LOCUS_32810 133125 133343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32810 133385 134362 gene locus_tag LOCUS_32820 133385 134362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32820 134861 134649 gene locus_tag LOCUS_32830 134861 134649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32830 134778 136664 gene locus_tag LOCUS_32840 134778 136664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32840 137273 136731 gene locus_tag LOCUS_32850 137273 136731 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034100451.1 protein_id gnl|my_center|LOCUS_32850 137607 137377 gene locus_tag LOCUS_32860 137607 137377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32860 138935 137736 gene locus_tag LOCUS_32870 138935 137736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32870 139066 139830 gene locus_tag LOCUS_32880 139066 139830 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001239224.1 protein_id gnl|my_center|LOCUS_32880 139827 140885 gene locus_tag LOCUS_32890 139827 140885 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704186.1 protein_id gnl|my_center|LOCUS_32890 141181 141825 gene locus_tag LOCUS_32900 141181 141825 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932332.1 protein_id gnl|my_center|LOCUS_32900 141901 142200 gene locus_tag LOCUS_32910 141901 142200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32910 142230 142814 gene locus_tag LOCUS_32920 gene gmk 142230 142814 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962519.1 protein_id gnl|my_center|LOCUS_32920 142811 143407 gene locus_tag LOCUS_32930 gene nadD 142811 143407 CDS product nicotinate (nicotinamide) nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116975564.1 protein_id gnl|my_center|LOCUS_32930 144048 143485 gene locus_tag LOCUS_32940 gene frr 144048 143485 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962605.1 protein_id gnl|my_center|LOCUS_32940 144951 144151 gene locus_tag LOCUS_32950 gene pyrH 144951 144151 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962604.1 protein_id gnl|my_center|LOCUS_32950 145496 144993 gene locus_tag LOCUS_32960 145496 144993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32960 145594 148182 gene locus_tag LOCUS_32970 145594 148182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32970 148353 148433 gene locus_tag LOCUS_t00380 148353 148433 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 148501 148574 gene locus_tag LOCUS_t00390 148501 148574 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 148666 148738 gene locus_tag LOCUS_t00400 148666 148738 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 148905 150095 gene locus_tag LOCUS_32980 gene tuf 148905 150095 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762026.1 protein_id gnl|my_center|LOCUS_32980 150458 150529 gene locus_tag LOCUS_t00410 150458 150529 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 150593 150787 gene locus_tag LOCUS_32990 150593 150787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32990 150800 151366 gene locus_tag LOCUS_33000 gene nusG 150800 151366 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782159.1 protein_id gnl|my_center|LOCUS_33000 151561 152004 gene locus_tag LOCUS_33010 gene rplK 151561 152004 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963316.1 protein_id gnl|my_center|LOCUS_33010 152023 152721 gene locus_tag LOCUS_33020 gene rplA 152023 152721 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963315.1 protein_id gnl|my_center|LOCUS_33020 152737 153285 gene locus_tag LOCUS_33030 gene rplJ 152737 153285 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791518.1 protein_id gnl|my_center|LOCUS_33030 153351 153734 gene locus_tag LOCUS_33040 gene rplL 153351 153734 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558082.1 protein_id gnl|my_center|LOCUS_33040 153982 157881 gene locus_tag LOCUS_33050 gene rpoB 153982 157881 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963312.1 protein_id gnl|my_center|LOCUS_33050 158298 162650 gene locus_tag LOCUS_33060 gene rpoC 158298 162650 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804126.1 protein_id gnl|my_center|LOCUS_33060 162778 163203 gene locus_tag LOCUS_33070 162778 163203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33070 163211 163363 gene locus_tag LOCUS_33080 163211 163363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33080 163455 163643 gene locus_tag LOCUS_33090 163455 163643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33090 163628 164206 gene locus_tag LOCUS_33100 163628 164206 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807613.1 protein_id gnl|my_center|LOCUS_33100 164214 164537 gene locus_tag LOCUS_33110 164214 164537 CDS product DUF3467 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963310.1 protein_id gnl|my_center|LOCUS_33110 164867 165295 gene locus_tag LOCUS_33120 gene rpsL 164867 165295 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005675419.1 protein_id gnl|my_center|LOCUS_33120 165428 165865 gene locus_tag LOCUS_33130 gene rpsG 165428 165865 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963472.1 protein_id gnl|my_center|LOCUS_33130 165977 168115 gene locus_tag LOCUS_33140 gene fusA 165977 168115 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963471.1 protein_id gnl|my_center|LOCUS_33140 168154 168459 gene locus_tag LOCUS_33150 gene rpsJ 168154 168459 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963470.1 protein_id gnl|my_center|LOCUS_33150 169123 168944 gene locus_tag LOCUS_33160 169123 168944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33160 169497 183287 gene locus_tag LOCUS_33170 169497 183287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33170 183421 184290 gene locus_tag LOCUS_33180 183421 184290 CDS product type IX secretion system membrane protein PorP/SprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962491.1 protein_id gnl|my_center|LOCUS_33180 184493 184942 gene locus_tag LOCUS_33190 184493 184942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33190 185072 186346 gene locus_tag LOCUS_33200 185072 186346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33200 186537 187157 gene locus_tag LOCUS_33210 gene rplC 186537 187157 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762034.1 protein_id gnl|my_center|LOCUS_33210 187166 187804 gene locus_tag LOCUS_33220 gene rplD 187166 187804 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762035.1 protein_id gnl|my_center|LOCUS_33220 187804 188091 gene locus_tag LOCUS_33230 gene rplW 187804 188091 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007747932.1 protein_id gnl|my_center|LOCUS_33230 188288 188971 gene locus_tag LOCUS_33240 gene rplB 188288 188971 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765427.1 protein_id gnl|my_center|LOCUS_33240 188975 189253 gene locus_tag LOCUS_33250 gene rpsS 188975 189253 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782197.1 protein_id gnl|my_center|LOCUS_33250 189255 189668 gene locus_tag LOCUS_33260 gene rplV 189255 189668 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558069.1 protein_id gnl|my_center|LOCUS_33260 189676 190536 gene locus_tag LOCUS_33270 189676 190536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33270 190640 191065 gene locus_tag LOCUS_33280 gene rplP 190640 191065 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791549.1 protein_id gnl|my_center|LOCUS_33280 191067 191282 gene locus_tag LOCUS_33290 191067 191282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33290 191286 191582 gene locus_tag LOCUS_33300 gene rpsQ 191286 191582 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770213.1 protein_id gnl|my_center|LOCUS_33300 191592 191960 gene locus_tag LOCUS_33310 gene rplN 191592 191960 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963460.1 protein_id gnl|my_center|LOCUS_33310 191964 192308 gene locus_tag LOCUS_33320 191964 192308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33320 192324 192872 gene locus_tag LOCUS_33330 gene rplE 192324 192872 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001080831.1 protein_id gnl|my_center|LOCUS_33330 192885 193154 gene locus_tag LOCUS_33340 gene rpsN 192885 193154 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963457.1 protein_id gnl|my_center|LOCUS_33340 193455 194615 gene locus_tag LOCUS_33350 193455 194615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33350 195180 194929 gene locus_tag LOCUS_33360 195180 194929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33360 198228 195598 gene locus_tag LOCUS_33370 198228 195598 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838916.1 protein_id gnl|my_center|LOCUS_33370 199661 198306 gene locus_tag LOCUS_33380 199661 198306 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022835601.1 protein_id gnl|my_center|LOCUS_33380 202714 199673 gene locus_tag LOCUS_33390 202714 199673 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_185958394.1 protein_id gnl|my_center|LOCUS_33390 205124 204003 gene locus_tag LOCUS_33400 205124 204003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33400 205525 205370 gene locus_tag LOCUS_33410 205525 205370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33410 206898 205783 gene locus_tag LOCUS_33420 206898 205783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33420 207827 207123 gene locus_tag LOCUS_33430 207827 207123 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764714.1 protein_id gnl|my_center|LOCUS_33430 208666 207812 gene locus_tag LOCUS_33440 208666 207812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33440 209601 211478 gene locus_tag LOCUS_33450 209601 211478 CDS product M1 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962262.1 protein_id gnl|my_center|LOCUS_33450 213245 211674 gene locus_tag LOCUS_33460 213245 211674 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767239.1 protein_id gnl|my_center|LOCUS_33460 216229 213266 gene locus_tag LOCUS_33470 216229 213266 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_185958394.1 protein_id gnl|my_center|LOCUS_33470 217123 218166 gene locus_tag LOCUS_33480 217123 218166 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206578673.1 protein_id gnl|my_center|LOCUS_33480 218380 219105 gene locus_tag LOCUS_33490 218380 219105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33490 219164 220726 gene locus_tag LOCUS_33500 219164 220726 CDS product S8 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729637.1 protein_id gnl|my_center|LOCUS_33500 220913 222277 gene locus_tag LOCUS_33510 220913 222277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094616.1 protein_id gnl|my_center|LOCUS_33510 222340 222996 gene locus_tag LOCUS_33520 222340 222996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33520 223710 224108 gene locus_tag LOCUS_33530 gene rpsH 223710 224108 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963456.1 protein_id gnl|my_center|LOCUS_33530 224136 224690 gene locus_tag LOCUS_33540 gene rplF 224136 224690 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963455.1 protein_id gnl|my_center|LOCUS_33540 224700 225050 gene locus_tag LOCUS_33550 gene rplR 224700 225050 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000624044.1 protein_id gnl|my_center|LOCUS_33550 225057 225632 gene locus_tag LOCUS_33560 gene rpsE 225057 225632 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762045.1 protein_id gnl|my_center|LOCUS_33560 225639 225818 gene locus_tag LOCUS_33570 gene rpmD 225639 225818 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004296332.1 protein_id gnl|my_center|LOCUS_33570 225831 226280 gene locus_tag LOCUS_33580 gene rplO 225831 226280 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762046.1 protein_id gnl|my_center|LOCUS_33580 226296 227615 gene locus_tag LOCUS_33590 gene secY 226296 227615 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762047.1 protein_id gnl|my_center|LOCUS_33590 227616 228410 gene locus_tag LOCUS_33600 gene map 227616 228410 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962588.1 protein_id gnl|my_center|LOCUS_33600 228477 228695 gene locus_tag LOCUS_33610 gene infA 228477 228695 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558052.1 protein_id gnl|my_center|LOCUS_33610 228933 229310 gene locus_tag LOCUS_33620 gene rpsM 228933 229310 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558050.1 protein_id gnl|my_center|LOCUS_33620 229465 229857 gene locus_tag LOCUS_33630 gene rpsK 229465 229857 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963447.1 protein_id gnl|my_center|LOCUS_33630 229884 230489 gene locus_tag LOCUS_33640 gene rpsD 229884 230489 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791575.1 protein_id gnl|my_center|LOCUS_33640 230601 231569 gene locus_tag LOCUS_33650 230601 231569 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963445.1 protein_id gnl|my_center|LOCUS_33650 231854 232405 gene locus_tag LOCUS_33660 231854 232405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33660 232668 233939 gene locus_tag LOCUS_33670 gene eno 232668 233939 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963441.1 protein_id gnl|my_center|LOCUS_33670 234017 234331 gene locus_tag LOCUS_33680 234017 234331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33680 234368 234625 gene locus_tag LOCUS_33690 234368 234625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33690 235995 234586 gene locus_tag LOCUS_33700 235995 234586 CDS product pyridoxal-dependent decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224881.1 protein_id gnl|my_center|LOCUS_33700 236859 236095 gene locus_tag LOCUS_33710 236859 236095 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249096.1 protein_id gnl|my_center|LOCUS_33710 237246 238682 gene locus_tag LOCUS_33720 237246 238682 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940696.1 protein_id gnl|my_center|LOCUS_33720 240359 240204 gene locus_tag LOCUS_33730 240359 240204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33730 241572 240421 gene locus_tag LOCUS_33740 241572 240421 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259711.1 protein_id gnl|my_center|LOCUS_33740 243828 241936 gene locus_tag LOCUS_33750 gene hscA 243828 241936 CDS product Fe-S protein assembly chaperone HscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693792.1 protein_id gnl|my_center|LOCUS_33750 242798 242880 gene locus_tag LOCUS_t00420 242798 242880 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 244202 246313 gene locus_tag LOCUS_33760 244202 246313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33760 246413 247756 gene locus_tag LOCUS_33770 246413 247756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33770 247960 247778 gene locus_tag LOCUS_33780 247960 247778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33780 248215 248874 gene locus_tag LOCUS_33790 248215 248874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33790 249298 249140 gene locus_tag LOCUS_33800 249298 249140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33800 249678 251993 gene locus_tag LOCUS_33810 249678 251993 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919029.1 protein_id gnl|my_center|LOCUS_33810 253619 252480 gene locus_tag LOCUS_33820 253619 252480 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001066853.1 protein_id gnl|my_center|LOCUS_33820 254272 253712 gene locus_tag LOCUS_33830 254272 253712 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966608.1 protein_id gnl|my_center|LOCUS_33830 256842 254464 gene locus_tag LOCUS_33840 256842 254464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33840 257231 258136 gene locus_tag LOCUS_33850 257231 258136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33850 258273 259139 gene locus_tag LOCUS_33860 258273 259139 CDS product murein L,D-transpeptidase catalytic domain family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964232.1 protein_id gnl|my_center|LOCUS_33860 259360 261165 gene locus_tag LOCUS_33870 259360 261165 CDS product family 10 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000635991.1 protein_id gnl|my_center|LOCUS_33870 262257 261196 gene locus_tag LOCUS_33880 262257 261196 CDS product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867978.1 protein_id gnl|my_center|LOCUS_33880 263467 262679 gene locus_tag LOCUS_33890 263467 262679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33890 264455 263505 gene locus_tag LOCUS_33900 264455 263505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33900 265012 264452 gene locus_tag LOCUS_33910 265012 264452 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640141.1 protein_id gnl|my_center|LOCUS_33910 265969 265085 gene locus_tag LOCUS_33920 265969 265085 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434910.1 protein_id gnl|my_center|LOCUS_33920 266243 266731 gene locus_tag LOCUS_33930 266243 266731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33930 266907 267698 gene locus_tag LOCUS_33940 gene dapF 266907 267698 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135464474.1 protein_id gnl|my_center|LOCUS_33940 267741 268280 gene locus_tag LOCUS_33950 267741 268280 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963346.1 protein_id gnl|my_center|LOCUS_33950 268571 269770 gene locus_tag LOCUS_33960 268571 269770 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038780.1 protein_id gnl|my_center|LOCUS_33960 269839 271017 gene locus_tag LOCUS_33970 gene glf 269839 271017 CDS product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017872005.1 protein_id gnl|my_center|LOCUS_33970 271409 272794 gene locus_tag LOCUS_33980 271409 272794 CDS product family 1 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142001.1 protein_id gnl|my_center|LOCUS_33980 272784 273683 gene locus_tag LOCUS_33990 gene rfbD 272784 273683 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417101.1 protein_id gnl|my_center|LOCUS_33990 273865 277266 gene locus_tag LOCUS_34000 gene secA 273865 277266 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962742.1 protein_id gnl|my_center|LOCUS_34000 277891 277328 gene locus_tag LOCUS_34010 277891 277328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34010 279053 277884 gene locus_tag LOCUS_34020 279053 277884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34020 279181 279849 gene locus_tag LOCUS_34030 gene deoC 279181 279849 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389958.1 protein_id gnl|my_center|LOCUS_34030 279851 280396 gene locus_tag LOCUS_34040 279851 280396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34040 280719 281999 gene locus_tag LOCUS_34050 280719 281999 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403533.1 protein_id gnl|my_center|LOCUS_34050 282087 282911 gene locus_tag LOCUS_34060 282087 282911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34060 283155 283676 gene locus_tag LOCUS_34070 283155 283676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34070 283915 285417 gene locus_tag LOCUS_34080 283915 285417 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538536.1 protein_id gnl|my_center|LOCUS_34080 285844 286230 gene locus_tag LOCUS_34090 285844 286230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34090 286383 287990 gene locus_tag LOCUS_34100 286383 287990 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964414.1 protein_id gnl|my_center|LOCUS_34100 288202 288083 gene locus_tag LOCUS_34110 288202 288083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34110 >Feature sequence43 244 41 gene locus_tag LOCUS_34120 244 41 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34120 1902 274 gene locus_tag LOCUS_34130 1902 274 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963147.1 protein_id gnl|my_center|LOCUS_34130 3086 2079 gene locus_tag LOCUS_34140 3086 2079 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759761.1 protein_id gnl|my_center|LOCUS_34140 4058 3225 gene locus_tag LOCUS_34150 4058 3225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34150 4190 7297 gene locus_tag LOCUS_34160 4190 7297 CDS product putative LPS assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108148.1 protein_id gnl|my_center|LOCUS_34160 7581 8396 gene locus_tag LOCUS_34170 gene panB 7581 8396 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963041.1 protein_id gnl|my_center|LOCUS_34170 8857 8483 gene locus_tag LOCUS_34180 8857 8483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34180 9325 10035 gene locus_tag LOCUS_34190 9325 10035 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792014.1 protein_id gnl|my_center|LOCUS_34190 10117 10353 gene locus_tag LOCUS_34200 10117 10353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34200 10442 11056 gene locus_tag LOCUS_34210 10442 11056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34210 11231 11986 gene locus_tag LOCUS_34220 11231 11986 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000511395.1 protein_id gnl|my_center|LOCUS_34220 12147 12683 gene locus_tag LOCUS_34230 12147 12683 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962515.1 protein_id gnl|my_center|LOCUS_34230 12775 13338 gene locus_tag LOCUS_34240 gene rimM 12775 13338 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965064.1 protein_id gnl|my_center|LOCUS_34240 13424 14098 gene locus_tag LOCUS_34250 gene trmD 13424 14098 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963979.1 protein_id gnl|my_center|LOCUS_34250 14266 14646 gene locus_tag LOCUS_34260 gene rplS 14266 14646 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870154.1 protein_id gnl|my_center|LOCUS_34260 15176 14769 gene locus_tag LOCUS_34270 15176 14769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34270 16024 15317 gene locus_tag LOCUS_34280 16024 15317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34280 16290 16697 gene locus_tag LOCUS_34290 16290 16697 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963898.1 protein_id gnl|my_center|LOCUS_34290 16690 17349 gene locus_tag LOCUS_34300 gene folE 16690 17349 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962758.1 protein_id gnl|my_center|LOCUS_34300 17448 18380 gene locus_tag LOCUS_34310 17448 18380 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962832.1 protein_id gnl|my_center|LOCUS_34310 19753 18611 gene locus_tag LOCUS_34320 19753 18611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34320 20722 20036 gene locus_tag LOCUS_34330 20722 20036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34330 23238 20944 gene locus_tag LOCUS_34340 23238 20944 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962206.1 protein_id gnl|my_center|LOCUS_34340 23923 23465 gene locus_tag LOCUS_34350 23923 23465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34350 24274 24005 gene locus_tag LOCUS_34360 24274 24005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34360 24546 24325 gene locus_tag LOCUS_34370 24546 24325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34370 26449 24908 gene locus_tag LOCUS_34380 26449 24908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34380 27396 26554 gene locus_tag LOCUS_34390 27396 26554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34390 29029 27578 gene locus_tag LOCUS_34400 29029 27578 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392350.1 protein_id gnl|my_center|LOCUS_34400 29678 29094 gene locus_tag LOCUS_34410 29678 29094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34410 30098 29805 gene locus_tag LOCUS_34420 30098 29805 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763041.1 protein_id gnl|my_center|LOCUS_34420 30772 30095 gene locus_tag LOCUS_34430 30772 30095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34430 31121 30939 gene locus_tag LOCUS_34440 31121 30939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34440 31591 32385 gene locus_tag LOCUS_34450 31591 32385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34450 32575 33447 gene locus_tag LOCUS_34460 32575 33447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34460 33536 34162 gene locus_tag LOCUS_34470 33536 34162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34470 34893 34219 gene locus_tag LOCUS_34480 34893 34219 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000448622.1 protein_id gnl|my_center|LOCUS_34480 37385 35139 gene locus_tag LOCUS_34490 37385 35139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34490 37819 39093 gene locus_tag LOCUS_34500 gene serS 37819 39093 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759982.1 protein_id gnl|my_center|LOCUS_34500 40251 39232 gene locus_tag LOCUS_34510 40251 39232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34510 41643 40579 gene locus_tag LOCUS_34520 41643 40579 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933791.1 protein_id gnl|my_center|LOCUS_34520 43623 41869 gene locus_tag LOCUS_34530 43623 41869 CDS product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839088.1 protein_id gnl|my_center|LOCUS_34530 43767 44180 gene locus_tag LOCUS_34540 43767 44180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34540 44620 45072 gene locus_tag LOCUS_34550 44620 45072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34550 45170 46183 gene locus_tag LOCUS_34560 45170 46183 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_059223299.1 protein_id gnl|my_center|LOCUS_34560 46200 46436 gene locus_tag LOCUS_34570 46200 46436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34570 46522 47919 gene locus_tag LOCUS_34580 46522 47919 CDS product DUF3570 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963601.1 protein_id gnl|my_center|LOCUS_34580 48010 48420 gene locus_tag LOCUS_34590 48010 48420 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174950.1 protein_id gnl|my_center|LOCUS_34590 48527 50122 gene locus_tag LOCUS_34600 48527 50122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34600 50233 50787 gene locus_tag LOCUS_34610 50233 50787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34610 52165 50876 gene locus_tag LOCUS_34620 52165 50876 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962330.1 protein_id gnl|my_center|LOCUS_34620 52933 52604 gene locus_tag LOCUS_34630 gene trxA 52933 52604 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962434.1 protein_id gnl|my_center|LOCUS_34630 53212 54705 gene locus_tag LOCUS_34640 53212 54705 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048068.1 protein_id gnl|my_center|LOCUS_34640 54824 55732 gene locus_tag LOCUS_34650 54824 55732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203219.1 protein_id gnl|my_center|LOCUS_34650 59533 55850 gene locus_tag LOCUS_34660 gene dnaE 59533 55850 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962512.1 protein_id gnl|my_center|LOCUS_34660 62357 60009 gene locus_tag LOCUS_34670 62357 60009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34670 65427 62509 gene locus_tag LOCUS_34680 65427 62509 CDS product carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962441.1 protein_id gnl|my_center|LOCUS_34680 66317 65673 gene locus_tag LOCUS_34690 66317 65673 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964180.1 protein_id gnl|my_center|LOCUS_34690 66900 66451 gene locus_tag LOCUS_34700 66900 66451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34700 68135 66897 gene locus_tag LOCUS_34710 68135 66897 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769163.1 protein_id gnl|my_center|LOCUS_34710 69472 68399 gene locus_tag LOCUS_34720 69472 68399 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001967602.1 protein_id gnl|my_center|LOCUS_34720 70009 69545 gene locus_tag LOCUS_34730 70009 69545 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359806.1 protein_id gnl|my_center|LOCUS_34730 72592 70358 gene locus_tag LOCUS_34740 72592 70358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34740 72841 74175 gene locus_tag LOCUS_34750 72841 74175 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964731.1 protein_id gnl|my_center|LOCUS_34750 74438 74226 gene locus_tag LOCUS_34760 74438 74226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34760 75301 74654 gene locus_tag LOCUS_34770 75301 74654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34770 75993 75424 gene locus_tag LOCUS_34780 75993 75424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34780 76923 76405 gene locus_tag LOCUS_34790 76923 76405 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964199.1 protein_id gnl|my_center|LOCUS_34790 78007 77021 gene locus_tag LOCUS_34800 78007 77021 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057690.1 protein_id gnl|my_center|LOCUS_34800 78892 78119 gene locus_tag LOCUS_34810 78892 78119 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889063.1 protein_id gnl|my_center|LOCUS_34810 79706 79029 gene locus_tag LOCUS_34820 79706 79029 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927022.1 protein_id gnl|my_center|LOCUS_34820 80243 79941 gene locus_tag LOCUS_34830 80243 79941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34830 81155 80445 gene locus_tag LOCUS_34840 81155 80445 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927022.1 protein_id gnl|my_center|LOCUS_34840 82212 81307 gene locus_tag LOCUS_34850 gene accD 82212 81307 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962493.1 protein_id gnl|my_center|LOCUS_34850 83397 82351 gene locus_tag LOCUS_34860 83397 82351 CDS product class I fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004295283.1 protein_id gnl|my_center|LOCUS_34860 83585 84592 gene locus_tag LOCUS_34870 83585 84592 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962242.1 protein_id gnl|my_center|LOCUS_34870 84784 85758 gene locus_tag LOCUS_34880 84784 85758 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000870126.1 protein_id gnl|my_center|LOCUS_34880 86170 86000 gene locus_tag LOCUS_34890 86170 86000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34890 86399 86593 gene locus_tag LOCUS_34900 86399 86593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34900 89534 86625 gene locus_tag LOCUS_34910 89534 86625 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162890684.1 protein_id gnl|my_center|LOCUS_34910 90271 89738 gene locus_tag LOCUS_34920 90271 89738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34920 91664 90807 gene locus_tag LOCUS_34930 91664 90807 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467799.1 protein_id gnl|my_center|LOCUS_34930 93072 91933 gene locus_tag LOCUS_34940 93072 91933 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962525.1 protein_id gnl|my_center|LOCUS_34940 93237 94151 gene locus_tag LOCUS_34950 93237 94151 CDS product DUF2167 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035601.1 protein_id gnl|my_center|LOCUS_34950 94277 94987 gene locus_tag LOCUS_34960 94277 94987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34960 95108 95182 gene locus_tag LOCUS_t00430 95108 95182 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 98356 95585 gene locus_tag LOCUS_34970 98356 95585 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207280508.1 protein_id gnl|my_center|LOCUS_34970 98996 98418 gene locus_tag LOCUS_34980 98996 98418 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167392103.1 protein_id gnl|my_center|LOCUS_34980 99283 99002 gene locus_tag LOCUS_34990 99283 99002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34990 99811 99563 gene locus_tag LOCUS_35000 99811 99563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35000 100224 100535 gene locus_tag LOCUS_35010 100224 100535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35010 100655 100831 gene locus_tag LOCUS_35020 100655 100831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35020 101393 100800 gene locus_tag LOCUS_35030 101393 100800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35030 101621 101466 gene locus_tag LOCUS_35040 101621 101466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35040 101926 102522 gene locus_tag LOCUS_35050 101926 102522 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963700.1 protein_id gnl|my_center|LOCUS_35050 102630 103766 gene locus_tag LOCUS_35060 102630 103766 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389065.1 protein_id gnl|my_center|LOCUS_35060 103818 105071 gene locus_tag LOCUS_35070 gene fabF 103818 105071 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962377.1 protein_id gnl|my_center|LOCUS_35070 105204 106070 gene locus_tag LOCUS_35080 105204 106070 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963867.1 protein_id gnl|my_center|LOCUS_35080 106152 106688 gene locus_tag LOCUS_35090 106152 106688 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963151.1 protein_id gnl|my_center|LOCUS_35090 106874 107251 gene locus_tag LOCUS_35100 106874 107251 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533874.1 protein_id gnl|my_center|LOCUS_35100 107318 108841 gene locus_tag LOCUS_35110 107318 108841 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004299143.1 protein_id gnl|my_center|LOCUS_35110 108854 109402 gene locus_tag LOCUS_35120 108854 109402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35120 109399 110961 gene locus_tag LOCUS_35130 109399 110961 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962400.1 protein_id gnl|my_center|LOCUS_35130 111014 111871 gene locus_tag LOCUS_35140 111014 111871 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268499.1 protein_id gnl|my_center|LOCUS_35140 112077 113078 gene locus_tag LOCUS_35150 112077 113078 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764892.1 protein_id gnl|my_center|LOCUS_35150 113189 114310 gene locus_tag LOCUS_35160 113189 114310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35160 114351 114875 gene locus_tag LOCUS_35170 114351 114875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35170 115185 116165 gene locus_tag LOCUS_35180 115185 116165 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027134.1 protein_id gnl|my_center|LOCUS_35180 116455 117546 gene locus_tag LOCUS_35190 116455 117546 CDS product DUF1624 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265890.1 protein_id gnl|my_center|LOCUS_35190 118194 117937 gene locus_tag LOCUS_35200 118194 117937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35200 118622 124756 gene locus_tag LOCUS_35210 118622 124756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35210 125892 124789 gene locus_tag LOCUS_35220 125892 124789 CDS product putative sulfate exporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785778.1 protein_id gnl|my_center|LOCUS_35220 126973 126062 gene locus_tag LOCUS_35230 126973 126062 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760345.1 protein_id gnl|my_center|LOCUS_35230 128429 127131 gene locus_tag LOCUS_35240 128429 127131 CDS product voltage-gated chloride channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037141.1 protein_id gnl|my_center|LOCUS_35240 129081 128731 gene locus_tag LOCUS_35250 129081 128731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000141780.1 protein_id gnl|my_center|LOCUS_35250 130166 129504 gene locus_tag LOCUS_35260 130166 129504 CDS product TIGR04282 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933082.1 protein_id gnl|my_center|LOCUS_35260 130667 130855 gene locus_tag LOCUS_35270 130667 130855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35270 131112 132815 gene locus_tag LOCUS_35280 131112 132815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35280 133327 134826 gene locus_tag LOCUS_35290 gene gndA 133327 134826 CDS product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141117.1 protein_id gnl|my_center|LOCUS_35290 135058 136572 gene locus_tag LOCUS_35300 gene zwf 135058 136572 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256405.1 protein_id gnl|my_center|LOCUS_35300 136577 137311 gene locus_tag LOCUS_35310 gene pgl 136577 137311 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143172.1 protein_id gnl|my_center|LOCUS_35310 138105 137935 gene locus_tag LOCUS_35320 138105 137935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35320 138754 138428 gene locus_tag LOCUS_35330 138754 138428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35330 139425 139006 gene locus_tag LOCUS_35340 139425 139006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35340 140233 139472 gene locus_tag LOCUS_35350 140233 139472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35350 140939 140469 gene locus_tag LOCUS_35360 140939 140469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35360 141158 140952 gene locus_tag LOCUS_35370 141158 140952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35370 141853 141515 gene locus_tag LOCUS_35380 141853 141515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35380 142321 141974 gene locus_tag LOCUS_35390 142321 141974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35390 143730 142981 gene locus_tag LOCUS_35400 gene rpiA 143730 142981 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086536.1 protein_id gnl|my_center|LOCUS_35400 144260 143838 gene locus_tag LOCUS_35410 144260 143838 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000791295.1 protein_id gnl|my_center|LOCUS_35410 146028 144313 gene locus_tag LOCUS_35420 146028 144313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35420 146362 146021 gene locus_tag LOCUS_35430 146362 146021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35430 146672 146370 gene locus_tag LOCUS_35440 146672 146370 CDS product circadian clock KaiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002725098.1 protein_id gnl|my_center|LOCUS_35440 148519 146783 gene locus_tag LOCUS_35450 gene kaiC 148519 146783 CDS product circadian clock protein KaiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331300.1 protein_id gnl|my_center|LOCUS_35450 148989 148771 gene locus_tag LOCUS_35460 148989 148771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35460 149361 149846 gene locus_tag LOCUS_35470 149361 149846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35470 150089 151171 gene locus_tag LOCUS_35480 gene fbaA 150089 151171 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962494.1 protein_id gnl|my_center|LOCUS_35480 152008 151349 gene locus_tag LOCUS_35490 152008 151349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35490 153649 152156 gene locus_tag LOCUS_35500 153649 152156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35500 155126 154116 gene locus_tag LOCUS_35510 155126 154116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35510 158499 155107 gene locus_tag LOCUS_35520 158499 155107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35520 160181 158703 gene locus_tag LOCUS_35530 160181 158703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35530 160813 160403 gene locus_tag LOCUS_35540 160813 160403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35540 162259 161006 gene locus_tag LOCUS_35550 162259 161006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_088462992.1 protein_id gnl|my_center|LOCUS_35550 162534 162779 gene locus_tag LOCUS_35560 162534 162779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35560 163116 163724 gene locus_tag LOCUS_35570 163116 163724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35570 164044 164307 gene locus_tag LOCUS_35580 164044 164307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35580 165069 166100 gene locus_tag LOCUS_35590 165069 166100 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963799.1 protein_id gnl|my_center|LOCUS_35590 166489 167505 gene locus_tag LOCUS_35600 166489 167505 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963782.1 protein_id gnl|my_center|LOCUS_35600 167615 167941 gene locus_tag LOCUS_35610 167615 167941 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964488.1 protein_id gnl|my_center|LOCUS_35610 169286 168306 gene locus_tag LOCUS_35620 169286 168306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35620 169385 169924 gene locus_tag LOCUS_35630 169385 169924 CDS product HAD-IIIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932505.1 protein_id gnl|my_center|LOCUS_35630 170754 170104 gene locus_tag LOCUS_35640 170754 170104 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188734.1 protein_id gnl|my_center|LOCUS_35640 171017 171679 gene locus_tag LOCUS_35650 171017 171679 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391572.1 protein_id gnl|my_center|LOCUS_35650 172472 171813 gene locus_tag LOCUS_35660 172472 171813 CDS product DUF1345 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115060.1 protein_id gnl|my_center|LOCUS_35660 172606 174096 gene locus_tag LOCUS_35670 172606 174096 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808616.1 protein_id gnl|my_center|LOCUS_35670 175210 176514 gene locus_tag LOCUS_35680 175210 176514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35680 177471 177076 gene locus_tag LOCUS_35690 177471 177076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_35690 177885 177535 gene locus_tag LOCUS_35700 177885 177535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_35700 179318 179145 gene locus_tag LOCUS_35710 179318 179145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35710 179511 180236 gene locus_tag LOCUS_35720 179511 180236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35720 180931 181626 gene locus_tag LOCUS_35730 180931 181626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35730 181773 185201 gene locus_tag LOCUS_35740 181773 185201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35740 186547 185450 gene locus_tag LOCUS_35750 gene purM 186547 185450 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249163.1 protein_id gnl|my_center|LOCUS_35750 188247 186745 gene locus_tag LOCUS_35760 gene purF 188247 186745 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460097.1 protein_id gnl|my_center|LOCUS_35760 189016 188336 gene locus_tag LOCUS_35770 189016 188336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35770 190319 189033 gene locus_tag LOCUS_35780 gene purD 190319 189033 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404599.1 protein_id gnl|my_center|LOCUS_35780 190750 190388 gene locus_tag LOCUS_35790 190750 190388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35790 192190 190772 gene locus_tag LOCUS_35800 192190 190772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35800 193714 192278 gene locus_tag LOCUS_35810 193714 192278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35810 196863 193714 gene locus_tag LOCUS_35820 gene purL 196863 193714 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120422.1 protein_id gnl|my_center|LOCUS_35820 197605 196979 gene locus_tag LOCUS_35830 gene pyrE 197605 196979 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583288.1 protein_id gnl|my_center|LOCUS_35830 198434 197655 gene locus_tag LOCUS_35840 gene pyrF 198434 197655 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839147.1 protein_id gnl|my_center|LOCUS_35840 199323 198475 gene locus_tag LOCUS_35850 199323 198475 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393617.1 protein_id gnl|my_center|LOCUS_35850 200745 200008 gene locus_tag LOCUS_35860 200745 200008 CDS product DNA/RNA non-specific endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140079.1 protein_id gnl|my_center|LOCUS_35860 203431 201176 gene locus_tag LOCUS_35870 203431 201176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35870 203811 205169 gene locus_tag LOCUS_35880 gene zraR 203811 205169 CDS product sigma-54-dependent response regulator transcription factor ZraR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000148531.1 protein_id gnl|my_center|LOCUS_35880 205382 208126 gene locus_tag LOCUS_35890 205382 208126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35890 208144 209358 gene locus_tag LOCUS_35900 208144 209358 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000653868.1 protein_id gnl|my_center|LOCUS_35900 210247 209864 gene locus_tag LOCUS_35910 210247 209864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35910 210444 211562 gene locus_tag LOCUS_35920 210444 211562 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404343.1 protein_id gnl|my_center|LOCUS_35920 211980 213188 gene locus_tag LOCUS_35930 211980 213188 CDS product type III polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480137.1 protein_id gnl|my_center|LOCUS_35930 213230 213931 gene locus_tag LOCUS_35940 213230 213931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35940 214951 214046 gene locus_tag LOCUS_35950 214951 214046 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141618.1 protein_id gnl|my_center|LOCUS_35950 215947 215264 gene locus_tag LOCUS_35960 215947 215264 CDS product DUF92 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209477179.1 protein_id gnl|my_center|LOCUS_35960 218390 216183 gene locus_tag LOCUS_35970 218390 216183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35970 218885 218676 gene locus_tag LOCUS_35980 218885 218676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35980 221095 218912 gene locus_tag LOCUS_35990 221095 218912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35990 222346 221639 gene locus_tag LOCUS_36000 222346 221639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36000 223430 223642 gene locus_tag LOCUS_36010 223430 223642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36010 226350 224188 gene locus_tag LOCUS_36020 226350 224188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36020 227441 227175 gene locus_tag LOCUS_36030 227441 227175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36030 227541 227466 gene locus_tag LOCUS_t00440 227541 227466 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 227792 228655 gene locus_tag LOCUS_36040 227792 228655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36040 228923 228848 gene locus_tag LOCUS_t00450 228923 228848 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 229204 229794 gene locus_tag LOCUS_36050 229204 229794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36050 230050 230559 gene locus_tag LOCUS_36060 230050 230559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256633.1 protein_id gnl|my_center|LOCUS_36060 230976 232886 gene locus_tag LOCUS_36070 230976 232886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36070 233016 234878 gene locus_tag LOCUS_36080 233016 234878 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086595297.1 protein_id gnl|my_center|LOCUS_36080 236416 235382 gene locus_tag LOCUS_36090 236416 235382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36090 237519 237160 gene locus_tag LOCUS_36100 237519 237160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36100 238026 237793 gene locus_tag LOCUS_36110 238026 237793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36110 238322 237948 gene locus_tag LOCUS_36120 238322 237948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36120 238309 238488 gene locus_tag LOCUS_36130 238309 238488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36130 238554 240569 gene locus_tag LOCUS_36140 238554 240569 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618845.1 protein_id gnl|my_center|LOCUS_36140 243214 240716 gene locus_tag LOCUS_36150 243214 240716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36150 243896 244312 gene locus_tag LOCUS_36160 243896 244312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36160 246453 244924 gene locus_tag LOCUS_36170 246453 244924 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404206.1 protein_id gnl|my_center|LOCUS_36170 246837 247850 gene locus_tag LOCUS_36180 246837 247850 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964450.1 protein_id gnl|my_center|LOCUS_36180 248561 247944 gene locus_tag LOCUS_36190 248561 247944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36190 249464 248643 gene locus_tag LOCUS_36200 249464 248643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36200 249648 249457 gene locus_tag LOCUS_36210 249648 249457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36210 249989 250828 gene locus_tag LOCUS_36220 249989 250828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36220 251252 251740 gene locus_tag LOCUS_36230 251252 251740 CDS product cold shock domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765470.1 protein_id gnl|my_center|LOCUS_36230 252121 251852 gene locus_tag LOCUS_36240 252121 251852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36240 252567 252232 gene locus_tag LOCUS_36250 252567 252232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36250 254422 253016 gene locus_tag LOCUS_36260 gene lpdA 254422 253016 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963845.1 protein_id gnl|my_center|LOCUS_36260 256238 254529 gene locus_tag LOCUS_36270 256238 254529 CDS product carbamoyltransferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537466.1 protein_id gnl|my_center|LOCUS_36270 258011 256347 gene locus_tag LOCUS_36280 258011 256347 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963149.1 protein_id gnl|my_center|LOCUS_36280 258402 259106 gene locus_tag LOCUS_36290 258402 259106 CDS product RNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008660650.1 protein_id gnl|my_center|LOCUS_36290 259090 260193 gene locus_tag LOCUS_36300 259090 260193 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638288.1 protein_id gnl|my_center|LOCUS_36300 260244 260687 gene locus_tag LOCUS_36310 260244 260687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36310 260754 261206 gene locus_tag LOCUS_36320 260754 261206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36320 262460 262254 gene locus_tag LOCUS_36330 262460 262254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36330 262348 262908 gene locus_tag LOCUS_36340 262348 262908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36340 263227 264096 gene locus_tag LOCUS_36350 gene yedA 263227 264096 CDS product drug/metabolite exporter YedA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210807.1 protein_id gnl|my_center|LOCUS_36350 264686 264306 gene locus_tag LOCUS_36360 264686 264306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978181.1 protein_id gnl|my_center|LOCUS_36360 265042 267402 gene locus_tag LOCUS_36370 265042 267402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36370 268221 267454 gene locus_tag LOCUS_36380 268221 267454 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963166.1 protein_id gnl|my_center|LOCUS_36380 268962 268432 gene locus_tag LOCUS_36390 268962 268432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36390 269618 269157 gene locus_tag LOCUS_36400 269618 269157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36400 270385 269690 gene locus_tag LOCUS_36410 270385 269690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36410 271042 270578 gene locus_tag LOCUS_36420 271042 270578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36420 271524 271144 gene locus_tag LOCUS_36430 271524 271144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36430 272029 271574 gene locus_tag LOCUS_36440 272029 271574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36440 272909 272616 gene locus_tag LOCUS_36450 272909 272616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36450 273760 273110 gene locus_tag LOCUS_36460 273760 273110 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785389.1 protein_id gnl|my_center|LOCUS_36460 275732 274044 gene locus_tag LOCUS_36470 275732 274044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36470 278899 275975 gene locus_tag LOCUS_36480 278899 275975 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964496.1 protein_id gnl|my_center|LOCUS_36480 279306 279833 gene locus_tag LOCUS_36490 279306 279833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36490 281113 279926 gene locus_tag LOCUS_36500 281113 279926 CDS product L-dopachrome tautomerase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228342.1 protein_id gnl|my_center|LOCUS_36500 282042 281233 gene locus_tag LOCUS_36510 282042 281233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36510 282796 282068 gene locus_tag LOCUS_36520 282796 282068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36520 283075 282821 gene locus_tag LOCUS_36530 283075 282821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36530 283334 283522 gene locus_tag LOCUS_36540 283334 283522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36540 >Feature sequence44 3012 2089 gene locus_tag LOCUS_36550 3012 2089 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023177.1 protein_id gnl|my_center|LOCUS_36550 3150 4478 gene locus_tag LOCUS_36560 3150 4478 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963479.1 protein_id gnl|my_center|LOCUS_36560 4903 6678 gene locus_tag LOCUS_36570 gene sppA 4903 6678 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765466.1 protein_id gnl|my_center|LOCUS_36570 6704 7537 gene locus_tag LOCUS_36580 6704 7537 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933475.1 protein_id gnl|my_center|LOCUS_36580 7575 8345 gene locus_tag LOCUS_36590 7575 8345 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203124.1 protein_id gnl|my_center|LOCUS_36590 8409 8849 gene locus_tag LOCUS_36600 8409 8849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36600 9632 9066 gene locus_tag LOCUS_36610 9632 9066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36610 9531 9773 gene locus_tag LOCUS_36620 9531 9773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36620 11094 10252 gene locus_tag LOCUS_36630 11094 10252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36630 13535 11208 gene locus_tag LOCUS_36640 13535 11208 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203489.1 protein_id gnl|my_center|LOCUS_36640 13901 13686 gene locus_tag LOCUS_36650 13901 13686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36650 14470 14141 gene locus_tag LOCUS_36660 14470 14141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36660 18823 15107 gene locus_tag LOCUS_36670 18823 15107 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208688.1 protein_id gnl|my_center|LOCUS_36670 19384 18911 gene locus_tag LOCUS_36680 19384 18911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36680 20732 19482 gene locus_tag LOCUS_36690 20732 19482 CDS product exonuclease SbcCD subunit D C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932820.1 protein_id gnl|my_center|LOCUS_36690 21619 21083 gene locus_tag LOCUS_36700 21619 21083 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143451.1 protein_id gnl|my_center|LOCUS_36700 22333 21752 gene locus_tag LOCUS_36710 22333 21752 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684454.1 protein_id gnl|my_center|LOCUS_36710 22965 22339 gene locus_tag LOCUS_36720 22965 22339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36720 23797 23195 gene locus_tag LOCUS_36730 23797 23195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36730 24746 23970 gene locus_tag LOCUS_36740 24746 23970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36740 25413 24997 gene locus_tag LOCUS_36750 25413 24997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36750 26812 25433 gene locus_tag LOCUS_36760 26812 25433 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896784.1 protein_id gnl|my_center|LOCUS_36760 27382 26966 gene locus_tag LOCUS_36770 27382 26966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36770 27815 29386 gene locus_tag LOCUS_36780 27815 29386 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962400.1 protein_id gnl|my_center|LOCUS_36780 29678 30055 gene locus_tag LOCUS_36790 29678 30055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36790 30770 30447 gene locus_tag LOCUS_36800 30770 30447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36800 31825 31619 gene locus_tag LOCUS_36810 31825 31619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36810 32288 34294 gene locus_tag LOCUS_36820 32288 34294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36820 34480 35367 gene locus_tag LOCUS_36830 34480 35367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36830 35968 35552 gene locus_tag LOCUS_36840 35968 35552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36840 36166 36591 gene locus_tag LOCUS_36850 36166 36591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36850 36702 37757 gene locus_tag LOCUS_36860 36702 37757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36860 38939 37821 gene locus_tag LOCUS_36870 38939 37821 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723390.1 protein_id gnl|my_center|LOCUS_36870 40401 39262 gene locus_tag LOCUS_36880 gene pgl 40401 39262 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244689.1 protein_id gnl|my_center|LOCUS_36880 41038 41571 gene locus_tag LOCUS_36890 41038 41571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36890 44597 41769 gene locus_tag LOCUS_36900 44597 41769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36900 44841 45665 gene locus_tag LOCUS_36910 44841 45665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36910 45971 46669 gene locus_tag LOCUS_36920 45971 46669 CDS product endonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093949618.1 protein_id gnl|my_center|LOCUS_36920 48252 46981 gene locus_tag LOCUS_36930 48252 46981 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143177.1 protein_id gnl|my_center|LOCUS_36930 48592 49047 gene locus_tag LOCUS_36940 48592 49047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36940 51834 49093 gene locus_tag LOCUS_36950 51834 49093 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000081335.1 protein_id gnl|my_center|LOCUS_36950 53534 51915 gene locus_tag LOCUS_36960 53534 51915 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105162.1 protein_id gnl|my_center|LOCUS_36960 55290 53587 gene locus_tag LOCUS_36970 55290 53587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36970 58252 55373 gene locus_tag LOCUS_36980 58252 55373 CDS product SNF2-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000286652.1 protein_id gnl|my_center|LOCUS_36980 58861 58779 gene locus_tag LOCUS_t00460 58861 58779 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 59439 58900 gene locus_tag LOCUS_36990 gene hscB 59439 58900 CDS product Fe-S protein assembly co-chaperone HscB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219110.1 protein_id gnl|my_center|LOCUS_36990 59767 59480 gene locus_tag LOCUS_37000 59767 59480 CDS product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404552.1 protein_id gnl|my_center|LOCUS_37000 60006 60212 gene locus_tag LOCUS_37010 60006 60212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37010 61145 60339 gene locus_tag LOCUS_37020 61145 60339 CDS product SAM-dependent chlorinase/fluorinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963221.1 protein_id gnl|my_center|LOCUS_37020 61238 62338 gene locus_tag LOCUS_37030 61238 62338 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785156.1 protein_id gnl|my_center|LOCUS_37030 62833 63705 gene locus_tag LOCUS_37040 62833 63705 CDS product DUF1223 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528690.1 protein_id gnl|my_center|LOCUS_37040 63876 64358 gene locus_tag LOCUS_37050 63876 64358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37050 64361 65218 gene locus_tag LOCUS_37060 64361 65218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37060 65553 65173 gene locus_tag LOCUS_37070 65553 65173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37070 66081 65833 gene locus_tag LOCUS_37080 66081 65833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37080 66675 66088 gene locus_tag LOCUS_37090 66675 66088 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005652768.1 protein_id gnl|my_center|LOCUS_37090 67190 66831 gene locus_tag LOCUS_37100 67190 66831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_37100 67568 67209 gene locus_tag LOCUS_37110 67568 67209 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_217159161.1 protein_id gnl|my_center|LOCUS_37110 67757 68203 gene locus_tag LOCUS_37120 67757 68203 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043552746.1 protein_id gnl|my_center|LOCUS_37120 68490 70763 gene locus_tag LOCUS_37130 68490 70763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37130 71558 70863 gene locus_tag LOCUS_37140 71558 70863 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920906.1 protein_id gnl|my_center|LOCUS_37140 71593 72660 gene locus_tag LOCUS_37150 71593 72660 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267317.1 protein_id gnl|my_center|LOCUS_37150 72657 73010 gene locus_tag LOCUS_37160 72657 73010 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392606.1 protein_id gnl|my_center|LOCUS_37160 73391 73017 gene locus_tag LOCUS_37170 73391 73017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37170 73964 73392 gene locus_tag LOCUS_37180 73964 73392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37180 75379 73967 gene locus_tag LOCUS_37190 gene rlmD 75379 73967 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788070.1 protein_id gnl|my_center|LOCUS_37190 75568 76377 gene locus_tag LOCUS_37200 75568 76377 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106828.1 protein_id gnl|my_center|LOCUS_37200 78373 76655 gene locus_tag LOCUS_37210 78373 76655 CDS product S8 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403341.1 protein_id gnl|my_center|LOCUS_37210 78477 81245 gene locus_tag LOCUS_37220 78477 81245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37220 81509 82852 gene locus_tag LOCUS_37230 81509 82852 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272364.1 protein_id gnl|my_center|LOCUS_37230 83945 83028 gene locus_tag LOCUS_37240 83945 83028 CDS product DUF2911 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963156.1 protein_id gnl|my_center|LOCUS_37240 85271 85954 gene locus_tag LOCUS_37250 85271 85954 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962592.1 protein_id gnl|my_center|LOCUS_37250 86008 87741 gene locus_tag LOCUS_37260 86008 87741 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962591.1 protein_id gnl|my_center|LOCUS_37260 87906 89315 gene locus_tag LOCUS_37270 87906 89315 CDS product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962590.1 protein_id gnl|my_center|LOCUS_37270 89312 90802 gene locus_tag LOCUS_37280 89312 90802 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962589.1 protein_id gnl|my_center|LOCUS_37280 92748 90982 gene locus_tag LOCUS_37290 gene pulA 92748 90982 CDS product type I pullulanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203210.1 protein_id gnl|my_center|LOCUS_37290 93170 94246 gene locus_tag LOCUS_37300 93170 94246 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763424.1 protein_id gnl|my_center|LOCUS_37300 94243 94986 gene locus_tag LOCUS_37310 94243 94986 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817185.1 protein_id gnl|my_center|LOCUS_37310 95561 95235 gene locus_tag LOCUS_37320 95561 95235 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964483.1 protein_id gnl|my_center|LOCUS_37320 96070 95675 gene locus_tag LOCUS_37330 96070 95675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37330 96576 96166 gene locus_tag LOCUS_37340 gene iscU 96576 96166 CDS product Fe-S cluster assembly scaffold IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004599506.1 protein_id gnl|my_center|LOCUS_37340 97950 96676 gene locus_tag LOCUS_37350 97950 96676 CDS product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144367.1 protein_id gnl|my_center|LOCUS_37350 98212 97964 gene locus_tag LOCUS_37360 98212 97964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37360 98108 98527 gene locus_tag LOCUS_37370 gene mce 98108 98527 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962412.1 protein_id gnl|my_center|LOCUS_37370 98617 99189 gene locus_tag LOCUS_37380 98617 99189 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963755.1 protein_id gnl|my_center|LOCUS_37380 99288 100727 gene locus_tag LOCUS_37390 99288 100727 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303110.1 protein_id gnl|my_center|LOCUS_37390 103838 101169 gene locus_tag LOCUS_37400 103838 101169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37400 104249 103902 gene locus_tag LOCUS_37410 104249 103902 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962835.1 protein_id gnl|my_center|LOCUS_37410 104658 105770 gene locus_tag LOCUS_37420 104658 105770 CDS product PorV/PorQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034099202.1 protein_id gnl|my_center|LOCUS_37420 105958 111117 gene locus_tag LOCUS_37430 105958 111117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37430 111247 111438 gene locus_tag LOCUS_37440 111247 111438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37440 111938 111450 gene locus_tag LOCUS_37450 111938 111450 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008593045.1 protein_id gnl|my_center|LOCUS_37450 112904 111972 gene locus_tag LOCUS_37460 gene fmt 112904 111972 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770001.1 protein_id gnl|my_center|LOCUS_37460 114200 113109 gene locus_tag LOCUS_37470 114200 113109 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108150.1 protein_id gnl|my_center|LOCUS_37470 114895 116118 gene locus_tag LOCUS_37480 114895 116118 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762301.1 protein_id gnl|my_center|LOCUS_37480 116137 117114 gene locus_tag LOCUS_37490 116137 117114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37490 117809 117117 gene locus_tag LOCUS_37500 117809 117117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37500 118036 119133 gene locus_tag LOCUS_37510 gene paaK 118036 119133 CDS product phenylacetate-CoA oxygenase/reductase subunit PaaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096758.1 protein_id gnl|my_center|LOCUS_37510 119462 121204 gene locus_tag LOCUS_37520 119462 121204 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080599.1 protein_id gnl|my_center|LOCUS_37520 122237 121611 gene locus_tag LOCUS_37530 122237 121611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37530 122774 122274 gene locus_tag LOCUS_37540 gene paaJ 122774 122274 CDS product phenylacetate-CoA oxygenase subunit PaaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813291.1 protein_id gnl|my_center|LOCUS_37540 123727 122978 gene locus_tag LOCUS_37550 gene paaC 123727 122978 CDS product phenylacetate-CoA oxygenase subunit PaaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889010.1 protein_id gnl|my_center|LOCUS_37550 124418 123732 gene locus_tag LOCUS_37560 124418 123732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37560 125520 124528 gene locus_tag LOCUS_37570 gene paaA 125520 124528 CDS product 1,2-phenylacetyl-CoA epoxidase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228339.1 protein_id gnl|my_center|LOCUS_37570 126202 125594 gene locus_tag LOCUS_37580 126202 125594 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228340.1 protein_id gnl|my_center|LOCUS_37580 126492 127520 gene locus_tag LOCUS_37590 gene thiL 126492 127520 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761224.1 protein_id gnl|my_center|LOCUS_37590 128023 128829 gene locus_tag LOCUS_37600 128023 128829 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404226.1 protein_id gnl|my_center|LOCUS_37600 128956 129450 gene locus_tag LOCUS_37610 128956 129450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37610 129544 130443 gene locus_tag LOCUS_37620 129544 130443 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963566.1 protein_id gnl|my_center|LOCUS_37620 130666 131217 gene locus_tag LOCUS_37630 130666 131217 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763722.1 protein_id gnl|my_center|LOCUS_37630 131432 132925 gene locus_tag LOCUS_37640 gene crtI 131432 132925 CDS product phytoene desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963567.1 protein_id gnl|my_center|LOCUS_37640 133010 133852 gene locus_tag LOCUS_37650 133010 133852 CDS product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963568.1 protein_id gnl|my_center|LOCUS_37650 133920 134567 gene locus_tag LOCUS_37660 133920 134567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37660 134671 135522 gene locus_tag LOCUS_37670 134671 135522 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797949.1 protein_id gnl|my_center|LOCUS_37670 135544 135873 gene locus_tag LOCUS_37680 135544 135873 CDS product DHCW motif cupin fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816257.1 protein_id gnl|my_center|LOCUS_37680 135882 136625 gene locus_tag LOCUS_37690 135882 136625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37690 137170 136799 gene locus_tag LOCUS_37700 137170 136799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37700 138141 137350 gene locus_tag LOCUS_37710 138141 137350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37710 140756 138387 gene locus_tag LOCUS_37720 140756 138387 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055269995.1 protein_id gnl|my_center|LOCUS_37720 141299 140859 gene locus_tag LOCUS_37730 141299 140859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37730 142548 141736 gene locus_tag LOCUS_37740 142548 141736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37740 142990 142625 gene locus_tag LOCUS_37750 142990 142625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37750 143309 143782 gene locus_tag LOCUS_37760 gene mraZ 143309 143782 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392353.1 protein_id gnl|my_center|LOCUS_37760 143779 144702 gene locus_tag LOCUS_37770 gene rsmH 143779 144702 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784016.1 protein_id gnl|my_center|LOCUS_37770 144839 145798 gene locus_tag LOCUS_37780 144839 145798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37780 145782 148283 gene locus_tag LOCUS_37790 145782 148283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37790 148341 149813 gene locus_tag LOCUS_37800 148341 149813 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964160.1 protein_id gnl|my_center|LOCUS_37800 149998 151218 gene locus_tag LOCUS_37810 gene mraY 149998 151218 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964159.1 protein_id gnl|my_center|LOCUS_37810 151293 152663 gene locus_tag LOCUS_37820 gene murD 151293 152663 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010991956.1 protein_id gnl|my_center|LOCUS_37820 153023 154204 gene locus_tag LOCUS_37830 153023 154204 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964157.1 protein_id gnl|my_center|LOCUS_37830 154343 155449 gene locus_tag LOCUS_37840 gene murG 154343 155449 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108837.1 protein_id gnl|my_center|LOCUS_37840 155537 157000 gene locus_tag LOCUS_37850 gene murC 155537 157000 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763710.1 protein_id gnl|my_center|LOCUS_37850 157146 157904 gene locus_tag LOCUS_37860 157146 157904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37860 157989 159383 gene locus_tag LOCUS_37870 gene ftsA 157989 159383 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034098846.1 protein_id gnl|my_center|LOCUS_37870 159495 160991 gene locus_tag LOCUS_37880 159495 160991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37880 161557 161099 gene locus_tag LOCUS_37890 161557 161099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37890 162340 163407 gene locus_tag LOCUS_37900 162340 163407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_37900 164760 163687 gene locus_tag LOCUS_37910 164760 163687 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061609.1 protein_id gnl|my_center|LOCUS_37910 165549 164815 gene locus_tag LOCUS_37920 165549 164815 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962991.1 protein_id gnl|my_center|LOCUS_37920 165561 165761 gene locus_tag LOCUS_37930 165561 165761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37930 166191 165679 gene locus_tag LOCUS_37940 166191 165679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37940 167376 166369 gene locus_tag LOCUS_37950 167376 166369 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403393.1 protein_id gnl|my_center|LOCUS_37950 167530 168366 gene locus_tag LOCUS_37960 167530 168366 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789838.1 protein_id gnl|my_center|LOCUS_37960 168359 169018 gene locus_tag LOCUS_37970 168359 169018 CDS product lipid-A-disaccharide synthase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802698.1 protein_id gnl|my_center|LOCUS_37970 169052 170722 gene locus_tag LOCUS_37980 169052 170722 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943191.1 protein_id gnl|my_center|LOCUS_37980 170815 171744 gene locus_tag LOCUS_37990 gene speB 170815 171744 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187785.1 protein_id gnl|my_center|LOCUS_37990 172174 173007 gene locus_tag LOCUS_38000 172174 173007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38000 173292 173519 gene locus_tag LOCUS_38010 173292 173519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38010 174168 175844 gene locus_tag LOCUS_38020 gene hutU 174168 175844 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000416707.1 protein_id gnl|my_center|LOCUS_38020 178370 176193 gene locus_tag LOCUS_38030 178370 176193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38030 178849 179031 gene locus_tag LOCUS_38040 178849 179031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_38040 179382 180215 gene locus_tag LOCUS_38050 179382 180215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38050 181034 180411 gene locus_tag LOCUS_38060 gene pncA 181034 180411 CDS product bifunctional nicotinamidase/pyrazinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444893.1 protein_id gnl|my_center|LOCUS_38060 181369 182238 gene locus_tag LOCUS_38070 181369 182238 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044233703.1 protein_id gnl|my_center|LOCUS_38070 182273 183067 gene locus_tag LOCUS_38080 gene nhoA 182273 183067 CDS product N-hydroxyarylamine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096510.1 protein_id gnl|my_center|LOCUS_38080 183744 183190 gene locus_tag LOCUS_38090 183744 183190 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002182765.1 protein_id gnl|my_center|LOCUS_38090 183920 184654 gene locus_tag LOCUS_38100 183920 184654 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242574.1 protein_id gnl|my_center|LOCUS_38100 184927 184700 gene locus_tag LOCUS_38110 184927 184700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38110 185061 185906 gene locus_tag LOCUS_38120 gene murI 185061 185906 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545640.1 protein_id gnl|my_center|LOCUS_38120 186321 186004 gene locus_tag LOCUS_38130 186321 186004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38130 186604 186936 gene locus_tag LOCUS_38140 186604 186936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38140 187485 189896 gene locus_tag LOCUS_38150 187485 189896 CDS product glycoside hydrolase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964231.1 protein_id gnl|my_center|LOCUS_38150 191922 190117 gene locus_tag LOCUS_38160 191922 190117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38160 194511 192253 gene locus_tag LOCUS_38170 194511 192253 CDS product DUF4175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640602.1 protein_id gnl|my_center|LOCUS_38170 196136 194508 gene locus_tag LOCUS_38180 196136 194508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38180 197090 196215 gene locus_tag LOCUS_38190 197090 196215 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324190.1 protein_id gnl|my_center|LOCUS_38190 198350 197307 gene locus_tag LOCUS_38200 198350 197307 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640601.1 protein_id gnl|my_center|LOCUS_38200 199048 198428 gene locus_tag LOCUS_38210 199048 198428 CDS product DUF4159 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920665.1 protein_id gnl|my_center|LOCUS_38210 200540 199215 gene locus_tag LOCUS_38220 200540 199215 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035351.1 protein_id gnl|my_center|LOCUS_38220 201006 200620 gene locus_tag LOCUS_38230 201006 200620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38230 202699 201050 gene locus_tag LOCUS_38240 202699 201050 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920663.1 protein_id gnl|my_center|LOCUS_38240 204264 202945 gene locus_tag LOCUS_38250 204264 202945 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035351.1 protein_id gnl|my_center|LOCUS_38250 206027 204378 gene locus_tag LOCUS_38260 206027 204378 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920663.1 protein_id gnl|my_center|LOCUS_38260 207307 206486 gene locus_tag LOCUS_38270 207307 206486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38270 210624 207430 gene locus_tag LOCUS_38280 210624 207430 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152945460.1 protein_id gnl|my_center|LOCUS_38280 211911 210952 gene locus_tag LOCUS_38290 211911 210952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38290 213378 212056 gene locus_tag LOCUS_38300 213378 212056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38300 214004 215482 gene locus_tag LOCUS_38310 214004 215482 CDS product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206844.1 protein_id gnl|my_center|LOCUS_38310 215659 217011 gene locus_tag LOCUS_38320 215659 217011 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029123.1 protein_id gnl|my_center|LOCUS_38320 217150 218523 gene locus_tag LOCUS_38330 gene hydA 217150 218523 CDS product dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891590.1 protein_id gnl|my_center|LOCUS_38330 218588 219445 gene locus_tag LOCUS_38340 218588 219445 CDS product nitrilase-related carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084641929.1 protein_id gnl|my_center|LOCUS_38340 219713 220000 gene locus_tag LOCUS_38350 219713 220000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38350 220318 221643 gene locus_tag LOCUS_38360 220318 221643 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_142081328.1 protein_id gnl|my_center|LOCUS_38360 221807 223195 gene locus_tag LOCUS_38370 gene preA 221807 223195 CDS product NAD-dependent dihydropyrimidine dehydrogenase subunit PreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338051.1 protein_id gnl|my_center|LOCUS_38370 223339 224292 gene locus_tag LOCUS_38380 223339 224292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38380 224492 224800 gene locus_tag LOCUS_38390 224492 224800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38390 225470 226090 gene locus_tag LOCUS_38400 225470 226090 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025775002.1 protein_id gnl|my_center|LOCUS_38400 226278 227684 gene locus_tag LOCUS_38410 226278 227684 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008657969.1 protein_id gnl|my_center|LOCUS_38410 227713 228174 gene locus_tag LOCUS_38420 227713 228174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38420 228263 228940 gene locus_tag LOCUS_38430 gene can 228263 228940 CDS product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964129.1 protein_id gnl|my_center|LOCUS_38430 231528 229042 gene locus_tag LOCUS_38440 231528 229042 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057830.1 protein_id gnl|my_center|LOCUS_38440 231719 233683 gene locus_tag LOCUS_38450 231719 233683 CDS product TonB-dependent receptor plug domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839978.1 protein_id gnl|my_center|LOCUS_38450 233871 234968 gene locus_tag LOCUS_38460 233871 234968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38460 236419 237873 gene locus_tag LOCUS_38470 236419 237873 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796334.1 protein_id gnl|my_center|LOCUS_38470 237986 238795 gene locus_tag LOCUS_38480 237986 238795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38480 239451 242024 gene locus_tag LOCUS_38490 239451 242024 CDS product DNA topoisomerase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817457.1 protein_id gnl|my_center|LOCUS_38490 242079 242546 gene locus_tag LOCUS_38500 242079 242546 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384944.1 protein_id gnl|my_center|LOCUS_38500 243667 242588 gene locus_tag LOCUS_38510 243667 242588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38510 >Feature sequence45 1126 773 gene locus_tag LOCUS_38520 1126 773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38520 1361 2458 gene locus_tag LOCUS_38530 1361 2458 CDS product agmatinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964304.1 protein_id gnl|my_center|LOCUS_38530 2486 2824 gene locus_tag LOCUS_38540 2486 2824 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964186.1 protein_id gnl|my_center|LOCUS_38540 3041 3424 gene locus_tag LOCUS_38550 3041 3424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38550 3730 4167 gene locus_tag LOCUS_38560 3730 4167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38560 4991 4179 gene locus_tag LOCUS_38570 4991 4179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38570 6076 5168 gene locus_tag LOCUS_38580 6076 5168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38580 7543 6239 gene locus_tag LOCUS_38590 gene murA 7543 6239 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108085.1 protein_id gnl|my_center|LOCUS_38590 8346 7636 gene locus_tag LOCUS_38600 8346 7636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38600 10660 8414 gene locus_tag LOCUS_38610 10660 8414 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111477477.1 protein_id gnl|my_center|LOCUS_38610 10902 11108 gene locus_tag LOCUS_38620 10902 11108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38620 11153 11725 gene locus_tag LOCUS_38630 11153 11725 CDS product DUF3109 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962628.1 protein_id gnl|my_center|LOCUS_38630 11774 12262 gene locus_tag LOCUS_38640 11774 12262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38640 12777 12319 gene locus_tag LOCUS_38650 12777 12319 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193328870.1 protein_id gnl|my_center|LOCUS_38650 12947 13585 gene locus_tag LOCUS_38660 12947 13585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38660 14796 13867 gene locus_tag LOCUS_38670 gene rsgA 14796 13867 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202106.1 protein_id gnl|my_center|LOCUS_38670 16283 15033 gene locus_tag LOCUS_38680 16283 15033 CDS product glycosyltransferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203604.1 protein_id gnl|my_center|LOCUS_38680 16711 16493 gene locus_tag LOCUS_38690 16711 16493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38690 17413 16829 gene locus_tag LOCUS_38700 17413 16829 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787656.1 protein_id gnl|my_center|LOCUS_38700 18352 17579 gene locus_tag LOCUS_38710 18352 17579 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198410.1 protein_id gnl|my_center|LOCUS_38710 19725 18442 gene locus_tag LOCUS_38720 19725 18442 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962473.1 protein_id gnl|my_center|LOCUS_38720 19899 20933 gene locus_tag LOCUS_38730 gene fbp 19899 20933 CDS product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001171118.1 protein_id gnl|my_center|LOCUS_38730 21544 21002 gene locus_tag LOCUS_38740 21544 21002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38740 22111 21665 gene locus_tag LOCUS_38750 22111 21665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38750 22810 22190 gene locus_tag LOCUS_38760 gene yihA 22810 22190 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794469.1 protein_id gnl|my_center|LOCUS_38760 23221 25440 gene locus_tag LOCUS_38770 23221 25440 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962492.1 protein_id gnl|my_center|LOCUS_38770 25620 26348 gene locus_tag LOCUS_38780 gene ubiE 25620 26348 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024980308.1 protein_id gnl|my_center|LOCUS_38780 26297 27100 gene locus_tag LOCUS_38790 26297 27100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38790 27271 28011 gene locus_tag LOCUS_38800 27271 28011 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939072.1 protein_id gnl|my_center|LOCUS_38800 28887 28231 gene locus_tag LOCUS_38810 28887 28231 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403534.1 protein_id gnl|my_center|LOCUS_38810 29428 28931 gene locus_tag LOCUS_38820 gene cdd 29428 28931 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762228.1 protein_id gnl|my_center|LOCUS_38820 29473 30885 gene locus_tag LOCUS_38830 29473 30885 CDS product saccharopine dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964462.1 protein_id gnl|my_center|LOCUS_38830 31080 31580 gene locus_tag LOCUS_38840 31080 31580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38840 31818 32750 gene locus_tag LOCUS_38850 31818 32750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38850 33076 34026 gene locus_tag LOCUS_38860 33076 34026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38860 34283 34975 gene locus_tag LOCUS_38870 34283 34975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38870 36010 36921 gene locus_tag LOCUS_38880 36010 36921 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096673.1 protein_id gnl|my_center|LOCUS_38880 37872 37126 gene locus_tag LOCUS_38890 37872 37126 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202815.1 protein_id gnl|my_center|LOCUS_38890 39579 38455 gene locus_tag LOCUS_38900 39579 38455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_38900 40334 39864 gene locus_tag LOCUS_38910 gene rnhA 40334 39864 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962375.1 protein_id gnl|my_center|LOCUS_38910 41622 40546 gene locus_tag LOCUS_38920 gene serC 41622 40546 CDS product phosphoserine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908729.1 protein_id gnl|my_center|LOCUS_38920 42255 41809 gene locus_tag LOCUS_38930 gene aroQ 42255 41809 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964118.1 protein_id gnl|my_center|LOCUS_38930 42434 43333 gene locus_tag LOCUS_38940 gene xerD 42434 43333 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964120.1 protein_id gnl|my_center|LOCUS_38940 43663 46602 gene locus_tag LOCUS_38950 43663 46602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38950 46814 47455 gene locus_tag LOCUS_38960 46814 47455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38960 47617 48918 gene locus_tag LOCUS_38970 47617 48918 CDS product DUF2851 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963326.1 protein_id gnl|my_center|LOCUS_38970 48915 50231 gene locus_tag LOCUS_38980 48915 50231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38980 50345 50977 gene locus_tag LOCUS_38990 50345 50977 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224137664.1 protein_id gnl|my_center|LOCUS_38990 51086 52048 gene locus_tag LOCUS_39000 51086 52048 CDS product rhodanese-related sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296405.1 protein_id gnl|my_center|LOCUS_39000 52356 53225 gene locus_tag LOCUS_39010 52356 53225 CDS product nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963177.1 protein_id gnl|my_center|LOCUS_39010 53541 53236 gene locus_tag LOCUS_39020 53541 53236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39020 54663 53650 gene locus_tag LOCUS_39030 54663 53650 CDS product acyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962802.1 protein_id gnl|my_center|LOCUS_39030 54857 55207 gene locus_tag LOCUS_39040 54857 55207 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962803.1 protein_id gnl|my_center|LOCUS_39040 55458 58196 gene locus_tag LOCUS_39050 55458 58196 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801208.1 protein_id gnl|my_center|LOCUS_39050 58559 58362 gene locus_tag LOCUS_39060 58559 58362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39060 60049 58679 gene locus_tag LOCUS_39070 60049 58679 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962751.1 protein_id gnl|my_center|LOCUS_39070 60811 60197 gene locus_tag LOCUS_39080 60811 60197 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141560.1 protein_id gnl|my_center|LOCUS_39080 61252 60890 gene locus_tag LOCUS_39090 61252 60890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39090 61500 61249 gene locus_tag LOCUS_39100 61500 61249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39100 62098 61691 gene locus_tag LOCUS_39110 62098 61691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39110 63486 62140 gene locus_tag LOCUS_39120 gene accC 63486 62140 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964466.1 protein_id gnl|my_center|LOCUS_39120 64126 63611 gene locus_tag LOCUS_39130 gene accB 64126 63611 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964467.1 protein_id gnl|my_center|LOCUS_39130 64670 64107 gene locus_tag LOCUS_39140 gene efp 64670 64107 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894417.1 protein_id gnl|my_center|LOCUS_39140 65896 64871 gene locus_tag LOCUS_39150 65896 64871 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791878.1 protein_id gnl|my_center|LOCUS_39150 66989 66048 gene locus_tag LOCUS_39160 gene plsX 66989 66048 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402829.1 protein_id gnl|my_center|LOCUS_39160 67334 67104 gene locus_tag LOCUS_39170 gene rpmF 67334 67104 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964469.1 protein_id gnl|my_center|LOCUS_39170 67954 67397 gene locus_tag LOCUS_39180 67954 67397 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402827.1 protein_id gnl|my_center|LOCUS_39180 68376 68008 gene locus_tag LOCUS_39190 68376 68008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39190 68681 68373 gene locus_tag LOCUS_39200 68681 68373 CDS product type II toxin-antitoxin system HigB family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040056.1 protein_id gnl|my_center|LOCUS_39200 69909 68761 gene locus_tag LOCUS_39210 gene pdxA 69909 68761 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785465.1 protein_id gnl|my_center|LOCUS_39210 70299 69925 gene locus_tag LOCUS_39220 70299 69925 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530241.1 protein_id gnl|my_center|LOCUS_39220 71844 70384 gene locus_tag LOCUS_39230 71844 70384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39230 72023 72856 gene locus_tag LOCUS_39240 gene rsmA 72023 72856 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760928.1 protein_id gnl|my_center|LOCUS_39240 72963 73901 gene locus_tag LOCUS_39250 72963 73901 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962245.1 protein_id gnl|my_center|LOCUS_39250 74007 74480 gene locus_tag LOCUS_39260 gene greA 74007 74480 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964455.1 protein_id gnl|my_center|LOCUS_39260 74668 75489 gene locus_tag LOCUS_39270 74668 75489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39270 75517 76290 gene locus_tag LOCUS_39280 75517 76290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39280 76646 76251 gene locus_tag LOCUS_39290 76646 76251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39290 77394 76630 gene locus_tag LOCUS_39300 77394 76630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39300 78122 77382 gene locus_tag LOCUS_39310 78122 77382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39310 78500 78135 gene locus_tag LOCUS_39320 78500 78135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39320 80015 78573 gene locus_tag LOCUS_39330 80015 78573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39330 80224 80949 gene locus_tag LOCUS_39340 80224 80949 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367602.1 protein_id gnl|my_center|LOCUS_39340 82711 81113 gene locus_tag LOCUS_39350 82711 81113 CDS product YdiU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037428.1 protein_id gnl|my_center|LOCUS_39350 83243 84562 gene locus_tag LOCUS_39360 83243 84562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39360 84575 84649 gene locus_tag LOCUS_t00470 84575 84649 tRNA product tRNA-Pyl inference COORDINATES:profile:Aragorn:1.2.38 85363 85121 gene locus_tag LOCUS_39370 85363 85121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39370 86066 85365 gene locus_tag LOCUS_39380 86066 85365 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760001.1 protein_id gnl|my_center|LOCUS_39380 86211 87245 gene locus_tag LOCUS_39390 86211 87245 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523318.1 protein_id gnl|my_center|LOCUS_39390 89308 87683 gene locus_tag LOCUS_39400 gene pckA 89308 87683 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392169.1 protein_id gnl|my_center|LOCUS_39400 89540 90481 gene locus_tag LOCUS_39410 89540 90481 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084097.1 protein_id gnl|my_center|LOCUS_39410 90585 92156 gene locus_tag LOCUS_39420 90585 92156 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964427.1 protein_id gnl|my_center|LOCUS_39420 92916 92452 gene locus_tag LOCUS_39430 92916 92452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39430 94936 93284 gene locus_tag LOCUS_39440 gene groL 94936 93284 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964087.1 protein_id gnl|my_center|LOCUS_39440 95293 95003 gene locus_tag LOCUS_39450 gene groES 95293 95003 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932216.1 protein_id gnl|my_center|LOCUS_39450 96207 96776 gene locus_tag LOCUS_39460 96207 96776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39460 96867 97973 gene locus_tag LOCUS_39470 96867 97973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39470 98962 98540 gene locus_tag LOCUS_39480 98962 98540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39480 100760 99339 gene locus_tag LOCUS_39490 100760 99339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39490 101625 101047 gene locus_tag LOCUS_39500 101625 101047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39500 102898 101606 gene locus_tag LOCUS_39510 102898 101606 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785466.1 protein_id gnl|my_center|LOCUS_39510 103141 102920 gene locus_tag LOCUS_39520 103141 102920 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545347.1 protein_id gnl|my_center|LOCUS_39520 103344 103159 gene locus_tag LOCUS_39530 103344 103159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39530 104857 103421 gene locus_tag LOCUS_39540 gene miaB 104857 103421 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964081.1 protein_id gnl|my_center|LOCUS_39540 106350 105049 gene locus_tag LOCUS_39550 106350 105049 CDS product anthranilate synthase component I family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963737.1 protein_id gnl|my_center|LOCUS_39550 107049 106462 gene locus_tag LOCUS_39560 107049 106462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39560 108717 107149 gene locus_tag LOCUS_39570 108717 107149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39570 110195 108921 gene locus_tag LOCUS_39580 110195 108921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39580 111081 110320 gene locus_tag LOCUS_39590 111081 110320 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761550.1 protein_id gnl|my_center|LOCUS_39590 112192 111071 gene locus_tag LOCUS_39600 112192 111071 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202852.1 protein_id gnl|my_center|LOCUS_39600 113030 112401 gene locus_tag LOCUS_39610 113030 112401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39610 114055 113363 gene locus_tag LOCUS_39620 114055 113363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39620 114173 115264 gene locus_tag LOCUS_39630 gene lpxK 114173 115264 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765467.1 protein_id gnl|my_center|LOCUS_39630 115385 117322 gene locus_tag LOCUS_39640 115385 117322 CDS product putative porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107202.1 protein_id gnl|my_center|LOCUS_39640 117333 117929 gene locus_tag LOCUS_39650 117333 117929 CDS product tRNA-(ms[2]io[6]A)-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962901.1 protein_id gnl|my_center|LOCUS_39650 119901 118789 gene locus_tag LOCUS_39660 119901 118789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39660 120795 120385 gene locus_tag LOCUS_39670 120795 120385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39670 122031 120913 gene locus_tag LOCUS_39680 122031 120913 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202951.1 protein_id gnl|my_center|LOCUS_39680 123208 122099 gene locus_tag LOCUS_39690 123208 122099 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202952.1 protein_id gnl|my_center|LOCUS_39690 124023 123238 gene locus_tag LOCUS_39700 124023 123238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39700 124946 124020 gene locus_tag LOCUS_39710 124946 124020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39710 125873 124959 gene locus_tag LOCUS_39720 125873 124959 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788227.1 protein_id gnl|my_center|LOCUS_39720 126085 125870 gene locus_tag LOCUS_39730 126085 125870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39730 127338 126100 gene locus_tag LOCUS_39740 127338 126100 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788229.1 protein_id gnl|my_center|LOCUS_39740 128040 127432 gene locus_tag LOCUS_39750 128040 127432 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107755.1 protein_id gnl|my_center|LOCUS_39750 128201 128917 gene locus_tag LOCUS_39760 128201 128917 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122349.1 protein_id gnl|my_center|LOCUS_39760 130273 128987 gene locus_tag LOCUS_39770 gene fahA 130273 128987 CDS product fumarylacetoacetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962840.1 protein_id gnl|my_center|LOCUS_39770 130389 131006 gene locus_tag LOCUS_39780 130389 131006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39780 131316 131053 gene locus_tag LOCUS_39790 131316 131053 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403584.1 protein_id gnl|my_center|LOCUS_39790 132422 131316 gene locus_tag LOCUS_39800 132422 131316 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764152.1 protein_id gnl|my_center|LOCUS_39800 132620 132925 gene locus_tag LOCUS_39810 132620 132925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39810 134795 132939 gene locus_tag LOCUS_39820 134795 132939 CDS product glycoside hydrolase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027553.1 protein_id gnl|my_center|LOCUS_39820 135755 135465 gene locus_tag LOCUS_39830 135755 135465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39830 137758 135794 gene locus_tag LOCUS_39840 137758 135794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39840 139504 138227 gene locus_tag LOCUS_39850 139504 138227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963252.1 protein_id gnl|my_center|LOCUS_39850 139653 140051 gene locus_tag LOCUS_39860 139653 140051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39860 140094 141332 gene locus_tag LOCUS_39870 140094 141332 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166151256.1 protein_id gnl|my_center|LOCUS_39870 141482 142204 gene locus_tag LOCUS_39880 141482 142204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39880 142254 143129 gene locus_tag LOCUS_39890 142254 143129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39890 144678 143353 gene locus_tag LOCUS_39900 gene mtaB 144678 143353 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963271.1 protein_id gnl|my_center|LOCUS_39900 146513 144828 gene locus_tag LOCUS_39910 146513 144828 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008661313.1 protein_id gnl|my_center|LOCUS_39910 146935 149124 gene locus_tag LOCUS_39920 146935 149124 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962708.1 protein_id gnl|my_center|LOCUS_39920 149804 149274 gene locus_tag LOCUS_39930 149804 149274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39930 149977 150342 gene locus_tag LOCUS_39940 149977 150342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39940 150425 150928 gene locus_tag LOCUS_39950 150425 150928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39950 151591 150983 gene locus_tag LOCUS_39960 151591 150983 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047812379.1 protein_id gnl|my_center|LOCUS_39960 152155 151625 gene locus_tag LOCUS_39970 152155 151625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39970 152311 154299 gene locus_tag LOCUS_39980 152311 154299 CDS product 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203674.1 protein_id gnl|my_center|LOCUS_39980 154320 154604 gene locus_tag LOCUS_39990 154320 154604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39990 154606 154884 gene locus_tag LOCUS_40000 154606 154884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40000 155443 154973 gene locus_tag LOCUS_40010 155443 154973 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840149.1 protein_id gnl|my_center|LOCUS_40010 156148 155699 gene locus_tag LOCUS_40020 156148 155699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40020 156576 157325 gene locus_tag LOCUS_40030 156576 157325 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122357.1 protein_id gnl|my_center|LOCUS_40030 157527 157715 gene locus_tag LOCUS_40040 157527 157715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40040 157715 158080 gene locus_tag LOCUS_40050 157715 158080 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764003.1 protein_id gnl|my_center|LOCUS_40050 160826 158226 gene locus_tag LOCUS_40060 160826 158226 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404969.1 protein_id gnl|my_center|LOCUS_40060 161980 160991 gene locus_tag LOCUS_40070 161980 160991 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112591.1 protein_id gnl|my_center|LOCUS_40070 162147 163394 gene locus_tag LOCUS_40080 gene hemA 162147 163394 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962225.1 protein_id gnl|my_center|LOCUS_40080 164399 163464 gene locus_tag LOCUS_40090 gene hemF 164399 163464 CDS product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920736.1 protein_id gnl|my_center|LOCUS_40090 165500 164580 gene locus_tag LOCUS_40100 165500 164580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40100 166268 165522 gene locus_tag LOCUS_40110 166268 165522 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963299.1 protein_id gnl|my_center|LOCUS_40110 166890 166318 gene locus_tag LOCUS_40120 166890 166318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40120 168317 166908 gene locus_tag LOCUS_40130 gene ccoG 168317 166908 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963297.1 protein_id gnl|my_center|LOCUS_40130 169346 168465 gene locus_tag LOCUS_40140 169346 168465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40140 169681 169343 gene locus_tag LOCUS_40150 169681 169343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40150 169878 169675 gene locus_tag LOCUS_40160 169878 169675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40160 172166 169956 gene locus_tag LOCUS_40170 gene ccoN 172166 169956 CDS product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963294.1 protein_id gnl|my_center|LOCUS_40170 172445 172290 gene locus_tag LOCUS_40180 172445 172290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40180 174925 172457 gene locus_tag LOCUS_40190 174925 172457 CDS product heavy metal translocating P-type ATPase metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963291.1 protein_id gnl|my_center|LOCUS_40190 175294 176703 gene locus_tag LOCUS_40200 175294 176703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40200 177447 177130 gene locus_tag LOCUS_40210 177447 177130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40210 177632 179245 gene locus_tag LOCUS_40220 177632 179245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40220 179223 180281 gene locus_tag LOCUS_40230 179223 180281 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143552.1 protein_id gnl|my_center|LOCUS_40230 180964 181962 gene locus_tag LOCUS_40240 180964 181962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40240 185288 182214 gene locus_tag LOCUS_40250 gene leuS 185288 182214 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964452.1 protein_id gnl|my_center|LOCUS_40250 185760 187859 gene locus_tag LOCUS_40260 gene dnaG 185760 187859 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109025.1 protein_id gnl|my_center|LOCUS_40260 187852 188031 gene locus_tag LOCUS_40270 187852 188031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40270 188232 189287 gene locus_tag LOCUS_40280 188232 189287 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546063.1 protein_id gnl|my_center|LOCUS_40280 189586 190779 gene locus_tag LOCUS_40290 189586 190779 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259615.1 protein_id gnl|my_center|LOCUS_40290 190776 191945 gene locus_tag LOCUS_40300 190776 191945 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259387.1 protein_id gnl|my_center|LOCUS_40300 192006 193235 gene locus_tag LOCUS_40310 192006 193235 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784515.1 protein_id gnl|my_center|LOCUS_40310 193560 193898 gene locus_tag LOCUS_40320 193560 193898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40320 193911 194222 gene locus_tag LOCUS_40330 193911 194222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40330 194350 194964 gene locus_tag LOCUS_40340 194350 194964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40340 195002 195349 gene locus_tag LOCUS_40350 195002 195349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40350 196123 195983 gene locus_tag LOCUS_40360 196123 195983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40360 196361 196714 gene locus_tag LOCUS_40370 196361 196714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40370 196774 197172 gene locus_tag LOCUS_40380 196774 197172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40380 197958 197626 gene locus_tag LOCUS_40390 197958 197626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40390 199223 197997 gene locus_tag LOCUS_40400 199223 197997 CDS product CinA family nicotinamide mononucleotide deamidase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202865.1 protein_id gnl|my_center|LOCUS_40400 199404 200210 gene locus_tag LOCUS_40410 199404 200210 CDS product DUF4197 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941866.1 protein_id gnl|my_center|LOCUS_40410 200814 200452 gene locus_tag LOCUS_40420 200814 200452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40420 201649 201017 gene locus_tag LOCUS_40430 201649 201017 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838378.1 protein_id gnl|my_center|LOCUS_40430 202471 201662 gene locus_tag LOCUS_40440 gene lpxA 202471 201662 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963123.1 protein_id gnl|my_center|LOCUS_40440 203977 202583 gene locus_tag LOCUS_40450 203977 202583 CDS product bifunctional UDP-3-O-[3-hydroxymyristoyl] N-acetylglucosamine deacetylase/3-hydroxyacyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963124.1 protein_id gnl|my_center|LOCUS_40450 205117 204077 gene locus_tag LOCUS_40460 gene lpxD 205117 204077 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963125.1 protein_id gnl|my_center|LOCUS_40460 206565 205336 gene locus_tag LOCUS_40470 206565 205336 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963126.1 protein_id gnl|my_center|LOCUS_40470 206979 206656 gene locus_tag LOCUS_40480 206979 206656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40480 207171 208739 gene locus_tag LOCUS_40490 207171 208739 CDS product PglZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963211.1 protein_id gnl|my_center|LOCUS_40490 210377 209121 gene locus_tag LOCUS_40500 210377 209121 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810425.1 protein_id gnl|my_center|LOCUS_40500 212915 210447 gene locus_tag LOCUS_40510 212915 210447 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963986.1 protein_id gnl|my_center|LOCUS_40510 215453 212982 gene locus_tag LOCUS_40520 215453 212982 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963986.1 protein_id gnl|my_center|LOCUS_40520 215668 216105 gene locus_tag LOCUS_40530 gene tsaE 215668 216105 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759702.1 protein_id gnl|my_center|LOCUS_40530 216199 217425 gene locus_tag LOCUS_40540 216199 217425 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963213.1 protein_id gnl|my_center|LOCUS_40540 217493 217948 gene locus_tag LOCUS_40550 217493 217948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40550 218348 218088 gene locus_tag LOCUS_40560 218348 218088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40560 219788 218868 gene locus_tag LOCUS_40570 219788 218868 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964439.1 protein_id gnl|my_center|LOCUS_40570 220501 220866 gene locus_tag LOCUS_40580 220501 220866 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362005.1 protein_id gnl|my_center|LOCUS_40580 221073 222653 gene locus_tag LOCUS_40590 221073 222653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40590 222700 224211 gene locus_tag LOCUS_40600 222700 224211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40600 224341 224565 gene locus_tag LOCUS_40610 224341 224565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40610 224745 227594 gene locus_tag LOCUS_40620 224745 227594 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338040.1 protein_id gnl|my_center|LOCUS_40620 >Feature sequence46 704 84 gene locus_tag LOCUS_40630 704 84 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40630 2449 773 gene locus_tag LOCUS_40640 2449 773 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943817.1 protein_id gnl|my_center|LOCUS_40640 2923 2522 gene locus_tag LOCUS_40650 2923 2522 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878542.1 protein_id gnl|my_center|LOCUS_40650 3511 2981 gene locus_tag LOCUS_40660 3511 2981 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072185.1 protein_id gnl|my_center|LOCUS_40660 7934 3615 gene locus_tag LOCUS_40670 7934 3615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40670 8325 10814 gene locus_tag LOCUS_40680 gene topA 8325 10814 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765309.1 protein_id gnl|my_center|LOCUS_40680 10844 11326 gene locus_tag LOCUS_40690 10844 11326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40690 11815 12498 gene locus_tag LOCUS_40700 11815 12498 CDS product DUF4846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765761.1 protein_id gnl|my_center|LOCUS_40700 13775 12687 gene locus_tag LOCUS_40710 13775 12687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40710 14269 14460 gene locus_tag LOCUS_40720 14269 14460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40720 15418 15059 gene locus_tag LOCUS_40730 15418 15059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40730 16766 15936 gene locus_tag LOCUS_40740 16766 15936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40740 19280 16884 gene locus_tag LOCUS_40750 19280 16884 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962850.1 protein_id gnl|my_center|LOCUS_40750 20642 19461 gene locus_tag LOCUS_40760 20642 19461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40760 21224 20697 gene locus_tag LOCUS_40770 21224 20697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40770 21558 22589 gene locus_tag LOCUS_40780 21558 22589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40780 22596 23333 gene locus_tag LOCUS_40790 22596 23333 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107709.1 protein_id gnl|my_center|LOCUS_40790 23899 23441 gene locus_tag LOCUS_40800 23899 23441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40800 24864 24100 gene locus_tag LOCUS_40810 24864 24100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40810 25170 24910 gene locus_tag LOCUS_40820 25170 24910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40820 25558 26562 gene locus_tag LOCUS_40830 25558 26562 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037389676.1 protein_id gnl|my_center|LOCUS_40830 26741 26559 gene locus_tag LOCUS_40840 26741 26559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40840 26680 27396 gene locus_tag LOCUS_40850 26680 27396 CDS product NAD-dependent deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963913.1 protein_id gnl|my_center|LOCUS_40850 27710 28132 gene locus_tag LOCUS_40860 27710 28132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40860 28361 28723 gene locus_tag LOCUS_40870 28361 28723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40870 29077 29628 gene locus_tag LOCUS_40880 29077 29628 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113921.1 protein_id gnl|my_center|LOCUS_40880 29683 33408 gene locus_tag LOCUS_40890 29683 33408 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163515044.1 protein_id gnl|my_center|LOCUS_40890 34002 36404 gene locus_tag LOCUS_40900 34002 36404 CDS product carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107799.1 protein_id gnl|my_center|LOCUS_40900 36756 37745 gene locus_tag LOCUS_40910 36756 37745 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963116.1 protein_id gnl|my_center|LOCUS_40910 40336 37985 gene locus_tag LOCUS_40920 40336 37985 CDS product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814149.1 protein_id gnl|my_center|LOCUS_40920 40909 40502 gene locus_tag LOCUS_40930 40909 40502 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480246.1 protein_id gnl|my_center|LOCUS_40930 43178 41184 gene locus_tag LOCUS_40940 gene gyrB 43178 41184 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783987.1 protein_id gnl|my_center|LOCUS_40940 43851 44180 gene locus_tag LOCUS_40950 43851 44180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40950 44623 45687 gene locus_tag LOCUS_40960 44623 45687 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115731595.1 protein_id gnl|my_center|LOCUS_40960 46041 46307 gene locus_tag LOCUS_40970 46041 46307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40970 46304 47632 gene locus_tag LOCUS_40980 46304 47632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40980 47651 47848 gene locus_tag LOCUS_40990 47651 47848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40990 47862 48077 gene locus_tag LOCUS_41000 47862 48077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41000 48070 49320 gene locus_tag LOCUS_41010 48070 49320 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192488.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_41010 49381 49641 gene locus_tag LOCUS_41020 49381 49641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_41020 49669 51309 gene locus_tag LOCUS_41030 49669 51309 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001108817.1 protein_id gnl|my_center|LOCUS_41030 51629 51555 gene locus_tag LOCUS_t00480 51629 51555 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 51724 51650 gene locus_tag LOCUS_t00490 51724 51650 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 51891 51803 gene locus_tag LOCUS_t00500 51891 51803 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 52037 53020 gene locus_tag LOCUS_41040 52037 53020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41040 53017 54012 gene locus_tag LOCUS_41050 53017 54012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41050 54146 55330 gene locus_tag LOCUS_41060 54146 55330 CDS product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962929.1 protein_id gnl|my_center|LOCUS_41060 55443 56882 gene locus_tag LOCUS_41070 55443 56882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41070 57319 57477 gene locus_tag LOCUS_41080 57319 57477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41080 60045 60290 gene locus_tag LOCUS_41090 60045 60290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41090 60815 61012 gene locus_tag LOCUS_41100 60815 61012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41100 61337 63877 gene locus_tag LOCUS_41110 61337 63877 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963618.1 protein_id gnl|my_center|LOCUS_41110 64895 64293 gene locus_tag LOCUS_41120 64895 64293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41120 66996 64921 gene locus_tag LOCUS_41130 66996 64921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41130 70945 68462 gene locus_tag LOCUS_41140 70945 68462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41140 72213 71551 gene locus_tag LOCUS_41150 72213 71551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41150 75446 72909 gene locus_tag LOCUS_41160 75446 72909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41160 76213 77634 gene locus_tag LOCUS_41170 gene hisS 76213 77634 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203280.1 protein_id gnl|my_center|LOCUS_41170 77793 79286 gene locus_tag LOCUS_41180 gene hutH 77793 79286 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962994.1 protein_id gnl|my_center|LOCUS_41180 79701 81380 gene locus_tag LOCUS_41190 79701 81380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41190 81537 81875 gene locus_tag LOCUS_41200 81537 81875 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197537018.1 protein_id gnl|my_center|LOCUS_41200 81897 83027 gene locus_tag LOCUS_41210 81897 83027 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963200.1 protein_id gnl|my_center|LOCUS_41210 83693 83475 gene locus_tag LOCUS_41220 83693 83475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41220 83938 85665 gene locus_tag LOCUS_41230 83938 85665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41230 85738 86721 gene locus_tag LOCUS_41240 85738 86721 CDS product pyruvate dehydrogenase complex E1 component subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028525108.1 protein_id gnl|my_center|LOCUS_41240 87055 87621 gene locus_tag LOCUS_41250 87055 87621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41250 88051 87623 gene locus_tag LOCUS_41260 88051 87623 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001088078.1 protein_id gnl|my_center|LOCUS_41260 88870 88136 gene locus_tag LOCUS_41270 88870 88136 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555511.1 protein_id gnl|my_center|LOCUS_41270 89159 89341 gene locus_tag LOCUS_41280 89159 89341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41280 89440 89832 gene locus_tag LOCUS_41290 89440 89832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41290 91668 90304 gene locus_tag LOCUS_41300 gene ffh 91668 90304 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789195.1 protein_id gnl|my_center|LOCUS_41300 92359 91715 gene locus_tag LOCUS_41310 92359 91715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41310 92393 93703 gene locus_tag LOCUS_41320 92393 93703 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103038479.1 protein_id gnl|my_center|LOCUS_41320 94813 93899 gene locus_tag LOCUS_41330 94813 93899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41330 96316 94844 gene locus_tag LOCUS_41340 96316 94844 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048068.1 protein_id gnl|my_center|LOCUS_41340 96501 97520 gene locus_tag LOCUS_41350 gene pseB 96501 97520 CDS product UDP-N-acetylglucosamine 4,6-dehydratase (inverting) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073154.1 protein_id gnl|my_center|LOCUS_41350 97538 98746 gene locus_tag LOCUS_41360 gene pseC 97538 98746 CDS product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097863.1 protein_id gnl|my_center|LOCUS_41360 98974 99180 gene locus_tag LOCUS_41370 98974 99180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41370 99180 99914 gene locus_tag LOCUS_41380 99180 99914 CDS product glycosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869429.1 protein_id gnl|my_center|LOCUS_41380 99911 100828 gene locus_tag LOCUS_41390 99911 100828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41390 100924 101667 gene locus_tag LOCUS_41400 100924 101667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41400 101875 103464 gene locus_tag LOCUS_41410 101875 103464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41410 103477 104154 gene locus_tag LOCUS_41420 103477 104154 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987013.1 protein_id gnl|my_center|LOCUS_41420 104276 105319 gene locus_tag LOCUS_41430 gene pseI 104276 105319 CDS product pseudaminic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920708.1 protein_id gnl|my_center|LOCUS_41430 105319 106626 gene locus_tag LOCUS_41440 105319 106626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41440 106702 108906 gene locus_tag LOCUS_41450 106702 108906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41450 108928 110331 gene locus_tag LOCUS_41460 108928 110331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41460 110350 111909 gene locus_tag LOCUS_41470 110350 111909 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965385.1 protein_id gnl|my_center|LOCUS_41470 113039 111999 gene locus_tag LOCUS_41480 113039 111999 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028993.1 protein_id gnl|my_center|LOCUS_41480 113829 113257 gene locus_tag LOCUS_41490 113829 113257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41490 114746 114408 gene locus_tag LOCUS_41500 114746 114408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41500 114830 115570 gene locus_tag LOCUS_41510 114830 115570 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962507.1 protein_id gnl|my_center|LOCUS_41510 115669 116646 gene locus_tag LOCUS_41520 115669 116646 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962506.1 protein_id gnl|my_center|LOCUS_41520 116861 117496 gene locus_tag LOCUS_41530 116861 117496 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062451.1 protein_id gnl|my_center|LOCUS_41530 117620 118168 gene locus_tag LOCUS_41540 gene bstA 117620 118168 CDS product bacillithiol transferase BstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243944.1 protein_id gnl|my_center|LOCUS_41540 119264 118449 gene locus_tag LOCUS_41550 119264 118449 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963507.1 protein_id gnl|my_center|LOCUS_41550 120095 119364 gene locus_tag LOCUS_41560 120095 119364 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963506.1 protein_id gnl|my_center|LOCUS_41560 120202 120921 gene locus_tag LOCUS_41570 120202 120921 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405499.1 protein_id gnl|my_center|LOCUS_41570 121660 120935 gene locus_tag LOCUS_41580 121660 120935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41580 121760 122455 gene locus_tag LOCUS_41590 121760 122455 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403642.1 protein_id gnl|my_center|LOCUS_41590 122706 123614 gene locus_tag LOCUS_41600 gene gldA 122706 123614 CDS product gliding motility-associated ABC transporter ATP-binding subunit GldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209146359.1 protein_id gnl|my_center|LOCUS_41600 123683 124993 gene locus_tag LOCUS_41610 123683 124993 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202567.1 protein_id gnl|my_center|LOCUS_41610 124990 126189 gene locus_tag LOCUS_41620 124990 126189 CDS product DUF3696 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202566.1 protein_id gnl|my_center|LOCUS_41620 126193 127137 gene locus_tag LOCUS_41630 126193 127137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41630 127144 127869 gene locus_tag LOCUS_41640 gene gldF 127144 127869 CDS product gliding motility-associated ABC transporter permease subunit GldF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963228.1 protein_id gnl|my_center|LOCUS_41640 127869 129599 gene locus_tag LOCUS_41650 gene gldG 127869 129599 CDS product gliding motility-associated ABC transporter substrate-binding protein GldG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963229.1 protein_id gnl|my_center|LOCUS_41650 130004 130876 gene locus_tag LOCUS_41660 130004 130876 CDS product manganese catalase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525132.1 protein_id gnl|my_center|LOCUS_41660 131730 131104 gene locus_tag LOCUS_41670 131730 131104 CDS product chloramphenicol acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787873.1 protein_id gnl|my_center|LOCUS_41670 131953 132135 gene locus_tag LOCUS_41680 131953 132135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41680 133097 134221 gene locus_tag LOCUS_41690 gene dnaN 133097 134221 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963230.1 protein_id gnl|my_center|LOCUS_41690 134359 134694 gene locus_tag LOCUS_41700 gene gldC 134359 134694 CDS product gliding motility protein GldC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964167.1 protein_id gnl|my_center|LOCUS_41700 135448 134900 gene locus_tag LOCUS_41710 135448 134900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41710 136118 135579 gene locus_tag LOCUS_41720 gene dcd 136118 135579 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963354.1 protein_id gnl|my_center|LOCUS_41720 137050 136178 gene locus_tag LOCUS_41730 137050 136178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41730 138445 137144 gene locus_tag LOCUS_41740 gene hemL 138445 137144 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933753.1 protein_id gnl|my_center|LOCUS_41740 140265 138532 gene locus_tag LOCUS_41750 140265 138532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41750 140465 141085 gene locus_tag LOCUS_41760 140465 141085 CDS product DUF1361 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680079.1 protein_id gnl|my_center|LOCUS_41760 142049 141402 gene locus_tag LOCUS_41770 142049 141402 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632821.1 protein_id gnl|my_center|LOCUS_41770 142876 142079 gene locus_tag LOCUS_41780 142876 142079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41780 143496 142852 gene locus_tag LOCUS_41790 143496 142852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41790 144050 143592 gene locus_tag LOCUS_41800 144050 143592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41800 144433 145446 gene locus_tag LOCUS_41810 144433 145446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41810 145479 145961 gene locus_tag LOCUS_41820 145479 145961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41820 146008 146766 gene locus_tag LOCUS_41830 146008 146766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41830 146882 152056 gene locus_tag LOCUS_41840 146882 152056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41840 152103 153521 gene locus_tag LOCUS_41850 152103 153521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41850 154301 153582 gene locus_tag LOCUS_41860 154301 153582 CDS product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057804.1 protein_id gnl|my_center|LOCUS_41860 155939 154404 gene locus_tag LOCUS_41870 gene guaA 155939 154404 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124903406.1 protein_id gnl|my_center|LOCUS_41870 156439 157095 gene locus_tag LOCUS_41880 gene fsa 156439 157095 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107927.1 protein_id gnl|my_center|LOCUS_41880 157351 157554 gene locus_tag LOCUS_41890 157351 157554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41890 157657 158337 gene locus_tag LOCUS_41900 157657 158337 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962683.1 protein_id gnl|my_center|LOCUS_41900 158391 159281 gene locus_tag LOCUS_41910 158391 159281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41910 159368 160531 gene locus_tag LOCUS_41920 159368 160531 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962574.1 protein_id gnl|my_center|LOCUS_41920 160521 161567 gene locus_tag LOCUS_41930 gene wlbA 160521 161567 CDS product O-antigen biosynthesis protein WlbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807115.1 protein_id gnl|my_center|LOCUS_41930 161595 162635 gene locus_tag LOCUS_41940 161595 162635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41940 162950 163600 gene locus_tag LOCUS_41950 162950 163600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531332.1 protein_id gnl|my_center|LOCUS_41950 165878 164946 gene locus_tag LOCUS_41960 165878 164946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41960 165981 166247 gene locus_tag LOCUS_41970 165981 166247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41970 166967 166605 gene locus_tag LOCUS_41980 166967 166605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41980 167537 170710 gene locus_tag LOCUS_41990 167537 170710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41990 170756 170947 gene locus_tag LOCUS_42000 170756 170947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42000 171621 172292 gene locus_tag LOCUS_42010 171621 172292 CDS product DUF4272 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141321.1 protein_id gnl|my_center|LOCUS_42010 172377 173111 gene locus_tag LOCUS_42020 172377 173111 CDS product DUF2071 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120779.1 protein_id gnl|my_center|LOCUS_42020 173118 173540 gene locus_tag LOCUS_42030 173118 173540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42030 174191 174652 gene locus_tag LOCUS_42040 174191 174652 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172598099.1 protein_id gnl|my_center|LOCUS_42040 174940 175251 gene locus_tag LOCUS_42050 174940 175251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42050 176180 176671 gene locus_tag LOCUS_42060 176180 176671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42060 176767 177399 gene locus_tag LOCUS_42070 176767 177399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42070 177368 177646 gene locus_tag LOCUS_42080 177368 177646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42080 177892 179679 gene locus_tag LOCUS_42090 177892 179679 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029327287.1 protein_id gnl|my_center|LOCUS_42090 179791 181017 gene locus_tag LOCUS_42100 179791 181017 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918524.1 protein_id gnl|my_center|LOCUS_42100 181260 181436 gene locus_tag LOCUS_42110 181260 181436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42110 181811 181548 gene locus_tag LOCUS_42120 181811 181548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42120 182006 183451 gene locus_tag LOCUS_42130 182006 183451 CDS product diadenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_150790356.1 protein_id gnl|my_center|LOCUS_42130 186325 183551 gene locus_tag LOCUS_42140 186325 183551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42140 187456 186782 gene locus_tag LOCUS_42150 187456 186782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42150 188304 191336 gene locus_tag LOCUS_42160 188304 191336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42160 191486 191938 gene locus_tag LOCUS_42170 191486 191938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42170 191942 192631 gene locus_tag LOCUS_42180 191942 192631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42180 192725 193132 gene locus_tag LOCUS_42190 192725 193132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42190 193472 194281 gene locus_tag LOCUS_42200 193472 194281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42200 194662 194261 gene locus_tag LOCUS_42210 194662 194261 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004348825.1 protein_id gnl|my_center|LOCUS_42210 195333 194764 gene locus_tag LOCUS_42220 195333 194764 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762221.1 protein_id gnl|my_center|LOCUS_42220 195443 195643 gene locus_tag LOCUS_42230 195443 195643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42230 195965 196900 gene locus_tag LOCUS_42240 195965 196900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42240 197112 198470 gene locus_tag LOCUS_42250 197112 198470 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918774.1 protein_id gnl|my_center|LOCUS_42250 198721 199092 gene locus_tag LOCUS_42260 198721 199092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42260 199153 199947 gene locus_tag LOCUS_42270 199153 199947 CDS product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249303.1 protein_id gnl|my_center|LOCUS_42270 200851 199988 gene locus_tag LOCUS_42280 200851 199988 CDS product DUF2911 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963156.1 protein_id gnl|my_center|LOCUS_42280 201067 202026 gene locus_tag LOCUS_42290 201067 202026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42290 202104 202388 gene locus_tag LOCUS_42300 202104 202388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42300 >Feature sequence47 <1 548 gene locus_tag LOCUS_42310 <1 548 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_172977944.1:IS630-like element ISRm10-1 family transposase 1656 793 gene locus_tag LOCUS_42320 1656 793 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962928.1 protein_id gnl|my_center|LOCUS_42320 2207 1749 gene locus_tag LOCUS_42330 gene smpB 2207 1749 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005780358.1 protein_id gnl|my_center|LOCUS_42330 2643 2200 gene locus_tag LOCUS_42340 2643 2200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42340 4005 2992 gene locus_tag LOCUS_42350 gene tsaD 4005 2992 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038503448.1 protein_id gnl|my_center|LOCUS_42350 4282 8886 gene locus_tag LOCUS_42360 4282 8886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42360 9497 10336 gene locus_tag LOCUS_42370 9497 10336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42370 10854 11753 gene locus_tag LOCUS_42380 10854 11753 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005779718.1 protein_id gnl|my_center|LOCUS_42380 11872 12186 gene locus_tag LOCUS_42390 11872 12186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42390 12250 13080 gene locus_tag LOCUS_42400 12250 13080 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964447.1 protein_id gnl|my_center|LOCUS_42400 13077 13925 gene locus_tag LOCUS_42410 gene truB 13077 13925 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964446.1 protein_id gnl|my_center|LOCUS_42410 14064 15011 gene locus_tag LOCUS_42420 14064 15011 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404517.1 protein_id gnl|my_center|LOCUS_42420 15020 15229 gene locus_tag LOCUS_42430 15020 15229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42430 15294 16487 gene locus_tag LOCUS_42440 15294 16487 CDS product carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838323.1 protein_id gnl|my_center|LOCUS_42440 16692 17387 gene locus_tag LOCUS_42450 16692 17387 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962207.1 protein_id gnl|my_center|LOCUS_42450 17475 18812 gene locus_tag LOCUS_42460 17475 18812 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967203.1 protein_id gnl|my_center|LOCUS_42460 18889 19548 gene locus_tag LOCUS_42470 18889 19548 CDS product 3-oxoacid CoA-transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962211.1 protein_id gnl|my_center|LOCUS_42470 20400 19792 gene locus_tag LOCUS_42480 20400 19792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42480 21302 20718 gene locus_tag LOCUS_42490 21302 20718 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790890.1 protein_id gnl|my_center|LOCUS_42490 21774 23159 gene locus_tag LOCUS_42500 21774 23159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42500 23238 24290 gene locus_tag LOCUS_42510 23238 24290 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921032.1 protein_id gnl|my_center|LOCUS_42510 24303 27392 gene locus_tag LOCUS_42520 24303 27392 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920956.1 protein_id gnl|my_center|LOCUS_42520 27556 27984 gene locus_tag LOCUS_42530 27556 27984 CDS product DUF2147 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014507213.1 protein_id gnl|my_center|LOCUS_42530 28235 29344 gene locus_tag LOCUS_42540 28235 29344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42540 29325 30104 gene locus_tag LOCUS_42550 29325 30104 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107611.1 protein_id gnl|my_center|LOCUS_42550 30544 30209 gene locus_tag LOCUS_42560 30544 30209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42560 31677 31036 gene locus_tag LOCUS_42570 31677 31036 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000446319.1 protein_id gnl|my_center|LOCUS_42570 33621 35366 gene locus_tag LOCUS_42580 33621 35366 CDS product bifunctional GNAT family N-acetyltransferase/carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625288.1 protein_id gnl|my_center|LOCUS_42580 35629 36273 gene locus_tag LOCUS_42590 35629 36273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42590 37081 36365 gene locus_tag LOCUS_42600 37081 36365 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784744.1 protein_id gnl|my_center|LOCUS_42600 37332 38309 gene locus_tag LOCUS_42610 37332 38309 CDS product stage II sporulation protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108173.1 protein_id gnl|my_center|LOCUS_42610 38326 39276 gene locus_tag LOCUS_42620 38326 39276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42620 39374 40099 gene locus_tag LOCUS_42630 39374 40099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42630 40117 41610 gene locus_tag LOCUS_42640 40117 41610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42640 41768 42916 gene locus_tag LOCUS_42650 41768 42916 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784757.1 protein_id gnl|my_center|LOCUS_42650 42965 43333 gene locus_tag LOCUS_42660 42965 43333 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016267883.1 protein_id gnl|my_center|LOCUS_42660 43376 44725 gene locus_tag LOCUS_42670 43376 44725 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108171.1 protein_id gnl|my_center|LOCUS_42670 45192 47234 gene locus_tag LOCUS_42680 45192 47234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42680 47625 49304 gene locus_tag LOCUS_42690 47625 49304 CDS product DUF6044 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245165.1 protein_id gnl|my_center|LOCUS_42690 49543 50154 gene locus_tag LOCUS_42700 49543 50154 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310428.1 protein_id gnl|my_center|LOCUS_42700 54043 50204 gene locus_tag LOCUS_42710 54043 50204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42710 57965 54117 gene locus_tag LOCUS_42720 57965 54117 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062542257.1 protein_id gnl|my_center|LOCUS_42720 58655 58266 gene locus_tag LOCUS_42730 58655 58266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034098264.1 protein_id gnl|my_center|LOCUS_42730 58909 58655 gene locus_tag LOCUS_42740 58909 58655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42740 59549 58980 gene locus_tag LOCUS_42750 59549 58980 CDS product DUF420 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231280.1 protein_id gnl|my_center|LOCUS_42750 60207 59533 gene locus_tag LOCUS_42760 60207 59533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42760 60555 60211 gene locus_tag LOCUS_42770 60555 60211 CDS product cytochrome C oxidase subunit IV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964208.1 protein_id gnl|my_center|LOCUS_42770 61427 60654 gene locus_tag LOCUS_42780 61427 60654 CDS product heme-copper oxidase subunit III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004434085.1 protein_id gnl|my_center|LOCUS_42780 62036 61449 gene locus_tag LOCUS_42790 62036 61449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42790 62982 62131 gene locus_tag LOCUS_42800 gene cyoE 62982 62131 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964205.1 protein_id gnl|my_center|LOCUS_42800 64132 63050 gene locus_tag LOCUS_42810 64132 63050 CDS product heme A synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880041.1 protein_id gnl|my_center|LOCUS_42810 66194 64308 gene locus_tag LOCUS_42820 66194 64308 CDS product cbb3-type cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962550.1 protein_id gnl|my_center|LOCUS_42820 67296 66223 gene locus_tag LOCUS_42830 67296 66223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42830 68724 67399 gene locus_tag LOCUS_42840 68724 67399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42840 69492 68728 gene locus_tag LOCUS_42850 69492 68728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42850 70019 69492 gene locus_tag LOCUS_42860 70019 69492 CDS product DUF3341 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962546.1 protein_id gnl|my_center|LOCUS_42860 71469 70012 gene locus_tag LOCUS_42870 gene nrfD 71469 70012 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962545.1 protein_id gnl|my_center|LOCUS_42870 74526 71491 gene locus_tag LOCUS_42880 74526 71491 CDS product TAT-variant-translocated molybdopterin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962544.1 protein_id gnl|my_center|LOCUS_42880 76029 74677 gene locus_tag LOCUS_42890 76029 74677 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962543.1 protein_id gnl|my_center|LOCUS_42890 76518 76895 gene locus_tag LOCUS_42900 gene rpsF 76518 76895 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005781453.1 protein_id gnl|my_center|LOCUS_42900 76912 77187 gene locus_tag LOCUS_42910 gene rpsR 76912 77187 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963955.1 protein_id gnl|my_center|LOCUS_42910 77302 77745 gene locus_tag LOCUS_42920 gene rplI 77302 77745 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759741.1 protein_id gnl|my_center|LOCUS_42920 77912 80404 gene locus_tag LOCUS_42930 77912 80404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42930 80471 82555 gene locus_tag LOCUS_42940 80471 82555 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964202.1 protein_id gnl|my_center|LOCUS_42940 82732 85275 gene locus_tag LOCUS_42950 gene priA 82732 85275 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108457.1 protein_id gnl|my_center|LOCUS_42950 85976 85356 gene locus_tag LOCUS_42960 85976 85356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42960 86184 86987 gene locus_tag LOCUS_42970 86184 86987 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404953.1 protein_id gnl|my_center|LOCUS_42970 87022 88296 gene locus_tag LOCUS_42980 87022 88296 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203495.1 protein_id gnl|my_center|LOCUS_42980 88407 88736 gene locus_tag LOCUS_42990 88407 88736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42990 89294 88971 gene locus_tag LOCUS_43000 89294 88971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43000 89772 89530 gene locus_tag LOCUS_43010 89772 89530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43010 89922 90389 gene locus_tag LOCUS_43020 89922 90389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43020 90527 91405 gene locus_tag LOCUS_43030 90527 91405 CDS product prohibitin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962731.1 protein_id gnl|my_center|LOCUS_43030 91575 91411 gene locus_tag LOCUS_43040 91575 91411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43040 91795 92703 gene locus_tag LOCUS_43050 91795 92703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43050 92831 93814 gene locus_tag LOCUS_43060 92831 93814 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140193.1 protein_id gnl|my_center|LOCUS_43060 93885 94634 gene locus_tag LOCUS_43070 93885 94634 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144187.1 protein_id gnl|my_center|LOCUS_43070 94659 95180 gene locus_tag LOCUS_43080 94659 95180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43080 95303 95734 gene locus_tag LOCUS_43090 95303 95734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43090 95818 96396 gene locus_tag LOCUS_43100 95818 96396 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707037.1 protein_id gnl|my_center|LOCUS_43100 96802 96608 gene locus_tag LOCUS_43110 96802 96608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43110 98305 96935 gene locus_tag LOCUS_43120 98305 96935 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022835601.1 protein_id gnl|my_center|LOCUS_43120 101426 98319 gene locus_tag LOCUS_43130 101426 98319 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_185958394.1 protein_id gnl|my_center|LOCUS_43130 101719 102888 gene locus_tag LOCUS_43140 gene rnd 101719 102888 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384075.1 protein_id gnl|my_center|LOCUS_43140 103062 104102 gene locus_tag LOCUS_43150 gene mltG 103062 104102 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202520.1 protein_id gnl|my_center|LOCUS_43150 106110 104578 gene locus_tag LOCUS_43160 106110 104578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43160 106210 106656 gene locus_tag LOCUS_43170 gene dtd 106210 106656 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933491.1 protein_id gnl|my_center|LOCUS_43170 106692 107018 gene locus_tag LOCUS_43180 106692 107018 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783700.1 protein_id gnl|my_center|LOCUS_43180 108007 107288 gene locus_tag LOCUS_43190 108007 107288 CDS product 2-phosphosulfolactate phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080870.1 protein_id gnl|my_center|LOCUS_43190 109254 108151 gene locus_tag LOCUS_43200 gene gcvT 109254 108151 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962992.1 protein_id gnl|my_center|LOCUS_43200 110461 109397 gene locus_tag LOCUS_43210 110461 109397 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246499.1 protein_id gnl|my_center|LOCUS_43210 111194 110631 gene locus_tag LOCUS_43220 111194 110631 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962744.1 protein_id gnl|my_center|LOCUS_43220 112750 112040 gene locus_tag LOCUS_43230 112750 112040 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962745.1 protein_id gnl|my_center|LOCUS_43230 115503 112762 gene locus_tag LOCUS_43240 115503 112762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43240 115842 115555 gene locus_tag LOCUS_43250 gene gatC 115842 115555 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544984.1 protein_id gnl|my_center|LOCUS_43250 116748 115924 gene locus_tag LOCUS_43260 116748 115924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43260 117601 117014 gene locus_tag LOCUS_43270 117601 117014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43270 117968 118300 gene locus_tag LOCUS_43280 117968 118300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43280 118411 119043 gene locus_tag LOCUS_43290 118411 119043 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796757.1 protein_id gnl|my_center|LOCUS_43290 119538 119095 gene locus_tag LOCUS_43300 119538 119095 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017870060.1 protein_id gnl|my_center|LOCUS_43300 121152 119596 gene locus_tag LOCUS_43310 121152 119596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43310 121839 122714 gene locus_tag LOCUS_43320 gene prfB 121839 122714 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_117386928.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43320 124195 122798 gene locus_tag LOCUS_43330 124195 122798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43330 127199 124218 gene locus_tag LOCUS_43340 127199 124218 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_185958394.1 protein_id gnl|my_center|LOCUS_43340 128838 128521 gene locus_tag LOCUS_43350 128838 128521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43350 129010 129267 gene locus_tag LOCUS_43360 129010 129267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43360 129612 132767 gene locus_tag LOCUS_43370 129612 132767 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121850300.1 protein_id gnl|my_center|LOCUS_43370 132800 134212 gene locus_tag LOCUS_43380 132800 134212 CDS product SusD/RagB family nutrient-binding outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072714626.1 protein_id gnl|my_center|LOCUS_43380 134756 137944 gene locus_tag LOCUS_43390 134756 137944 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108195.1 protein_id gnl|my_center|LOCUS_43390 137971 139554 gene locus_tag LOCUS_43400 137971 139554 CDS product SusD/RagB family nutrient-binding outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766147.1 protein_id gnl|my_center|LOCUS_43400 139609 140163 gene locus_tag LOCUS_43410 139609 140163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43410 140283 141734 gene locus_tag LOCUS_43420 140283 141734 CDS product IS4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157579517.1 protein_id gnl|my_center|LOCUS_43420 143232 141832 gene locus_tag LOCUS_43430 gene hslU 143232 141832 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404390.1 protein_id gnl|my_center|LOCUS_43430 144332 143328 gene locus_tag LOCUS_43440 gene porQ 144332 143328 CDS product type IX secretion system protein PorQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963823.1 protein_id gnl|my_center|LOCUS_43440 147410 144900 gene locus_tag LOCUS_43450 gene lon 147410 144900 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963824.1 protein_id gnl|my_center|LOCUS_43450 147638 149758 gene locus_tag LOCUS_43460 147638 149758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43460 150366 149920 gene locus_tag LOCUS_43470 150366 149920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43470 150997 150359 gene locus_tag LOCUS_43480 150997 150359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43480 151473 151027 gene locus_tag LOCUS_43490 151473 151027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43490 151846 151598 gene locus_tag LOCUS_43500 151846 151598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43500 153458 151962 gene locus_tag LOCUS_43510 153458 151962 CDS product GH3 auxin-responsive promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964569.1 protein_id gnl|my_center|LOCUS_43510 153603 154037 gene locus_tag LOCUS_43520 153603 154037 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838707.1 protein_id gnl|my_center|LOCUS_43520 154214 154708 gene locus_tag LOCUS_43530 154214 154708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43530 155019 154705 gene locus_tag LOCUS_43540 155019 154705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43540 156785 155229 gene locus_tag LOCUS_43550 gene dnaA 156785 155229 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402792.1 protein_id gnl|my_center|LOCUS_43550 157876 156938 gene locus_tag LOCUS_43560 157876 156938 CDS product metallophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963938.1 protein_id gnl|my_center|LOCUS_43560 158765 157974 gene locus_tag LOCUS_43570 158765 157974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43570 159651 161432 gene locus_tag LOCUS_43580 159651 161432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43580 161562 163814 gene locus_tag LOCUS_43590 gene scpA 161562 163814 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887727.1 protein_id gnl|my_center|LOCUS_43590 164426 163944 gene locus_tag LOCUS_43600 164426 163944 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895679.1 protein_id gnl|my_center|LOCUS_43600 165393 164644 gene locus_tag LOCUS_43610 165393 164644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43610 165638 166483 gene locus_tag LOCUS_43620 165638 166483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43620 167335 166583 gene locus_tag LOCUS_43630 gene ureG 167335 166583 CDS product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095530.1 protein_id gnl|my_center|LOCUS_43630 168088 167417 gene locus_tag LOCUS_43640 168088 167417 CDS product urease accessory protein UreF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013380.1 protein_id gnl|my_center|LOCUS_43640 169868 168153 gene locus_tag LOCUS_43650 gene ureC 169868 168153 CDS product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763096.1 protein_id gnl|my_center|LOCUS_43650 170262 169876 gene locus_tag LOCUS_43660 170262 169876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43660 170544 170263 gene locus_tag LOCUS_43670 170544 170263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43670 171521 170778 gene locus_tag LOCUS_43680 171521 170778 CDS product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267498.1 protein_id gnl|my_center|LOCUS_43680 172377 171772 gene locus_tag LOCUS_43690 172377 171772 CDS product hydantoin utilization protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125521.1 protein_id gnl|my_center|LOCUS_43690 172898 173608 gene locus_tag LOCUS_43700 172898 173608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43700 173659 174831 gene locus_tag LOCUS_43710 173659 174831 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802379.1 protein_id gnl|my_center|LOCUS_43710 174947 176293 gene locus_tag LOCUS_43720 gene rseP 174947 176293 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203410.1 protein_id gnl|my_center|LOCUS_43720 176375 176878 gene locus_tag LOCUS_43730 176375 176878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43730 178041 177376 gene locus_tag LOCUS_43740 178041 177376 CDS product DUF2461 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000902962.1 protein_id gnl|my_center|LOCUS_43740 180721 178247 gene locus_tag LOCUS_43750 180721 178247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43750 181039 181791 gene locus_tag LOCUS_43760 181039 181791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43760 183337 181898 gene locus_tag LOCUS_43770 183337 181898 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963081.1 protein_id gnl|my_center|LOCUS_43770 186521 183330 gene locus_tag LOCUS_43780 186521 183330 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963080.1 protein_id gnl|my_center|LOCUS_43780 187804 186635 gene locus_tag LOCUS_43790 187804 186635 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963079.1 protein_id gnl|my_center|LOCUS_43790 188112 188807 gene locus_tag LOCUS_43800 188112 188807 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025775002.1 protein_id gnl|my_center|LOCUS_43800 188804 190141 gene locus_tag LOCUS_43810 188804 190141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43810 190426 191517 gene locus_tag LOCUS_43820 190426 191517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43820 193147 191723 gene locus_tag LOCUS_43830 193147 191723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43830 193408 194421 gene locus_tag LOCUS_43840 gene meaB 193408 194421 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404535.1 protein_id gnl|my_center|LOCUS_43840 194887 194405 gene locus_tag LOCUS_43850 194887 194405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43850 195902 195687 gene locus_tag LOCUS_43860 195902 195687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43860