COMMON DATATYPE type WGS KEYWORD keyword WGS KEYWORD keyword STANDARD_DRAFT DBLINK project biosample SUBMITTER ab_name ab_name ab_name contact email phone fax institute country city street zip REFERENCE title ab_name ab_name ab_name status Unpublished year COMMENT line Annotated by DFAST v.1.2.20 (https://dfast.nig.ac.jp) ST_COMMENT tagset_id Genome-Assembly-Data Assembly Method Genome Coverage Sequencing Technology sequence1 source 1..2044869 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 452..973 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00010 CDS 954..6023 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00020 CDS complement(6219..8762) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00030 CDS 8961..9233 product DNA-binding protein HU-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087931.1 transl_table 11 codon_start 1 locus_tag LOCUS_00040 gene hupB CDS complement(9246..12029) product IncHI-type conjugal transfer protein TrhN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000682729.1 transl_table 11 codon_start 1 locus_tag LOCUS_00050 gene trhN CDS complement(12029..13069) product IncHI-type conjugal transfer protein TrhU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011011070.1 transl_table 11 codon_start 1 locus_tag LOCUS_00060 gene trhU CDS complement(13066..14277) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00070 CDS complement(14264..14830) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00080 CDS complement(14808..15125) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00090 CDS complement(15115..17529) product TraC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331477.1 transl_table 11 codon_start 1 locus_tag LOCUS_00100 CDS complement(17526..17783) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00110 CDS complement(17795..18019) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00120 CDS complement(18226..18738) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00130 CDS complement(18735..19559) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00140 CDS complement(19586..20965) product IncHI-type conjugal transfer protein TrhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000351840.1 transl_table 11 codon_start 1 locus_tag LOCUS_00150 gene trhB CDS complement(20965..21942) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00160 CDS complement(21939..22550) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00170 CDS complement(22547..22828) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00180 CDS complement(23039..24067) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00190 CDS complement(24377..24610) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00200 CDS complement(24780..26081) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00210 CDS complement(26429..26737) product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928906.1 transl_table 11 codon_start 1 locus_tag LOCUS_00220 CDS complement(26802..27335) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00230 CDS complement(27370..27603) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00240 CDS complement(27645..27872) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00250 CDS complement(27869..28138) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00260 CDS complement(28285..29166) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00270 CDS complement(29191..29424) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00280 CDS 29644..30246 product 5'-deoxynucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210283.1 transl_table 11 codon_start 1 locus_tag LOCUS_00290 gene yfbR CDS 30263..32461 product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933069.1 transl_table 11 codon_start 1 locus_tag LOCUS_00300 CDS complement(32642..33091) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00310 CDS complement(33141..34136) product RelA/SpoT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038251091.1 transl_table 11 codon_start 1 locus_tag LOCUS_00320 CDS complement(34136..35236) product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691008.1 transl_table 11 codon_start 1 locus_tag LOCUS_00330 CDS complement(35661..35969) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00340 CDS complement(36078..36743) product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142493.1 transl_table 11 codon_start 1 locus_tag LOCUS_00350 CDS complement(36765..37001) product TIGR02450 family Trp-rich protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406940.1 transl_table 11 codon_start 1 locus_tag LOCUS_00360 CDS complement(36994..38400) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00370 CDS complement(38410..39036) product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087594.1 transl_table 11 codon_start 1 locus_tag LOCUS_00380 gene lexA CDS 39142..39627 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00390 CDS 39630..40919 product Y-family DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020162165.1 transl_table 11 codon_start 1 locus_tag LOCUS_00400 CDS complement(40929..42068) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00410 CDS complement(42197..42829) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00420 CDS complement(42826..44658) product conjugative transfer system coupling protein TraD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205050578.1 transl_table 11 codon_start 1 locus_tag LOCUS_00430 gene traD CDS complement(44655..47060) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00440 CDS 47190..47636 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00450 CDS 47638..48510 product plasmid replication initiator TrfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815848.1 transl_table 11 codon_start 1 locus_tag LOCUS_00460 gene trfA CDS complement(48858..49328) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00470 CDS complement(49580..49738) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00480 CDS 49832..50848 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00490 CDS 50845..52296 product conjugal transfer protein TraH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_175404606.1 transl_table 11 codon_start 1 locus_tag LOCUS_00500 CDS 52361..55558 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00510 CDS complement(55562..55837) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00520 CDS complement(56511..59576) product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142029.1 transl_table 11 codon_start 1 locus_tag LOCUS_00530 CDS complement(59573..60553) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00540 CDS complement(60654..61976) product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941495.1 transl_table 11 codon_start 1 locus_tag LOCUS_00550 CDS complement(61973..63298) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194633.1 transl_table 11 codon_start 1 locus_tag LOCUS_00560 CDS complement(63295..63960) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194706.1 transl_table 11 codon_start 1 locus_tag LOCUS_00570 CDS complement(64402..64959) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00580 CDS complement(64956..65270) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00590 CDS complement(65272..65904) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00600 CDS 66215..66499 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00610 CDS 67137..67739 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00620 CDS 67729..68214 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00630 CDS 68325..68537 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00640 CDS 68543..69655 product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038129.1 transl_table 11 codon_start 1 locus_tag LOCUS_00650 tRNA complement(69728..69803) product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00010 tRNA complement(69825..69901) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00020 tRNA complement(69908..69984) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00030 CDS complement(70177..72411) product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095687.1 transl_table 11 codon_start 1 locus_tag LOCUS_00660 gene parC CDS 72644..73393 product fumarate/nitrate reduction transcriptional regulator Fnr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005662331.1 transl_table 11 codon_start 1 locus_tag LOCUS_00670 gene fnr CDS complement(74897..75691) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00680 CDS complement(76144..77394) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00690 CDS complement(77479..79095) product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110915.1 transl_table 11 codon_start 1 locus_tag LOCUS_00700 CDS 79502..81595 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00710 CDS 81636..82940 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00720 CDS 82954..84309 product peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729271.1 transl_table 11 codon_start 1 locus_tag LOCUS_00730 CDS 84551..85225 product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704181.1 transl_table 11 codon_start 1 locus_tag LOCUS_00740 gene radC CDS complement(85239..85973) product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072060.1 transl_table 11 codon_start 1 locus_tag LOCUS_00750 CDS complement(86023..88344) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00760 CDS complement(88687..89817) product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688278.1 transl_table 11 codon_start 1 locus_tag LOCUS_00770 gene dapE CDS complement(89814..90155) product ArsC family reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397337.1 transl_table 11 codon_start 1 locus_tag LOCUS_00780 CDS complement(90162..90407) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00790 CDS complement(90767..91144) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00800 CDS 91491..92207 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00810 CDS complement(92264..92854) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00820 CDS complement(92989..93807) product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368172.1 transl_table 11 codon_start 1 locus_tag LOCUS_00830 gene dapD CDS complement(93907..95109) product succinyldiaminopimelate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092403.1 transl_table 11 codon_start 1 locus_tag LOCUS_00840 gene dapC CDS complement(95109..95894) product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000753571.1 transl_table 11 codon_start 1 locus_tag LOCUS_00850 CDS complement(96072..96563) product nicotinamide-nucleotide amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132240.1 transl_table 11 codon_start 1 locus_tag LOCUS_00860 gene pncC CDS complement(96648..97226) product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947206.1 transl_table 11 codon_start 1 locus_tag LOCUS_00870 CDS complement(97339..98430) product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000568258.1 transl_table 11 codon_start 1 locus_tag LOCUS_00880 gene cydB CDS complement(98420..99826) product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000568053.1 transl_table 11 codon_start 1 locus_tag LOCUS_00890 gene cydA CDS 99992..102133 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00900 CDS complement(102152..103426) product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121316.1 transl_table 11 codon_start 1 locus_tag LOCUS_00910 gene phoR CDS complement(103433..104131) product phosphate regulon transcriptional regulator PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003383141.1 transl_table 11 codon_start 1 locus_tag LOCUS_00920 gene phoB CDS complement(104218..106128) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00930 CDS complement(106689..107255) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00940 CDS complement(107267..107686) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00950 CDS complement(108154..109467) product selenium-binding protein SBP56-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728146.1 transl_table 11 codon_start 1 locus_tag LOCUS_00960 CDS complement(109603..109875) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00970 CDS complement(110023..110673) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965325.1 transl_table 11 codon_start 1 locus_tag LOCUS_00980 CDS complement(110756..111361) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921379.1 transl_table 11 codon_start 1 locus_tag LOCUS_00990 CDS 111685..112218 product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037700.1 transl_table 11 codon_start 1 locus_tag LOCUS_01000 gene dcd CDS 112219..115476 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01010 CDS 115485..116468 product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141169.1 transl_table 11 codon_start 1 locus_tag LOCUS_01020 gene glk CDS 116584..119007 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01030 CDS complement(119149..119526) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01040 CDS complement(119709..120704) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01050 CDS 120942..121106 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01060 CDS 121183..121737 product flavodoxin FldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501067.1 transl_table 11 codon_start 1 locus_tag LOCUS_01070 gene fldA CDS 121738..122520 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01080 CDS 122507..123187 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01090 CDS 123193..123639 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01100 CDS 123910..124461 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01110 CDS 124811..125890 product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199913.1 transl_table 11 codon_start 1 locus_tag LOCUS_01120 gene hisC CDS 126039..126638 product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215005.1 transl_table 11 codon_start 1 locus_tag LOCUS_01130 gene petA CDS 126647..128032 product cytochrome bc complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094159.1 transl_table 11 codon_start 1 locus_tag LOCUS_01140 CDS 128036..128758 product cytochrome c1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707595.1 transl_table 11 codon_start 1 locus_tag LOCUS_01150 CDS 128943..129503 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01160 CDS 129686..129946 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01170 CDS 130344..130973 product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971587.1 transl_table 11 codon_start 1 locus_tag LOCUS_01180 gene lexA CDS 130983..131132 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01190 CDS 131181..131504 product YqfO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092679.1 transl_table 11 codon_start 1 locus_tag LOCUS_01200 CDS complement(131737..132894) product type IVa pilus ATPase TapW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706550.1 transl_table 11 codon_start 1 locus_tag LOCUS_01210 gene tapW CDS complement(132884..133168) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01220 CDS 133451..135667 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01230 CDS 135664..136296 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768051.1 transl_table 11 codon_start 1 locus_tag LOCUS_01240 CDS complement(136621..136758) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01250 CDS 136902..139406 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01260 CDS 139525..141279 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01270 CDS 141464..142507 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941103.1 transl_table 11 codon_start 1 locus_tag LOCUS_01280 CDS 142504..142728 product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002035794.1 transl_table 11 codon_start 1 locus_tag LOCUS_01290 CDS 144448..145662 product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110156.1 transl_table 11 codon_start 1 locus_tag LOCUS_01300 gene argJ CDS 145676..146620 product Nudix family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268840.1 transl_table 11 codon_start 1 locus_tag LOCUS_01310 CDS complement(146637..146840) product DNA gyrase inhibitor YacG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003381207.1 transl_table 11 codon_start 1 locus_tag LOCUS_01320 gene yacG CDS complement(146840..147613) product cell division protein ZapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195118.1 transl_table 11 codon_start 1 locus_tag LOCUS_01330 gene zapD CDS complement(147610..148221) product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209319.1 transl_table 11 codon_start 1 locus_tag LOCUS_01340 gene coaE CDS complement(148225..149091) product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770019.1 transl_table 11 codon_start 1 locus_tag LOCUS_01350 CDS complement(149166..150383) product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947252.1 transl_table 11 codon_start 1 locus_tag LOCUS_01360 CDS complement(150386..152101) product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266636.1 transl_table 11 codon_start 1 locus_tag LOCUS_01370 gene pilB CDS complement(152303..154171) product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095696.1 transl_table 11 codon_start 1 locus_tag LOCUS_01380 gene thiC CDS 154510..154914 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01390 CDS complement(154919..155923) product octaprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925908.1 transl_table 11 codon_start 1 locus_tag LOCUS_01400 gene ispB CDS 156130..156441 product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551971.1 transl_table 11 codon_start 1 locus_tag LOCUS_01410 gene rplU CDS 156459..156716 product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940593.1 transl_table 11 codon_start 1 locus_tag LOCUS_01420 gene rpmA CDS 156798..157856 product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948349.1 transl_table 11 codon_start 1 locus_tag LOCUS_01430 gene obgE CDS 157843..158964 product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094756.1 transl_table 11 codon_start 1 locus_tag LOCUS_01440 gene proB CDS complement(159008..160099) product iron-sulfur cluster carrier protein ApbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193796.1 transl_table 11 codon_start 1 locus_tag LOCUS_01450 gene apbC CDS 160458..161696 product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940858.1 transl_table 11 codon_start 1 locus_tag LOCUS_01460 CDS complement(161710..163977) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01470 CDS complement(163974..164312) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01480 CDS complement(164892..165140) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01490 CDS complement(165433..165834) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01500 CDS 166093..168162 product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211829411.1 transl_table 11 codon_start 1 locus_tag LOCUS_01510 gene metG CDS 168301..168873 product electron transport complex subunit RsxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813855.1 transl_table 11 codon_start 1 locus_tag LOCUS_01520 gene rsxB tRNA 169027..169103 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00040 CDS complement(169461..169694) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01530 CDS complement(170067..170342) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01540 CDS complement(170626..170859) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01550 CDS complement(171442..171627) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01560 CDS complement(171780..172904) product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093119.1 transl_table 11 codon_start 1 locus_tag LOCUS_01570 tRNA complement(173167..173242) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00050 CDS complement(173253..173639) product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095888.1 transl_table 11 codon_start 1 locus_tag LOCUS_01580 gene hisI CDS complement(173636..174409) product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106334.1 transl_table 11 codon_start 1 locus_tag LOCUS_01590 gene hisF CDS complement(174435..175181) product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106336.1 transl_table 11 codon_start 1 locus_tag LOCUS_01600 gene hisA CDS complement(175250..175861) product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121251.1 transl_table 11 codon_start 1 locus_tag LOCUS_01610 gene hisH CDS complement(175939..176532) product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096088.1 transl_table 11 codon_start 1 locus_tag LOCUS_01620 gene hisB CDS complement(176582..179227) product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113940.1 transl_table 11 codon_start 1 locus_tag LOCUS_01630 gene pepN CDS complement(179228..179776) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01640 CDS complement(179777..180148) product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405261.1 transl_table 11 codon_start 1 locus_tag LOCUS_01650 CDS complement(180148..180669) product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965931.1 transl_table 11 codon_start 1 locus_tag LOCUS_01660 gene moaB CDS 180791..181903 product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765838.1 transl_table 11 codon_start 1 locus_tag LOCUS_01670 CDS 182406..182771 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01680 CDS complement(182846..183313) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01690 CDS complement(183478..183981) product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072759.1 transl_table 11 codon_start 1 locus_tag LOCUS_01700 CDS complement(184007..184282) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01710 CDS complement(184725..185516) product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453865.1 transl_table 11 codon_start 1 locus_tag LOCUS_01720 CDS complement(185516..185911) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01730 note possible pseudo, internal stop codon CDS complement(185939..186199) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01740 CDS complement(186293..186574) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01750 CDS complement(186595..187077) product lpg2434 family Dot/Icm T4SS effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948137.1 transl_table 11 codon_start 1 locus_tag LOCUS_01760 CDS complement(187142..187990) product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099300.1 transl_table 11 codon_start 1 locus_tag LOCUS_01770 gene murI CDS complement(188019..188645) product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314066.1 transl_table 11 codon_start 1 locus_tag LOCUS_01780 CDS complement(188781..192743) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01790 CDS complement(192942..193991) product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410204.1 transl_table 11 codon_start 1 locus_tag LOCUS_01800 CDS complement(194076..194321) product YfhL family 4Fe-4S dicluster ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084462.1 transl_table 11 codon_start 1 locus_tag LOCUS_01810 CDS complement(194324..194809) product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084466.1 transl_table 11 codon_start 1 locus_tag LOCUS_01820 gene coaD CDS complement(194836..195420) product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001189766.1 transl_table 11 codon_start 1 locus_tag LOCUS_01830 gene rsmD CDS complement(195422..196720) product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958524.1 transl_table 11 codon_start 1 locus_tag LOCUS_01840 CDS complement(196710..198080) product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948371.1 transl_table 11 codon_start 1 locus_tag LOCUS_01850 CDS 198188..199078 product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074210.1 transl_table 11 codon_start 1 locus_tag LOCUS_01860 gene cyoE CDS 199075..200073 product glycosyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207217.1 transl_table 11 codon_start 1 locus_tag LOCUS_01870 CDS complement(200099..200731) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01880 CDS 200855..201388 product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042064868.1 transl_table 11 codon_start 1 locus_tag LOCUS_01890 CDS 201425..201910 product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071597.1 transl_table 11 codon_start 1 locus_tag LOCUS_01900 CDS 202432..202704 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01910 CDS 202907..203542 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01920 CDS complement(203978..204553) product chemoreceptor glutamine deamidase CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072188.1 transl_table 11 codon_start 1 locus_tag LOCUS_01930 gene cheD CDS 205012..207168 product bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113961.1 transl_table 11 codon_start 1 locus_tag LOCUS_01940 gene rlmKL CDS 207165..207437 product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259430.1 transl_table 11 codon_start 1 locus_tag LOCUS_01950 CDS complement(207467..207712) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01960 CDS 207933..208859 product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114031.1 transl_table 11 codon_start 1 locus_tag LOCUS_01970 gene hemC CDS 208856..209638 product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073973.1 transl_table 11 codon_start 1 locus_tag LOCUS_01980 CDS 209622..210788 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01990 CDS 210813..212036 product heme biosynthesis protein HemY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772915.1 transl_table 11 codon_start 1 locus_tag LOCUS_02000 CDS complement(212057..213139) product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071150.1 transl_table 11 codon_start 1 locus_tag LOCUS_02010 CDS complement(213347..214483) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02020 CDS complement(214524..215987) product 4-hydroxy-3-polyprenylbenzoate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096332.1 transl_table 11 codon_start 1 locus_tag LOCUS_02030 gene ubiD CDS 216292..216996 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02040 CDS complement(217200..219680) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122524.1 transl_table 11 codon_start 1 locus_tag LOCUS_02050 CDS complement(219677..220369) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406778.1 transl_table 11 codon_start 1 locus_tag LOCUS_02060 CDS 220368..220967 product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010440639.1 transl_table 11 codon_start 1 locus_tag LOCUS_02070 CDS complement(220978..221928) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02080 CDS complement(221968..223050) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02090 CDS complement(223256..223735) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02100 CDS 224173..225591 product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096848.1 transl_table 11 codon_start 1 locus_tag LOCUS_02110 CDS 225607..227430 product sodium-extruding oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105555.1 transl_table 11 codon_start 1 locus_tag LOCUS_02120 gene oadA CDS 227582..228550 product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188980.1 transl_table 11 codon_start 1 locus_tag LOCUS_02130 CDS 228552..229016 product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370298.1 transl_table 11 codon_start 1 locus_tag LOCUS_02140 gene tadA CDS complement(229223..229489) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02150 CDS 229736..230869 product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921980.1 transl_table 11 codon_start 1 locus_tag LOCUS_02160 CDS 230918..231190 product TIGR02450 family Trp-rich protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768830.1 transl_table 11 codon_start 1 locus_tag LOCUS_02170 CDS 231194..232714 product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256609.1 transl_table 11 codon_start 1 locus_tag LOCUS_02180 CDS 232785..234389 product cryptochrome/photolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036476.1 transl_table 11 codon_start 1 locus_tag LOCUS_02190 CDS 234482..235057 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02200 CDS complement(235428..235835) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02210 CDS complement(236202..237254) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531377.1 transl_table 11 codon_start 1 locus_tag LOCUS_02220 CDS complement(237388..237792) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02230 CDS complement(237882..239699) product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098692.1 transl_table 11 codon_start 1 locus_tag LOCUS_02240 CDS complement(239699..240358) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098693.1 transl_table 11 codon_start 1 locus_tag LOCUS_02250 CDS 240804..241217 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02260 CDS 241580..242026 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02270 CDS complement(242060..242695) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02280 CDS complement(242682..244499) product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098692.1 transl_table 11 codon_start 1 locus_tag LOCUS_02290 CDS complement(244664..245056) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02300 CDS 245409..246137 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02310 CDS 246209..246943 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02320 CDS 247051..247869 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_221065779.1 transl_table 11 codon_start 1 locus_tag LOCUS_02330 CDS complement(248366..248824) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02340 CDS 248898..249176 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02350 CDS 249296..250642 product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_114714636.1 transl_table 11 codon_start 1 locus_tag LOCUS_02360 CDS complement(250682..250852) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02370 CDS 250793..251170 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02380 CDS complement(251438..251872) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02390 CDS complement(251872..252051) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02400 CDS complement(252359..252766) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02410 CDS complement(252899..253390) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02420 CDS complement(253433..253741) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02430 CDS complement(253808..254638) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02440 note possible pseudo, frameshifted CDS complement(254635..254970) product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082849.1 transl_table 11 codon_start 1 locus_tag LOCUS_02450 CDS complement(255292..255675) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02460 CDS complement(255678..256364) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02470 CDS 256299..256571 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02480 CDS complement(256652..257467) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269357.1 transl_table 11 codon_start 1 locus_tag LOCUS_02490 CDS complement(257472..261614) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02500 CDS 261763..262056 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02510 CDS complement(262060..264012) product type VI secretion system spike protein VgrG1b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147059.1 transl_table 11 codon_start 1 locus_tag LOCUS_02520 gene vgrG1b CDS complement(264059..264352) product PAAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226572031.1 transl_table 11 codon_start 1 locus_tag LOCUS_02530 CDS complement(264363..264956) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02540 CDS complement(265030..265335) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02550 CDS complement(265332..265799) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02560 CDS complement(266000..266701) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02570 CDS complement(266830..267297) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02580 CDS complement(267556..268224) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02590 CDS complement(268862..271561) product type VI secretion system ATPase TssH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115056.1 transl_table 11 codon_start 1 locus_tag LOCUS_02600 gene tssH CDS complement(271595..272650) product type VI secretion system baseplate subunit TssG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104969.1 transl_table 11 codon_start 1 locus_tag LOCUS_02610 gene tssG CDS complement(272632..274518) product type VI secretion system baseplate subunit TssF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115055.1 transl_table 11 codon_start 1 locus_tag LOCUS_02620 gene tssF CDS complement(274521..275024) product type VI secretion system baseplate subunit TssE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104971.1 transl_table 11 codon_start 1 locus_tag LOCUS_02630 gene tssE CDS complement(275024..275830) product type VI secretion system accessory protein TagJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119488.1 transl_table 11 codon_start 1 locus_tag LOCUS_02640 gene tagJ CDS complement(275891..276373) product type VI secretion system tube protein Hcp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328777.1 transl_table 11 codon_start 1 locus_tag LOCUS_02650 CDS complement(276539..278026) product type VI secretion system contractile sheath large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111626.1 transl_table 11 codon_start 1 locus_tag LOCUS_02660 gene tssC CDS complement(278030..278560) product type VI secretion system contractile sheath small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083666.1 transl_table 11 codon_start 1 locus_tag LOCUS_02670 gene tssB CDS complement(278606..279637) product type VI secretion system protein TssA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115054.1 transl_table 11 codon_start 1 locus_tag LOCUS_02680 gene tssA CDS complement(280346..281884) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02690 CDS complement(281890..285402) product type VI secretion system membrane subunit TssM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895493.1 transl_table 11 codon_start 1 locus_tag LOCUS_02700 gene tssM CDS complement(285448..286758) product DotU family type VI secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115051.1 transl_table 11 codon_start 1 locus_tag LOCUS_02710 CDS complement(286763..288103) product type VI secretion system baseplate subunit TssK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115052.1 transl_table 11 codon_start 1 locus_tag LOCUS_02720 gene tssK CDS complement(288183..289550) product type VI secretion system-associated FHA domain protein TagH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147054.1 transl_table 11 codon_start 1 locus_tag LOCUS_02730 gene tagH CDS complement(290253..290657) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02740 CDS complement(290774..292018) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02750 CDS complement(292102..292851) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02760 CDS complement(292968..293720) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02770 CDS complement(295192..295512) product Grx4 family monothiol glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771068.1 transl_table 11 codon_start 1 locus_tag LOCUS_02780 gene grxD rRNA complement(295649..295758) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00010 rRNA complement(295961..298853) product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00020 tRNA complement(299178..299253) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00060 tRNA complement(299370..299446) product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00070 rRNA complement(299508..301036) product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00030 CDS complement(301420..302175) product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114345.1 transl_table 11 codon_start 1 locus_tag LOCUS_02790 gene xerC CDS complement(302319..303008) product DUF484 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266243.1 transl_table 11 codon_start 1 locus_tag LOCUS_02800 CDS complement(303005..303835) product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073967.1 transl_table 11 codon_start 1 locus_tag LOCUS_02810 gene dapF CDS complement(303838..305088) product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000384387.1 transl_table 11 codon_start 1 locus_tag LOCUS_02820 gene lysA CDS complement(305359..307602) product type 4a pilus secretin PilQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114575.1 transl_table 11 codon_start 1 locus_tag LOCUS_02830 gene pilQ CDS complement(307605..308162) product type 4a pilus biogenesis lipoprotein PilP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095836.1 transl_table 11 codon_start 1 locus_tag LOCUS_02840 gene pilP CDS complement(308159..308785) product type 4a pilus biogenesis protein PilO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014841277.1 transl_table 11 codon_start 1 locus_tag LOCUS_02850 CDS complement(308782..309354) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02860 CDS complement(309354..310415) product pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403040.1 transl_table 11 codon_start 1 locus_tag LOCUS_02870 CDS 310628..312988 product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946660.1 transl_table 11 codon_start 1 locus_tag LOCUS_02880 CDS complement(313061..313327) product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768737.1 transl_table 11 codon_start 1 locus_tag LOCUS_02890 gene rpmE CDS complement(313364..314434) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705057.1 transl_table 11 codon_start 1 locus_tag LOCUS_02900 CDS complement(314757..316118) product sodium:proton antiporter NhaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071215.1 transl_table 11 codon_start 1 locus_tag LOCUS_02910 gene nhaD CDS 316277..317929 product nitrite/sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098180.1 transl_table 11 codon_start 1 locus_tag LOCUS_02920 CDS 317916..318371 product DUF934 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088003.1 transl_table 11 codon_start 1 locus_tag LOCUS_02930 CDS complement(318482..319846) product proteolytic complex protein CptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096067.1 transl_table 11 codon_start 1 locus_tag LOCUS_02940 gene cptA CDS complement(319884..321116) product murein hydrolase activator EnvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123645.1 transl_table 11 codon_start 1 locus_tag LOCUS_02950 CDS 321486..321797 product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000137417.1 transl_table 11 codon_start 1 locus_tag LOCUS_02960 CDS 321833..322267 product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958278.1 transl_table 11 codon_start 1 locus_tag LOCUS_02970 CDS 322301..322774 product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704300.1 transl_table 11 codon_start 1 locus_tag LOCUS_02980 gene secB CDS 322780..323781 product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704301.1 transl_table 11 codon_start 1 locus_tag LOCUS_02990 gene gpsA CDS 324153..324641 product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295770.1 transl_table 11 codon_start 1 locus_tag LOCUS_03000 gene mraZ CDS 324647..325576 product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095568.1 transl_table 11 codon_start 1 locus_tag LOCUS_03010 gene rsmH CDS 325576..325848 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03020 CDS 325849..327576 product peptidoglycan D,D-transpeptidase FtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094139.1 transl_table 11 codon_start 1 locus_tag LOCUS_03030 gene ftsI CDS 327573..329033 product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112751.1 transl_table 11 codon_start 1 locus_tag LOCUS_03040 CDS 329030..330394 product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957393.1 transl_table 11 codon_start 1 locus_tag LOCUS_03050 CDS 330394..331476 product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094129.1 transl_table 11 codon_start 1 locus_tag LOCUS_03060 gene mraY CDS 331479..332849 product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103104.1 transl_table 11 codon_start 1 locus_tag LOCUS_03070 gene murD CDS 332843..334009 product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406017.1 transl_table 11 codon_start 1 locus_tag LOCUS_03080 gene ftsW CDS 334006..335070 product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766568.1 transl_table 11 codon_start 1 locus_tag LOCUS_03090 gene murG CDS 335067..336494 product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094121.1 transl_table 11 codon_start 1 locus_tag LOCUS_03100 gene murC CDS 336494..337372 product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016357031.1 transl_table 11 codon_start 1 locus_tag LOCUS_03110 gene murB CDS 337369..338319 product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105003.1 transl_table 11 codon_start 1 locus_tag LOCUS_03120 CDS 338330..339049 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03130 CDS 339070..340296 product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377649.1 transl_table 11 codon_start 1 locus_tag LOCUS_03140 gene ftsA CDS 340320..341480 product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011997353.1 transl_table 11 codon_start 1 locus_tag LOCUS_03150 gene ftsZ CDS 341591..342517 product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094111.1 transl_table 11 codon_start 1 locus_tag LOCUS_03160 gene lpxC CDS complement(342590..343054) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03170 CDS complement(343051..344694) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03180 CDS complement(344720..345085) product SMR family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393953.1 transl_table 11 codon_start 1 locus_tag LOCUS_03190 CDS complement(345089..346612) product UbiA family prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931866.1 transl_table 11 codon_start 1 locus_tag LOCUS_03200 CDS 346812..347567 product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966736.1 transl_table 11 codon_start 1 locus_tag LOCUS_03210 CDS 347581..348975 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144080476.1 transl_table 11 codon_start 1 locus_tag LOCUS_03220 CDS complement(349528..350328) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03230 CDS complement(351010..352329) product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932849.1 transl_table 11 codon_start 1 locus_tag LOCUS_03240 CDS complement(352346..353212) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259184.1 transl_table 11 codon_start 1 locus_tag LOCUS_03250 CDS complement(353284..353892) product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021108.1 transl_table 11 codon_start 1 locus_tag LOCUS_03260 CDS complement(353957..355783) product arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095365.1 transl_table 11 codon_start 1 locus_tag LOCUS_03270 gene speA CDS 355867..356712 product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038944.1 transl_table 11 codon_start 1 locus_tag LOCUS_03280 gene speE CDS 356971..357885 product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099262600.1 transl_table 11 codon_start 1 locus_tag LOCUS_03290 CDS 358049..358486 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03300 CDS 358522..359217 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03310 CDS complement(359302..359478) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03320 CDS complement(359548..359823) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03330 CDS complement(359959..361158) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03340 CDS complement(361160..362365) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057223.1 transl_table 11 codon_start 1 locus_tag LOCUS_03350 CDS complement(362424..362561) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03360 CDS complement(362843..364006) product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730128.1 transl_table 11 codon_start 1 locus_tag LOCUS_03370 CDS complement(364123..366114) product TonB-dependent receptor plug domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937411.1 transl_table 11 codon_start 1 locus_tag LOCUS_03380 CDS 366413..367378 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814187.1 transl_table 11 codon_start 1 locus_tag LOCUS_03390 CDS 367529..368443 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181015.1 transl_table 11 codon_start 1 locus_tag LOCUS_03400 CDS complement(368544..369443) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03410 CDS complement(369480..369905) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03420 CDS complement(370022..370693) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000609100.1 transl_table 11 codon_start 1 locus_tag LOCUS_03430 CDS complement(370690..371826) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964215.1 transl_table 11 codon_start 1 locus_tag LOCUS_03440 CDS complement(372067..372522) product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948332.1 transl_table 11 codon_start 1 locus_tag LOCUS_03450 CDS complement(372599..374083) product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461107.1 transl_table 11 codon_start 1 locus_tag LOCUS_03460 gene pepA CDS 374082..375308 product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065108.1 transl_table 11 codon_start 1 locus_tag LOCUS_03470 gene lptF CDS 375305..376375 product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461103.1 transl_table 11 codon_start 1 locus_tag LOCUS_03480 gene lptG CDS complement(376442..376828) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03490 CDS complement(376888..377352) product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100603.1 transl_table 11 codon_start 1 locus_tag LOCUS_03500 CDS complement(377353..377532) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03510 CDS 377860..379170 product polynucleotide adenylyltransferase PcnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086024044.1 transl_table 11 codon_start 1 locus_tag LOCUS_03520 CDS 379157..379660 product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095144.1 transl_table 11 codon_start 1 locus_tag LOCUS_03530 gene folK CDS 379657..380466 product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194137.1 transl_table 11 codon_start 1 locus_tag LOCUS_03540 gene panB CDS 380471..381322 product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266657.1 transl_table 11 codon_start 1 locus_tag LOCUS_03550 gene panC CDS 381420..381800 product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036943.1 transl_table 11 codon_start 1 locus_tag LOCUS_03560 CDS complement(381844..382302) product flagellar assembly protein FliW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987029.1 transl_table 11 codon_start 1 locus_tag LOCUS_03570 gene fliW CDS 382775..384598 product TonB-dependent vitamin B12 receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112350.1 transl_table 11 codon_start 1 locus_tag LOCUS_03580 gene btuB CDS 384617..385192 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038181.1 transl_table 11 codon_start 1 locus_tag LOCUS_03590 CDS 385309..386226 product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268581.1 transl_table 11 codon_start 1 locus_tag LOCUS_03600 gene cbiB CDS 386213..387265 product threonine-phosphate decarboxylase CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112352.1 transl_table 11 codon_start 1 locus_tag LOCUS_03610 gene cobD CDS complement(387212..387934) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03620 CDS complement(388151..388945) product RMD1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873837.1 transl_table 11 codon_start 1 locus_tag LOCUS_03630 CDS 389040..390131 product 3-deoxy-7-phosphoheptulonate synthase AroG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001109233.1 transl_table 11 codon_start 1 locus_tag LOCUS_03640 gene aroG CDS 390135..391112 product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038257.1 transl_table 11 codon_start 1 locus_tag LOCUS_03650 CDS 391416..391607 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03660 CDS 391617..391937 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03670 CDS 392177..392413 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03680 CDS 392410..392616 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03690 CDS 392684..393160 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03700 CDS 393297..393986 product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173629.1 transl_table 11 codon_start 1 locus_tag LOCUS_03710 gene trmB CDS complement(393991..394545) product DUF2058 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086049.1 transl_table 11 codon_start 1 locus_tag LOCUS_03720 CDS complement(394600..395820) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03730 CDS complement(395824..396669) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03740 CDS 396795..397706 product 23S rRNA pseudouridine(1911/1915/1917) synthase RluD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094686.1 transl_table 11 codon_start 1 locus_tag LOCUS_03750 gene rluD CDS 397687..398412 product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707735.1 transl_table 11 codon_start 1 locus_tag LOCUS_03760 gene pgeF CDS 398414..399289 product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930274.1 transl_table 11 codon_start 1 locus_tag LOCUS_03770 CDS complement(399363..399827) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03780 CDS 400656..402548 product transketolase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929297.1 transl_table 11 codon_start 1 locus_tag LOCUS_03790 CDS 402843..403316 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03800 CDS 403419..404684 product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706313.1 transl_table 11 codon_start 1 locus_tag LOCUS_03810 gene glgC CDS complement(404738..405325) product phosphoheptose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005620308.1 transl_table 11 codon_start 1 locus_tag LOCUS_03820 CDS complement(405331..405699) product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948678.1 transl_table 11 codon_start 1 locus_tag LOCUS_03830 CDS complement(405701..407455) product penicillin-binding protein activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948679.1 transl_table 11 codon_start 1 locus_tag LOCUS_03840 CDS 407543..408394 product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016568902.1 transl_table 11 codon_start 1 locus_tag LOCUS_03850 gene rsmI CDS complement(408413..408598) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03860 CDS 408931..409956 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03870 CDS 410273..413692 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03880 note possible pseudo, frameshifted CDS 413653..414399 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03890 note possible pseudo, frameshifted CDS complement(414467..414730) product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119787.1 transl_table 11 codon_start 1 locus_tag LOCUS_03900 CDS complement(414742..418413) product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000096036.1 transl_table 11 codon_start 1 locus_tag LOCUS_03910 gene metH CDS 418489..418680 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03920 CDS complement(418735..419154) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03930 CDS 419368..419496 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03940 CDS 419631..421538 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03950 CDS 421640..421777 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03960 CDS complement(422166..422930) product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100265.1 transl_table 11 codon_start 1 locus_tag LOCUS_03970 CDS complement(422896..423438) product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769732.1 transl_table 11 codon_start 1 locus_tag LOCUS_03980 gene gmhB CDS complement(423435..425504) product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114646.1 transl_table 11 codon_start 1 locus_tag LOCUS_03990 gene glyS CDS complement(425507..426433) product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070431.1 transl_table 11 codon_start 1 locus_tag LOCUS_04000 gene glyQ CDS 426720..428885 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04010 CDS complement(428888..429064) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04020 CDS 429108..429704 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04030 CDS 429941..431479 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04040 CDS 431449..433137 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04050 CDS 434276..438970 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04060 CDS 439019..439756 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04070 CDS 440105..440641 product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112472.1 transl_table 11 codon_start 1 locus_tag LOCUS_04080 CDS 440835..442085 product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143713.1 transl_table 11 codon_start 1 locus_tag LOCUS_04090 CDS 442371..443597 product PepSY-associated TM helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087276.1 transl_table 11 codon_start 1 locus_tag LOCUS_04100 CDS complement(443600..443911) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04110 CDS complement(443880..444188) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04120 note possible pseudo, frameshifted CDS 444353..447097 product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940283.1 transl_table 11 codon_start 1 locus_tag LOCUS_04130 gene polA CDS 447120..448016 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920959.1 transl_table 11 codon_start 1 locus_tag LOCUS_04140 CDS 448496..449032 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268600.1 transl_table 11 codon_start 1 locus_tag LOCUS_04150 CDS complement(449189..449722) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04160 CDS complement(449794..450315) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04170 CDS complement(450341..451642) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112837.1 transl_table 11 codon_start 1 locus_tag LOCUS_04180 CDS 451915..452415 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04190 CDS complement(452488..453174) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04200 CDS complement(453661..454605) product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389193.1 transl_table 11 codon_start 1 locus_tag LOCUS_04210 CDS complement(454750..455256) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815594.1 transl_table 11 codon_start 1 locus_tag LOCUS_04220 CDS complement(456614..458200) product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266918.1 transl_table 11 codon_start 1 locus_tag LOCUS_04230 gene guaA CDS complement(458272..459231) product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201850.1 transl_table 11 codon_start 1 locus_tag LOCUS_04240 CDS complement(459316..460788) product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380633.1 transl_table 11 codon_start 1 locus_tag LOCUS_04250 gene guaB CDS complement(460859..461344) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04260 CDS complement(461354..461944) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04270 CDS 462032..462304 product YcgL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096146.1 transl_table 11 codon_start 1 locus_tag LOCUS_04280 CDS 462414..463433 product DUF2333 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106226.1 transl_table 11 codon_start 1 locus_tag LOCUS_04290 CDS 463441..463743 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04300 CDS 463750..464841 product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974700.1 transl_table 11 codon_start 1 locus_tag LOCUS_04310 gene dinB CDS 464941..466332 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04320 CDS 466332..467756 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04330 CDS complement(467999..468670) product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397315.1 transl_table 11 codon_start 1 locus_tag LOCUS_04340 CDS complement(468849..469601) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269309.1 transl_table 11 codon_start 1 locus_tag LOCUS_04350 CDS 469729..470637 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087264598.1 transl_table 11 codon_start 1 locus_tag LOCUS_04360 CDS 471191..471685 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04370 CDS complement(471682..472353) product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000185713.1 transl_table 11 codon_start 1 locus_tag LOCUS_04380 CDS complement(472355..473107) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04390 CDS complement(473282..475489) product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095847.1 transl_table 11 codon_start 1 locus_tag LOCUS_04400 CDS complement(475890..476387) product disulfide bond formation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207954.1 transl_table 11 codon_start 1 locus_tag LOCUS_04410 CDS complement(476458..477411) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335731.1 transl_table 11 codon_start 1 locus_tag LOCUS_04420 CDS 477731..478951 product potassium/proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941860.1 transl_table 11 codon_start 1 locus_tag LOCUS_04430 CDS complement(478980..479684) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04440 CDS complement(479681..481285) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04450 CDS complement(481292..482005) product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933740.1 transl_table 11 codon_start 1 locus_tag LOCUS_04460 CDS complement(481993..482985) product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001257894.1 transl_table 11 codon_start 1 locus_tag LOCUS_04470 CDS 483377..483733 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04480 CDS complement(483795..484694) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04490 CDS complement(484795..485385) product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929870.1 transl_table 11 codon_start 1 locus_tag LOCUS_04500 CDS 485542..486486 product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477935.1 transl_table 11 codon_start 1 locus_tag LOCUS_04510 gene ribF CDS 486483..486713 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04520 CDS complement(486710..488191) product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813883.1 transl_table 11 codon_start 1 locus_tag LOCUS_04530 CDS complement(488307..488879) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004549931.1 transl_table 11 codon_start 1 locus_tag LOCUS_04540 CDS 488995..489645 product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196420.1 transl_table 11 codon_start 1 locus_tag LOCUS_04550 CDS 489958..490722 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04560 CDS 490722..491603 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04570 CDS 491600..492895 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04580 CDS 492892..493860 product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099798653.1 transl_table 11 codon_start 1 locus_tag LOCUS_04590 CDS 493860..495158 product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104968.1 transl_table 11 codon_start 1 locus_tag LOCUS_04600 CDS 495208..495978 product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268792.1 transl_table 11 codon_start 1 locus_tag LOCUS_04610 CDS 495986..496975 product stage II sporulation protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256411.1 transl_table 11 codon_start 1 locus_tag LOCUS_04620 CDS complement(497208..497789) product superoxide dismutase [Fe] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094005.1 transl_table 11 codon_start 1 locus_tag LOCUS_04630 gene sodB CDS 497914..498387 product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036473.1 transl_table 11 codon_start 1 locus_tag LOCUS_04640 CDS 498601..499308 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706996.1 transl_table 11 codon_start 1 locus_tag LOCUS_04650 CDS 499378..504012 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04660 CDS complement(504682..505152) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04670 CDS complement(505209..506555) product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_114714636.1 transl_table 11 codon_start 1 locus_tag LOCUS_04680 CDS 507346..508332 product IS110-like element IS1663 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930320.1 transl_table 11 codon_start 1 locus_tag LOCUS_04690 CDS complement(508446..509948) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04700 CDS complement(510530..510712) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04710 CDS complement(511180..513009) product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074325.1 transl_table 11 codon_start 1 locus_tag LOCUS_04720 gene glmS CDS complement(513011..514432) product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074328.1 transl_table 11 codon_start 1 locus_tag LOCUS_04730 gene glmU CDS complement(514505..514927) product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948665.1 transl_table 11 codon_start 1 locus_tag LOCUS_04740 CDS complement(514952..516325) product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649402.1 transl_table 11 codon_start 1 locus_tag LOCUS_04750 gene atpD CDS complement(516368..517231) product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097132.1 transl_table 11 codon_start 1 locus_tag LOCUS_04760 gene atpG CDS complement(517243..518784) product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948668.1 transl_table 11 codon_start 1 locus_tag LOCUS_04770 gene atpA CDS complement(518806..519336) product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097135.1 transl_table 11 codon_start 1 locus_tag LOCUS_04780 CDS complement(519340..519813) product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214796.1 transl_table 11 codon_start 1 locus_tag LOCUS_04790 CDS complement(519898..520182) product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948671.1 transl_table 11 codon_start 1 locus_tag LOCUS_04800 gene atpE CDS complement(520225..520989) product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074335.1 transl_table 11 codon_start 1 locus_tag LOCUS_04810 gene atpB CDS complement(521007..521375) product ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074336.1 transl_table 11 codon_start 1 locus_tag LOCUS_04820 CDS complement(521686..522534) product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100240.1 transl_table 11 codon_start 1 locus_tag LOCUS_04830 CDS complement(522531..523307) product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074338.1 transl_table 11 codon_start 1 locus_tag LOCUS_04840 CDS complement(523300..523926) product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948576.1 transl_table 11 codon_start 1 locus_tag LOCUS_04850 gene rsmG CDS complement(523926..525800) product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369000.1 transl_table 11 codon_start 1 locus_tag LOCUS_04860 gene mnmG CDS 525849..526088 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04870 CDS 526116..526724 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04880 CDS 526733..529120 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771663.1 transl_table 11 codon_start 1 locus_tag LOCUS_04890 CDS complement(529326..530168) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04900 CDS 530447..531358 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000188441.1 transl_table 11 codon_start 1 locus_tag LOCUS_04910 CDS complement(531382..531903) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027568.1 transl_table 11 codon_start 1 locus_tag LOCUS_04920 CDS complement(532173..533519) product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_114714636.1 transl_table 11 codon_start 1 locus_tag LOCUS_04930 CDS 533681..534322 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04940 CDS complement(534334..534849) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04950 CDS complement(534927..535331) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04960 CDS complement(535331..537067) product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582444.1 transl_table 11 codon_start 1 locus_tag LOCUS_04970 gene dnaK CDS complement(537085..537735) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04980 CDS complement(537732..538067) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04990 CDS complement(538074..540569) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05000 CDS complement(540837..541574) product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546167.1 transl_table 11 codon_start 1 locus_tag LOCUS_05010 CDS complement(541749..542768) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05020 CDS complement(542786..543913) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05030 CDS 544130..545242 product ISAs1-like element ISSod22 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072192.1 transl_table 11 codon_start 1 locus_tag LOCUS_05040 CDS 545531..546379 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947778.1 transl_table 11 codon_start 1 locus_tag LOCUS_05050 CDS 546698..548728 product TonB-dependent receptor plug domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262962.1 transl_table 11 codon_start 1 locus_tag LOCUS_05060 CDS 548746..549255 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05070 CDS 549252..551177 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05080 CDS complement(551191..551667) product CreA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792825.1 transl_table 11 codon_start 1 locus_tag LOCUS_05090 CDS complement(551708..552184) product MEKHLA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192119.1 transl_table 11 codon_start 1 locus_tag LOCUS_05100 CDS complement(552194..552907) product RES family NAD+ phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533388.1 transl_table 11 codon_start 1 locus_tag LOCUS_05110 CDS complement(552892..553296) product MbcA/ParS/Xre antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525097.1 transl_table 11 codon_start 1 locus_tag LOCUS_05120 CDS 553346..553603 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05130 CDS 553774..553998 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05140 CDS complement(554011..554463) product molybdopterin synthase catalytic subunit MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535771.1 transl_table 11 codon_start 1 locus_tag LOCUS_05150 gene moaE CDS complement(554465..554698) product molybdopterin synthase sulfur carrier subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000598605.1 transl_table 11 codon_start 1 locus_tag LOCUS_05160 gene moaD CDS 554800..555240 product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705487.1 transl_table 11 codon_start 1 locus_tag LOCUS_05170 gene moaC CDS complement(555256..555837) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05180 CDS complement(555843..556661) product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946685.1 transl_table 11 codon_start 1 locus_tag LOCUS_05190 CDS complement(556730..560530) product YhdP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268867.1 transl_table 11 codon_start 1 locus_tag LOCUS_05200 CDS complement(560540..561997) product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094386.1 transl_table 11 codon_start 1 locus_tag LOCUS_05210 gene rng CDS complement(561994..562569) product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112737.1 transl_table 11 codon_start 1 locus_tag LOCUS_05220 CDS complement(562574..563038) product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210328.1 transl_table 11 codon_start 1 locus_tag LOCUS_05230 gene rlmH CDS 563363..564835 product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967804.1 transl_table 11 codon_start 1 locus_tag LOCUS_05240 CDS 565197..568403 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05250 CDS 568406..569977 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05260 CDS 569974..571515 product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001159928.1 transl_table 11 codon_start 1 locus_tag LOCUS_05270 CDS 571508..573079 product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545185.1 transl_table 11 codon_start 1 locus_tag LOCUS_05280 CDS 573228..573860 product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651595.1 transl_table 11 codon_start 1 locus_tag LOCUS_05290 gene can CDS 573893..575452 product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362015.1 transl_table 11 codon_start 1 locus_tag LOCUS_05300 CDS 575699..578065 product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_090828103.1 transl_table 11 codon_start 1 locus_tag LOCUS_05310 CDS complement(578219..579040) product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103420.1 transl_table 11 codon_start 1 locus_tag LOCUS_05320 CDS complement(579459..579611) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05330 CDS complement(579779..580795) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05340 CDS complement(580792..580959) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05350 CDS complement(580968..581219) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05360 CDS complement(581356..581904) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05370 CDS complement(581897..582439) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05380 note possible pseudo, frameshifted CDS complement(582451..583158) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05390 note possible pseudo, frameshifted CDS complement(583335..584186) product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098315.1 transl_table 11 codon_start 1 locus_tag LOCUS_05400 CDS 584241..585146 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05410 CDS 585198..585953 product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038353.1 transl_table 11 codon_start 1 locus_tag LOCUS_05420 gene rph CDS 585959..586546 product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482459.1 transl_table 11 codon_start 1 locus_tag LOCUS_05430 CDS 586543..587604 product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124950.1 transl_table 11 codon_start 1 locus_tag LOCUS_05440 CDS complement(587978..588646) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05450 CDS complement(588703..590700) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05460 CDS complement(591245..592120) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258990.1 transl_table 11 codon_start 1 locus_tag LOCUS_05470 CDS 592260..592841 product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921658.1 transl_table 11 codon_start 1 locus_tag LOCUS_05480 CDS 592870..593472 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05490 CDS 593557..593778 product 4-oxalocrotonate tautomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104925.1 transl_table 11 codon_start 1 locus_tag LOCUS_05500 CDS complement(593816..594442) product TIGR04282 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839307.1 transl_table 11 codon_start 1 locus_tag LOCUS_05510 CDS complement(594446..595237) product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453865.1 transl_table 11 codon_start 1 locus_tag LOCUS_05520 CDS complement(595237..595920) product TIGR04283 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256873.1 transl_table 11 codon_start 1 locus_tag LOCUS_05530 CDS complement(595934..598084) product bifunctional TVP38/TMEM64 family protein/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705444.1 transl_table 11 codon_start 1 locus_tag LOCUS_05540 CDS 598365..598859 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05550 CDS complement(599037..600101) product cobalamin-independent methionine synthase II family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227080.1 transl_table 11 codon_start 1 locus_tag LOCUS_05560 CDS complement(600162..600461) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05570 CDS complement(600694..601656) product arsenosugar biosynthesis radical SAM protein ArsS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140889.1 transl_table 11 codon_start 1 locus_tag LOCUS_05580 gene arsS CDS complement(601659..602306) product DUF3047 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941830.1 transl_table 11 codon_start 1 locus_tag LOCUS_05590 CDS complement(602309..602863) product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113020.1 transl_table 11 codon_start 1 locus_tag LOCUS_05600 CDS complement(602860..603642) product putative DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206316.1 transl_table 11 codon_start 1 locus_tag LOCUS_05610 CDS complement(603639..604511) product DUF692 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072092.1 transl_table 11 codon_start 1 locus_tag LOCUS_05620 CDS complement(604528..604854) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072091.1 transl_table 11 codon_start 1 locus_tag LOCUS_05630 CDS 605082..605978 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05640 CDS complement(606138..606656) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05650 CDS complement(606777..606983) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05660 CDS complement(606976..607599) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002220007.1 transl_table 11 codon_start 1 locus_tag LOCUS_05670 CDS complement(607590..608633) product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028993.1 transl_table 11 codon_start 1 locus_tag LOCUS_05680 CDS complement(608653..609777) product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082965.1 transl_table 11 codon_start 1 locus_tag LOCUS_05690 CDS complement(610095..610568) product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096727.1 transl_table 11 codon_start 1 locus_tag LOCUS_05700 CDS complement(610599..611204) product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552112.1 transl_table 11 codon_start 1 locus_tag LOCUS_05710 CDS complement(611220..612509) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05720 CDS complement(612657..613202) product peroxidase-related enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063704.1 transl_table 11 codon_start 1 locus_tag LOCUS_05730 CDS 613340..614239 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033459673.1 transl_table 11 codon_start 1 locus_tag LOCUS_05740 CDS complement(614541..614873) product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389943.1 transl_table 11 codon_start 1 locus_tag LOCUS_05750 CDS 615459..616730 product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187436542.1 transl_table 11 codon_start 1 locus_tag LOCUS_05760 CDS complement(616963..617553) product excalibur calcium-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071042.1 transl_table 11 codon_start 1 locus_tag LOCUS_05770 CDS complement(617664..618317) product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142493.1 transl_table 11 codon_start 1 locus_tag LOCUS_05780 CDS 618384..619175 product NERD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206820009.1 transl_table 11 codon_start 1 locus_tag LOCUS_05790 CDS complement(619480..620820) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05800 CDS complement(621333..622307) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05810 CDS complement(622300..622542) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05820 CDS complement(622570..624243) product Mu transposase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478346.1 transl_table 11 codon_start 1 locus_tag LOCUS_05830 CDS complement(624167..624949) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05840 CDS complement(625116..625508) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05850 CDS complement(625864..626034) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05860 CDS complement(626197..627960) product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039208.1 transl_table 11 codon_start 1 locus_tag LOCUS_05870 CDS complement(627957..629798) product ATP-dependent endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974287.1 transl_table 11 codon_start 1 locus_tag LOCUS_05880 CDS complement(629818..630705) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05890 CDS complement(630858..633263) product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260901.1 transl_table 11 codon_start 1 locus_tag LOCUS_05900 gene gyrB CDS complement(633384..634457) product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266123.1 transl_table 11 codon_start 1 locus_tag LOCUS_05910 gene recF CDS complement(634472..635575) product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768226.1 transl_table 11 codon_start 1 locus_tag LOCUS_05920 gene dnaN CDS complement(635765..637087) product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945763.1 transl_table 11 codon_start 1 locus_tag LOCUS_05930 gene dnaA CDS 637203..637817 product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098317.1 transl_table 11 codon_start 1 locus_tag LOCUS_05940 gene gmk CDS 637835..638275 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05950 CDS 638388..639668 product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007243834.1 transl_table 11 codon_start 1 locus_tag LOCUS_05960 gene hemL CDS complement(639885..640052) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05970 CDS complement(640308..640808) product phosphate-starvation-inducible PsiE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004152114.1 transl_table 11 codon_start 1 locus_tag LOCUS_05980 CDS 640953..641585 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05990 CDS 641635..642960 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06000 CDS 643433..644788 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06010 CDS 644781..647168 product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149605307.1 transl_table 11 codon_start 1 locus_tag LOCUS_06020 CDS 647278..648204 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06030 CDS 648246..649313 product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193758.1 transl_table 11 codon_start 1 locus_tag LOCUS_06040 CDS 649310..652426 product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024698545.1 transl_table 11 codon_start 1 locus_tag LOCUS_06050 CDS complement(652586..652975) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06060 CDS complement(653077..653724) product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966379.1 transl_table 11 codon_start 1 locus_tag LOCUS_06070 CDS complement(653989..654438) product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038585.1 transl_table 11 codon_start 1 locus_tag LOCUS_06080 CDS complement(654586..655446) product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704199.1 transl_table 11 codon_start 1 locus_tag LOCUS_06090 gene ubiA CDS complement(655507..656772) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06100 CDS complement(656782..656913) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06110 CDS complement(657021..657380) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968936.1 transl_table 11 codon_start 1 locus_tag LOCUS_06120 CDS complement(657377..657631) product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129080272.1 transl_table 11 codon_start 1 locus_tag LOCUS_06130 CDS complement(657718..659148) product bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693548.1 transl_table 11 codon_start 1 locus_tag LOCUS_06140 gene hldE CDS 659203..659568 product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072786.1 transl_table 11 codon_start 1 locus_tag LOCUS_06150 gene arsC CDS 659568..660158 product NAD(P)H:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003363251.1 transl_table 11 codon_start 1 locus_tag LOCUS_06160 gene wrbA CDS complement(660169..660951) product oxacillin-hydrolyzing class D beta-lactamase OXA-50 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099707.1 transl_table 11 codon_start 1 locus_tag LOCUS_06170 gene blaOXA CDS complement(660951..661424) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525695.1 transl_table 11 codon_start 1 locus_tag LOCUS_06180 CDS complement(661463..661939) product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252527.1 transl_table 11 codon_start 1 locus_tag LOCUS_06190 CDS complement(661969..662496) product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045629.1 transl_table 11 codon_start 1 locus_tag LOCUS_06200 CDS complement(662522..662878) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06210 CDS complement(662901..663308) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809248.1 transl_table 11 codon_start 1 locus_tag LOCUS_06220 CDS complement(663351..663839) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809130.1 transl_table 11 codon_start 1 locus_tag LOCUS_06230 CDS complement(663969..664361) product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089353.1 transl_table 11 codon_start 1 locus_tag LOCUS_06240 CDS 664576..665070 product YchJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389735.1 transl_table 11 codon_start 1 locus_tag LOCUS_06250 CDS 665067..665831 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06260 CDS 665936..667657 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06270 CDS complement(668117..669343) product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082803.1 transl_table 11 codon_start 1 locus_tag LOCUS_06280 CDS complement(669367..669849) product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000191912.1 transl_table 11 codon_start 1 locus_tag LOCUS_06290 CDS 669912..671081 product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212060.1 transl_table 11 codon_start 1 locus_tag LOCUS_06300 CDS complement(671083..671889) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970116.1 transl_table 11 codon_start 1 locus_tag LOCUS_06310 CDS 672037..672507 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06320 CDS 672713..673627 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06330 CDS 673846..674055 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06340 CDS complement(674043..675008) product IS110-like element IS621 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000399648.1 transl_table 11 codon_start 1 locus_tag LOCUS_06350 CDS complement(675406..676506) product cellulase family glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009901552.1 transl_table 11 codon_start 1 locus_tag LOCUS_06360 CDS complement(676549..678219) product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972722.1 transl_table 11 codon_start 1 locus_tag LOCUS_06370 CDS complement(678451..679707) product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096334.1 transl_table 11 codon_start 1 locus_tag LOCUS_06380 gene rho CDS complement(679882..680220) product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403255.1 transl_table 11 codon_start 1 locus_tag LOCUS_06390 gene trxA CDS 680310..681650 product ATP-dependent RNA helicase RhlB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458582.1 transl_table 11 codon_start 1 locus_tag LOCUS_06400 gene rhlB CDS complement(681589..682245) product GMP/IMP nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114065.1 transl_table 11 codon_start 1 locus_tag LOCUS_06410 gene yrfG CDS 682423..683934 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037458.1 transl_table 11 codon_start 1 locus_tag LOCUS_06420 CDS 684018..684569 product ADP compounds hydrolase NudE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017765235.1 transl_table 11 codon_start 1 locus_tag LOCUS_06430 gene nudE CDS complement(684625..686313) product BatD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267197.1 transl_table 11 codon_start 1 locus_tag LOCUS_06440 CDS complement(686326..689451) product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942780.1 transl_table 11 codon_start 1 locus_tag LOCUS_06450 CDS complement(689455..690591) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942781.1 transl_table 11 codon_start 1 locus_tag LOCUS_06460 CDS complement(690783..692081) product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140384.1 transl_table 11 codon_start 1 locus_tag LOCUS_06470 CDS complement(692153..693940) product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072991.1 transl_table 11 codon_start 1 locus_tag LOCUS_06480 CDS complement(693937..694923) product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072990.1 transl_table 11 codon_start 1 locus_tag LOCUS_06490 CDS complement(694920..695387) product DUF4381 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038328.1 transl_table 11 codon_start 1 locus_tag LOCUS_06500 CDS complement(695397..699554) product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925941.1 transl_table 11 codon_start 1 locus_tag LOCUS_06510 CDS complement(699573..700490) product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003376303.1 transl_table 11 codon_start 1 locus_tag LOCUS_06520 CDS complement(700491..701477) product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554476.1 transl_table 11 codon_start 1 locus_tag LOCUS_06530 CDS complement(701544..702248) product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545458.1 transl_table 11 codon_start 1 locus_tag LOCUS_06540 CDS complement(702304..703593) product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114891.1 transl_table 11 codon_start 1 locus_tag LOCUS_06550 CDS complement(703590..704555) product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084569.1 transl_table 11 codon_start 1 locus_tag LOCUS_06560 CDS complement(704552..705073) product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084574.1 transl_table 11 codon_start 1 locus_tag LOCUS_06570 gene pyrR CDS complement(705175..705621) product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084575.1 transl_table 11 codon_start 1 locus_tag LOCUS_06580 gene ruvX CDS complement(705614..706180) product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037878.1 transl_table 11 codon_start 1 locus_tag LOCUS_06590 CDS complement(706197..707090) product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895505.1 transl_table 11 codon_start 1 locus_tag LOCUS_06600 CDS complement(707092..708042) product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000593260.1 transl_table 11 codon_start 1 locus_tag LOCUS_06610 gene gshB CDS 708182..708418 product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096556.1 transl_table 11 codon_start 1 locus_tag LOCUS_06620 gene rpmB CDS 708430..708585 product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094893.1 transl_table 11 codon_start 1 locus_tag LOCUS_06630 gene rpmG CDS complement(708645..709976) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06640 CDS 710129..711469 product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162600451.1 transl_table 11 codon_start 1 locus_tag LOCUS_06650 CDS complement(711472..713478) product DNA helicase Rep inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045224090.1 transl_table 11 codon_start 1 locus_tag LOCUS_06660 gene rep CDS complement(713622..713816) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06670 CDS 713985..714248 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06680 CDS complement(714335..715768) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06690 CDS complement(716033..716449) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06700 CDS complement(716814..717494) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963158.1 transl_table 11 codon_start 1 locus_tag LOCUS_06710 CDS 717417..717683 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06720 CDS 717791..718336 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06730 CDS 718504..718890 product MAPEG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454090.1 transl_table 11 codon_start 1 locus_tag LOCUS_06740 CDS 719275..720255 product TIGR03790 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009545347.1 transl_table 11 codon_start 1 locus_tag LOCUS_06750 CDS complement(720305..721696) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06760 CDS complement(721741..722343) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06770 CDS 722669..725500 product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704643.1 transl_table 11 codon_start 1 locus_tag LOCUS_06780 gene ileS CDS 725493..725972 product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210508.1 transl_table 11 codon_start 1 locus_tag LOCUS_06790 gene lspA CDS 726522..727856 product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073169944.1 transl_table 11 codon_start 1 locus_tag LOCUS_06800 CDS 728961..729182 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06810 CDS 729571..730635 product L-dopachrome tautomerase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086613793.1 transl_table 11 codon_start 1 locus_tag LOCUS_06820 CDS complement(730632..731567) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096239.1 transl_table 11 codon_start 1 locus_tag LOCUS_06830 CDS 731819..732571 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06840 CDS 732583..733821 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06850 CDS 733838..734611 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06860 CDS 734979..736106 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223123.1 transl_table 11 codon_start 1 locus_tag LOCUS_06870 CDS 736127..736507 product tautomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190990.1 transl_table 11 codon_start 1 locus_tag LOCUS_06880 CDS 736575..737081 product DUF1993 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083593.1 transl_table 11 codon_start 1 locus_tag LOCUS_06890 CDS complement(737579..738172) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06900 CDS complement(738534..739331) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097205.1 transl_table 11 codon_start 1 locus_tag LOCUS_06910 CDS complement(739386..740405) product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767792.1 transl_table 11 codon_start 1 locus_tag LOCUS_06920 CDS complement(740601..741446) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530513.1 transl_table 11 codon_start 1 locus_tag LOCUS_06930 CDS 741629..741994 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06940 CDS complement(742291..743775) product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112353.1 transl_table 11 codon_start 1 locus_tag LOCUS_06950 CDS complement(743765..744478) product 5,6-dimethylbenzimidazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185643.1 transl_table 11 codon_start 1 locus_tag LOCUS_06960 gene bluB CDS complement(744475..745197) product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404265.1 transl_table 11 codon_start 1 locus_tag LOCUS_06970 CDS complement(745200..745613) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06980 CDS complement(745790..746830) product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268579.1 transl_table 11 codon_start 1 locus_tag LOCUS_06990 gene cobT CDS complement(746838..747365) product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206639.1 transl_table 11 codon_start 1 locus_tag LOCUS_07000 gene cobU CDS complement(747358..747801) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946670.1 transl_table 11 codon_start 1 locus_tag LOCUS_07010 CDS complement(747810..748319) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07020 CDS complement(748322..750208) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707314.1 transl_table 11 codon_start 1 locus_tag LOCUS_07030 CDS complement(750500..752797) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07040 CDS complement(753276..756392) product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123110.1 transl_table 11 codon_start 1 locus_tag LOCUS_07050 CDS complement(756389..757567) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071226.1 transl_table 11 codon_start 1 locus_tag LOCUS_07060 CDS complement(757564..758865) product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188537.1 transl_table 11 codon_start 1 locus_tag LOCUS_07070 CDS 759286..760029 product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887613.1 transl_table 11 codon_start 1 locus_tag LOCUS_07080 CDS complement(760100..760897) product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767891.1 transl_table 11 codon_start 1 locus_tag LOCUS_07090 gene trpC CDS 760991..761176 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07100 CDS complement(761268..762338) product type I restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065824.1 transl_table 11 codon_start 1 locus_tag LOCUS_07110 CDS complement(762825..763061) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643598.1 transl_table 11 codon_start 1 locus_tag LOCUS_07120 CDS complement(763051..763314) product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589156.1 transl_table 11 codon_start 1 locus_tag LOCUS_07130 CDS complement(763378..764385) product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085203.1 transl_table 11 codon_start 1 locus_tag LOCUS_07140 gene trpD CDS 764764..765609 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07150 CDS complement(766068..766589) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07160 CDS complement(766713..767420) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07170 CDS complement(768442..769632) product TIGR03862 family flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202907611.1 transl_table 11 codon_start 1 locus_tag LOCUS_07180 CDS 769851..770510 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07190 CDS 772453..773367 product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258773.1 transl_table 11 codon_start 1 locus_tag LOCUS_07200 CDS complement(773618..774373) product IS21-like element ISPsy14 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104225.1 transl_table 11 codon_start 1 locus_tag LOCUS_07210 gene istB CDS complement(774385..774645) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07220 CDS complement(774691..775197) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07230 note possible pseudo, internal stop codon, frameshifted CDS complement(775194..775898) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07240 note possible pseudo, frameshifted CDS complement(776174..776500) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07250 CDS 776541..777194 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07260 CDS 777195..777440 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07270 CDS 777798..778130 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07280 CDS 778181..778765 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07290 CDS 779049..779201 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07300 CDS 779364..779870 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07310 CDS 780263..784456 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07320 CDS 784603..786744 product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268199.1 transl_table 11 codon_start 1 locus_tag LOCUS_07330 CDS 786749..788182 product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268198.1 transl_table 11 codon_start 1 locus_tag LOCUS_07340 CDS complement(788649..790049) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07350 CDS complement(790049..792148) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07360 CDS complement(792334..792759) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07370 CDS complement(792906..793586) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07380 CDS complement(793590..793922) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07390 CDS complement(793929..794081) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07400 CDS complement(794078..795076) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07410 CDS 795203..796009 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07420 note possible pseudo, internal stop codon, frameshifted CDS 796021..796452 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07430 note possible pseudo, internal stop codon, frameshifted CDS complement(796834..797997) product TIGR03862 family flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202907611.1 transl_table 11 codon_start 1 locus_tag LOCUS_07440 CDS complement(798035..798262) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07450 CDS complement(798289..799428) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968622.1 transl_table 11 codon_start 1 locus_tag LOCUS_07460 CDS complement(799425..799976) product DUF4365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968621.1 transl_table 11 codon_start 1 locus_tag LOCUS_07470 CDS complement(800060..800650) product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113175.1 transl_table 11 codon_start 1 locus_tag LOCUS_07480 CDS complement(800647..802155) product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113204.1 transl_table 11 codon_start 1 locus_tag LOCUS_07490 gene trpE CDS complement(802985..804070) product IS110-like element ISPa11 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147159.1 transl_table 11 codon_start 1 locus_tag LOCUS_07500 CDS 804088..804435 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07510 CDS 804480..804836 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07520 CDS complement(804942..805124) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07530 CDS complement(805202..805474) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07540 CDS complement(805660..805986) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07550 CDS complement(806007..807113) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07560 CDS 807270..807479 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07570 CDS complement(807567..808160) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07580 CDS complement(808177..811980) product RHS repeat-associated core domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161946530.1 transl_table 11 codon_start 1 locus_tag LOCUS_07590 CDS 812014..812181 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07600 CDS complement(812950..814737) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07610 CDS complement(814950..816632) product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330281.1 transl_table 11 codon_start 1 locus_tag LOCUS_07620 gene groL CDS complement(816653..817093) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07630 CDS complement(817062..818099) product 2Fe-2S iron-sulfur cluster binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226170.1 transl_table 11 codon_start 1 locus_tag LOCUS_07640 CDS complement(818101..818361) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07650 CDS complement(818518..819015) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07660 CDS complement(819025..819450) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07670 CDS complement(819460..820638) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07680 CDS complement(820667..822250) product methane monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893346.1 transl_table 11 codon_start 1 locus_tag LOCUS_07690 CDS 822382..822609 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07700 CDS 822590..823459 product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088041.1 transl_table 11 codon_start 1 locus_tag LOCUS_07710 CDS 823539..823985 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07720 CDS complement(824011..825897) product potassium transporter Kup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406174.1 transl_table 11 codon_start 1 locus_tag LOCUS_07730 CDS 826024..826914 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07740 CDS 826930..827610 product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103062.1 transl_table 11 codon_start 1 locus_tag LOCUS_07750 CDS 827615..828025 product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771285.1 transl_table 11 codon_start 1 locus_tag LOCUS_07760 CDS complement(828111..829001) product 30S ribosomal protein S6--L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000689982.1 transl_table 11 codon_start 1 locus_tag LOCUS_07770 gene rimK CDS complement(829020..829694) product acireductone synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167481.1 transl_table 11 codon_start 1 locus_tag LOCUS_07780 gene mtnC CDS complement(829691..830248) product acireductone dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881290.1 transl_table 11 codon_start 1 locus_tag LOCUS_07790 CDS complement(830245..830871) product methylthioribulose 1-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881293.1 transl_table 11 codon_start 1 locus_tag LOCUS_07800 CDS 831370..831549 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07810 CDS 831766..832041 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07820 CDS complement(832277..832723) product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888773.1 transl_table 11 codon_start 1 locus_tag LOCUS_07830 CDS complement(832726..833646) product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531115.1 transl_table 11 codon_start 1 locus_tag LOCUS_07840 CDS 833748..834011 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07850 CDS complement(834123..836075) product DUF3488 and DUF4129 domain-containing transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463435.1 transl_table 11 codon_start 1 locus_tag LOCUS_07860 CDS complement(836078..837028) product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114742.1 transl_table 11 codon_start 1 locus_tag LOCUS_07870 CDS complement(837025..837930) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114741.1 transl_table 11 codon_start 1 locus_tag LOCUS_07880 CDS 838077..838418 product TraR/DksA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037379501.1 transl_table 11 codon_start 1 locus_tag LOCUS_07890 CDS 838535..839572 product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003489919.1 transl_table 11 codon_start 1 locus_tag LOCUS_07900 CDS 839588..840721 product type IV pilus ATPase PilU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100959.1 transl_table 11 codon_start 1 locus_tag LOCUS_07910 gene pilU CDS 840739..841920 product lytic murein transglycosylase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705439.1 transl_table 11 codon_start 1 locus_tag LOCUS_07920 gene mltB CDS 842509..843303 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07930 CDS 843457..844977 product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036607.1 transl_table 11 codon_start 1 locus_tag LOCUS_07940 CDS complement(845009..845578) product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057636.1 transl_table 11 codon_start 1 locus_tag LOCUS_07950 CDS 845708..846712 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07960 CDS 846875..848020 product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947032.1 transl_table 11 codon_start 1 locus_tag LOCUS_07970 CDS 848161..848634 product DUF2269 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920736.1 transl_table 11 codon_start 1 locus_tag LOCUS_07980 CDS 848638..849219 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07990 CDS 849248..849532 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08000 CDS complement(849611..850687) product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103810.1 transl_table 11 codon_start 1 locus_tag LOCUS_08010 CDS 851301..851456 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08020 CDS complement(851645..851863) product DUF3820 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764045.1 transl_table 11 codon_start 1 locus_tag LOCUS_08030 CDS complement(851921..852967) product bifunctional nicotinamide-nucleotide adenylyltransferase/Nudix hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038544.1 transl_table 11 codon_start 1 locus_tag LOCUS_08040 CDS complement(852978..854675) product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938901.1 transl_table 11 codon_start 1 locus_tag LOCUS_08050 CDS complement(854695..855885) product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225072.1 transl_table 11 codon_start 1 locus_tag LOCUS_08060 gene pncB CDS complement(855895..856743) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08070 CDS 856872..857570 product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206820.1 transl_table 11 codon_start 1 locus_tag LOCUS_08080 CDS complement(857565..858188) product 5'-deoxynucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210283.1 transl_table 11 codon_start 1 locus_tag LOCUS_08090 gene yfbR CDS complement(858188..858973) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08100 CDS complement(859395..859850) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08110 CDS complement(860252..860626) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08120 CDS 860909..861721 product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194827.1 transl_table 11 codon_start 1 locus_tag LOCUS_08130 CDS complement(861789..863597) product ribosome-dependent GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368970.1 transl_table 11 codon_start 1 locus_tag LOCUS_08140 gene typA CDS complement(863704..864096) product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196360.1 transl_table 11 codon_start 1 locus_tag LOCUS_08150 CDS complement(864109..864678) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08160 CDS complement(864675..865577) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388796.1 transl_table 11 codon_start 1 locus_tag LOCUS_08170 CDS 865720..865920 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08180 CDS 866104..866424 product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105340.1 transl_table 11 codon_start 1 locus_tag LOCUS_08190 CDS 866448..866663 product Sec-independent protein translocase subunit TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199902.1 transl_table 11 codon_start 1 locus_tag LOCUS_08200 gene tatA CDS 866672..866995 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08210 CDS 866970..867725 product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704121.1 transl_table 11 codon_start 1 locus_tag LOCUS_08220 gene tatC CDS 867718..868401 product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084549.1 transl_table 11 codon_start 1 locus_tag LOCUS_08230 CDS 868459..870216 product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947747.1 transl_table 11 codon_start 1 locus_tag LOCUS_08240 gene argS CDS 870216..870857 product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095850.1 transl_table 11 codon_start 1 locus_tag LOCUS_08250 CDS 871003..871563 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08260 CDS complement(871655..872671) product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166135.1 transl_table 11 codon_start 1 locus_tag LOCUS_08270 gene ansA CDS 872728..873273 product type 3 dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707142.1 transl_table 11 codon_start 1 locus_tag LOCUS_08280 gene folA CDS 873354..874343 product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096673.1 transl_table 11 codon_start 1 locus_tag LOCUS_08290 gene pstS CDS 874560..876839 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768357.1 transl_table 11 codon_start 1 locus_tag LOCUS_08300 CDS 876836..878491 product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114377.1 transl_table 11 codon_start 1 locus_tag LOCUS_08310 gene pstA CDS 878528..879361 product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071864.1 transl_table 11 codon_start 1 locus_tag LOCUS_08320 gene pstB CDS 879372..880091 product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071865.1 transl_table 11 codon_start 1 locus_tag LOCUS_08330 gene phoU CDS complement(880279..880782) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08340 CDS complement(880849..882783) product TonB-dependent receptor plug domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262962.1 transl_table 11 codon_start 1 locus_tag LOCUS_08350 CDS complement(882936..883553) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391567.1 transl_table 11 codon_start 1 locus_tag LOCUS_08360 CDS complement(883560..884531) product Tim44-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791677.1 transl_table 11 codon_start 1 locus_tag LOCUS_08370 CDS 884674..885069 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08380 CDS 885197..886507 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08390 CDS 886504..887595 product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929017.1 transl_table 11 codon_start 1 locus_tag LOCUS_08400 CDS 887595..890654 product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086886.1 transl_table 11 codon_start 1 locus_tag LOCUS_08410 CDS 890654..890959 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08420 CDS 891058..891771 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08430 CDS complement(891863..892186) product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036917.1 transl_table 11 codon_start 1 locus_tag LOCUS_08440 CDS complement(892335..894440) product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000774533.1 transl_table 11 codon_start 1 locus_tag LOCUS_08450 gene fusA CDS complement(894661..895599) product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000488462.1 transl_table 11 codon_start 1 locus_tag LOCUS_08460 CDS complement(895596..896288) product DnaA regulatory inactivator Hda inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958403.1 transl_table 11 codon_start 1 locus_tag LOCUS_08470 gene hda CDS complement(896300..896644) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08480 CDS 896750..897316 product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194433.1 transl_table 11 codon_start 1 locus_tag LOCUS_08490 CDS 897403..897852 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027567.1 transl_table 11 codon_start 1 locus_tag LOCUS_08500 CDS complement(897925..898104) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08510 CDS complement(898144..900501) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08520 CDS complement(900605..901561) product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267457.1 transl_table 11 codon_start 1 locus_tag LOCUS_08530 CDS complement(901672..902193) product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114482.1 transl_table 11 codon_start 1 locus_tag LOCUS_08540 CDS complement(902862..905225) product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015154897.1 transl_table 11 codon_start 1 locus_tag LOCUS_08550 CDS complement(905508..906518) product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918866.1 transl_table 11 codon_start 1 locus_tag LOCUS_08560 CDS complement(906563..907090) product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082669.1 transl_table 11 codon_start 1 locus_tag LOCUS_08570 CDS complement(907270..908478) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08580 CDS complement(908598..911093) product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015154897.1 transl_table 11 codon_start 1 locus_tag LOCUS_08590 CDS complement(911376..912344) product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969652.1 transl_table 11 codon_start 1 locus_tag LOCUS_08600 CDS complement(912527..913048) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814464.1 transl_table 11 codon_start 1 locus_tag LOCUS_08610 CDS 913075..913326 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08620 CDS complement(913417..914631) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103037383.1 transl_table 11 codon_start 1 locus_tag LOCUS_08630 CDS complement(914684..917191) product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015154897.1 transl_table 11 codon_start 1 locus_tag LOCUS_08640 CDS complement(917367..918359) product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390126.1 transl_table 11 codon_start 1 locus_tag LOCUS_08650 CDS complement(918433..918948) product pyoverdine signaling pathway sigma factor FpvI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103620.1 transl_table 11 codon_start 1 locus_tag LOCUS_08660 gene fpvI CDS 919368..921791 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08670 CDS 922487..923161 product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005666147.1 transl_table 11 codon_start 1 locus_tag LOCUS_08680 gene mtgA CDS complement(923169..923813) product ribosome biogenesis factor YjgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101581.1 transl_table 11 codon_start 1 locus_tag LOCUS_08690 gene yjgA CDS complement(923815..923997) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08700 CDS 924481..925389 product recombination-associated protein RdgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706841.1 transl_table 11 codon_start 1 locus_tag LOCUS_08710 gene rdgC CDS 925389..926351 product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090946.1 transl_table 11 codon_start 1 locus_tag LOCUS_08720 CDS complement(926418..926696) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08730 CDS complement(926781..927335) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08740 CDS 927408..929042 product alpha-D-glucose phosphate-specific phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143971.1 transl_table 11 codon_start 1 locus_tag LOCUS_08750 CDS complement(929090..931162) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08760 CDS 931488..931703 product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072720.1 transl_table 11 codon_start 1 locus_tag LOCUS_08770 CDS 931917..932183 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08780 CDS complement(932401..933087) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08790 CDS 933345..934412 product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602520.1 transl_table 11 codon_start 1 locus_tag LOCUS_08800 gene mutY CDS 934405..934665 product oxidative damage protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193961.1 transl_table 11 codon_start 1 locus_tag LOCUS_08810 CDS 934788..935006 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08820 CDS 935049..935366 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08830 CDS complement(935425..935871) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08840 CDS complement(935967..937382) product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070784.1 transl_table 11 codon_start 1 locus_tag LOCUS_08850 gene lpdA CDS complement(937393..938688) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08860 CDS complement(938702..941374) product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199569.1 transl_table 11 codon_start 1 locus_tag LOCUS_08870 gene aceE CDS 941659..942243 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08880 CDS complement(942319..944082) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08890 CDS complement(944195..945799) product YdiU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122546.1 transl_table 11 codon_start 1 locus_tag LOCUS_08900 CDS 945910..946254 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08910 CDS 946267..947208 product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096656.1 transl_table 11 codon_start 1 locus_tag LOCUS_08920 CDS complement(947211..949355) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08930 CDS complement(949595..950794) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706487.1 transl_table 11 codon_start 1 locus_tag LOCUS_08940 CDS 950957..951739 product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943172.1 transl_table 11 codon_start 1 locus_tag LOCUS_08950 CDS complement(951740..952435) product TetR family multidrug efflux transcriptional regulator VceR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264144.1 transl_table 11 codon_start 1 locus_tag LOCUS_08960 gene vceR CDS 952746..953744 product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267830.1 transl_table 11 codon_start 1 locus_tag LOCUS_08970 CDS 953744..956806 product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267831.1 transl_table 11 codon_start 1 locus_tag LOCUS_08980 CDS complement(956826..957479) product cAMP-activated global transcriptional regulator CRP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000242746.1 transl_table 11 codon_start 1 locus_tag LOCUS_08990 gene crp CDS 957608..958027 product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085219.1 transl_table 11 codon_start 1 locus_tag LOCUS_09000 CDS 958032..958811 product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316303.1 transl_table 11 codon_start 1 locus_tag LOCUS_09010 gene speD CDS complement(958872..959192) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09020 CDS complement(959268..960101) product symmetrical bis(5'-nucleosyl)-tetraphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015443884.1 transl_table 11 codon_start 1 locus_tag LOCUS_09030 CDS complement(960101..960478) product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095539.1 transl_table 11 codon_start 1 locus_tag LOCUS_09040 gene apaG CDS 960550..961071 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09050 CDS 961135..962505 product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266525.1 transl_table 11 codon_start 1 locus_tag LOCUS_09060 gene mpl CDS 962509..962796 product SelT/SelW/SelH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398761.1 transl_table 11 codon_start 1 locus_tag LOCUS_09070 CDS 962840..964810 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09080 CDS complement(964963..969000) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09090 CDS complement(969292..969678) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09100 CDS complement(969682..970317) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09110 CDS 970664..970969 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09120 CDS complement(971091..971795) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09130 CDS complement(972178..972612) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09140 CDS complement(972786..974348) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095088.1 transl_table 11 codon_start 1 locus_tag LOCUS_09150 CDS 974664..975491 product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389556.1 transl_table 11 codon_start 1 locus_tag LOCUS_09160 CDS 975553..976536 product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705183.1 transl_table 11 codon_start 1 locus_tag LOCUS_09170 CDS 976539..979205 product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387818.1 transl_table 11 codon_start 1 locus_tag LOCUS_09180 CDS 979321..980169 product flagellar motor stator protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198197.1 transl_table 11 codon_start 1 locus_tag LOCUS_09190 gene motA CDS 980176..981147 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09200 CDS 981192..981926 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09210 CDS complement(981929..983773) product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946701.1 transl_table 11 codon_start 1 locus_tag LOCUS_09220 CDS complement(983758..984789) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103696.1 transl_table 11 codon_start 1 locus_tag LOCUS_09230 CDS complement(984797..985750) product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003124383.1 transl_table 11 codon_start 1 locus_tag LOCUS_09240 CDS complement(985822..986280) product DUF411 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095106.1 transl_table 11 codon_start 1 locus_tag LOCUS_09250 CDS complement(986291..986710) product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477375.1 transl_table 11 codon_start 1 locus_tag LOCUS_09260 CDS complement(986719..987783) product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000137640.1 transl_table 11 codon_start 1 locus_tag LOCUS_09270 gene hemE CDS complement(987806..989467) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09280 CDS complement(989457..990539) product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403032.1 transl_table 11 codon_start 1 locus_tag LOCUS_09290 gene aroB CDS complement(990511..991029) product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806947.1 transl_table 11 codon_start 1 locus_tag LOCUS_09300 CDS complement(991677..992024) product endonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687278.1 transl_table 11 codon_start 1 locus_tag LOCUS_09310 CDS complement(992264..992989) product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039203.1 transl_table 11 codon_start 1 locus_tag LOCUS_09320 gene pyrF CDS 993357..994709 product exopolysaccharide biosynthesis glycosyltransferase VpsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001889848.1 transl_table 11 codon_start 1 locus_tag LOCUS_09330 gene vpsL CDS 995598..995978 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09340 CDS 996096..997088 product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001833065.1 transl_table 11 codon_start 1 locus_tag LOCUS_09350 CDS 997170..998411 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09360 CDS 998428..999558 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09370 CDS 999715..1000662 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09380 CDS 1000951..1002054 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09390 CDS 1002145..1003203 product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962920.1 transl_table 11 codon_start 1 locus_tag LOCUS_09400 CDS 1003492..1004652 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222487.1 transl_table 11 codon_start 1 locus_tag LOCUS_09410 CDS complement(1005795..1005974) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09420 CDS complement(1006366..1007214) product IS630 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_140590772.1 transl_table 11 codon_start 1 locus_tag LOCUS_09430 note possible pseudo, frameshifted CDS 1007494..1007970 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09440 CDS 1007976..1008350 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09450 CDS complement(1008378..1009088) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09460 CDS 1009253..1010599 product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_114714636.1 transl_table 11 codon_start 1 locus_tag LOCUS_09470 CDS complement(1010904..1011380) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09480 note possible pseudo, internal stop codon CDS complement(1011540..1013627) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09490 CDS complement(1013858..1015204) product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_114714636.1 transl_table 11 codon_start 1 locus_tag LOCUS_09500 CDS complement(1015444..1017570) product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922617.1 transl_table 11 codon_start 1 locus_tag LOCUS_09510 CDS complement(1017560..1017727) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09520 CDS 1018636..1018902 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09530 note possible pseudo, frameshifted CDS 1018923..1019423 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09540 note possible pseudo, internal stop codon, frameshifted CDS 1020110..1020889 product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288211.1 transl_table 11 codon_start 1 locus_tag LOCUS_09550 CDS complement(1021135..1022430) product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188362.1 transl_table 11 codon_start 1 locus_tag LOCUS_09560 gene gltA CDS complement(1022701..1023804) product HupE/UreJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142975.1 transl_table 11 codon_start 1 locus_tag LOCUS_09570 CDS complement(1023822..1024448) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09580 CDS complement(1024518..1024895) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09590 CDS complement(1024919..1026139) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09600 CDS 1026496..1027092 product CHRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088650.1 transl_table 11 codon_start 1 locus_tag LOCUS_09610 CDS complement(1027249..1028661) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947022.1 transl_table 11 codon_start 1 locus_tag LOCUS_09620 CDS complement(1028661..1029320) product two-component system response regulator PrmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102236.1 transl_table 11 codon_start 1 locus_tag LOCUS_09630 gene pmrA CDS complement(1029459..1030688) product isocitrate dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963977.1 transl_table 11 codon_start 1 locus_tag LOCUS_09640 CDS 1030980..1032737 product GMC oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000759730.1 transl_table 11 codon_start 1 locus_tag LOCUS_09650 CDS 1032761..1034500 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09660 note possible pseudo, frameshifted CDS 1034512..1036086 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09670 CDS 1036170..1036754 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112585.1 transl_table 11 codon_start 1 locus_tag LOCUS_09680 CDS 1036760..1037011 product accessory factor UbiK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958608.1 transl_table 11 codon_start 1 locus_tag LOCUS_09690 CDS 1037019..1037870 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09700 CDS 1038133..1038462 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09710 CDS 1038579..1039694 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09720 CDS 1039691..1040296 product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876732.1 transl_table 11 codon_start 1 locus_tag LOCUS_09730 gene queC CDS complement(1040892..1041476) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09740 CDS complement(1041758..1042384) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09750 CDS 1042947..1043264 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09760 CDS 1043693..1044097 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09770 CDS complement(1044559..1045752) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09780 CDS complement(1045940..1046458) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09790 CDS complement(1046482..1047033) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09800 CDS 1048054..1048353 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09810 CDS 1048460..1048864 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09820 CDS 1049461..1049637 product CbtB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003342053.1 transl_table 11 codon_start 1 locus_tag LOCUS_09830 CDS 1049646..1050329 product CbtA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091061.1 transl_table 11 codon_start 1 locus_tag LOCUS_09840 CDS 1050326..1051135 product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876241.1 transl_table 11 codon_start 1 locus_tag LOCUS_09850 gene cobM CDS 1051144..1052004 product sirohydrochlorin chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034944231.1 transl_table 11 codon_start 1 locus_tag LOCUS_09860 CDS 1052001..1052672 product cobalt-precorrin-8 methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000999239.1 transl_table 11 codon_start 1 locus_tag LOCUS_09870 gene cbiC CDS 1052682..1053782 product cobalt-precorrin-5B (C(1))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258428.1 transl_table 11 codon_start 1 locus_tag LOCUS_09880 CDS 1053775..1055088 product bifunctional cobalt-precorrin-7 (C(5))-methyltransferase/cobalt-precorrin-6B (C(15))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008631406.1 transl_table 11 codon_start 1 locus_tag LOCUS_09890 CDS 1055078..1055872 product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392605.1 transl_table 11 codon_start 1 locus_tag LOCUS_09900 gene cobI CDS 1055869..1056615 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09910 note possible pseudo, frameshifted CDS 1056615..1057016 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09920 note possible pseudo, frameshifted CDS 1057013..1058392 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09930 CDS 1058385..1058744 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09940 CDS complement(1058907..1060253) product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_114714636.1 transl_table 11 codon_start 1 locus_tag LOCUS_09950 CDS complement(1060976..1062322) product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_114714636.1 transl_table 11 codon_start 1 locus_tag LOCUS_09960 CDS 1063054..1063995 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09970 CDS 1064316..1066529 product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836919.1 transl_table 11 codon_start 1 locus_tag LOCUS_09980 CDS complement(1066702..1067373) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09990 CDS 1068070..1068237 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10000 CDS 1068368..1068940 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10010 CDS 1069175..1069849 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10020 CDS 1070173..1082037 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10030 CDS 1082164..1083435 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10040 CDS 1083457..1084851 product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705262.1 transl_table 11 codon_start 1 locus_tag LOCUS_10050 CDS 1085049..1085414 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10060 CDS 1085490..1086836 product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_114714636.1 transl_table 11 codon_start 1 locus_tag LOCUS_10070 CDS 1086785..1089496 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10080 CDS 1090059..1090553 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10090 CDS 1090965..1092311 product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_114714636.1 transl_table 11 codon_start 1 locus_tag LOCUS_10100 CDS 1093469..1093672 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10110 CDS 1093679..1094194 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10120 CDS complement(1094332..1094910) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10130 CDS complement(1095905..1096798) product TniB family NTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003465065.1 transl_table 11 codon_start 1 locus_tag LOCUS_10140 CDS complement(1096795..1098684) product DDE-type integrase/transposase/recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044392641.1 transl_table 11 codon_start 1 locus_tag LOCUS_10150 CDS complement(1098681..1099376) product TnsA endonuclease N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223862839.1 transl_table 11 codon_start 1 locus_tag LOCUS_10160 CDS 1099358..1100092 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10170 CDS complement(1100112..1101395) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10180 CDS complement(1101392..1104499) product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202770.1 transl_table 11 codon_start 1 locus_tag LOCUS_10190 CDS complement(1104512..1105432) product CzcB/NccB family metal efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880267.1 transl_table 11 codon_start 1 locus_tag LOCUS_10200 gene czcB CDS complement(1106203..1106805) product peroxiredoxin C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092073.1 transl_table 11 codon_start 1 locus_tag LOCUS_10210 CDS 1107057..1107569 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10220 CDS complement(1107586..1108437) product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104915.1 transl_table 11 codon_start 1 locus_tag LOCUS_10230 gene nadC CDS 1108505..1109173 product 1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262620.1 transl_table 11 codon_start 1 locus_tag LOCUS_10240 gene ampD CDS complement(1109170..1111101) product dynamin-like GTPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114887.1 transl_table 11 codon_start 1 locus_tag LOCUS_10250 CDS complement(1111204..1111842) product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815272.1 transl_table 11 codon_start 1 locus_tag LOCUS_10260 gene pyrE CDS complement(1111891..1113021) product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266423.1 transl_table 11 codon_start 1 locus_tag LOCUS_10270 gene hemW CDS complement(1113033..1113473) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530919.1 transl_table 11 codon_start 1 locus_tag LOCUS_10280 CDS complement(1113737..1114567) product protein-glutamate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266627.1 transl_table 11 codon_start 1 locus_tag LOCUS_10290 CDS complement(1114634..1115200) product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403299.1 transl_table 11 codon_start 1 locus_tag LOCUS_10300 CDS complement(1115210..1118467) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10310 CDS complement(1118645..1123036) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10320 CDS complement(1123079..1125253) product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704965.1 transl_table 11 codon_start 1 locus_tag LOCUS_10330 CDS complement(1125266..1125553) product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704966.1 transl_table 11 codon_start 1 locus_tag LOCUS_10340 CDS complement(1125634..1126002) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004880039.1 transl_table 11 codon_start 1 locus_tag LOCUS_10350 CDS complement(1126015..1127097) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704968.1 transl_table 11 codon_start 1 locus_tag LOCUS_10360 CDS 1127363..1127698 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10370 CDS complement(1127676..1128434) product DUF2063 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114075.1 transl_table 11 codon_start 1 locus_tag LOCUS_10380 CDS complement(1128434..1129285) product DUF692 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072092.1 transl_table 11 codon_start 1 locus_tag LOCUS_10390 CDS complement(1129289..1129870) product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096354.1 transl_table 11 codon_start 1 locus_tag LOCUS_10400 CDS complement(1129900..1130463) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10410 CDS complement(1130571..1131266) product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005654382.1 transl_table 11 codon_start 1 locus_tag LOCUS_10420 gene nth CDS 1131419..1131754 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10430 CDS complement(1131830..1132663) product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212612.1 transl_table 11 codon_start 1 locus_tag LOCUS_10440 CDS complement(1132802..1132981) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10450 CDS 1133189..1133779 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10460 CDS 1133776..1134609 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261481.1 transl_table 11 codon_start 1 locus_tag LOCUS_10470 CDS 1134678..1135160 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10480 CDS complement(1135236..1136057) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10490 CDS 1136158..1136604 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10500 CDS complement(1136642..1139278) product UPF0182 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090068.1 transl_table 11 codon_start 1 locus_tag LOCUS_10510 CDS complement(1139742..1141472) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10520 CDS 1141728..1143428 product beta-1,6-glucan synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087383.1 transl_table 11 codon_start 1 locus_tag LOCUS_10530 CDS 1143666..1144352 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10540 CDS complement(1144480..1145790) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10550 CDS complement(1145804..1147330) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10560 CDS complement(1147456..1148061) product thiol:disulfide interchange protein DsbA/DsbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403888.1 transl_table 11 codon_start 1 locus_tag LOCUS_10570 CDS complement(1148410..1149093) product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945885.1 transl_table 11 codon_start 1 locus_tag LOCUS_10580 CDS 1149204..1149824 product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096980.1 transl_table 11 codon_start 1 locus_tag LOCUS_10590 gene yihA CDS 1150147..1150530 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10600 CDS 1150530..1150925 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10610 CDS 1151098..1151544 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10620 CDS complement(1151703..1153172) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10630 CDS complement(1153176..1153715) product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085759.1 transl_table 11 codon_start 1 locus_tag LOCUS_10640 CDS complement(1153873..1154667) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070889.1 transl_table 11 codon_start 1 locus_tag LOCUS_10650 CDS complement(1154671..1156113) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10660 CDS complement(1156118..1158925) product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113794.1 transl_table 11 codon_start 1 locus_tag LOCUS_10670 CDS 1159218..1159508 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10680 CDS 1159559..1160233 product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035300.1 transl_table 11 codon_start 1 locus_tag LOCUS_10690 CDS 1160411..1160950 product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350905.1 transl_table 11 codon_start 1 locus_tag LOCUS_10700 CDS complement(1160990..1161751) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10710 CDS complement(1161755..1162177) product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704675.1 transl_table 11 codon_start 1 locus_tag LOCUS_10720 CDS complement(1162237..1163133) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10730 CDS complement(1163268..1163861) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10740 CDS 1164174..1165811 product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261112.1 transl_table 11 codon_start 1 locus_tag LOCUS_10750 gene pgi CDS 1166187..1166381 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10760 CDS 1166406..1166912 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10770 CDS complement(1166971..1167258) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10780 CDS complement(1167320..1169359) product oligopeptidase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000070205.1 transl_table 11 codon_start 1 locus_tag LOCUS_10790 gene prlC CDS complement(1169394..1170758) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10800 CDS complement(1170760..1172049) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10810 CDS complement(1172054..1173334) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10820 CDS complement(1173408..1174256) product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111201.1 transl_table 11 codon_start 1 locus_tag LOCUS_10830 gene aroE CDS complement(1174243..1174818) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10840 CDS complement(1174843..1175850) product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073891.1 transl_table 11 codon_start 1 locus_tag LOCUS_10850 gene hemB CDS 1175999..1176646 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199924.1 transl_table 11 codon_start 1 locus_tag LOCUS_10860 CDS 1176699..1177442 product carboxy-S-adenosyl-L-methionine synthase CmoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068374.1 transl_table 11 codon_start 1 locus_tag LOCUS_10870 gene cmoA CDS 1177439..1178410 product tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816529.1 transl_table 11 codon_start 1 locus_tag LOCUS_10880 gene cmoB CDS 1178540..1178866 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10890 CDS complement(1178962..1179309) product phenylpyruvate tautomerase MIF-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_101886618.1 transl_table 11 codon_start 1 locus_tag LOCUS_10900 CDS 1180279..1180926 product 3-hexulose-6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776031.1 transl_table 11 codon_start 1 locus_tag LOCUS_10910 gene hxlA CDS 1180930..1181463 product 6-phospho-3-hexuloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879292.1 transl_table 11 codon_start 1 locus_tag LOCUS_10920 gene hxlB CDS 1181666..1183681 product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110216.1 transl_table 11 codon_start 1 locus_tag LOCUS_10930 gene tkt CDS 1183784..1184437 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10940 CDS 1184723..1185709 product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141596.1 transl_table 11 codon_start 1 locus_tag LOCUS_10950 CDS 1185811..1186890 product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704732.1 transl_table 11 codon_start 1 locus_tag LOCUS_10960 gene fbaA CDS 1187174..1187722 product flagellar basal body-associated FliL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881216.1 transl_table 11 codon_start 1 locus_tag LOCUS_10970 CDS 1187723..1188703 product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705279.1 transl_table 11 codon_start 1 locus_tag LOCUS_10980 gene fliM CDS 1188722..1189174 product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083049.1 transl_table 11 codon_start 1 locus_tag LOCUS_10990 gene fliN CDS 1189174..1189617 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11000 CDS 1189610..1190356 product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481091.1 transl_table 11 codon_start 1 locus_tag LOCUS_11010 gene fliP CDS 1190366..1190638 product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199882.1 transl_table 11 codon_start 1 locus_tag LOCUS_11020 gene fliQ CDS 1190635..1191411 product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073100.1 transl_table 11 codon_start 1 locus_tag LOCUS_11030 gene fliR CDS 1191412..1192539 product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083056.1 transl_table 11 codon_start 1 locus_tag LOCUS_11040 gene flhB CDS 1192559..1194664 product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481069.1 transl_table 11 codon_start 1 locus_tag LOCUS_11050 gene flhA CDS 1194680..1196080 product flagellar biosynthesis protein FlhF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262353.1 transl_table 11 codon_start 1 locus_tag LOCUS_11060 gene flhF CDS 1196121..1196945 product flagellar synthesis regulator FleN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412391.1 transl_table 11 codon_start 1 locus_tag LOCUS_11070 gene fleN CDS 1196942..1197688 product RNA polymerase sigma factor FliA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083070.1 transl_table 11 codon_start 1 locus_tag LOCUS_11080 gene fliA CDS 1197776..1198162 product chemotaxis response regulator CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007649667.1 transl_table 11 codon_start 1 locus_tag LOCUS_11090 gene cheY CDS 1198180..1198902 product protein phosphatase CheZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705289.1 transl_table 11 codon_start 1 locus_tag LOCUS_11100 CDS 1198913..1201117 product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114282.1 transl_table 11 codon_start 1 locus_tag LOCUS_11110 CDS 1201127..1202221 product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000985860.1 transl_table 11 codon_start 1 locus_tag LOCUS_11120 CDS 1202334..1202966 product flagellar motor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083089.1 transl_table 11 codon_start 1 locus_tag LOCUS_11130 note possible pseudo, frameshifted CDS 1202977..1203858 product flagellar motor protein MotD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004408098.1 transl_table 11 codon_start 1 locus_tag LOCUS_11140 gene motD CDS 1203855..1204658 product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083092.1 transl_table 11 codon_start 1 locus_tag LOCUS_11150 CDS 1204655..1205386 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11160 CDS 1205408..1205881 product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073088.1 transl_table 11 codon_start 1 locus_tag LOCUS_11170 CDS 1205910..1206074 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11180 CDS 1206074..1206496 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11190 CDS complement(1206508..1207326) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008657976.1 transl_table 11 codon_start 1 locus_tag LOCUS_11200 CDS complement(1207323..1208072) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813226.1 transl_table 11 codon_start 1 locus_tag LOCUS_11210 CDS complement(1208065..1209285) product O-antigen ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958356.1 transl_table 11 codon_start 1 locus_tag LOCUS_11220 CDS complement(1209297..1209953) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11230 CDS complement(1210105..1211223) product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531909.1 transl_table 11 codon_start 1 locus_tag LOCUS_11240 CDS 1211281..1213044 product lipid A export permease/ATP-binding protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114544.1 transl_table 11 codon_start 1 locus_tag LOCUS_11250 gene msbA CDS complement(1213090..1214214) product pyrroloquinoline quinone biosynthesis protein PqqE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269165.1 transl_table 11 codon_start 1 locus_tag LOCUS_11260 gene pqqE CDS complement(1214192..1214464) product pyrroloquinoline quinone biosynthesis peptide chaperone PqqD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366526.1 transl_table 11 codon_start 1 locus_tag LOCUS_11270 gene pqqD CDS complement(1214498..1215061) product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141099.1 transl_table 11 codon_start 1 locus_tag LOCUS_11280 CDS complement(1215064..1215792) product pyrroloquinoline-quinone synthase PqqC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111679.1 transl_table 11 codon_start 1 locus_tag LOCUS_11290 gene pqqC CDS complement(1215805..1216716) product pyrroloquinoline quinone biosynthesis protein PqqB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113495.1 transl_table 11 codon_start 1 locus_tag LOCUS_11300 gene pqqB CDS complement(1217055..1217891) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705953.1 transl_table 11 codon_start 1 locus_tag LOCUS_11310 CDS 1217938..1219185 product multifunctional CCA addition/repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817222.1 transl_table 11 codon_start 1 locus_tag LOCUS_11320 CDS 1219182..1219532 product DMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068360.1 transl_table 11 codon_start 1 locus_tag LOCUS_11330 CDS 1219574..1220440 product 23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478729.1 transl_table 11 codon_start 1 locus_tag LOCUS_11340 CDS 1220443..1220907 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11350 CDS 1220951..1222390 product metalloprotease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268865.1 transl_table 11 codon_start 1 locus_tag LOCUS_11360 gene tldD CDS 1222448..1223779 product metalloprotease PmbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112740.1 transl_table 11 codon_start 1 locus_tag LOCUS_11370 gene pmbA CDS complement(1223982..1224461) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11380 CDS 1224790..1225746 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391987.1 transl_table 11 codon_start 1 locus_tag LOCUS_11390 CDS complement(1225707..1226432) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11400 CDS complement(1226783..1227226) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11410 CDS 1227328..1227747 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11420 CDS 1227844..1228305 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11430 CDS 1228331..1228903 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196513.1 transl_table 11 codon_start 1 locus_tag LOCUS_11440 CDS 1228948..1230126 product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532914.1 transl_table 11 codon_start 1 locus_tag LOCUS_11450 CDS 1230123..1233185 product multidrug efflux RND transporter permease subunit MexK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092464.1 transl_table 11 codon_start 1 locus_tag LOCUS_11460 gene mexK CDS 1233290..1234768 product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082901032.1 transl_table 11 codon_start 1 locus_tag LOCUS_11470 CDS 1234854..1235798 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038743.1 transl_table 11 codon_start 1 locus_tag LOCUS_11480 CDS 1235795..1236556 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038742.1 transl_table 11 codon_start 1 locus_tag LOCUS_11490 CDS complement(1236608..1237621) product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103236.1 transl_table 11 codon_start 1 locus_tag LOCUS_11500 CDS complement(1237618..1238721) product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895678.1 transl_table 11 codon_start 1 locus_tag LOCUS_11510 gene thiO CDS 1239036..1239938 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11520 CDS 1240007..1240951 product prolyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095918.1 transl_table 11 codon_start 1 locus_tag LOCUS_11530 gene pip CDS 1240963..1241544 product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807624.1 transl_table 11 codon_start 1 locus_tag LOCUS_11540 CDS 1241767..1242414 product 3-hexulose-6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776031.1 transl_table 11 codon_start 1 locus_tag LOCUS_11550 gene hxlA CDS 1242565..1244580 product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110216.1 transl_table 11 codon_start 1 locus_tag LOCUS_11560 gene tkt CDS 1244658..1244942 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11570 CDS 1245022..1246428 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11580 CDS 1246591..1246944 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11590 CDS complement(1246982..1247392) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11600 CDS 1247490..1247855 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11610 CDS 1247856..1248587 product pteridine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038530.1 transl_table 11 codon_start 1 locus_tag LOCUS_11620 CDS complement(1248601..1249083) product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707548.1 transl_table 11 codon_start 1 locus_tag LOCUS_11630 gene folK CDS complement(1249086..1249439) product bifunctional dihydroneopterin aldolase/7,8-dihydroneopterin epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174138.1 transl_table 11 codon_start 1 locus_tag LOCUS_11640 gene folB CDS 1249529..1250101 product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071503.1 transl_table 11 codon_start 1 locus_tag LOCUS_11650 gene plsY CDS complement(1250102..1251112) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262666.1 transl_table 11 codon_start 1 locus_tag LOCUS_11660 gene tsaD CDS 1251217..1251450 product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001144069.1 transl_table 11 codon_start 1 locus_tag LOCUS_11670 gene rpsU CDS 1251459..1251908 product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085042.1 transl_table 11 codon_start 1 locus_tag LOCUS_11680 CDS 1251924..1253663 product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453774.1 transl_table 11 codon_start 1 locus_tag LOCUS_11690 gene dnaG CDS 1253740..1255551 product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085035.1 transl_table 11 codon_start 1 locus_tag LOCUS_11700 gene rpoD tRNA 1255585..1255661 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00080 CDS 1255730..1256890 product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817040.1 transl_table 11 codon_start 1 locus_tag LOCUS_11710 gene metK CDS 1256874..1258202 product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947737.1 transl_table 11 codon_start 1 locus_tag LOCUS_11720 gene ahcY CDS 1258316..1259626 product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105299.1 transl_table 11 codon_start 1 locus_tag LOCUS_11730 CDS 1259626..1260354 product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106127.1 transl_table 11 codon_start 1 locus_tag LOCUS_11740 CDS 1260351..1261247 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11750 CDS 1261349..1261654 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11760 CDS 1262294..1263664 product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011946152.1 transl_table 11 codon_start 1 locus_tag LOCUS_11770 gene atpD CDS 1263661..1264077 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946788.1 transl_table 11 codon_start 1 locus_tag LOCUS_11780 CDS 1264074..1264349 product AtpZ/AtpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946787.1 transl_table 11 codon_start 1 locus_tag LOCUS_11790 CDS 1264699..1265565 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11800 CDS 1265719..1266408 product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946786.1 transl_table 11 codon_start 1 locus_tag LOCUS_11810 CDS 1266411..1266677 product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019235654.1 transl_table 11 codon_start 1 locus_tag LOCUS_11820 CDS complement(1266712..1268820) product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266676.1 transl_table 11 codon_start 1 locus_tag LOCUS_11830 CDS 1269073..1269843 product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946784.1 transl_table 11 codon_start 1 locus_tag LOCUS_11840 CDS 1269836..1271272 product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946783.1 transl_table 11 codon_start 1 locus_tag LOCUS_11850 CDS 1271269..1272075 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11860 CDS complement(1272070..1273425) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11870 CDS 1273723..1274415 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206673.1 transl_table 11 codon_start 1 locus_tag LOCUS_11880 CDS 1274429..1275355 product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855402.1 transl_table 11 codon_start 1 locus_tag LOCUS_11890 CDS 1275553..1277307 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11900 CDS 1277339..1278370 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11910 CDS 1278377..1278799 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11920 CDS 1278830..1279342 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11930 CDS complement(1279539..1281635) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11940 CDS complement(1281632..1283284) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11950 CDS complement(1283281..1283901) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11960 CDS complement(1283898..1284926) product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943022.1 transl_table 11 codon_start 1 locus_tag LOCUS_11970 CDS complement(1284923..1285588) product corrinoid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025814379.1 transl_table 11 codon_start 1 locus_tag LOCUS_11980 CDS complement(1285588..1287225) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11990 CDS 1287534..1288823 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12000 CDS 1288918..1289457 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12010 CDS complement(1289565..1290341) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852748.1 transl_table 11 codon_start 1 locus_tag LOCUS_12020 CDS 1290689..1291570 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036068.1 transl_table 11 codon_start 1 locus_tag LOCUS_12030 CDS 1292009..1292740 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12040 CDS complement(1293130..1293855) product DUF2971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966202.1 transl_table 11 codon_start 1 locus_tag LOCUS_12050 CDS complement(1293895..1294461) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12060 CDS 1295017..1295295 product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213585.1 transl_table 11 codon_start 1 locus_tag LOCUS_12070 CDS 1295270..1295566 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12080 CDS complement(1295622..1296923) product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094326.1 transl_table 11 codon_start 1 locus_tag LOCUS_12090 gene hisD CDS complement(1296928..1297554) product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005739058.1 transl_table 11 codon_start 1 locus_tag LOCUS_12100 gene hisG CDS complement(1297570..1298835) product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005739059.1 transl_table 11 codon_start 1 locus_tag LOCUS_12110 gene murA CDS complement(1298869..1299180) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12120 CDS complement(1299180..1299644) product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003313587.1 transl_table 11 codon_start 1 locus_tag LOCUS_12130 gene mlaD CDS complement(1299646..1300428) product lipid asymmetry maintenance ABC transporter permease subunit MlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094341.1 transl_table 11 codon_start 1 locus_tag LOCUS_12140 gene mlaE CDS complement(1300446..1301264) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946577.1 transl_table 11 codon_start 1 locus_tag LOCUS_12150 CDS 1301409..1302383 product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707617.1 transl_table 11 codon_start 1 locus_tag LOCUS_12160 CDS 1302393..1302929 product 3-deoxy-manno-octulosonate-8-phosphatase KdsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000099768.1 transl_table 11 codon_start 1 locus_tag LOCUS_12170 gene kdsC CDS 1302926..1303492 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12180 CDS 1303479..1303979 product lipopolysaccharide ABC transporter substrate-binding protein LptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000669770.1 transl_table 11 codon_start 1 locus_tag LOCUS_12190 gene lptA CDS 1303979..1304704 product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073698.1 transl_table 11 codon_start 1 locus_tag LOCUS_12200 gene lptB CDS 1304718..1306154 product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703606.1 transl_table 11 codon_start 1 locus_tag LOCUS_12210 gene rpoN CDS 1306194..1306484 product ribosome hibernation promoting factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073700.1 transl_table 11 codon_start 1 locus_tag LOCUS_12220 gene hpf CDS 1306520..1307398 product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377550.1 transl_table 11 codon_start 1 locus_tag LOCUS_12230 gene rapZ CDS 1307434..1308792 product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037936.1 transl_table 11 codon_start 1 locus_tag LOCUS_12240 gene mgtE CDS 1308861..1309601 product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104763.1 transl_table 11 codon_start 1 locus_tag LOCUS_12250 gene minC CDS 1309623..1310435 product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705992.1 transl_table 11 codon_start 1 locus_tag LOCUS_12260 gene minD CDS 1310435..1310689 product cell division topological specificity factor MinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091581.1 transl_table 11 codon_start 1 locus_tag LOCUS_12270 gene minE CDS 1310791..1310988 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12280 CDS 1311269..1314091 product glycosyltransferase NdvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115817.1 transl_table 11 codon_start 1 locus_tag LOCUS_12290 gene ndvB CDS 1314519..1316882 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162494110.1 transl_table 11 codon_start 1 locus_tag LOCUS_12300 CDS 1317022..1318263 product sialidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536056.1 transl_table 11 codon_start 1 locus_tag LOCUS_12310 CDS complement(1318321..1319217) product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809513.1 transl_table 11 codon_start 1 locus_tag LOCUS_12320 CDS 1319287..1320090 product co-chaperone DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704885.1 transl_table 11 codon_start 1 locus_tag LOCUS_12330 gene djlA CDS complement(1320175..1320336) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12340 CDS complement(1320493..1321053) product IMPACT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015911.1 transl_table 11 codon_start 1 locus_tag LOCUS_12350 CDS complement(1321055..1321798) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532066.1 transl_table 11 codon_start 1 locus_tag LOCUS_12360 CDS complement(1321795..1322556) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173656.1 transl_table 11 codon_start 1 locus_tag LOCUS_12370 CDS complement(1322556..1323521) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966734.1 transl_table 11 codon_start 1 locus_tag LOCUS_12380 CDS complement(1323864..1327166) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12390 CDS complement(1327218..1327697) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12400 CDS complement(1327694..1328272) product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957540.1 transl_table 11 codon_start 1 locus_tag LOCUS_12410 CDS complement(1328272..1328631) product YajD family HNH nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071871.1 transl_table 11 codon_start 1 locus_tag LOCUS_12420 CDS complement(1328646..1329650) product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317890.1 transl_table 11 codon_start 1 locus_tag LOCUS_12430 gene moaA CDS complement(1329770..1330216) product low molecular weight phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258015.1 transl_table 11 codon_start 1 locus_tag LOCUS_12440 CDS 1330270..1330716 product putative toxin-antitoxin system toxin component, PIN family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626168.1 transl_table 11 codon_start 1 locus_tag LOCUS_12450 CDS 1330713..1330949 product toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389170.1 transl_table 11 codon_start 1 locus_tag LOCUS_12460 CDS 1331198..1331548 product DUF1801 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000034818.1 transl_table 11 codon_start 1 locus_tag LOCUS_12470 CDS complement(1331587..1332585) product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084490.1 transl_table 11 codon_start 1 locus_tag LOCUS_12480 CDS 1332878..1333816 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12490 CDS complement(1333859..1334155) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12500 CDS 1334602..1336854 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12510 note possible pseudo, frameshifted CDS 1336836..1338440 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12520 note possible pseudo, frameshifted CDS complement(1338646..1339110) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12530 CDS 1339461..1340048 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12540 CDS 1340045..1340821 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12550 CDS 1340884..1343061 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12560 CDS 1343083..1343544 product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941646.1 transl_table 11 codon_start 1 locus_tag LOCUS_12570 CDS 1343560..1345059 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12580 CDS 1345052..1345564 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12590 CDS 1345561..1346577 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12600 CDS 1346791..1346985 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12610 CDS 1347643..1348689 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12620 CDS 1348686..1349327 product phage baseplate assembly protein V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941650.1 transl_table 11 codon_start 1 locus_tag LOCUS_12630 CDS 1349334..1350998 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12640 CDS 1351001..1351396 product GPW/gp25 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226665.1 transl_table 11 codon_start 1 locus_tag LOCUS_12650 CDS 1351416..1353587 product putative baseplate assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941654.1 transl_table 11 codon_start 1 locus_tag LOCUS_12660 CDS 1353597..1356023 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12670 CDS 1356081..1356983 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12680 CDS 1356997..1358688 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12690 CDS 1359160..1362834 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12700 CDS 1362841..1364445 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12710 CDS 1364438..1366417 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12720 CDS 1366421..1370236 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12730 CDS 1370236..1371201 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12740 CDS 1371274..1372059 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12750 CDS 1372955..1373986 product agmatine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941691.1 transl_table 11 codon_start 1 locus_tag LOCUS_12760 CDS 1374002..1374886 product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941690.1 transl_table 11 codon_start 1 locus_tag LOCUS_12770 CDS complement(1374952..1377186) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12780 CDS 1377605..1378564 product 23S rRNA pseudouridine(955/2504/2580) synthase RluC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693754.1 transl_table 11 codon_start 1 locus_tag LOCUS_12790 gene rluC CDS 1378548..1379195 product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524610.1 transl_table 11 codon_start 1 locus_tag LOCUS_12800 CDS 1379203..1380186 product S49 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191725.1 transl_table 11 codon_start 1 locus_tag LOCUS_12810 CDS 1380434..1382032 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12820 CDS 1382046..1382372 product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192342.1 transl_table 11 codon_start 1 locus_tag LOCUS_12830 CDS 1382375..1382971 product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262239.1 transl_table 11 codon_start 1 locus_tag LOCUS_12840 gene recR CDS 1382980..1383318 product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948455.1 transl_table 11 codon_start 1 locus_tag LOCUS_12850 CDS complement(1383396..1384388) product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094902.1 transl_table 11 codon_start 1 locus_tag LOCUS_12860 CDS complement(1384385..1385242) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12870 CDS complement(1385295..1385561) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12880 CDS complement(1385592..1386695) product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958200.1 transl_table 11 codon_start 1 locus_tag LOCUS_12890 gene odhB CDS complement(1386705..1388732) product alpha-ketoacid dehydrogenase subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943646.1 transl_table 11 codon_start 1 locus_tag LOCUS_12900 CDS complement(1388855..1389766) product small ribosomal subunit biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815419.1 transl_table 11 codon_start 1 locus_tag LOCUS_12910 gene rsgA CDS complement(1389766..1391016) product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004555861.1 transl_table 11 codon_start 1 locus_tag LOCUS_12920 CDS 1391106..1391651 product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095671.1 transl_table 11 codon_start 1 locus_tag LOCUS_12930 gene orn CDS 1391651..1392358 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12940 CDS 1392401..1393672 product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946261.1 transl_table 11 codon_start 1 locus_tag LOCUS_12950 gene serS CDS 1393830..1394219 product group 1 truncated hemoglobin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947457.1 transl_table 11 codon_start 1 locus_tag LOCUS_12960 CDS complement(1394272..1396302) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269423.1 transl_table 11 codon_start 1 locus_tag LOCUS_12970 CDS complement(1396422..1396700) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12980 CDS 1396882..1397607 product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966736.1 transl_table 11 codon_start 1 locus_tag LOCUS_12990 CDS complement(1397658..1398440) product symmetrical bis(5'-nucleosyl)-tetraphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103186.1 transl_table 11 codon_start 1 locus_tag LOCUS_13000 CDS 1399005..1399274 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13010 CDS complement(1399517..1399924) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13020 CDS 1400173..1401381 product cyclic di-GMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113015.1 transl_table 11 codon_start 1 locus_tag LOCUS_13030 CDS complement(1401475..1401816) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13040 CDS complement(1402000..1402797) product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086933.1 transl_table 11 codon_start 1 locus_tag LOCUS_13050 CDS complement(1402913..1404553) product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001973414.1 transl_table 11 codon_start 1 locus_tag LOCUS_13060 gene gpmI CDS 1405030..1405986 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022102.1 transl_table 11 codon_start 1 locus_tag LOCUS_13070 CDS complement(1406063..1406785) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13080 CDS complement(1406757..1406978) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13090 CDS complement(1407223..1410666) product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024299434.1 transl_table 11 codon_start 1 locus_tag LOCUS_13100 gene mfd CDS complement(1410825..1411574) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13110 CDS 1411654..1411974 product quaternary ammonium compound efflux SMR transporter SugE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171053.1 transl_table 11 codon_start 1 locus_tag LOCUS_13120 gene sugE CDS 1411974..1412267 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13130 CDS 1412258..1412590 product TusE/DsrC/DsvC family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693989.1 transl_table 11 codon_start 1 locus_tag LOCUS_13140 CDS 1412612..1413922 product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000073304.1 transl_table 11 codon_start 1 locus_tag LOCUS_13150 gene rimO CDS complement(1413961..1414170) product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072720.1 transl_table 11 codon_start 1 locus_tag LOCUS_13160 CDS complement(1414627..1416066) product sodium:proton antiporter NhaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071215.1 transl_table 11 codon_start 1 locus_tag LOCUS_13170 gene nhaD CDS complement(1416414..1420061) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388324.1 transl_table 11 codon_start 1 locus_tag LOCUS_13180 CDS complement(1420110..1421039) product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000486403.1 transl_table 11 codon_start 1 locus_tag LOCUS_13190 gene secF CDS complement(1421138..1422595) product potassium transporter TrkG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219613.1 transl_table 11 codon_start 1 locus_tag LOCUS_13200 CDS 1422874..1423395 product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704824.1 transl_table 11 codon_start 1 locus_tag LOCUS_13210 CDS 1423392..1424435 product glycosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073877.1 transl_table 11 codon_start 1 locus_tag LOCUS_13220 CDS complement(1424443..1425471) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13230 CDS 1425637..1426020 product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114050.1 transl_table 11 codon_start 1 locus_tag LOCUS_13240 gene gcvH CDS 1426030..1426389 product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261207.1 transl_table 11 codon_start 1 locus_tag LOCUS_13250 CDS 1426494..1427426 product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038567.1 transl_table 11 codon_start 1 locus_tag LOCUS_13260 CDS 1427423..1428238 product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268591.1 transl_table 11 codon_start 1 locus_tag LOCUS_13270 gene mazG CDS 1428231..1428698 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13280 CDS 1428801..1429730 product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527906.1 transl_table 11 codon_start 1 locus_tag LOCUS_13290 gene msrP CDS 1429727..1430365 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13300 CDS 1430407..1430922 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13310 CDS 1431110..1431439 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13320 CDS complement(1431544..1431993) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13330 CDS 1432515..1433606 product hydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338265.1 transl_table 11 codon_start 1 locus_tag LOCUS_13340 CDS 1433606..1435402 product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009566012.1 transl_table 11 codon_start 1 locus_tag LOCUS_13350 CDS 1435412..1435627 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13360 CDS 1435624..1436319 product Ni/Fe-hydrogenase, b-type cytochrome subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089678.1 transl_table 11 codon_start 1 locus_tag LOCUS_13370 gene cybH CDS 1436409..1437095 product HyaD/HybD family hydrogenase maturation endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338268.1 transl_table 11 codon_start 1 locus_tag LOCUS_13380 CDS 1437095..1437391 product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089676.1 transl_table 11 codon_start 1 locus_tag LOCUS_13390 CDS 1437388..1437810 product hydrogenase expression/formation protein HupG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089675.1 transl_table 11 codon_start 1 locus_tag LOCUS_13400 CDS 1438397..1438672 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13410 CDS 1439362..1440471 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13420 CDS 1440993..1441841 product hydrogenase expression/formation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338271.1 transl_table 11 codon_start 1 locus_tag LOCUS_13430 CDS 1441838..1442059 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13440 note possible pseudo, internal stop codon, frameshifted CDS 1442062..1442523 product [NiFe]-hydrogenase assembly chaperone HybE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089672.1 transl_table 11 codon_start 1 locus_tag LOCUS_13450 gene hybE CDS 1442524..1443675 product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388922.1 transl_table 11 codon_start 1 locus_tag LOCUS_13460 CDS 1443713..1444054 product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089670.1 transl_table 11 codon_start 1 locus_tag LOCUS_13470 gene hypA CDS 1444054..1444878 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13480 CDS 1444909..1445136 product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089667.1 transl_table 11 codon_start 1 locus_tag LOCUS_13490 CDS 1445133..1446293 product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089666.1 transl_table 11 codon_start 1 locus_tag LOCUS_13500 gene hypD CDS complement(1446357..1446614) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13510 CDS complement(1446855..1447130) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13520 CDS complement(1447130..1447390) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13530 CDS 1447593..1447886 product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_214300674.1 transl_table 11 codon_start 1 locus_tag LOCUS_13540 CDS 1447890..1448174 product putative addiction module antidote protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389060.1 transl_table 11 codon_start 1 locus_tag LOCUS_13550 CDS 1448232..1449254 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13560 CDS 1449505..1450851 product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_114714636.1 transl_table 11 codon_start 1 locus_tag LOCUS_13570 CDS 1450933..1451970 product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948173.1 transl_table 11 codon_start 1 locus_tag LOCUS_13580 gene hypE CDS 1451970..1454402 product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338264.1 transl_table 11 codon_start 1 locus_tag LOCUS_13590 gene hypF CDS complement(1454388..1455020) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016982205.1 transl_table 11 codon_start 1 locus_tag LOCUS_13600 CDS complement(1455004..1456422) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404998.1 transl_table 11 codon_start 1 locus_tag LOCUS_13610 CDS complement(1456526..1459624) product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142029.1 transl_table 11 codon_start 1 locus_tag LOCUS_13620 CDS complement(1459816..1460490) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13630 CDS complement(1460549..1461199) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13640 CDS 1461552..1462790 product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162518500.1 transl_table 11 codon_start 1 locus_tag LOCUS_13650 CDS complement(1462929..1463618) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13660 CDS complement(1463986..1464549) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13670 CDS complement(1464572..1465741) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13680 CDS 1466074..1467468 product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380723.1 transl_table 11 codon_start 1 locus_tag LOCUS_13690 gene dnaB CDS 1467465..1468577 product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206817869.1 transl_table 11 codon_start 1 locus_tag LOCUS_13700 gene alr CDS complement(1468808..1469167) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13710 CDS 1469296..1469547 product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026614401.1 transl_table 11 codon_start 1 locus_tag LOCUS_13720 CDS 1469547..1469975 product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766948.1 transl_table 11 codon_start 1 locus_tag LOCUS_13730 CDS 1470140..1470967 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13740 CDS complement(1471028..1471675) product methylamine utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268752.1 transl_table 11 codon_start 1 locus_tag LOCUS_13750 CDS complement(1471645..1472841) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13760 CDS complement(1472964..1474721) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13770 CDS complement(1474718..1475440) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704857.1 transl_table 11 codon_start 1 locus_tag LOCUS_13780 CDS 1475662..1476750 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13790 CDS 1476821..1477588 product haloacid dehalogenase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204015.1 transl_table 11 codon_start 1 locus_tag LOCUS_13800 CDS complement(1477590..1479215) product sulfate adenylyltransferase subunit CysN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268855.1 transl_table 11 codon_start 1 locus_tag LOCUS_13810 gene cysN CDS complement(1479269..1479646) product type II toxin-antitoxin system death-on-curing family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932025.1 transl_table 11 codon_start 1 locus_tag LOCUS_13820 CDS complement(1479651..1479854) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13830 CDS complement(1479877..1480296) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13840 CDS complement(1480333..1481241) product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707309.1 transl_table 11 codon_start 1 locus_tag LOCUS_13850 gene cysD CDS 1481332..1481754 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13860 CDS 1481870..1483240 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13870 CDS complement(1483235..1483669) product thioredoxin TrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036377.1 transl_table 11 codon_start 1 locus_tag LOCUS_13880 gene trxC CDS complement(1483727..1484680) product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004152113.1 transl_table 11 codon_start 1 locus_tag LOCUS_13890 CDS complement(1484683..1484991) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13900 CDS complement(1484995..1485939) product DnaJ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930139.1 transl_table 11 codon_start 1 locus_tag LOCUS_13910 tmRNA 1486287..1486667 product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_tm00010 CDS complement(1487394..1487771) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13920 note possible pseudo, frameshifted CDS complement(1487869..1488219) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13930 note possible pseudo, frameshifted CDS 1488544..1489593 product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068670.1 transl_table 11 codon_start 1 locus_tag LOCUS_13940 CDS 1490068..1491240 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13950 CDS 1491263..1492243 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13960 CDS 1492562..1497724 product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041670058.1 transl_table 11 codon_start 1 locus_tag LOCUS_13970 CDS complement(1497861..1499300) product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105016.1 transl_table 11 codon_start 1 locus_tag LOCUS_13980 gene gatB CDS complement(1499319..1499921) product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050754228.1 transl_table 11 codon_start 1 locus_tag LOCUS_13990 CDS complement(1499935..1501386) product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091960758.1 transl_table 11 codon_start 1 locus_tag LOCUS_14000 gene gatA CDS complement(1501395..1501682) product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106543.1 transl_table 11 codon_start 1 locus_tag LOCUS_14010 gene gatC CDS 1501797..1502840 product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000473772.1 transl_table 11 codon_start 1 locus_tag LOCUS_14020 CDS 1503094..1503918 product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123307.1 transl_table 11 codon_start 1 locus_tag LOCUS_14030 gene mreC CDS 1503905..1504393 product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073800.1 transl_table 11 codon_start 1 locus_tag LOCUS_14040 gene mreD CDS 1504400..1506184 product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093191.1 transl_table 11 codon_start 1 locus_tag LOCUS_14050 gene mrdA CDS 1506246..1507376 product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818663.1 transl_table 11 codon_start 1 locus_tag LOCUS_14060 gene rodA CDS 1507384..1508370 product lytic murein transglycosylase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399773.1 transl_table 11 codon_start 1 locus_tag LOCUS_14070 gene mltB CDS 1508490..1509902 product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119569.1 transl_table 11 codon_start 1 locus_tag LOCUS_14080 CDS 1509949..1510950 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14090 CDS 1511125..1512819 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14100 CDS 1513181..1516663 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14110 CDS complement(1516672..1517766) product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266577.1 transl_table 11 codon_start 1 locus_tag LOCUS_14120 CDS 1517987..1519075 product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921497.1 transl_table 11 codon_start 1 locus_tag LOCUS_14130 gene gcvT CDS 1519080..1521989 product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967189.1 transl_table 11 codon_start 1 locus_tag LOCUS_14140 gene gcvP CDS 1521998..1523380 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14150 CDS 1523636..1524019 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14160 CDS 1524294..1525232 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14170 CDS complement(1525595..1526410) product DUF2797 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483526.1 transl_table 11 codon_start 1 locus_tag LOCUS_14180 CDS 1526483..1527028 product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948454.1 transl_table 11 codon_start 1 locus_tag LOCUS_14190 gene ppa CDS complement(1527044..1527805) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14200 CDS complement(1528150..1529007) product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704890.1 transl_table 11 codon_start 1 locus_tag LOCUS_14210 CDS complement(1529473..1530360) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14220 CDS 1530647..1531858 product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704180.1 transl_table 11 codon_start 1 locus_tag LOCUS_14230 gene coaBC CDS 1531830..1532285 product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015570042.1 transl_table 11 codon_start 1 locus_tag LOCUS_14240 gene dut CDS 1532301..1534838 product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114359.1 transl_table 11 codon_start 1 locus_tag LOCUS_14250 CDS 1534839..1535744 product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096572.1 transl_table 11 codon_start 1 locus_tag LOCUS_14260 gene argB CDS complement(1535727..1536647) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14270 CDS complement(1536751..1537326) product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084544.1 transl_table 11 codon_start 1 locus_tag LOCUS_14280 CDS complement(1537326..1538114) product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114890.1 transl_table 11 codon_start 1 locus_tag LOCUS_14290 gene proC CDS complement(1538239..1539738) product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073367.1 transl_table 11 codon_start 1 locus_tag LOCUS_14300 gene murJ CDS 1539889..1540152 product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094744.1 transl_table 11 codon_start 1 locus_tag LOCUS_14310 gene rpsT CDS 1540382..1541398 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258874.1 transl_table 11 codon_start 1 locus_tag LOCUS_14320 CDS 1541513..1541911 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14330 CDS complement(1542019..1542921) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14340 CDS complement(1543270..1545843) product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947476.1 transl_table 11 codon_start 1 locus_tag LOCUS_14350 gene clpB CDS 1546136..1546339 product cold shock domain-containing protein CspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072576.1 transl_table 11 codon_start 1 locus_tag LOCUS_14360 gene cspD CDS 1546475..1547398 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14370 CDS 1547511..1547765 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14380 CDS complement(1547762..1548631) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14390 CDS complement(1548659..1549474) product formylmethanofuran dehydrogenase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532025.1 transl_table 11 codon_start 1 locus_tag LOCUS_14400 CDS complement(1549471..1550367) product formylmethanofuran--tetrahydromethanopterin N-formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532026.1 transl_table 11 codon_start 1 locus_tag LOCUS_14410 gene fhcD CDS complement(1550364..1552028) product formylmethanofuran dehydrogenase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922276.1 transl_table 11 codon_start 1 locus_tag LOCUS_14420 CDS complement(1552039..1553298) product formylmethanofuran dehydrogenase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083774548.1 transl_table 11 codon_start 1 locus_tag LOCUS_14430 CDS complement(1553309..1553686) product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532029.1 transl_table 11 codon_start 1 locus_tag LOCUS_14440 CDS complement(1553879..1554262) product ClpXP protease specificity-enhancing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420947.1 transl_table 11 codon_start 1 locus_tag LOCUS_14450 gene sspB CDS complement(1554259..1554837) product stringent starvation protein SspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257293.1 transl_table 11 codon_start 1 locus_tag LOCUS_14460 gene sspA CDS complement(1555042..1555683) product DUF47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941056.1 transl_table 11 codon_start 1 locus_tag LOCUS_14470 CDS complement(1555698..1556732) product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941057.1 transl_table 11 codon_start 1 locus_tag LOCUS_14480 CDS complement(1556755..1557147) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14490 CDS 1558048..1559727 product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707925.1 transl_table 11 codon_start 1 locus_tag LOCUS_14500 gene yidC CDS 1559733..1561073 product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175133.1 transl_table 11 codon_start 1 locus_tag LOCUS_14510 gene mnmE CDS 1561129..1562583 product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032728610.1 transl_table 11 codon_start 1 locus_tag LOCUS_14520 CDS 1562580..1563005 product nucleotidyltransferase substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962808.1 transl_table 11 codon_start 1 locus_tag LOCUS_14530 CDS 1563002..1563331 product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948606.1 transl_table 11 codon_start 1 locus_tag LOCUS_14540 CDS 1563414..1564583 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14550 CDS 1564658..1564870 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14560 CDS 1564885..1565190 product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932679.1 transl_table 11 codon_start 1 locus_tag LOCUS_14570 CDS 1565200..1567704 product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000229101.1 transl_table 11 codon_start 1 locus_tag LOCUS_14580 CDS complement(1567911..1568306) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14590 CDS complement(1568418..1570025) product SagB/ThcOx family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114317.1 transl_table 11 codon_start 1 locus_tag LOCUS_14600 CDS 1570452..1571690 product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919650.1 transl_table 11 codon_start 1 locus_tag LOCUS_14610 CDS 1571804..1573885 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14620 CDS complement(1573939..1574208) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14630 CDS 1574405..1574761 product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389926.1 transl_table 11 codon_start 1 locus_tag LOCUS_14640 CDS 1574780..1575691 product Fe-S cluster assembly protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937968.1 transl_table 11 codon_start 1 locus_tag LOCUS_14650 gene nifU CDS 1575684..1576898 product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937967.1 transl_table 11 codon_start 1 locus_tag LOCUS_14660 gene nifS CDS 1577026..1577286 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14670 CDS complement(1577474..1578100) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14680 CDS complement(1578534..1579511) product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928642.1 transl_table 11 codon_start 1 locus_tag LOCUS_14690 CDS complement(1579750..1579905) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14700 CDS 1579975..1581099 product homocitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389924.1 transl_table 11 codon_start 1 locus_tag LOCUS_14710 gene nifV CDS 1581111..1581278 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14720 CDS 1581275..1582051 product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100615.1 transl_table 11 codon_start 1 locus_tag LOCUS_14730 gene cysE CDS 1582051..1582590 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14740 CDS 1582787..1583107 product nitrogenase-stabilizing/protective protein NifW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389923.1 transl_table 11 codon_start 1 locus_tag LOCUS_14750 CDS 1583104..1583580 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14760 CDS 1583582..1584433 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14770 CDS 1584435..1585736 product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114726.1 transl_table 11 codon_start 1 locus_tag LOCUS_14780 gene clpX CDS 1585811..1586428 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14790 CDS 1586453..1586983 product flavodoxin FldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018618.1 transl_table 11 codon_start 1 locus_tag LOCUS_14800 gene fldA CDS 1586994..1587434 product SoxR reducing system RseC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704746.1 transl_table 11 codon_start 1 locus_tag LOCUS_14810 CDS 1588302..1588805 product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084762.1 transl_table 11 codon_start 1 locus_tag LOCUS_14820 CDS 1588812..1589786 product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070694233.1 transl_table 11 codon_start 1 locus_tag LOCUS_14830 CDS 1590088..1592526 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14840 CDS 1592655..1593884 product PepSY-associated TM helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140346.1 transl_table 11 codon_start 1 locus_tag LOCUS_14850 CDS 1594024..1594335 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14860 CDS 1594332..1594691 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14870 CDS 1594672..1594992 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14880 note possible pseudo, internal stop codon, frameshifted CDS 1595287..1595637 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14890 CDS 1595724..1595996 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14900 note possible pseudo, internal stop codon, frameshifted CDS 1595977..1596330 product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771285.1 transl_table 11 codon_start 1 locus_tag LOCUS_14910 note possible pseudo, frameshifted CDS complement(1596621..1597550) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14920 CDS complement(1597679..1598989) product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195684.1 transl_table 11 codon_start 1 locus_tag LOCUS_14930 CDS complement(1599079..1599876) product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143164.1 transl_table 11 codon_start 1 locus_tag LOCUS_14940 CDS complement(1599975..1601675) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14950 CDS 1602022..1602525 product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005156585.1 transl_table 11 codon_start 1 locus_tag LOCUS_14960 CDS 1602663..1603814 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14970 CDS 1604145..1606679 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104229.1 transl_table 11 codon_start 1 locus_tag LOCUS_14980 CDS 1606911..1607699 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14990 CDS 1607855..1608697 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15000 CDS 1608694..1609656 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15010 CDS 1609656..1611446 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15020 CDS 1611564..1612145 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15030 CDS 1612304..1613299 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15040 CDS 1613565..1613771 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15050 CDS complement(1613793..1615007) product 2-octaprenyl-6-methoxyphenyl hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000111225.1 transl_table 11 codon_start 1 locus_tag LOCUS_15060 gene ubiH CDS complement(1615011..1616318) product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114045.1 transl_table 11 codon_start 1 locus_tag LOCUS_15070 gene pepP CDS complement(1616334..1616861) product YecA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005621372.1 transl_table 11 codon_start 1 locus_tag LOCUS_15080 CDS 1616904..1617191 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15090 CDS 1617188..1617487 product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038364.1 transl_table 11 codon_start 1 locus_tag LOCUS_15100 CDS 1617916..1619814 product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393063.1 transl_table 11 codon_start 1 locus_tag LOCUS_15110 CDS 1619837..1620673 product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943642.1 transl_table 11 codon_start 1 locus_tag LOCUS_15120 CDS 1620836..1622365 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15130 CDS complement(1622539..1622727) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15140 CDS 1622813..1623754 product DUF1152 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084641995.1 transl_table 11 codon_start 1 locus_tag LOCUS_15150 CDS complement(1624072..1625034) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15160 CDS complement(1625027..1625791) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15170 CDS complement(1625801..1626067) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15180 CDS complement(1626070..1626765) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15190 CDS complement(1626770..1626970) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15200 CDS complement(1626975..1627196) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15210 CDS complement(1627310..1628893) product nitrogenase molybdenum-iron protein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084553.1 transl_table 11 codon_start 1 locus_tag LOCUS_15220 gene nifK CDS complement(1629042..1630610) product nitrogenase molybdenum-iron protein alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084552.1 transl_table 11 codon_start 1 locus_tag LOCUS_15230 gene nifD CDS complement(1630628..1631512) product nitrogenase iron protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943447.1 transl_table 11 codon_start 1 locus_tag LOCUS_15240 gene nifH CDS 1631924..1633249 product cyclic di-GMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113015.1 transl_table 11 codon_start 1 locus_tag LOCUS_15250 CDS 1633440..1633877 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15260 CDS 1633892..1636771 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15270 CDS complement(1636758..1639832) product multidrug efflux RND transporter permease subunit MdtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815800.1 transl_table 11 codon_start 1 locus_tag LOCUS_15280 gene mdtC CDS complement(1639829..1642951) product multidrug efflux RND transporter permease subunit MuxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089920.1 transl_table 11 codon_start 1 locus_tag LOCUS_15290 gene muxB CDS complement(1642954..1644162) product MdtA/MuxA family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534674.1 transl_table 11 codon_start 1 locus_tag LOCUS_15300 CDS complement(1644277..1644552) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080314.1 transl_table 11 codon_start 1 locus_tag LOCUS_15310 CDS complement(1644614..1646077) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15320 CDS 1646774..1647997 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15330 CDS 1648043..1649239 product cyclic di-GMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113015.1 transl_table 11 codon_start 1 locus_tag LOCUS_15340 CDS complement(1649252..1650262) product lipopolysaccharide heptosyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684682.1 transl_table 11 codon_start 1 locus_tag LOCUS_15350 gene waaC CDS complement(1650266..1651345) product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958358.1 transl_table 11 codon_start 1 locus_tag LOCUS_15360 gene waaF CDS complement(1651346..1652272) product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095783.1 transl_table 11 codon_start 1 locus_tag LOCUS_15370 gene ilvE CDS 1652636..1652845 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15380 CDS complement(1652908..1654293) product DUF3526 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928739.1 transl_table 11 codon_start 1 locus_tag LOCUS_15390 CDS complement(1654290..1655702) product DUF3526 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143098.1 transl_table 11 codon_start 1 locus_tag LOCUS_15400 CDS complement(1655699..1656493) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038800.1 transl_table 11 codon_start 1 locus_tag LOCUS_15410 CDS complement(1656894..1660247) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15420 CDS complement(1660251..1660586) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15430 CDS complement(1661864..1662430) product elongation factor P-like protein YeiP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261881.1 transl_table 11 codon_start 1 locus_tag LOCUS_15440 gene yeiP CDS complement(1662434..1663156) product arginyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192823.1 transl_table 11 codon_start 1 locus_tag LOCUS_15450 CDS complement(1663153..1663845) product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405081.1 transl_table 11 codon_start 1 locus_tag LOCUS_15460 gene aat CDS complement(1663937..1664665) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025775002.1 transl_table 11 codon_start 1 locus_tag LOCUS_15470 CDS complement(1664679..1666265) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265692.1 transl_table 11 codon_start 1 locus_tag LOCUS_15480 CDS complement(1666271..1666846) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15490 CDS complement(1666852..1668309) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703178.1 transl_table 11 codon_start 1 locus_tag LOCUS_15500 CDS complement(1668637..1669113) product nitrogen fixation protein NifX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545689.1 transl_table 11 codon_start 1 locus_tag LOCUS_15510 gene nifX CDS complement(1669294..1669611) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15520 CDS complement(1670102..1670887) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15530 note possible pseudo, internal stop codon CDS complement(1670933..1672495) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15540 note possible pseudo, internal stop codon CDS complement(1672495..1673358) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15550 CDS complement(1673747..1674067) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15560 CDS complement(1674213..1675121) product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001212768.1 transl_table 11 codon_start 1 locus_tag LOCUS_15570 gene flgL CDS complement(1675131..1676798) product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930329.1 transl_table 11 codon_start 1 locus_tag LOCUS_15580 gene flgK CDS complement(1676808..1677857) product flagellar assembly peptidoglycan hydrolase FlgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112508.1 transl_table 11 codon_start 1 locus_tag LOCUS_15590 gene flgJ CDS complement(1677903..1678991) product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082169.1 transl_table 11 codon_start 1 locus_tag LOCUS_15600 CDS complement(1679014..1679718) product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082166.1 transl_table 11 codon_start 1 locus_tag LOCUS_15610 gene flgH CDS complement(1679734..1680522) product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946953.1 transl_table 11 codon_start 1 locus_tag LOCUS_15620 gene flgG CDS complement(1680574..1681317) product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082159.1 transl_table 11 codon_start 1 locus_tag LOCUS_15630 gene flgF CDS complement(1681334..1682665) product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037113.1 transl_table 11 codon_start 1 locus_tag LOCUS_15640 gene flgE CDS complement(1682679..1683359) product flagellar hook assembly protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082153.1 transl_table 11 codon_start 1 locus_tag LOCUS_15650 gene flgD CDS complement(1683367..1683783) product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706643.1 transl_table 11 codon_start 1 locus_tag LOCUS_15660 gene flgC CDS complement(1683786..1684181) product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082144.1 transl_table 11 codon_start 1 locus_tag LOCUS_15670 gene flgB CDS complement(1684360..1685226) product protein-glutamate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420407.1 transl_table 11 codon_start 1 locus_tag LOCUS_15680 CDS complement(1685265..1686197) product chemotaxis protein CheV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706646.1 transl_table 11 codon_start 1 locus_tag LOCUS_15690 CDS 1686315..1687004 product flagellar basal body P-ring formation chaperone FlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032608868.1 transl_table 11 codon_start 1 locus_tag LOCUS_15700 gene flgA CDS 1687074..1687379 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15710 CDS 1687384..1687878 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15720 CDS 1687912..1688691 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15730 tRNA 1688724..1688800 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00090 CDS 1688850..1689887 product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083692.1 transl_table 11 codon_start 1 locus_tag LOCUS_15740 CDS 1690003..1690272 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15750 CDS complement(1690417..1691166) product IS21-like element IS1326 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001163403.1 transl_table 11 codon_start 1 locus_tag LOCUS_15760 gene istB CDS complement(1691156..1691392) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15770 note possible pseudo, frameshifted CDS complement(1691335..1692729) product IS21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_128955176.1 transl_table 11 codon_start 1 locus_tag LOCUS_15780 gene istA CDS complement(1692971..1693483) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15790 CDS 1693739..1694578 product S1-like domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796486.1 transl_table 11 codon_start 1 locus_tag LOCUS_15800 CDS complement(1694641..1695096) product cytochrome P460 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941939.1 transl_table 11 codon_start 1 locus_tag LOCUS_15810 CDS complement(1695370..1695918) product formaldehyde-activating enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122249.1 transl_table 11 codon_start 1 locus_tag LOCUS_15820 gene fae CDS complement(1695970..1696626) product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978773.1 transl_table 11 codon_start 1 locus_tag LOCUS_15830 CDS complement(1696768..1697247) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15840 CDS 1697367..1697624 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15850 CDS complement(1697611..1698075) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15860 CDS complement(1698312..1698551) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15870 CDS complement(1698608..1699333) product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207530.1 transl_table 11 codon_start 1 locus_tag LOCUS_15880 CDS complement(1699338..1700924) product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535409.1 transl_table 11 codon_start 1 locus_tag LOCUS_15890 gene gshA CDS 1700974..1701168 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15900 CDS 1701165..1703297 product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091724.1 transl_table 11 codon_start 1 locus_tag LOCUS_15910 gene recQ CDS complement(1703266..1703730) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15920 CDS complement(1703733..1704137) product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880124.1 transl_table 11 codon_start 1 locus_tag LOCUS_15930 CDS complement(1704174..1704473) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15940 CDS 1704723..1705736 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15950 CDS 1705844..1706602 product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268978.1 transl_table 11 codon_start 1 locus_tag LOCUS_15960 CDS 1706694..1708511 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444571.1 transl_table 11 codon_start 1 locus_tag LOCUS_15970 CDS 1708632..1709102 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15980 CDS 1709099..1710442 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390742.1 transl_table 11 codon_start 1 locus_tag LOCUS_15990 CDS 1710430..1711917 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390741.1 transl_table 11 codon_start 1 locus_tag LOCUS_16000 CDS complement(1711985..1712485) product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971896.1 transl_table 11 codon_start 1 locus_tag LOCUS_16010 gene bcp CDS complement(1712718..1714148) product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963081.1 transl_table 11 codon_start 1 locus_tag LOCUS_16020 CDS complement(1714138..1717311) product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963080.1 transl_table 11 codon_start 1 locus_tag LOCUS_16030 CDS complement(1717333..1718418) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963079.1 transl_table 11 codon_start 1 locus_tag LOCUS_16040 CDS 1718873..1719547 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812762.1 transl_table 11 codon_start 1 locus_tag LOCUS_16050 CDS 1719540..1720937 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930991.1 transl_table 11 codon_start 1 locus_tag LOCUS_16060 CDS 1721038..1721664 product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651595.1 transl_table 11 codon_start 1 locus_tag LOCUS_16070 gene can CDS 1721835..1722788 product VacJ family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521932.1 transl_table 11 codon_start 1 locus_tag LOCUS_16080 CDS 1722906..1723262 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16090 CDS 1723319..1723744 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16100 CDS complement(1723824..1724501) product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057113.1 transl_table 11 codon_start 1 locus_tag LOCUS_16110 gene rpiA CDS complement(1724594..1725622) product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546116.1 transl_table 11 codon_start 1 locus_tag LOCUS_16120 gene lpxD CDS complement(1725631..1727859) product fused MFS/spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966435.1 transl_table 11 codon_start 1 locus_tag LOCUS_16130 CDS 1728012..1728713 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16140 CDS 1728798..1730111 product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208331.1 transl_table 11 codon_start 1 locus_tag LOCUS_16150 CDS complement(1730160..1731092) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16160 CDS complement(1731473..1731922) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16170 CDS complement(1732043..1732468) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094613.1 transl_table 11 codon_start 1 locus_tag LOCUS_16180 CDS complement(1732551..1733915) product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257389.1 transl_table 11 codon_start 1 locus_tag LOCUS_16190 CDS 1734272..1735243 product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038601.1 transl_table 11 codon_start 1 locus_tag LOCUS_16200 CDS 1735333..1737687 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16210 CDS 1737684..1739975 product type I-U CRISPR-associated protein Csx17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184045897.1 transl_table 11 codon_start 1 locus_tag LOCUS_16220 gene csx17 CDS 1740139..1741134 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16230 CDS 1741138..1742655 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16240 CDS complement(1742660..1743001) product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458809.1 transl_table 11 codon_start 1 locus_tag LOCUS_16250 CDS complement(1743001..1743381) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16260 CDS 1743356..1745080 product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940735.1 transl_table 11 codon_start 1 locus_tag LOCUS_16270 gene cas1 CDS 1745080..1745376 product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940736.1 transl_table 11 codon_start 1 locus_tag LOCUS_16280 gene cas2 repeat_region 1745586..1747069 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gcattccccggcttcccgccggggcctcattgaagc CDS 1747414..1751310 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16290 CDS complement(1751436..1751618) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16300 CDS 1751617..1752879 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16310 CDS complement(1752970..1753593) product ADP-ribose diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024943166.1 transl_table 11 codon_start 1 locus_tag LOCUS_16320 gene nudF CDS complement(1753590..1754699) product sorbosone dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940868.1 transl_table 11 codon_start 1 locus_tag LOCUS_16330 CDS 1754812..1755687 product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004397849.1 transl_table 11 codon_start 1 locus_tag LOCUS_16340 gene htpX CDS 1755697..1755957 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16350 CDS complement(1756132..1756638) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206007.1 transl_table 11 codon_start 1 locus_tag LOCUS_16360 CDS complement(1756955..1759348) product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015154897.1 transl_table 11 codon_start 1 locus_tag LOCUS_16370 CDS 1759459..1759653 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16380 CDS 1759755..1760000 product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197529995.1 transl_table 11 codon_start 1 locus_tag LOCUS_16390 CDS 1759997..1760413 product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142378.1 transl_table 11 codon_start 1 locus_tag LOCUS_16400 CDS complement(1760465..1761523) product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267457.1 transl_table 11 codon_start 1 locus_tag LOCUS_16410 CDS complement(1761572..1762093) product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797529.1 transl_table 11 codon_start 1 locus_tag LOCUS_16420 CDS complement(1762704..1763036) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16430 CDS complement(1763131..1763322) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16440 CDS complement(1763345..1764502) product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919650.1 transl_table 11 codon_start 1 locus_tag LOCUS_16450 CDS complement(1764520..1765443) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16460 CDS complement(1765449..1766900) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16470 note possible pseudo, frameshifted CDS complement(1767168..1768127) product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974566.1 transl_table 11 codon_start 1 locus_tag LOCUS_16480 CDS complement(1768245..1768769) product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114482.1 transl_table 11 codon_start 1 locus_tag LOCUS_16490 CDS complement(1769466..1769717) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16500 CDS complement(1769745..1770251) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198478.1 transl_table 11 codon_start 1 locus_tag LOCUS_16510 CDS complement(1770227..1770673) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16520 CDS complement(1771075..1773528) product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015154897.1 transl_table 11 codon_start 1 locus_tag LOCUS_16530 CDS 1774192..1774497 product BrnA antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000063142.1 transl_table 11 codon_start 1 locus_tag LOCUS_16540 CDS complement(1774543..1775508) product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070694233.1 transl_table 11 codon_start 1 locus_tag LOCUS_16550 CDS complement(1775515..1776024) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092999.1 transl_table 11 codon_start 1 locus_tag LOCUS_16560 CDS 1776428..1777720 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097074.1 transl_table 11 codon_start 1 locus_tag LOCUS_16570 CDS complement(1777877..1778086) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16580 CDS complement(1778115..1778648) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16590 CDS complement(1778725..1779372) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16600 note possible pseudo, frameshifted CDS complement(1779372..1780166) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16610 note possible pseudo, frameshifted CDS complement(1780294..1780830) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16620 CDS 1781417..1781647 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16630 CDS complement(1782831..1782980) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16640 CDS complement(1783005..1783244) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16650 CDS 1783287..1783886 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16660 CDS 1783949..1785112 product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975556.1 transl_table 11 codon_start 1 locus_tag LOCUS_16670 CDS complement(1785155..1786390) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16680 CDS complement(1786665..1788620) product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616027.1 transl_table 11 codon_start 1 locus_tag LOCUS_16690 CDS complement(1788819..1789673) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16700 CDS complement(1789689..1791827) product HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056430.1 transl_table 11 codon_start 1 locus_tag LOCUS_16710 CDS complement(1791901..1793103) product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546769.1 transl_table 11 codon_start 1 locus_tag LOCUS_16720 CDS complement(1793118..1794509) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16730 CDS complement(1794775..1795809) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706078.1 transl_table 11 codon_start 1 locus_tag LOCUS_16740 CDS complement(1795781..1799518) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16750 CDS complement(1800082..1801299) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037397.1 transl_table 11 codon_start 1 locus_tag LOCUS_16760 CDS complement(1801388..1802500) product NADH:flavin oxidoreductase/NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525764.1 transl_table 11 codon_start 1 locus_tag LOCUS_16770 CDS 1802727..1803965 product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114089.1 transl_table 11 codon_start 1 locus_tag LOCUS_16780 CDS 1803965..1804606 product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707025.1 transl_table 11 codon_start 1 locus_tag LOCUS_16790 gene nadD CDS 1804607..1804948 product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001161664.1 transl_table 11 codon_start 1 locus_tag LOCUS_16800 gene rsfS CDS 1805063..1805755 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16810 CDS 1805745..1806926 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16820 CDS complement(1806916..1807422) product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192400.1 transl_table 11 codon_start 1 locus_tag LOCUS_16830 CDS complement(1807446..1807610) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16840 CDS complement(1807738..1808433) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16850 CDS 1809200..1809907 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16860 CDS 1810192..1812009 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16870 CDS 1812470..1813237 product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142041.1 transl_table 11 codon_start 1 locus_tag LOCUS_16880 CDS complement(1813248..1814429) product molybdenum ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394039.1 transl_table 11 codon_start 1 locus_tag LOCUS_16890 gene modC CDS complement(1814485..1814913) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16900 CDS complement(1814970..1815740) product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113613.1 transl_table 11 codon_start 1 locus_tag LOCUS_16910 gene modA CDS complement(1815767..1817179) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16920 CDS complement(1817595..1818389) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927097.1 transl_table 11 codon_start 1 locus_tag LOCUS_16930 CDS complement(1818416..1826254) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16940 CDS complement(1826248..1828767) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16950 CDS 1829129..1829983 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16960 CDS 1830016..1831644 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16970 CDS 1831884..1832936 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16980 CDS 1832958..1833482 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16990 CDS 1833522..1835411 product DUF2341 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112717.1 transl_table 11 codon_start 1 locus_tag LOCUS_17000 CDS 1835415..1835819 product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085366.1 transl_table 11 codon_start 1 locus_tag LOCUS_17010 CDS 1835880..1836554 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17020 CDS 1836663..1838525 product putative porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112715.1 transl_table 11 codon_start 1 locus_tag LOCUS_17030 CDS 1838535..1839284 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17040 CDS 1839281..1840933 product ShlB/FhaC/HecB family hemolysin secretion/activation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112718.1 transl_table 11 codon_start 1 locus_tag LOCUS_17050 CDS 1841069..1841473 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17060 CDS 1841466..1842281 product TOBE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943595.1 transl_table 11 codon_start 1 locus_tag LOCUS_17070 CDS 1842451..1843110 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17080 CDS 1843147..1843455 product thiosulfate sulfurtransferase GlpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262814.1 transl_table 11 codon_start 1 locus_tag LOCUS_17090 gene glpE CDS 1843466..1844173 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17100 CDS complement(1844276..1844923) product DUF2959 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456820.1 transl_table 11 codon_start 1 locus_tag LOCUS_17110 CDS 1845304..1845465 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17120 CDS complement(1845694..1846950) product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104507.1 transl_table 11 codon_start 1 locus_tag LOCUS_17130 CDS 1847093..1848067 product acetyl-CoA carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349878.1 transl_table 11 codon_start 1 locus_tag LOCUS_17140 gene accA CDS 1848134..1849462 product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816961.1 transl_table 11 codon_start 1 locus_tag LOCUS_17150 gene tilS CDS 1849494..1849688 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17160 CDS 1849691..1849888 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17170 CDS 1849902..1851374 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17180 CDS 1851618..1853255 product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092366.1 transl_table 11 codon_start 1 locus_tag LOCUS_17190 CDS 1853268..1854101 product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946916.1 transl_table 11 codon_start 1 locus_tag LOCUS_17200 gene kdsA CDS 1854111..1855394 product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192585.1 transl_table 11 codon_start 1 locus_tag LOCUS_17210 gene eno CDS 1855520..1855735 product cell division protein FtsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377835.1 transl_table 11 codon_start 1 locus_tag LOCUS_17220 gene ftsB CDS 1855739..1856434 product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262540.1 transl_table 11 codon_start 1 locus_tag LOCUS_17230 gene ispD CDS 1856431..1856904 product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098560.1 transl_table 11 codon_start 1 locus_tag LOCUS_17240 gene ispF CDS 1857091..1857357 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17250 note possible pseudo, frameshifted CDS 1857378..1858133 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17260 note possible pseudo, frameshifted CDS complement(1858161..1858943) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17270 note possible pseudo, internal stop codon CDS complement(1858956..1859432) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17280 note possible pseudo, internal stop codon CDS 1859690..1860181 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17290 CDS 1860181..1860534 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17300 CDS complement(1860658..1863633) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17310 CDS complement(1863737..1870666) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17320 CDS complement(1870754..1876579) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17330 note possible pseudo, internal stop codon CDS 1876950..1877816 product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545798.1 transl_table 11 codon_start 1 locus_tag LOCUS_17340 CDS 1877823..1878713 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17350 CDS 1878703..1880451 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17360 CDS 1880473..1882617 product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122785.1 transl_table 11 codon_start 1 locus_tag LOCUS_17370 CDS 1882610..1884607 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17380 CDS 1884694..1885581 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17390 CDS 1885925..1886116 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17400 CDS complement(1886241..1888130) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17410 CDS complement(1888193..1888543) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17420 CDS 1888467..1888676 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17430 CDS complement(1888755..1889729) product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119196.1 transl_table 11 codon_start 1 locus_tag LOCUS_17440 gene lipA CDS complement(1889796..1890416) product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261452.1 transl_table 11 codon_start 1 locus_tag LOCUS_17450 gene lipB CDS complement(1890426..1890692) product YbeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002237935.1 transl_table 11 codon_start 1 locus_tag LOCUS_17460 CDS complement(1890689..1891528) product D-amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929622.1 transl_table 11 codon_start 1 locus_tag LOCUS_17470 CDS complement(1891525..1892688) product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555330.1 transl_table 11 codon_start 1 locus_tag LOCUS_17480 CDS complement(1892832..1893464) product HTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805063.1 transl_table 11 codon_start 1 locus_tag LOCUS_17490 CDS 1893662..1894042 product group 1 truncated hemoglobin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947457.1 transl_table 11 codon_start 1 locus_tag LOCUS_17500 CDS 1894059..1895045 product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948238.1 transl_table 11 codon_start 1 locus_tag LOCUS_17510 CDS complement(1895018..1895950) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098205.1 transl_table 11 codon_start 1 locus_tag LOCUS_17520 CDS 1896015..1896902 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17530 CDS 1896922..1898502 product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524545.1 transl_table 11 codon_start 1 locus_tag LOCUS_17540 CDS 1898502..1899947 product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112617.1 transl_table 11 codon_start 1 locus_tag LOCUS_17550 CDS 1899944..1901116 product multidrug efflux MFS transporter periplasmic adaptor subunit EmrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208745.1 transl_table 11 codon_start 1 locus_tag LOCUS_17560 gene emrA CDS 1901285..1902019 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17570 CDS complement(1902055..1902936) product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120323.1 transl_table 11 codon_start 1 locus_tag LOCUS_17580 CDS 1903152..1904585 product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391137.1 transl_table 11 codon_start 1 locus_tag LOCUS_17590 CDS 1904579..1905523 product alpha-E domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391136.1 transl_table 11 codon_start 1 locus_tag LOCUS_17600 CDS 1905618..1906871 product lpg1639 family Dot/Icm T4SS effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947366.1 transl_table 11 codon_start 1 locus_tag LOCUS_17610 CDS 1906868..1910179 product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266501.1 transl_table 11 codon_start 1 locus_tag LOCUS_17620 CDS 1910456..1911115 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17630 CDS complement(1911189..1912565) product PEP-CTERM-box response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390852.1 transl_table 11 codon_start 1 locus_tag LOCUS_17640 gene prsR CDS complement(1912552..1913922) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17650 CDS 1914749..1915222 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17660 CDS 1915255..1915992 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17670 CDS 1916169..1918472 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17680 CDS 1918599..1919168 product polysaccharide export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390865.1 transl_table 11 codon_start 1 locus_tag LOCUS_17690 CDS 1919245..1920792 product Wzz/FepE/Etk N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390866.1 transl_table 11 codon_start 1 locus_tag LOCUS_17700 CDS 1920816..1921715 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17710 CDS 1921702..1923372 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17720 CDS 1923384..1924418 product XrtA-associated ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390863.1 transl_table 11 codon_start 1 locus_tag LOCUS_17730 CDS 1924421..1925548 product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582948.1 transl_table 11 codon_start 1 locus_tag LOCUS_17740 gene wecB CDS 1925555..1926418 product DUF3473 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390862.1 transl_table 11 codon_start 1 locus_tag LOCUS_17750 CDS 1926425..1927444 product FemAB family PEP-CTERM system-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390861.1 transl_table 11 codon_start 1 locus_tag LOCUS_17760 CDS 1927444..1928649 product TIGR03087 family PEP-CTERM/XrtA system glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390853.1 transl_table 11 codon_start 1 locus_tag LOCUS_17770 CDS 1928650..1929786 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081188.1 transl_table 11 codon_start 1 locus_tag LOCUS_17780 CDS 1929807..1931690 product amidotransferase 1, exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390869.1 transl_table 11 codon_start 1 locus_tag LOCUS_17790 CDS 1931797..1932585 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17800 CDS 1932589..1932858 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17810 CDS 1933605..1933769 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17820 CDS 1933781..1934857 product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390849.1 transl_table 11 codon_start 1 locus_tag LOCUS_17830 CDS 1934922..1936139 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17840 CDS 1936219..1937334 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390844.1 transl_table 11 codon_start 1 locus_tag LOCUS_17850 CDS 1937331..1938680 product phenylacetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942599.1 transl_table 11 codon_start 1 locus_tag LOCUS_17860 CDS 1938716..1940479 product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119978.1 transl_table 11 codon_start 1 locus_tag LOCUS_17870 gene asnB CDS 1940741..1941211 product pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038214.1 transl_table 11 codon_start 1 locus_tag LOCUS_17880 CDS 1941286..1943346 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17890 CDS 1943458..1946904 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104711.1 transl_table 11 codon_start 1 locus_tag LOCUS_17900 CDS complement(1946949..1947329) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17910 CDS complement(1947433..1949709) product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100071.1 transl_table 11 codon_start 1 locus_tag LOCUS_17920 CDS complement(1949861..1950058) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17930 CDS 1951133..1951537 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17940 CDS complement(1951617..1952900) product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175672.1 transl_table 11 codon_start 1 locus_tag LOCUS_17950 gene purD CDS complement(1952917..1954497) product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210692.1 transl_table 11 codon_start 1 locus_tag LOCUS_17960 gene purH CDS complement(1954535..1954798) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946289.1 transl_table 11 codon_start 1 locus_tag LOCUS_17970 CDS complement(1954799..1955728) product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035999.1 transl_table 11 codon_start 1 locus_tag LOCUS_17980 gene dusB CDS 1956059..1956682 product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046849124.1 transl_table 11 codon_start 1 locus_tag LOCUS_17990 gene cysC CDS 1956684..1957637 product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456983.1 transl_table 11 codon_start 1 locus_tag LOCUS_18000 CDS 1958133..1960046 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18010 CDS 1960181..1960621 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18020 CDS complement(1961101..1961895) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18030 CDS complement(1962106..1962858) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18040 CDS complement(1963229..1963423) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18050 CDS complement(1963482..1964264) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18060 note possible pseudo, internal stop codon CDS complement(1964277..1964753) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18070 note possible pseudo, internal stop codon CDS 1965018..1966625 product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390860.1 transl_table 11 codon_start 1 locus_tag LOCUS_18080 CDS 1966747..1967223 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18090 note possible pseudo, internal stop codon CDS 1967236..1968018 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18100 note possible pseudo, internal stop codon CDS complement(1968101..1968709) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18110 CDS 1968771..1968965 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18120 CDS complement(1969168..1970556) product TIGR03013 family PEP-CTERM/XrtA system glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390850.1 transl_table 11 codon_start 1 locus_tag LOCUS_18130 CDS complement(1970587..1971363) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18140 CDS complement(1971707..1972441) product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000212239.1 transl_table 11 codon_start 1 locus_tag LOCUS_18150 gene lpxH CDS complement(1972482..1973063) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019248574.1 transl_table 11 codon_start 1 locus_tag LOCUS_18160 CDS 1973178..1974587 product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113587.1 transl_table 11 codon_start 1 locus_tag LOCUS_18170 gene cysS CDS 1974596..1975225 product cyclodeaminase/cyclohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259121.1 transl_table 11 codon_start 1 locus_tag LOCUS_18180 CDS complement(1975295..1976821) product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880089.1 transl_table 11 codon_start 1 locus_tag LOCUS_18190 CDS complement(1976814..1978451) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18200 CDS 1978699..1979307 product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005302262.1 transl_table 11 codon_start 1 locus_tag LOCUS_18210 gene rsxA CDS 1979318..1979851 product electron transport complex subunit RsxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418571.1 transl_table 11 codon_start 1 locus_tag LOCUS_18220 gene rsxB CDS 1979865..1981367 product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339117.1 transl_table 11 codon_start 1 locus_tag LOCUS_18230 gene rsxC CDS 1981364..1982425 product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339118.1 transl_table 11 codon_start 1 locus_tag LOCUS_18240 CDS 1982434..1983174 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18250 CDS 1983496..1984206 product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_119632344.1 transl_table 11 codon_start 1 locus_tag LOCUS_18260 CDS 1984210..1984473 product RnfH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723777.1 transl_table 11 codon_start 1 locus_tag LOCUS_18270 CDS 1984477..1984698 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18280 CDS 1984700..1985164 product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005395745.1 transl_table 11 codon_start 1 locus_tag LOCUS_18290 gene bfr CDS 1985637..1986941 product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038711081.1 transl_table 11 codon_start 1 locus_tag LOCUS_18300 CDS 1986956..1987882 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18310 CDS complement(1987951..1988742) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006788385.1 transl_table 11 codon_start 1 locus_tag LOCUS_18320 CDS complement(1988834..1989496) product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260948.1 transl_table 11 codon_start 1 locus_tag LOCUS_18330 CDS complement(1989484..1991103) product b(o/a)3-type cytochrome-c oxidase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536008.1 transl_table 11 codon_start 1 locus_tag LOCUS_18340 CDS complement(1991096..1991620) product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087253.1 transl_table 11 codon_start 1 locus_tag LOCUS_18350 CDS complement(1991630..1991782) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18360 CDS 1992226..1992558 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18370 CDS 1993057..1993539 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18380 CDS complement(1993595..1994434) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18390 CDS 1995021..1995605 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18400 CDS 1995686..1998949 product chemotaxis protein CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021984.1 transl_table 11 codon_start 1 locus_tag LOCUS_18410 CDS complement(1998968..1999573) product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074308.1 transl_table 11 codon_start 1 locus_tag LOCUS_18420 gene mobA CDS 1999591..2000049 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18430 CDS 2000082..2000477 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966733.1 transl_table 11 codon_start 1 locus_tag LOCUS_18440 CDS 2000593..2001120 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18450 CDS 2001151..2002908 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18460 CDS complement(2002844..2003479) product alpha-ketoglutarate-dependent dioxygenase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479964.1 transl_table 11 codon_start 1 locus_tag LOCUS_18470 CDS complement(2003550..2005211) product putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707241.1 transl_table 11 codon_start 1 locus_tag LOCUS_18480 CDS 2005347..2005913 product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102831.1 transl_table 11 codon_start 1 locus_tag LOCUS_18490 CDS complement(2005965..2006153) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18500 CDS 2006071..2008809 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18510 CDS complement(2008832..2009347) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18520 CDS complement(2009788..2010873) product IS110-like element ISPa11 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147159.1 transl_table 11 codon_start 1 locus_tag LOCUS_18530 CDS complement(2010852..2011229) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18540 CDS complement(2011232..2012710) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18550 CDS complement(2012712..2013395) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393381.1 transl_table 11 codon_start 1 locus_tag LOCUS_18560 CDS 2013575..2014015 product Spy/CpxP family protein refolding chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925933.1 transl_table 11 codon_start 1 locus_tag LOCUS_18570 CDS 2014260..2015393 product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706536.1 transl_table 11 codon_start 1 locus_tag LOCUS_18580 gene carA CDS 2015411..2018626 product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007243709.1 transl_table 11 codon_start 1 locus_tag LOCUS_18590 gene carB CDS 2018660..2019136 product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_128178593.1 transl_table 11 codon_start 1 locus_tag LOCUS_18600 gene greA CDS complement(2019176..2019442) product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095204.1 transl_table 11 codon_start 1 locus_tag LOCUS_18610 gene yhbY CDS 2019493..2020110 product 23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095202.1 transl_table 11 codon_start 1 locus_tag LOCUS_18620 gene rlmE CDS 2020231..2022150 product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707080.1 transl_table 11 codon_start 1 locus_tag LOCUS_18630 gene ftsH CDS 2022222..2023562 product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707078.1 transl_table 11 codon_start 1 locus_tag LOCUS_18640 gene glmM CDS 2023617..2024363 product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071430.1 transl_table 11 codon_start 1 locus_tag LOCUS_18650 gene tpiA CDS 2024385..2024786 product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185627.1 transl_table 11 codon_start 1 locus_tag LOCUS_18660 gene secG tRNA 2024803..2024887 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00100 CDS 2025050..2026246 product integrase arm-type DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530181.1 transl_table 11 codon_start 1 locus_tag LOCUS_18670 CDS 2026358..2027239 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18680 CDS 2027330..2027572 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18690 CDS 2027856..2028104 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18700 CDS 2028344..2028811 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18710 CDS 2028824..2029948 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18720 CDS 2030108..2030365 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18730 CDS 2030488..2032281 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18740 CDS 2032282..2034915 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18750 CDS 2034915..2035823 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18760 CDS 2036504..2037346 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18770 note possible pseudo, frameshifted CDS complement(2037470..2040790) product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583655.1 transl_table 11 codon_start 1 locus_tag LOCUS_18780 CDS complement(2040802..2041002) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18790 CDS complement(2040999..2041535) product zeta toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766449.1 transl_table 11 codon_start 1 locus_tag LOCUS_18800 CDS complement(2041539..2044787) product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583653.1 transl_table 11 codon_start 1 locus_tag LOCUS_18810 sequence2 source 1..1747170 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 647..1183 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18820 CDS 1684..2328 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18830 note possible pseudo, frameshifted CDS 2343..3047 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18840 note possible pseudo, frameshifted CDS complement(3088..3276) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18850 CDS 3688..4167 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18860 CDS 4231..4473 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18870 CDS complement(4842..5825) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18880 CDS 6263..6556 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18890 CDS 6582..7154 product flagellar transcriptional regulator FlhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811929.1 transl_table 11 codon_start 1 locus_tag LOCUS_18900 gene flhC CDS 7187..7780 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18910 CDS 7793..8257 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18920 CDS 8302..8643 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18930 CDS 8676..9542 product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087144570.1 transl_table 11 codon_start 1 locus_tag LOCUS_18940 tRNA complement(9569..9645) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00110 CDS complement(9716..10069) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090655.1 transl_table 11 codon_start 1 locus_tag LOCUS_18950 CDS complement(10053..10349) product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090661.1 transl_table 11 codon_start 1 locus_tag LOCUS_18960 gene ihfA CDS complement(10352..12727) product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705112.1 transl_table 11 codon_start 1 locus_tag LOCUS_18970 gene pheT CDS complement(12743..13762) product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003367019.1 transl_table 11 codon_start 1 locus_tag LOCUS_18980 gene pheS CDS complement(13904..14266) product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770935.1 transl_table 11 codon_start 1 locus_tag LOCUS_18990 gene rplT CDS complement(14296..14493) product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001885060.1 transl_table 11 codon_start 1 locus_tag LOCUS_19000 gene rpmI CDS complement(14654..15043) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19010 CDS complement(15201..17108) product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267470.1 transl_table 11 codon_start 1 locus_tag LOCUS_19020 gene thrS tRNA complement(17157..17233) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00120 CDS complement(17322..18089) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19030 CDS complement(18481..19395) product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704273.1 transl_table 11 codon_start 1 locus_tag LOCUS_19040 gene hemF CDS 19661..20128 product ProQ/FinO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205535.1 transl_table 11 codon_start 1 locus_tag LOCUS_19050 CDS 20651..21397 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19060 CDS 21531..22274 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19070 CDS 22362..22958 product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965738.1 transl_table 11 codon_start 1 locus_tag LOCUS_19080 CDS 22963..23670 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19090 CDS 23677..24918 product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036840.1 transl_table 11 codon_start 1 locus_tag LOCUS_19100 CDS complement(24915..26057) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972423.1 transl_table 11 codon_start 1 locus_tag LOCUS_19110 CDS complement(26071..27591) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19120 CDS complement(27618..28445) product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061519.1 transl_table 11 codon_start 1 locus_tag LOCUS_19130 CDS complement(28435..29646) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141066.1 transl_table 11 codon_start 1 locus_tag LOCUS_19140 CDS complement(29643..31445) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141069.1 transl_table 11 codon_start 1 locus_tag LOCUS_19150 CDS complement(31466..32743) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19160 CDS complement(32740..33384) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19170 CDS complement(33371..34699) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19180 CDS complement(34696..36828) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19190 CDS complement(36829..38838) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19200 CDS complement(38813..40168) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992353.1 transl_table 11 codon_start 1 locus_tag LOCUS_19210 CDS complement(40235..41491) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928673.1 transl_table 11 codon_start 1 locus_tag LOCUS_19220 CDS 41965..42222 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19230 CDS 42289..42696 product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971139.1 transl_table 11 codon_start 1 locus_tag LOCUS_19240 CDS 42672..43022 product IS66 family insertion sequence element accessory protein TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971138.1 transl_table 11 codon_start 1 locus_tag LOCUS_19250 gene tnpB CDS 43054..43524 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19260 CDS complement(43546..44271) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19270 note possible pseudo, frameshifted CDS complement(44292..44558) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19280 note possible pseudo, frameshifted CDS complement(44623..45312) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096987.1 transl_table 11 codon_start 1 locus_tag LOCUS_19290 CDS complement(45414..47564) product adenosylcobalamin-dependent ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704810.1 transl_table 11 codon_start 1 locus_tag LOCUS_19300 tRNA complement(48263..48338) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00130 CDS 48815..49852 product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072122.1 transl_table 11 codon_start 1 locus_tag LOCUS_19310 CDS complement(49867..51096) product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207754.1 transl_table 11 codon_start 1 locus_tag LOCUS_19320 CDS 51263..51757 product YchJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026612345.1 transl_table 11 codon_start 1 locus_tag LOCUS_19330 CDS complement(51784..52251) product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703791.1 transl_table 11 codon_start 1 locus_tag LOCUS_19340 gene trmL CDS complement(52256..54760) product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022951227.1 transl_table 11 codon_start 1 locus_tag LOCUS_19350 CDS complement(54899..57652) product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073892.1 transl_table 11 codon_start 1 locus_tag LOCUS_19360 gene secA CDS 57950..59305 product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166392.1 transl_table 11 codon_start 1 locus_tag LOCUS_19370 gene trkA CDS complement(59302..59844) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19380 CDS complement(59831..60316) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19390 CDS complement(60370..60744) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19400 CDS complement(60788..61570) product hydroxypyruvate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087181.1 transl_table 11 codon_start 1 locus_tag LOCUS_19410 gene hyi CDS complement(61570..62448) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113156.1 transl_table 11 codon_start 1 locus_tag LOCUS_19420 CDS complement(62463..62957) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19430 CDS complement(63107..63595) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19440 CDS complement(63595..64044) product FMN-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880804.1 transl_table 11 codon_start 1 locus_tag LOCUS_19450 CDS complement(64310..65743) product FlxA-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930692.1 transl_table 11 codon_start 1 locus_tag LOCUS_19460 CDS complement(65873..66130) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19470 CDS complement(66138..66419) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19480 CDS complement(66443..66883) product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921194.1 transl_table 11 codon_start 1 locus_tag LOCUS_19490 gene rnhA CDS complement(66876..67598) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19500 CDS 67684..69282 product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072517.1 transl_table 11 codon_start 1 locus_tag LOCUS_19510 tRNA complement(69544..69619) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00140 tRNA complement(69685..69760) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00150 tRNA complement(69784..69859) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00160 CDS complement(69901..71307) product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707206.1 transl_table 11 codon_start 1 locus_tag LOCUS_19520 gene gltX CDS complement(71314..71757) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19530 CDS 71926..73110 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19540 CDS complement(73937..74533) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19550 note possible pseudo, frameshifted CDS complement(74452..74934) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19560 CDS complement(75221..76567) product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_114714636.1 transl_table 11 codon_start 1 locus_tag LOCUS_19570 CDS 76919..77239 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19580 CDS complement(77438..80926) product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705106.1 transl_table 11 codon_start 1 locus_tag LOCUS_19590 gene dnaE CDS complement(80933..81523) product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693388.1 transl_table 11 codon_start 1 locus_tag LOCUS_19600 gene rnhB CDS complement(81498..82268) product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092373.1 transl_table 11 codon_start 1 locus_tag LOCUS_19610 gene lpxA CDS complement(82269..82718) product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173178.1 transl_table 11 codon_start 1 locus_tag LOCUS_19620 gene fabZ CDS complement(82825..83337) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19630 CDS complement(83409..85757) product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092382.1 transl_table 11 codon_start 1 locus_tag LOCUS_19640 gene bamA CDS complement(85949..87247) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069810832.1 transl_table 11 codon_start 1 locus_tag LOCUS_19650 CDS complement(87247..87543) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19660 CDS complement(87549..88292) product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704663.1 transl_table 11 codon_start 1 locus_tag LOCUS_19670 gene rlmB CDS complement(88289..90613) product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105236.1 transl_table 11 codon_start 1 locus_tag LOCUS_19680 gene rnr CDS complement(90676..92268) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19690 CDS complement(92379..92702) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19700 CDS complement(92775..93221) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19710 CDS complement(93315..96257) product DUF748 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766460.1 transl_table 11 codon_start 1 locus_tag LOCUS_19720 CDS complement(96280..98070) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19730 CDS complement(98305..98703) product ribosome-associated heat shock protein Hsp15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819274.1 transl_table 11 codon_start 1 locus_tag LOCUS_19740 gene hslR CDS complement(98696..99052) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19750 CDS complement(99078..100034) product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116992.1 transl_table 11 codon_start 1 locus_tag LOCUS_19760 gene ispH CDS complement(100072..100557) product ribonuclease E activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267431.1 transl_table 11 codon_start 1 locus_tag LOCUS_19770 gene rraA CDS complement(100572..101882) product tRNA 5-hydroxyuridine modification protein YegQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222142.1 transl_table 11 codon_start 1 locus_tag LOCUS_19780 gene yegQ CDS complement(102041..102811) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_102484484.1 transl_table 11 codon_start 1 locus_tag LOCUS_19790 CDS complement(102948..103979) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19800 CDS complement(103987..105288) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004545573.1 transl_table 11 codon_start 1 locus_tag LOCUS_19810 CDS complement(105360..106373) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19820 CDS complement(106414..106854) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19830 CDS complement(108819..109118) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19840 CDS complement(109254..110084) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_114948346.1 transl_table 11 codon_start 1 locus_tag LOCUS_19850 CDS complement(110081..111001) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232632.1 transl_table 11 codon_start 1 locus_tag LOCUS_19860 CDS complement(111001..111747) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096017.1 transl_table 11 codon_start 1 locus_tag LOCUS_19870 CDS complement(111755..112294) product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838745.1 transl_table 11 codon_start 1 locus_tag LOCUS_19880 CDS complement(112416..113366) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096015.1 transl_table 11 codon_start 1 locus_tag LOCUS_19890 CDS complement(113386..114348) product glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028028148.1 transl_table 11 codon_start 1 locus_tag LOCUS_19900 CDS complement(114673..115392) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223106389.1 transl_table 11 codon_start 1 locus_tag LOCUS_19910 CDS complement(115458..116312) product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965995.1 transl_table 11 codon_start 1 locus_tag LOCUS_19920 CDS complement(116313..117005) product WbqC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096013.1 transl_table 11 codon_start 1 locus_tag LOCUS_19930 CDS complement(117064..118173) product dTDP-4-amino-4,6-dideoxy-D-glucose aminotransferase VioA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198210.1 transl_table 11 codon_start 1 locus_tag LOCUS_19940 gene vioA CDS complement(118443..119096) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19950 CDS complement(120397..120822) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19960 CDS complement(120806..121747) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948087.1 transl_table 11 codon_start 1 locus_tag LOCUS_19970 CDS complement(121759..123540) product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094808.1 transl_table 11 codon_start 1 locus_tag LOCUS_19980 gene ilvB CDS complement(123556..124869) product lipopolysaccharide biosynthesis protein RfbH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000126347.1 transl_table 11 codon_start 1 locus_tag LOCUS_19990 gene rfbH CDS complement(124895..125977) product CDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261039.1 transl_table 11 codon_start 1 locus_tag LOCUS_20000 gene rfbG CDS complement(125971..126738) product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816873.1 transl_table 11 codon_start 1 locus_tag LOCUS_20010 gene rfbF CDS complement(126771..127772) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20020 CDS complement(127772..128848) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20030 CDS complement(128832..129536) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026183471.1 transl_table 11 codon_start 1 locus_tag LOCUS_20040 CDS complement(129538..130320) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20050 CDS complement(130437..130976) product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771397.1 transl_table 11 codon_start 1 locus_tag LOCUS_20060 gene rfbC CDS complement(130976..131860) product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706707.1 transl_table 11 codon_start 1 locus_tag LOCUS_20070 gene rfbA CDS complement(131863..132759) product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001023610.1 transl_table 11 codon_start 1 locus_tag LOCUS_20080 gene rfbD CDS complement(132784..133854) product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096179.1 transl_table 11 codon_start 1 locus_tag LOCUS_20090 gene rfbB CDS complement(133965..134648) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268467.1 transl_table 11 codon_start 1 locus_tag LOCUS_20100 CDS complement(134653..136281) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268468.1 transl_table 11 codon_start 1 locus_tag LOCUS_20110 CDS 136408..138342 product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087446.1 transl_table 11 codon_start 1 locus_tag LOCUS_20120 gene htpG CDS 138470..139339 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20130 CDS 139820..140701 product NAD(+) kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091343.1 transl_table 11 codon_start 1 locus_tag LOCUS_20140 CDS 140706..142388 product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418848.1 transl_table 11 codon_start 1 locus_tag LOCUS_20150 gene recN CDS complement(142385..142588) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20160 CDS complement(142537..143883) product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_114714636.1 transl_table 11 codon_start 1 locus_tag LOCUS_20170 CDS complement(144003..144830) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813145.1 transl_table 11 codon_start 1 locus_tag LOCUS_20180 CDS complement(145039..146646) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001088888.1 transl_table 11 codon_start 1 locus_tag LOCUS_20190 CDS 146970..149483 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20200 CDS 149480..150868 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20210 CDS 151554..152420 product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690326.1 transl_table 11 codon_start 1 locus_tag LOCUS_20220 CDS complement(152417..153334) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20230 CDS complement(153339..154415) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20240 CDS 154431..154670 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20250 CDS complement(155329..155685) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20260 CDS complement(155723..156175) product TerB family tellurite resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012534145.1 transl_table 11 codon_start 1 locus_tag LOCUS_20270 CDS complement(156890..157780) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036906.1 transl_table 11 codon_start 1 locus_tag LOCUS_20280 CDS 157946..158665 product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766806.1 transl_table 11 codon_start 1 locus_tag LOCUS_20290 CDS 158672..159250 product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368006.1 transl_table 11 codon_start 1 locus_tag LOCUS_20300 CDS 159362..160186 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20310 CDS 160416..161081 product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704554.1 transl_table 11 codon_start 1 locus_tag LOCUS_20320 CDS 161139..163016 product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704555.1 transl_table 11 codon_start 1 locus_tag LOCUS_20330 CDS 163061..164419 product alginate export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235045022.1 transl_table 11 codon_start 1 locus_tag LOCUS_20340 CDS 164513..165934 product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057573.1 transl_table 11 codon_start 1 locus_tag LOCUS_20350 CDS complement(165912..166136) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20360 CDS complement(166313..166600) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20370 note possible pseudo, internal stop codon, frameshifted CDS complement(166762..168309) product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228222.1 transl_table 11 codon_start 1 locus_tag LOCUS_20380 CDS 168561..169688 product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113995.1 transl_table 11 codon_start 1 locus_tag LOCUS_20390 CDS 170303..170959 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20400 CDS 171476..173284 product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185359.1 transl_table 11 codon_start 1 locus_tag LOCUS_20410 gene kdpA CDS 173304..175376 product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522436.1 transl_table 11 codon_start 1 locus_tag LOCUS_20420 gene kdpB CDS 175387..175977 product potassium-transporting ATPase subunit KdpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186443.1 transl_table 11 codon_start 1 locus_tag LOCUS_20430 gene kdpC CDS 175974..178712 product DUF4118 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526440.1 transl_table 11 codon_start 1 locus_tag LOCUS_20440 CDS 178737..179435 product two-component system response regulator KdpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185947.1 transl_table 11 codon_start 1 locus_tag LOCUS_20450 gene kdpE CDS complement(179476..180363) product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105929.1 transl_table 11 codon_start 1 locus_tag LOCUS_20460 CDS complement(180531..181079) product putative Fe-S cluster assembly protein SufT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770997.1 transl_table 11 codon_start 1 locus_tag LOCUS_20470 gene sufT CDS complement(181087..181815) product YciK family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208030.1 transl_table 11 codon_start 1 locus_tag LOCUS_20480 CDS complement(181806..182477) product N-acetylmuramic acid 6-phosphate phosphatase MupP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268565.1 transl_table 11 codon_start 1 locus_tag LOCUS_20490 gene mupP CDS complement(182484..183191) product bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532296.1 transl_table 11 codon_start 1 locus_tag LOCUS_20500 CDS complement(183334..184656) product TRZ/ATZ family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014507955.1 transl_table 11 codon_start 1 locus_tag LOCUS_20510 CDS 184755..185090 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20520 CDS 185247..186284 product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404235.1 transl_table 11 codon_start 1 locus_tag LOCUS_20530 gene mtnA CDS 186278..187027 product sulfate transporter CysZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408742.1 transl_table 11 codon_start 1 locus_tag LOCUS_20540 gene cysZ CDS complement(187067..188413) product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_114714636.1 transl_table 11 codon_start 1 locus_tag LOCUS_20550 CDS complement(189904..190332) product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461281.1 transl_table 11 codon_start 1 locus_tag LOCUS_20560 CDS 190566..191042 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20570 note possible pseudo, internal stop codon CDS 191055..191837 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20580 note possible pseudo, internal stop codon CDS complement(191990..192373) product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204255.1 transl_table 11 codon_start 1 locus_tag LOCUS_20590 note possible pseudo, internal stop codon, frameshifted CDS complement(192377..193255) product YgcG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189948.1 transl_table 11 codon_start 1 locus_tag LOCUS_20600 CDS complement(193257..193847) product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090002.1 transl_table 11 codon_start 1 locus_tag LOCUS_20610 CDS complement(193925..194527) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072123.1 transl_table 11 codon_start 1 locus_tag LOCUS_20620 CDS 194578..195714 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114811.1 transl_table 11 codon_start 1 locus_tag LOCUS_20630 CDS complement(195727..195939) product DksA/TraR family C4-type zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367587.1 transl_table 11 codon_start 1 locus_tag LOCUS_20640 CDS complement(195972..197591) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20650 CDS complement(197725..199821) product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769676.1 transl_table 11 codon_start 1 locus_tag LOCUS_20660 gene uvrB CDS complement(199855..201078) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399360.1 transl_table 11 codon_start 1 locus_tag LOCUS_20670 CDS 201217..201606 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20680 CDS 201619..202446 product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143074.1 transl_table 11 codon_start 1 locus_tag LOCUS_20690 CDS 203108..204040 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20700 CDS 204073..204738 product tail fiber protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070581.1 transl_table 11 codon_start 1 locus_tag LOCUS_20710 CDS complement(204902..205246) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20720 CDS complement(205332..207461) product peptidase domain-containing ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004545619.1 transl_table 11 codon_start 1 locus_tag LOCUS_20730 CDS complement(207464..208711) product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093492.1 transl_table 11 codon_start 1 locus_tag LOCUS_20740 CDS complement(208757..209191) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20750 CDS complement(209199..209474) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20760 CDS complement(209517..209699) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20770 CDS 210474..213758 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20780 tRNA complement(211544..211630) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00170 CDS 213984..214649 product cAMP-activated global transcriptional regulator CRP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897584.1 transl_table 11 codon_start 1 locus_tag LOCUS_20790 gene crp CDS 214802..218242 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20800 CDS 218291..218770 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20810 CDS 218987..221140 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20820 CDS complement(221216..221812) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20830 CDS complement(221839..222831) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20840 CDS complement(222828..223619) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390199.1 transl_table 11 codon_start 1 locus_tag LOCUS_20850 CDS complement(223622..224785) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403123.1 transl_table 11 codon_start 1 locus_tag LOCUS_20860 CDS complement(224957..225952) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706078.1 transl_table 11 codon_start 1 locus_tag LOCUS_20870 CDS complement(225960..230657) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20880 CDS complement(230650..230919) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20890 CDS complement(231122..231583) product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114685.1 transl_table 11 codon_start 1 locus_tag LOCUS_20900 gene ssb CDS complement(231620..233029) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103910.1 transl_table 11 codon_start 1 locus_tag LOCUS_20910 CDS 233168..235984 product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000357696.1 transl_table 11 codon_start 1 locus_tag LOCUS_20920 gene uvrA CDS 236051..236644 product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050754228.1 transl_table 11 codon_start 1 locus_tag LOCUS_20930 CDS 236870..237100 product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_182307811.1 transl_table 11 codon_start 1 locus_tag LOCUS_20940 CDS 237100..237513 product type II toxin-antitoxin system toxin VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970128.1 transl_table 11 codon_start 1 locus_tag LOCUS_20950 gene vapC CDS 237711..238091 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20960 note possible pseudo, frameshifted CDS 238072..238500 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20970 note possible pseudo, frameshifted CDS 238769..240136 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20980 CDS 240139..242961 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20990 CDS 243114..243578 product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102894.1 transl_table 11 codon_start 1 locus_tag LOCUS_21000 CDS 243585..244490 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21010 CDS 244522..244776 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21020 CDS complement(244809..245354) product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202950651.1 transl_table 11 codon_start 1 locus_tag LOCUS_21030 CDS complement(245372..247408) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21040 CDS complement(247456..249657) product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704965.1 transl_table 11 codon_start 1 locus_tag LOCUS_21050 CDS complement(249654..249860) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21060 CDS complement(250017..250385) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002553206.1 transl_table 11 codon_start 1 locus_tag LOCUS_21070 CDS complement(250406..251614) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704968.1 transl_table 11 codon_start 1 locus_tag LOCUS_21080 CDS 251878..252588 product protein-glutamate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266627.1 transl_table 11 codon_start 1 locus_tag LOCUS_21090 CDS 252585..253181 product chemotaxis protein CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941388.1 transl_table 11 codon_start 1 locus_tag LOCUS_21100 CDS 253220..254314 product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704959.1 transl_table 11 codon_start 1 locus_tag LOCUS_21110 CDS complement(254328..255584) product sugar MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217858.1 transl_table 11 codon_start 1 locus_tag LOCUS_21120 CDS complement(255606..257855) product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405547.1 transl_table 11 codon_start 1 locus_tag LOCUS_21130 CDS complement(258112..259014) product transcriptional activator NhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405479.1 transl_table 11 codon_start 1 locus_tag LOCUS_21140 gene nhaR CDS 259127..262048 product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207161458.1 transl_table 11 codon_start 1 locus_tag LOCUS_21150 gene ppc CDS 262156..262596 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21160 CDS 262618..264711 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921383.1 transl_table 11 codon_start 1 locus_tag LOCUS_21170 CDS 264704..266014 product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140024.1 transl_table 11 codon_start 1 locus_tag LOCUS_21180 CDS 266021..267832 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21190 CDS complement(267908..268384) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085816.1 transl_table 11 codon_start 1 locus_tag LOCUS_21200 CDS 268443..268934 product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090951.1 transl_table 11 codon_start 1 locus_tag LOCUS_21210 gene greB CDS 268936..269100 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21220 CDS 269097..269507 product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090087.1 transl_table 11 codon_start 1 locus_tag LOCUS_21230 CDS 269504..269950 product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103447.1 transl_table 11 codon_start 1 locus_tag LOCUS_21240 gene dtd CDS 270264..270830 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21250 CDS complement(271304..271699) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21260 CDS 272113..274143 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706575.1 transl_table 11 codon_start 1 locus_tag LOCUS_21270 CDS complement(274174..274530) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21280 CDS 274739..275908 product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626511.1 transl_table 11 codon_start 1 locus_tag LOCUS_21290 CDS complement(276060..277454) product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531269.1 transl_table 11 codon_start 1 locus_tag LOCUS_21300 CDS 277775..280126 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114901.1 transl_table 11 codon_start 1 locus_tag LOCUS_21310 CDS 280126..281625 product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114902.1 transl_table 11 codon_start 1 locus_tag LOCUS_21320 CDS 281929..282453 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21330 CDS complement(282750..283034) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21340 CDS 282918..283400 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21350 CDS 283472..284467 product aliphatic nitrilase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877947.1 transl_table 11 codon_start 1 locus_tag LOCUS_21360 CDS 284445..285557 product MSMEG_0568 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876804.1 transl_table 11 codon_start 1 locus_tag LOCUS_21370 CDS 285559..286101 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21380 CDS 286098..287171 product methanogenesis marker 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024078.1 transl_table 11 codon_start 1 locus_tag LOCUS_21390 CDS 287195..288349 product MSMEG_0565 family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876802.1 transl_table 11 codon_start 1 locus_tag LOCUS_21400 CDS 288342..288629 product MSMEG_0570 family nitrogen starvation response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891991.1 transl_table 11 codon_start 1 locus_tag LOCUS_21410 CDS 288664..289935 product MSMEG_0569 family flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891990.1 transl_table 11 codon_start 1 locus_tag LOCUS_21420 CDS 290011..291483 product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940696.1 transl_table 11 codon_start 1 locus_tag LOCUS_21430 CDS complement(291603..291800) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21440 CDS complement(291951..293027) product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880230.1 transl_table 11 codon_start 1 locus_tag LOCUS_21450 gene rlmN CDS complement(293095..293910) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21460 CDS complement(293897..295549) product copper resistance system multicopper oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040631.1 transl_table 11 codon_start 1 locus_tag LOCUS_21470 CDS complement(295752..296159) product DUF2750 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706662.1 transl_table 11 codon_start 1 locus_tag LOCUS_21480 CDS 296414..296677 product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115113.1 transl_table 11 codon_start 1 locus_tag LOCUS_21490 CDS 296670..296903 product VF530 family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210768.1 transl_table 11 codon_start 1 locus_tag LOCUS_21500 CDS complement(296941..297669) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21510 CDS 297836..298063 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21520 CDS complement(298101..298910) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815935.1 transl_table 11 codon_start 1 locus_tag LOCUS_21530 CDS complement(299208..300110) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21540 CDS 300238..301461 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21550 CDS 301512..302675 product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928767.1 transl_table 11 codon_start 1 locus_tag LOCUS_21560 gene hflK CDS 302672..303538 product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106429.1 transl_table 11 codon_start 1 locus_tag LOCUS_21570 gene hflC CDS 303556..305460 product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707080.1 transl_table 11 codon_start 1 locus_tag LOCUS_21580 gene ftsH CDS 305529..305948 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21590 CDS 306261..306746 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21600 CDS 306789..307244 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21610 CDS 307276..308106 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21620 CDS 308142..309098 product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113450.1 transl_table 11 codon_start 1 locus_tag LOCUS_21630 gene msrP CDS 309098..309739 product sulfoxide reductase heme-binding subunit YedZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388352.1 transl_table 11 codon_start 1 locus_tag LOCUS_21640 CDS 309798..310709 product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103436.1 transl_table 11 codon_start 1 locus_tag LOCUS_21650 CDS 310730..311239 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21660 CDS 311244..312635 product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978886.1 transl_table 11 codon_start 1 locus_tag LOCUS_21670 CDS 312639..313157 product lipocalin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071839.1 transl_table 11 codon_start 1 locus_tag LOCUS_21680 CDS 313169..314110 product DUF523 and DUF1722 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705026.1 transl_table 11 codon_start 1 locus_tag LOCUS_21690 CDS complement(314114..314314) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21700 CDS complement(314539..316173) product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816975.1 transl_table 11 codon_start 1 locus_tag LOCUS_21710 CDS 316670..318376 product type II secretion system ATPase GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070691812.1 transl_table 11 codon_start 1 locus_tag LOCUS_21720 gene gspE CDS 318780..324221 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21730 CDS 324296..325645 product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035901.1 transl_table 11 codon_start 1 locus_tag LOCUS_21740 CDS 325703..326128 product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088760.1 transl_table 11 codon_start 1 locus_tag LOCUS_21750 gene gspG CDS 326129..326596 product GspH/FimT family pseudopilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035903.1 transl_table 11 codon_start 1 locus_tag LOCUS_21760 CDS 326583..327002 product type II secretion system minor pseudopilin GspI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038518.1 transl_table 11 codon_start 1 locus_tag LOCUS_21770 gene gspI CDS 327002..327715 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21780 CDS 327717..328688 product type II secretion system protein GspK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035906.1 transl_table 11 codon_start 1 locus_tag LOCUS_21790 CDS 328666..329838 product type II secretion system protein GspL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268250.1 transl_table 11 codon_start 1 locus_tag LOCUS_21800 CDS 329835..330413 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21810 CDS 330410..331027 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21820 CDS 331047..333281 product type II secretion system secretin GspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268249.1 transl_table 11 codon_start 1 locus_tag LOCUS_21830 gene gspD CDS 333327..334073 product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337653.1 transl_table 11 codon_start 1 locus_tag LOCUS_21840 CDS complement(334142..334354) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21850 CDS complement(334672..335889) product M20 aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931140.1 transl_table 11 codon_start 1 locus_tag LOCUS_21860 CDS complement(335908..337323) product transcriptional regulator FleQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382141.1 transl_table 11 codon_start 1 locus_tag LOCUS_21870 gene fleQ CDS 337552..338796 product CNNM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071563.1 transl_table 11 codon_start 1 locus_tag LOCUS_21880 CDS complement(339001..340278) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21890 CDS complement(340544..341842) product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035868.1 transl_table 11 codon_start 1 locus_tag LOCUS_21900 CDS complement(342097..343617) product exosortase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390868.1 transl_table 11 codon_start 1 locus_tag LOCUS_21910 gene xrtA CDS 343878..345116 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21920 CDS 345153..346106 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21930 CDS 346163..347386 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002936352.1 transl_table 11 codon_start 1 locus_tag LOCUS_21940 CDS 347407..347979 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21950 CDS 348043..348861 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257972.1 transl_table 11 codon_start 1 locus_tag LOCUS_21960 CDS 348905..350164 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963401.1 transl_table 11 codon_start 1 locus_tag LOCUS_21970 CDS 350149..350811 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21980 CDS 350822..351709 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21990 CDS 351979..353145 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22000 CDS 353196..354593 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002936352.1 transl_table 11 codon_start 1 locus_tag LOCUS_22010 CDS 354624..356672 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22020 CDS 356669..357997 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22030 CDS 358070..359026 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22040 CDS 359114..359998 product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932752.1 transl_table 11 codon_start 1 locus_tag LOCUS_22050 CDS complement(360486..361463) product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886970.1 transl_table 11 codon_start 1 locus_tag LOCUS_22060 CDS 361671..362528 product NADP-dependent methylenetetrahydromethanopterin/methylenetetrahydrofolate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122705.1 transl_table 11 codon_start 1 locus_tag LOCUS_22070 CDS complement(362525..362719) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22080 CDS 362750..363901 product DUF4147 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_182574366.1 transl_table 11 codon_start 1 locus_tag LOCUS_22090 CDS 363926..365185 product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112798.1 transl_table 11 codon_start 1 locus_tag LOCUS_22100 CDS 365718..366386 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22110 CDS complement(366965..367663) product lipoprotein-releasing ABC transporter ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091168.1 transl_table 11 codon_start 1 locus_tag LOCUS_22120 gene lolD CDS complement(367656..368903) product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091170.1 transl_table 11 codon_start 1 locus_tag LOCUS_22130 CDS complement(368906..369328) product ferric iron uptake transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705427.1 transl_table 11 codon_start 1 locus_tag LOCUS_22140 gene fur CDS 369444..369998 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22150 CDS complement(370017..370490) product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105112.1 transl_table 11 codon_start 1 locus_tag LOCUS_22160 CDS complement(370498..370812) product pyrimidine/purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941982.1 transl_table 11 codon_start 1 locus_tag LOCUS_22170 CDS complement(370749..371435) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404273.1 transl_table 11 codon_start 1 locus_tag LOCUS_22180 CDS complement(371410..372465) product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002661162.1 transl_table 11 codon_start 1 locus_tag LOCUS_22190 CDS complement(372471..372821) product HopJ type III effector protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263557.1 transl_table 11 codon_start 1 locus_tag LOCUS_22200 CDS 372906..373697 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22210 CDS 373723..374676 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22220 CDS 374769..375026 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22230 CDS 375028..376770 product GNVR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176617.1 transl_table 11 codon_start 1 locus_tag LOCUS_22240 CDS 376789..377571 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22250 CDS complement(377620..380007) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011787323.1 transl_table 11 codon_start 1 locus_tag LOCUS_22260 CDS complement(380162..380821) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22270 CDS complement(380833..382527) product putative porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112715.1 transl_table 11 codon_start 1 locus_tag LOCUS_22280 CDS complement(382546..383208) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22290 CDS complement(383220..383624) product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085366.1 transl_table 11 codon_start 1 locus_tag LOCUS_22300 CDS complement(383711..385498) product DUF2341 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112717.1 transl_table 11 codon_start 1 locus_tag LOCUS_22310 CDS complement(385776..396329) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22320 CDS complement(397041..398639) product ShlB/FhaC/HecB family hemolysin secretion/activation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112718.1 transl_table 11 codon_start 1 locus_tag LOCUS_22330 CDS complement(398740..400299) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22340 CDS complement(400400..401191) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22350 CDS complement(401801..402316) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22360 CDS complement(402297..403490) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22370 CDS complement(403483..404418) product GspK family T2SS minor pseudopilin variant XcpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103524.1 transl_table 11 codon_start 1 locus_tag LOCUS_22380 gene xcpX CDS complement(404415..404993) product GspJ family T2SS minor pseudopilin variant XcpW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110067.1 transl_table 11 codon_start 1 locus_tag LOCUS_22390 gene xcpW CDS complement(404983..405360) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22400 CDS complement(405357..405869) product type II secretion system minor pseudopilin GspH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070567.1 transl_table 11 codon_start 1 locus_tag LOCUS_22410 gene gspH CDS complement(405884..406315) product GspG family T2SS major pseudopilin variant XcpT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119751.1 transl_table 11 codon_start 1 locus_tag LOCUS_22420 gene xcpT CDS complement(406412..407623) product type II secretion system inner membrane protein GspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070565.1 transl_table 11 codon_start 1 locus_tag LOCUS_22430 gene gspF CDS complement(407633..409138) product GspE family T2SS ATPase variant XcpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091377.1 transl_table 11 codon_start 1 locus_tag LOCUS_22440 gene xcpR CDS complement(409125..411029) product GspD family T2SS secretin variant XcpQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113934.1 transl_table 11 codon_start 1 locus_tag LOCUS_22450 gene xcpQ CDS complement(411051..411620) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22460 CDS 411746..412885 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22470 CDS 412943..415198 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680025.1 transl_table 11 codon_start 1 locus_tag LOCUS_22480 CDS 415659..416042 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22490 CDS 416039..416527 product type VI secretion system amidase effector protein Tae4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315890.1 transl_table 11 codon_start 1 locus_tag LOCUS_22500 CDS complement(416948..418294) product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_114714636.1 transl_table 11 codon_start 1 locus_tag LOCUS_22510 CDS complement(418607..419194) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22520 CDS complement(419387..420169) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22530 CDS complement(420213..421532) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203793.1 transl_table 11 codon_start 1 locus_tag LOCUS_22540 CDS complement(421552..423336) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22550 CDS 423439..423846 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22560 CDS complement(423859..425745) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268339.1 transl_table 11 codon_start 1 locus_tag LOCUS_22570 CDS complement(425736..426956) product nicotinamide mononucleotide deamidase-related protein YfaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706150.1 transl_table 11 codon_start 1 locus_tag LOCUS_22580 CDS complement(426953..427867) product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545151.1 transl_table 11 codon_start 1 locus_tag LOCUS_22590 CDS complement(428012..431317) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22600 CDS complement(431441..432127) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22610 CDS complement(432124..432687) product DUF447 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532039.1 transl_table 11 codon_start 1 locus_tag LOCUS_22620 CDS 432841..433647 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070889.1 transl_table 11 codon_start 1 locus_tag LOCUS_22630 CDS 433923..434534 product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091196.1 transl_table 11 codon_start 1 locus_tag LOCUS_22640 gene lexA CDS 434531..435142 product translesion DNA synthesis-associated protein ImuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195290.1 transl_table 11 codon_start 1 locus_tag LOCUS_22650 gene imuA CDS 435150..436640 product DNA polymerase Y family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112733.1 transl_table 11 codon_start 1 locus_tag LOCUS_22660 CDS 436624..439728 product error-prone DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895514.1 transl_table 11 codon_start 1 locus_tag LOCUS_22670 gene dnaE2 CDS complement(439776..441338) product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203470.1 transl_table 11 codon_start 1 locus_tag LOCUS_22680 CDS 441715..442023 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22690 CDS 442626..443732 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22700 CDS complement(443799..444428) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22710 CDS complement(444547..445554) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22720 CDS complement(445655..446476) product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004396554.1 transl_table 11 codon_start 1 locus_tag LOCUS_22730 CDS complement(446479..447132) product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946654.1 transl_table 11 codon_start 1 locus_tag LOCUS_22740 CDS complement(447138..447758) product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004396553.1 transl_table 11 codon_start 1 locus_tag LOCUS_22750 CDS complement(447841..448545) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266959.1 transl_table 11 codon_start 1 locus_tag LOCUS_22760 gene tsaB CDS complement(448542..450500) product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881716.1 transl_table 11 codon_start 1 locus_tag LOCUS_22770 CDS complement(450500..451222) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22780 CDS complement(451249..451788) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22790 CDS 452111..453523 product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813082.1 transl_table 11 codon_start 1 locus_tag LOCUS_22800 CDS complement(453529..454530) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705564.1 transl_table 11 codon_start 1 locus_tag LOCUS_22810 CDS complement(454699..454998) product anti-anti sigma factor HsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091727.1 transl_table 11 codon_start 1 locus_tag LOCUS_22820 gene hsbA CDS complement(455043..456119) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037126.1 transl_table 11 codon_start 1 locus_tag LOCUS_22830 CDS complement(456249..457310) product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037036.1 transl_table 11 codon_start 1 locus_tag LOCUS_22840 CDS complement(457320..457958) product chemoreceptor glutamine deamidase CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072188.1 transl_table 11 codon_start 1 locus_tag LOCUS_22850 gene cheD CDS complement(457955..458791) product chemotaxis protein methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525698.1 transl_table 11 codon_start 1 locus_tag LOCUS_22860 CDS complement(458816..459325) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22870 CDS complement(459325..460086) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898851.1 transl_table 11 codon_start 1 locus_tag LOCUS_22880 CDS complement(460083..460589) product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941953.1 transl_table 11 codon_start 1 locus_tag LOCUS_22890 CDS complement(460635..462980) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22900 CDS complement(463023..463538) product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199265.1 transl_table 11 codon_start 1 locus_tag LOCUS_22910 gene cheW CDS complement(463558..465648) product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001162435.1 transl_table 11 codon_start 1 locus_tag LOCUS_22920 CDS complement(465688..466005) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002806565.1 transl_table 11 codon_start 1 locus_tag LOCUS_22930 CDS 466459..467070 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22940 CDS 467074..467526 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22950 CDS 467523..468254 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22960 CDS 468411..468845 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22970 CDS complement(471072..471293) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22980 CDS 471655..473703 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22990 CDS 473784..474251 product type IV pilin protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103296.1 transl_table 11 codon_start 1 locus_tag LOCUS_23000 CDS complement(474275..475294) product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771042.1 transl_table 11 codon_start 1 locus_tag LOCUS_23010 gene queA CDS complement(475444..475686) product succinate dehydrogenase assembly factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014507842.1 transl_table 11 codon_start 1 locus_tag LOCUS_23020 CDS complement(475683..476465) product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037280.1 transl_table 11 codon_start 1 locus_tag LOCUS_23030 CDS complement(476465..478249) product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388959.1 transl_table 11 codon_start 1 locus_tag LOCUS_23040 gene sdhA CDS complement(478253..478633) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23050 CDS complement(478647..478916) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23060 CDS complement(479057..479248) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23070 CDS complement(479252..480559) product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038338.1 transl_table 11 codon_start 1 locus_tag LOCUS_23080 CDS complement(480677..481861) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948327.1 transl_table 11 codon_start 1 locus_tag LOCUS_23090 CDS 482005..484743 product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583674.1 transl_table 11 codon_start 1 locus_tag LOCUS_23100 gene ppdK CDS complement(484791..486026) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23110 CDS 486225..486737 product zinc uptake transcriptional repressor Zur inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096992.1 transl_table 11 codon_start 1 locus_tag LOCUS_23120 gene zur CDS 486932..488887 product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880378.1 transl_table 11 codon_start 1 locus_tag LOCUS_23130 gene ligA CDS 488884..489669 product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100335.1 transl_table 11 codon_start 1 locus_tag LOCUS_23140 CDS 489666..490292 product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093148.1 transl_table 11 codon_start 1 locus_tag LOCUS_23150 gene thiE CDS 490298..490507 product dodecin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084181.1 transl_table 11 codon_start 1 locus_tag LOCUS_23160 CDS complement(490510..491559) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23170 CDS complement(491662..492576) product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819958.1 transl_table 11 codon_start 1 locus_tag LOCUS_23180 CDS complement(492573..493391) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23190 CDS complement(493525..493743) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23200 CDS complement(493963..494451) product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206712.1 transl_table 11 codon_start 1 locus_tag LOCUS_23210 CDS complement(494506..496002) product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817018.1 transl_table 11 codon_start 1 locus_tag LOCUS_23220 gene lysS CDS complement(496041..496409) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23230 CDS complement(496406..496636) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23240 CDS complement(496982..498079) product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_098729101.1 transl_table 11 codon_start 1 locus_tag LOCUS_23250 gene prfB CDS complement(498165..498953) product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403744.1 transl_table 11 codon_start 1 locus_tag LOCUS_23260 gene lgt CDS complement(499049..499363) product non-heme iron oxygenase ferredoxin subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000010050.1 transl_table 11 codon_start 1 locus_tag LOCUS_23270 CDS complement(499399..500169) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704126.1 transl_table 11 codon_start 1 locus_tag LOCUS_23280 CDS complement(500180..500632) product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141374.1 transl_table 11 codon_start 1 locus_tag LOCUS_23290 CDS complement(500632..501855) product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141373.1 transl_table 11 codon_start 1 locus_tag LOCUS_23300 CDS 501936..502496 product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392284.1 transl_table 11 codon_start 1 locus_tag LOCUS_23310 CDS complement(502491..503780) product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958176.1 transl_table 11 codon_start 1 locus_tag LOCUS_23320 gene sufD CDS complement(503777..504526) product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037895.1 transl_table 11 codon_start 1 locus_tag LOCUS_23330 gene sufC CDS complement(505118..505849) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23340 CDS complement(506343..506552) product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813809.1 transl_table 11 codon_start 1 locus_tag LOCUS_23350 CDS complement(506545..506802) product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813812.1 transl_table 11 codon_start 1 locus_tag LOCUS_23360 CDS complement(506802..508250) product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946338.1 transl_table 11 codon_start 1 locus_tag LOCUS_23370 gene sufB CDS complement(508265..508714) product SUF system Fe-S cluster assembly regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037893.1 transl_table 11 codon_start 1 locus_tag LOCUS_23380 CDS 508947..509714 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23390 CDS 509888..510847 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23400 CDS 511005..512168 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23410 CDS 512721..514280 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23420 CDS complement(514335..515330) product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942881.1 transl_table 11 codon_start 1 locus_tag LOCUS_23430 CDS complement(515342..516613) product Vi polysaccharide biosynthesis UDP-N-acetylglucosamine C-6 dehydrogenase TviB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073077.1 transl_table 11 codon_start 1 locus_tag LOCUS_23440 gene tviB CDS complement(516659..517264) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23450 CDS complement(517328..517888) product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037265.1 transl_table 11 codon_start 1 locus_tag LOCUS_23460 gene pgsA CDS complement(517878..519716) product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113354.1 transl_table 11 codon_start 1 locus_tag LOCUS_23470 gene uvrC CDS complement(519709..520356) product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087828.1 transl_table 11 codon_start 1 locus_tag LOCUS_23480 CDS 520762..521826 product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036149.1 transl_table 11 codon_start 1 locus_tag LOCUS_23490 CDS complement(521914..522873) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036674.1 transl_table 11 codon_start 1 locus_tag LOCUS_23500 CDS complement(522997..524649) product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142055.1 transl_table 11 codon_start 1 locus_tag LOCUS_23510 CDS complement(524898..526976) product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707071.1 transl_table 11 codon_start 1 locus_tag LOCUS_23520 gene pnp CDS complement(527061..527330) product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369527.1 transl_table 11 codon_start 1 locus_tag LOCUS_23530 gene rpsO CDS complement(527441..528358) product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016351717.1 transl_table 11 codon_start 1 locus_tag LOCUS_23540 gene truB CDS complement(528358..528774) product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003024988.1 transl_table 11 codon_start 1 locus_tag LOCUS_23550 gene rbfA CDS complement(528774..531482) product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707074.1 transl_table 11 codon_start 1 locus_tag LOCUS_23560 gene infB CDS complement(531497..533008) product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071433.1 transl_table 11 codon_start 1 locus_tag LOCUS_23570 gene nusA CDS complement(532998..533483) product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095193.1 transl_table 11 codon_start 1 locus_tag LOCUS_23580 gene rimP tRNA complement(534027..534102) product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00180 tRNA complement(534130..534205) product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00190 CDS 534398..535219 product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909158.1 transl_table 11 codon_start 1 locus_tag LOCUS_23590 CDS 535253..536239 product dihydroxyacetone kinase subunit DhaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028170688.1 transl_table 11 codon_start 1 locus_tag LOCUS_23600 gene dhaK CDS complement(536253..536900) product dihydroxyacetone kinase subunit DhaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051000397.1 transl_table 11 codon_start 1 locus_tag LOCUS_23610 gene dhaL CDS complement(537066..537578) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23620 CDS 537851..539026 product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121101.1 transl_table 11 codon_start 1 locus_tag LOCUS_23630 CDS 539029..539928 product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206994.1 transl_table 11 codon_start 1 locus_tag LOCUS_23640 gene argF CDS 539976..540614 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23650 CDS 540710..542560 product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084436.1 transl_table 11 codon_start 1 locus_tag LOCUS_23660 gene ilvD CDS 542932..543675 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23670 CDS 543754..545067 product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403912.1 transl_table 11 codon_start 1 locus_tag LOCUS_23680 gene argA CDS 545104..545556 product GDP-mannose mannosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001393539.1 transl_table 11 codon_start 1 locus_tag LOCUS_23690 gene gmm CDS 545560..546348 product 3',5'-cyclic-AMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707475.1 transl_table 11 codon_start 1 locus_tag LOCUS_23700 gene cpdA CDS complement(546345..546872) product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084400.1 transl_table 11 codon_start 1 locus_tag LOCUS_23710 CDS 547026..547682 product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269258.1 transl_table 11 codon_start 1 locus_tag LOCUS_23720 CDS complement(547742..547984) product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193727.1 transl_table 11 codon_start 1 locus_tag LOCUS_23730 CDS 548047..549438 product siroheme synthase CysG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113366.1 transl_table 11 codon_start 1 locus_tag LOCUS_23740 gene cysG CDS 549648..549983 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23750 CDS complement(550062..550676) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23760 CDS complement(550821..552032) product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092065.1 transl_table 11 codon_start 1 locus_tag LOCUS_23770 CDS complement(552130..553389) product lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114538.1 transl_table 11 codon_start 1 locus_tag LOCUS_23780 gene waaA CDS complement(553690..554598) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23790 CDS complement(554940..557333) product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941469.1 transl_table 11 codon_start 1 locus_tag LOCUS_23800 gene ppsA CDS complement(557818..560259) product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015154897.1 transl_table 11 codon_start 1 locus_tag LOCUS_23810 CDS complement(560355..561320) product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974566.1 transl_table 11 codon_start 1 locus_tag LOCUS_23820 CDS complement(561406..561960) product pyoverdine signaling pathway sigma factor FpvI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103620.1 transl_table 11 codon_start 1 locus_tag LOCUS_23830 gene fpvI CDS complement(562295..563431) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23840 CDS complement(563424..564584) product FIST N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197970.1 transl_table 11 codon_start 1 locus_tag LOCUS_23850 CDS complement(564723..565664) product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707885.1 transl_table 11 codon_start 1 locus_tag LOCUS_23860 gene rfaD CDS complement(565670..566116) product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008502894.1 transl_table 11 codon_start 1 locus_tag LOCUS_23870 gene rplI CDS complement(566163..567035) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004407837.1 transl_table 11 codon_start 1 locus_tag LOCUS_23880 CDS complement(567094..567324) product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947320.1 transl_table 11 codon_start 1 locus_tag LOCUS_23890 gene rpsR CDS complement(567350..567775) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23900 CDS complement(567917..569281) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23910 CDS complement(569309..569761) product flagellar export protein FliJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073108.1 transl_table 11 codon_start 1 locus_tag LOCUS_23920 gene fliJ CDS complement(569761..571110) product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086458.1 transl_table 11 codon_start 1 locus_tag LOCUS_23930 gene fliI CDS complement(571107..571811) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23940 CDS complement(571798..572808) product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037091.1 transl_table 11 codon_start 1 locus_tag LOCUS_23950 gene fliG CDS complement(572801..574552) product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268443.1 transl_table 11 codon_start 1 locus_tag LOCUS_23960 gene fliF CDS complement(574570..574881) product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086454.1 transl_table 11 codon_start 1 locus_tag LOCUS_23970 gene fliE CDS complement(574937..576319) product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262361.1 transl_table 11 codon_start 1 locus_tag LOCUS_23980 CDS complement(576306..577511) product sensor histidine kinase FleS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086450.1 transl_table 11 codon_start 1 locus_tag LOCUS_23990 gene fleS CDS 577704..580520 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24000 CDS 580756..581520 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24010 CDS complement(581605..582633) product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767875.1 transl_table 11 codon_start 1 locus_tag LOCUS_24020 gene argC CDS 582712..583689 product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529235.1 transl_table 11 codon_start 1 locus_tag LOCUS_24030 CDS 583692..584537 product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109274.1 transl_table 11 codon_start 1 locus_tag LOCUS_24040 CDS complement(584642..585937) product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095642.1 transl_table 11 codon_start 1 locus_tag LOCUS_24050 CDS complement(585962..587176) product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095644.1 transl_table 11 codon_start 1 locus_tag LOCUS_24060 CDS complement(587230..588084) product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106429.1 transl_table 11 codon_start 1 locus_tag LOCUS_24070 gene hflC CDS complement(588086..589279) product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928767.1 transl_table 11 codon_start 1 locus_tag LOCUS_24080 gene hflK CDS complement(589447..590712) product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460377.1 transl_table 11 codon_start 1 locus_tag LOCUS_24090 gene hflX CDS complement(590724..590966) product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192796.1 transl_table 11 codon_start 1 locus_tag LOCUS_24100 gene hfq CDS complement(591158..592822) product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110721.1 transl_table 11 codon_start 1 locus_tag LOCUS_24110 gene ettA CDS 592916..593617 product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963856.1 transl_table 11 codon_start 1 locus_tag LOCUS_24120 CDS 593610..594365 product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963855.1 transl_table 11 codon_start 1 locus_tag LOCUS_24130 CDS 594358..594759 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24140 CDS 594816..595733 product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258363.1 transl_table 11 codon_start 1 locus_tag LOCUS_24150 CDS 595739..596149 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24160 CDS complement(596172..597311) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24170 CDS complement(597308..597907) product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922815.1 transl_table 11 codon_start 1 locus_tag LOCUS_24180 CDS complement(597900..598838) product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113929.1 transl_table 11 codon_start 1 locus_tag LOCUS_24190 gene miaA CDS complement(598839..600710) product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106411.1 transl_table 11 codon_start 1 locus_tag LOCUS_24200 gene mutL CDS complement(600796..602355) product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198702760.1 transl_table 11 codon_start 1 locus_tag LOCUS_24210 CDS complement(602391..602861) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070930.1 transl_table 11 codon_start 1 locus_tag LOCUS_24220 gene tsaE CDS complement(602861..604324) product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958000.1 transl_table 11 codon_start 1 locus_tag LOCUS_24230 CDS complement(604460..604621) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24240 CDS complement(604736..604948) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24250 CDS complement(605077..605547) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24260 CDS 605943..606524 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24270 CDS 606746..608056 product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526010.1 transl_table 11 codon_start 1 locus_tag LOCUS_24280 CDS complement(608039..609370) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24290 CDS 609518..612598 product bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase PutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038915.1 transl_table 11 codon_start 1 locus_tag LOCUS_24300 gene putA CDS 612738..613532 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24310 CDS 613736..614728 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387829.1 transl_table 11 codon_start 1 locus_tag LOCUS_24320 CDS 614797..615633 product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190029.1 transl_table 11 codon_start 1 locus_tag LOCUS_24330 CDS 616226..617281 product nitrogen regulation protein NR(II) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555720.1 transl_table 11 codon_start 1 locus_tag LOCUS_24340 gene glnL CDS 617268..618689 product two-component system response regulator NtrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104661.1 transl_table 11 codon_start 1 locus_tag LOCUS_24350 gene ntrC CDS 618861..620228 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24360 CDS 620245..620748 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24370 CDS complement(620734..621549) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24380 CDS 621646..622689 product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703153.1 transl_table 11 codon_start 1 locus_tag LOCUS_24390 gene purM CDS complement(623006..623731) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24400 CDS complement(623878..625320) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24410 CDS 625630..626112 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24420 note possible pseudo, frameshifted CDS 626109..626375 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24430 note possible pseudo, frameshifted CDS complement(626636..627466) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24440 note possible pseudo, internal stop codon, frameshifted CDS complement(627874..628149) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24450 note possible pseudo, frameshifted CDS complement(628154..629236) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24460 note possible pseudo, frameshifted CDS complement(629257..629523) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24470 note possible pseudo, frameshifted CDS complement(629711..629881) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24480 CDS 630090..630596 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24490 CDS 630747..631148 product phage terminase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098052.1 transl_table 11 codon_start 1 locus_tag LOCUS_24500 note possible pseudo, internal stop codon CDS 631157..632722 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24510 CDS 633116..633445 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24520 CDS complement(633860..634756) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24530 CDS complement(634802..635317) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24540 CDS complement(635450..635776) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24550 CDS 635894..636769 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399088.1 transl_table 11 codon_start 1 locus_tag LOCUS_24560 CDS 637887..638102 product AlpA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263379.1 transl_table 11 codon_start 1 locus_tag LOCUS_24570 CDS 638099..638929 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24580 CDS complement(639106..639507) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24590 CDS complement(639491..639796) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24600 CDS complement(639952..640239) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24610 CDS 640640..641074 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24620 CDS 641071..641310 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24630 CDS 641307..641543 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24640 CDS 641540..641782 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24650 CDS 641843..641989 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24660 CDS 642325..642498 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24670 note possible pseudo, frameshifted CDS 642697..643323 product isochorismate family cysteine hydrolase YcaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000046156.1 transl_table 11 codon_start 1 locus_tag LOCUS_24680 gene ycaC CDS 644535..644741 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24690 CDS 644738..645502 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24700 tRNA complement(646314..646389) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00200 CDS complement(646463..647305) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24710 CDS complement(647306..649756) product copper-exporting P-type ATPase CopA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242925.1 transl_table 11 codon_start 1 locus_tag LOCUS_24720 gene copA CDS complement(649826..650482) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24730 CDS complement(650531..650827) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24740 CDS complement(650846..651031) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24750 CDS complement(651210..651419) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24760 CDS 651476..651664 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24770 CDS complement(651698..652918) product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085971.1 transl_table 11 codon_start 1 locus_tag LOCUS_24780 CDS complement(653043..653345) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24790 CDS complement(653417..653626) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24800 CDS complement(653965..655569) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24810 CDS complement(656015..658624) product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112602.1 transl_table 11 codon_start 1 locus_tag LOCUS_24820 gene alaS CDS complement(658762..659082) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24830 CDS complement(659079..659297) product addiction module protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932270.1 transl_table 11 codon_start 1 locus_tag LOCUS_24840 CDS complement(659379..659873) product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766020.1 transl_table 11 codon_start 1 locus_tag LOCUS_24850 gene recX CDS complement(659857..660909) product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947527.1 transl_table 11 codon_start 1 locus_tag LOCUS_24860 gene recA CDS complement(660998..662260) product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082590.1 transl_table 11 codon_start 1 locus_tag LOCUS_24870 CDS complement(662319..663041) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006788385.1 transl_table 11 codon_start 1 locus_tag LOCUS_24880 CDS 663402..663875 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24890 CDS 664174..666288 product GTP diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086042.1 transl_table 11 codon_start 1 locus_tag LOCUS_24900 gene relA CDS 666392..666610 product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002553999.1 transl_table 11 codon_start 1 locus_tag LOCUS_24910 gene infA CDS complement(666645..668921) product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090432.1 transl_table 11 codon_start 1 locus_tag LOCUS_24920 gene clpA CDS complement(668931..669254) product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097649.1 transl_table 11 codon_start 1 locus_tag LOCUS_24930 gene clpS CDS 669380..669835 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194031.1 transl_table 11 codon_start 1 locus_tag LOCUS_24940 CDS 669832..670929 product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295972.1 transl_table 11 codon_start 1 locus_tag LOCUS_24950 gene mnmA CDS 670939..672114 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143072.1 transl_table 11 codon_start 1 locus_tag LOCUS_24960 CDS 672114..672776 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24970 CDS 672801..674159 product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262318.1 transl_table 11 codon_start 1 locus_tag LOCUS_24980 gene purB CDS 674174..675406 product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783728.1 transl_table 11 codon_start 1 locus_tag LOCUS_24990 CDS 675476..676762 product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454735.1 transl_table 11 codon_start 1 locus_tag LOCUS_25000 gene mtaB CDS complement(676828..677610) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25010 CDS 677701..678327 product ribonuclease T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092070.1 transl_table 11 codon_start 1 locus_tag LOCUS_25020 gene rnt CDS complement(678431..678751) product Grx4 family monothiol glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771068.1 transl_table 11 codon_start 1 locus_tag LOCUS_25030 gene grxD rRNA complement(678888..678997) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00040 rRNA complement(679200..682091) product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00050 tRNA complement(682416..682491) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00210 tRNA complement(682608..682684) product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00220 rRNA complement(682746..684274) product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00060 CDS complement(684734..685708) product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097874.1 transl_table 11 codon_start 1 locus_tag LOCUS_25040 CDS complement(685713..686834) product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000048190.1 transl_table 11 codon_start 1 locus_tag LOCUS_25050 gene gmd CDS complement(686934..688517) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25060 CDS complement(688709..689236) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25070 CDS complement(689416..690612) product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763607.1 transl_table 11 codon_start 1 locus_tag LOCUS_25080 CDS complement(690619..691263) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25090 CDS complement(691268..692152) product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005647969.1 transl_table 11 codon_start 1 locus_tag LOCUS_25100 gene prmA CDS complement(692218..693561) product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035764.1 transl_table 11 codon_start 1 locus_tag LOCUS_25110 gene accC CDS complement(693582..694019) product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005163113.1 transl_table 11 codon_start 1 locus_tag LOCUS_25120 gene accB CDS complement(694009..694470) product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555369.1 transl_table 11 codon_start 1 locus_tag LOCUS_25130 gene aroQ CDS complement(694583..695110) product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194069.1 transl_table 11 codon_start 1 locus_tag LOCUS_25140 CDS complement(695107..697326) product protein-disulfide reductase DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025862442.1 transl_table 11 codon_start 1 locus_tag LOCUS_25150 gene dsbD CDS complement(697308..697625) product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888922.1 transl_table 11 codon_start 1 locus_tag LOCUS_25160 CDS 697698..698138 product membrane protein FxsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460455.1 transl_table 11 codon_start 1 locus_tag LOCUS_25170 gene fxsA CDS complement(698200..698436) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25180 CDS 698538..700703 product DNA helicase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000383393.1 transl_table 11 codon_start 1 locus_tag LOCUS_25190 gene uvrD CDS complement(700770..702203) product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000044417.1 transl_table 11 codon_start 1 locus_tag LOCUS_25200 gene pyk CDS complement(702212..703225) product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194065.1 transl_table 11 codon_start 1 locus_tag LOCUS_25210 gene gap CDS 703501..704448 product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072540.1 transl_table 11 codon_start 1 locus_tag LOCUS_25220 gene ylqF CDS complement(704526..705233) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25230 CDS complement(705349..706005) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25240 CDS 706368..706808 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25250 CDS 707762..708805 product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028993.1 transl_table 11 codon_start 1 locus_tag LOCUS_25260 CDS complement(709029..710375) product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142259.1 transl_table 11 codon_start 1 locus_tag LOCUS_25270 CDS 710643..712385 product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172599.1 transl_table 11 codon_start 1 locus_tag LOCUS_25280 CDS 712429..712941 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25290 CDS complement(712971..713585) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25300 CDS complement(713643..713978) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25310 CDS complement(714292..714915) product TIGR04282 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839307.1 transl_table 11 codon_start 1 locus_tag LOCUS_25320 CDS complement(714919..717036) product bifunctional TVP38/TMEM64 family protein/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705444.1 transl_table 11 codon_start 1 locus_tag LOCUS_25330 CDS complement(717093..718055) product arsenosugar biosynthesis radical SAM protein ArsS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140889.1 transl_table 11 codon_start 1 locus_tag LOCUS_25340 gene arsS CDS complement(718058..718753) product DUF3047 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941830.1 transl_table 11 codon_start 1 locus_tag LOCUS_25350 CDS complement(718641..718901) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25360 CDS 718992..720071 product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110324.1 transl_table 11 codon_start 1 locus_tag LOCUS_25370 gene queG CDS 720308..720829 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25380 CDS complement(720830..721099) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25390 CDS complement(721186..722427) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039644929.1 transl_table 11 codon_start 1 locus_tag LOCUS_25400 CDS 722701..724914 product penicillin-binding protein 1B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427455.1 transl_table 11 codon_start 1 locus_tag LOCUS_25410 gene mrcB CDS 724917..725543 product outer membrane lipoprotein chaperone LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222831.1 transl_table 11 codon_start 1 locus_tag LOCUS_25420 gene lolA CDS complement(725550..727334) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25430 CDS complement(727379..730027) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25440 CDS complement(730024..730482) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25450 CDS complement(730479..731630) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25460 CDS 732601..732909 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25470 CDS 733376..734374 product tRNA dihydrouridine(20/20a) synthase DusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707399.1 transl_table 11 codon_start 1 locus_tag LOCUS_25480 gene dusA CDS 734414..734959 product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011216616.1 transl_table 11 codon_start 1 locus_tag LOCUS_25490 gene folE CDS 734962..735945 product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927663.1 transl_table 11 codon_start 1 locus_tag LOCUS_25500 gene hemH CDS 735978..737570 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25510 CDS 737567..738763 product formate-dependent phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064909.1 transl_table 11 codon_start 1 locus_tag LOCUS_25520 gene purT CDS 738788..739363 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25530 CDS 739364..740227 product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941571.1 transl_table 11 codon_start 1 locus_tag LOCUS_25540 CDS complement(740271..740849) product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925884.1 transl_table 11 codon_start 1 locus_tag LOCUS_25550 CDS 740919..741437 product YceD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104745.1 transl_table 11 codon_start 1 locus_tag LOCUS_25560 CDS 741439..741621 product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771287.1 transl_table 11 codon_start 1 locus_tag LOCUS_25570 gene rpmF CDS 741859..742860 product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947122.1 transl_table 11 codon_start 1 locus_tag LOCUS_25580 gene plsX CDS 742857..743825 product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097122.1 transl_table 11 codon_start 1 locus_tag LOCUS_25590 CDS 743828..744784 product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816075.1 transl_table 11 codon_start 1 locus_tag LOCUS_25600 gene fabD CDS 744759..745505 product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420124.1 transl_table 11 codon_start 1 locus_tag LOCUS_25610 gene fabG CDS complement(745576..746505) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206468.1 transl_table 11 codon_start 1 locus_tag LOCUS_25620 CDS complement(746502..749879) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044393613.1 transl_table 11 codon_start 1 locus_tag LOCUS_25630 CDS complement(750039..750800) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25640 CDS 751074..751658 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25650 note possible pseudo, frameshifted CDS 751658..752296 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25660 note possible pseudo, frameshifted CDS 752323..752679 product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104861.1 transl_table 11 codon_start 1 locus_tag LOCUS_25670 CDS 752787..754037 product urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767480.1 transl_table 11 codon_start 1 locus_tag LOCUS_25680 gene urtA CDS 754144..755046 product urea ABC transporter permease subunit UrtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083789.1 transl_table 11 codon_start 1 locus_tag LOCUS_25690 gene urtB CDS 755058..756212 product urea ABC transporter permease subunit UrtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104863.1 transl_table 11 codon_start 1 locus_tag LOCUS_25700 gene urtC CDS 756209..756952 product urea ABC transporter ATP-binding protein UrtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104862.1 transl_table 11 codon_start 1 locus_tag LOCUS_25710 gene urtD CDS 756997..757686 product urea ABC transporter ATP-binding subunit UrtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083792.1 transl_table 11 codon_start 1 locus_tag LOCUS_25720 gene urtE CDS 758127..759380 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25730 CDS 759407..760705 product urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244008.1 transl_table 11 codon_start 1 locus_tag LOCUS_25740 gene urtA CDS 760854..762524 product urea ABC transporter permease subunit UrtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531848.1 transl_table 11 codon_start 1 locus_tag LOCUS_25750 gene urtB CDS 762926..763219 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25760 CDS 763604..764722 product urea ABC transporter permease subunit UrtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084267.1 transl_table 11 codon_start 1 locus_tag LOCUS_25770 gene urtC CDS 764719..765528 product urea ABC transporter ATP-binding protein UrtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003376420.1 transl_table 11 codon_start 1 locus_tag LOCUS_25780 gene urtD CDS 765525..766301 product urea ABC transporter ATP-binding subunit UrtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056966.1 transl_table 11 codon_start 1 locus_tag LOCUS_25790 gene urtE CDS 766398..766703 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25800 CDS 766716..767567 product urease accessory protein UreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261404.1 transl_table 11 codon_start 1 locus_tag LOCUS_25810 CDS 767631..767825 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25820 CDS 767825..768091 product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870423.1 transl_table 11 codon_start 1 locus_tag LOCUS_25830 CDS 768545..768811 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25840 CDS 769118..769738 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25850 CDS 770112..770414 product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056825.1 transl_table 11 codon_start 1 locus_tag LOCUS_25860 gene ureA CDS 770544..770867 product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056185.1 transl_table 11 codon_start 1 locus_tag LOCUS_25870 CDS 770864..772567 product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099392.1 transl_table 11 codon_start 1 locus_tag LOCUS_25880 gene ureC CDS complement(772662..773024) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25890 CDS complement(773317..773673) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25900 CDS 774386..775471 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25910 CDS 776155..776586 product urease accessory protein UreE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098769.1 transl_table 11 codon_start 1 locus_tag LOCUS_25920 gene ureE CDS 776576..777250 product urease accessory protein UreF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418029.1 transl_table 11 codon_start 1 locus_tag LOCUS_25930 CDS 777344..777961 product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095530.1 transl_table 11 codon_start 1 locus_tag LOCUS_25940 gene ureG CDS 778312..778857 product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082631.1 transl_table 11 codon_start 1 locus_tag LOCUS_25950 CDS 778919..780277 product DASH family cryptochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037642.1 transl_table 11 codon_start 1 locus_tag LOCUS_25960 CDS complement(780312..780722) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25970 CDS complement(780761..781177) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807254.1 transl_table 11 codon_start 1 locus_tag LOCUS_25980 CDS complement(781192..781608) product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038731.1 transl_table 11 codon_start 1 locus_tag LOCUS_25990 CDS complement(781749..782699) product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245803.1 transl_table 11 codon_start 1 locus_tag LOCUS_26000 gene cysK CDS 783297..784121 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26010 CDS complement(784175..785203) product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268982.1 transl_table 11 codon_start 1 locus_tag LOCUS_26020 gene holA CDS complement(785206..785706) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26030 CDS complement(785732..788320) product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454506.1 transl_table 11 codon_start 1 locus_tag LOCUS_26040 gene leuS CDS 788412..788900 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26050 CDS 788959..789732 product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266403.1 transl_table 11 codon_start 1 locus_tag LOCUS_26060 CDS complement(789830..790558) product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071865.1 transl_table 11 codon_start 1 locus_tag LOCUS_26070 gene phoU CDS 790850..791644 product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201215821.1 transl_table 11 codon_start 1 locus_tag LOCUS_26080 CDS 791903..794431 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26090 CDS 794794..795393 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26100 CDS complement(795864..798248) product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015154897.1 transl_table 11 codon_start 1 locus_tag LOCUS_26110 CDS 798807..799325 product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088185.1 transl_table 11 codon_start 1 locus_tag LOCUS_26120 CDS 799303..800367 product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389193.1 transl_table 11 codon_start 1 locus_tag LOCUS_26130 CDS 800732..801436 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26140 CDS complement(801907..802707) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26150 note possible pseudo, frameshifted CDS complement(802728..802994) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26160 note possible pseudo, frameshifted CDS complement(803033..803269) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26170 CDS 803381..804727 product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_114714636.1 transl_table 11 codon_start 1 locus_tag LOCUS_26180 CDS complement(804757..805530) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26190 CDS 806403..807011 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26200 CDS 807023..808798 product bifunctional metallophosphatase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085439.1 transl_table 11 codon_start 1 locus_tag LOCUS_26210 CDS complement(809021..809764) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26220 CDS complement(809845..811494) product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037727.1 transl_table 11 codon_start 1 locus_tag LOCUS_26230 CDS complement(811659..813299) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26240 CDS 813488..813847 product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198701.1 transl_table 11 codon_start 1 locus_tag LOCUS_26250 CDS 813844..814323 product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095198.1 transl_table 11 codon_start 1 locus_tag LOCUS_26260 CDS 814342..814698 product arsenite efflux transporter metallochaperone ArsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817072.1 transl_table 11 codon_start 1 locus_tag LOCUS_26270 gene arsD CDS 814716..816491 product arsenical pump-driving ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705614.1 transl_table 11 codon_start 1 locus_tag LOCUS_26280 gene arsA CDS 816555..817001 product ArsI/CadI family heavy metal resistance metalloenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184724.1 transl_table 11 codon_start 1 locus_tag LOCUS_26290 CDS 817023..818075 product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000826560.1 transl_table 11 codon_start 1 locus_tag LOCUS_26300 gene arsB CDS 818139..818345 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26310 CDS 818497..818760 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26320 CDS 819093..820874 product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226417.1 transl_table 11 codon_start 1 locus_tag LOCUS_26330 CDS 820876..821715 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26340 CDS 821705..822244 product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582501.1 transl_table 11 codon_start 1 locus_tag LOCUS_26350 CDS 822257..823768 product Ni/Fe hydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582502.1 transl_table 11 codon_start 1 locus_tag LOCUS_26360 CDS 823765..824220 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26370 CDS 824592..825242 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26380 CDS complement(825475..826251) product ethanolamine ammonia-lyase subunit EutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114907.1 transl_table 11 codon_start 1 locus_tag LOCUS_26390 gene eutC CDS complement(826254..827636) product ethanolamine ammonia-lyase subunit EutB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037404.1 transl_table 11 codon_start 1 locus_tag LOCUS_26400 CDS 827789..829279 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000778115.1 transl_table 11 codon_start 1 locus_tag LOCUS_26410 CDS 829409..830038 product DUF47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036867.1 transl_table 11 codon_start 1 locus_tag LOCUS_26420 CDS 830049..831161 product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036868.1 transl_table 11 codon_start 1 locus_tag LOCUS_26430 CDS 831330..831458 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26440 CDS complement(831627..832211) product DUF2799 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462742.1 transl_table 11 codon_start 1 locus_tag LOCUS_26450 CDS complement(832888..833076) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26460 CDS complement(833156..833473) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26470 CDS 833741..833953 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26480 CDS complement(833957..834796) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26490 note possible pseudo, internal stop codon, frameshifted CDS complement(834793..835182) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26500 CDS complement(835372..835737) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26510 CDS complement(835737..836804) product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073356551.1 transl_table 11 codon_start 1 locus_tag LOCUS_26520 CDS 837479..838675 product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480579.1 transl_table 11 codon_start 1 locus_tag LOCUS_26530 CDS complement(838726..839697) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26540 CDS 839854..840147 product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018210984.1 transl_table 11 codon_start 1 locus_tag LOCUS_26550 CDS 840228..841043 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26560 note possible pseudo, frameshifted CDS complement(841098..841481) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26570 CDS 841826..842398 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26580 CDS 842417..842728 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26590 CDS 843422..843766 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26600 CDS 843748..844260 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26610 CDS complement(844993..848190) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26620 CDS complement(848221..849672) product conjugal transfer protein TraH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_175404606.1 transl_table 11 codon_start 1 locus_tag LOCUS_26630 CDS complement(849669..850679) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26640 CDS 851167..851646 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26650 CDS complement(851935..852183) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26660 CDS complement(852192..852506) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26670 CDS complement(852902..854119) product PepSY-associated TM helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143960.1 transl_table 11 codon_start 1 locus_tag LOCUS_26680 CDS complement(854314..856779) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26690 CDS complement(857040..858005) product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070694233.1 transl_table 11 codon_start 1 locus_tag LOCUS_26700 CDS complement(858012..858518) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524116.1 transl_table 11 codon_start 1 locus_tag LOCUS_26710 CDS complement(859232..860254) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26720 CDS complement(860392..862122) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26730 CDS complement(862109..862324) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26740 CDS complement(862484..863677) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26750 CDS complement(863895..865376) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26760 CDS complement(866254..867123) product plasmid replication initiator TrfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815848.1 transl_table 11 codon_start 1 locus_tag LOCUS_26770 gene trfA CDS complement(867134..867598) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26780 CDS 867730..870132 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26790 CDS 870129..871973 product conjugative transfer system coupling protein TraD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205050578.1 transl_table 11 codon_start 1 locus_tag LOCUS_26800 gene traD CDS 871970..872602 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26810 CDS complement(872700..873107) product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771285.1 transl_table 11 codon_start 1 locus_tag LOCUS_26820 CDS complement(873110..873805) product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768984.1 transl_table 11 codon_start 1 locus_tag LOCUS_26830 CDS complement(873955..874761) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26840 CDS complement(874758..875075) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26850 CDS complement(875091..878312) product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123110.1 transl_table 11 codon_start 1 locus_tag LOCUS_26860 CDS complement(878305..879468) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071226.1 transl_table 11 codon_start 1 locus_tag LOCUS_26870 CDS complement(879465..880844) product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188537.1 transl_table 11 codon_start 1 locus_tag LOCUS_26880 CDS complement(880952..882145) product PepSY-associated TM helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087276.1 transl_table 11 codon_start 1 locus_tag LOCUS_26890 CDS 882524..882991 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26900 note possible pseudo, frameshifted CDS complement(883035..883988) product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389193.1 transl_table 11 codon_start 1 locus_tag LOCUS_26910 CDS complement(884077..886461) product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535630.1 transl_table 11 codon_start 1 locus_tag LOCUS_26920 CDS complement(886477..888162) product cyclic peptide export ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057486.1 transl_table 11 codon_start 1 locus_tag LOCUS_26930 CDS 888953..889465 product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082669.1 transl_table 11 codon_start 1 locus_tag LOCUS_26940 CDS 889562..889780 product MbtH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089636.1 transl_table 11 codon_start 1 locus_tag LOCUS_26950 CDS complement(889907..890614) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26960 note possible pseudo, frameshifted CDS complement(890611..891522) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26970 note possible pseudo, frameshifted CDS complement(891537..891905) product carbamoyltransferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035667843.1 transl_table 11 codon_start 1 locus_tag LOCUS_26980 CDS complement(892009..892305) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26990 CDS complement(892305..893039) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27000 CDS complement(893646..894986) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27010 CDS complement(895052..896215) product PepSY-associated TM helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143960.1 transl_table 11 codon_start 1 locus_tag LOCUS_27020 CDS complement(896267..897838) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27030 note possible pseudo, frameshifted CDS complement(897745..898737) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27040 note possible pseudo, frameshifted CDS complement(899420..903982) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27050 CDS complement(903979..906132) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27060 CDS complement(907398..909539) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27070 CDS complement(910825..914157) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27080 CDS complement(914188..914391) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27090 CDS complement(914366..914932) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27100 CDS complement(915124..916722) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551694.1 transl_table 11 codon_start 1 locus_tag LOCUS_27110 CDS complement(916805..922108) product non-ribosomal peptide synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103872.1 transl_table 11 codon_start 1 locus_tag LOCUS_27120 CDS 922486..922767 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27130 CDS 922764..923375 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27140 CDS 923372..924349 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27150 CDS 924349..925728 product IncHI-type conjugal transfer protein TrhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000351840.1 transl_table 11 codon_start 1 locus_tag LOCUS_27160 gene trhB CDS 925756..926580 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27170 CDS 926577..927089 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27180 CDS 927221..927520 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27190 CDS 927534..927791 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27200 CDS 927788..930202 product TraC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331477.1 transl_table 11 codon_start 1 locus_tag LOCUS_27210 CDS 930192..930509 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27220 CDS 930601..931053 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27230 CDS 931040..932239 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27240 CDS 932236..933267 product IncHI-type conjugal transfer protein TrhU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011011070.1 transl_table 11 codon_start 1 locus_tag LOCUS_27250 gene trhU CDS 933273..936050 product IncHI-type conjugal transfer protein TrhN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000682729.1 transl_table 11 codon_start 1 locus_tag LOCUS_27260 gene trhN CDS complement(936064..936336) product DNA-binding protein HU-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087931.1 transl_table 11 codon_start 1 locus_tag LOCUS_27270 gene hupB CDS complement(936400..937551) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27280 CDS complement(937538..937891) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27290 CDS 938056..938349 product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018210984.1 transl_table 11 codon_start 1 locus_tag LOCUS_27300 CDS 938409..939245 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27310 note possible pseudo, frameshifted CDS 939401..939832 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27320 CDS 939991..940224 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27330 CDS complement(940577..941107) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27340 CDS complement(941416..942438) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27350 CDS 942566..942781 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27360 CDS 942814..943227 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27370 CDS complement(943396..943734) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27380 CDS complement(943777..944403) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27390 CDS complement(944563..947619) product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114402.1 transl_table 11 codon_start 1 locus_tag LOCUS_27400 CDS complement(947616..948740) product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022383.1 transl_table 11 codon_start 1 locus_tag LOCUS_27410 CDS complement(948727..950055) product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895634.1 transl_table 11 codon_start 1 locus_tag LOCUS_27420 CDS complement(950123..952564) product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114406.1 transl_table 11 codon_start 1 locus_tag LOCUS_27430 CDS complement(952590..954044) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948598.1 transl_table 11 codon_start 1 locus_tag LOCUS_27440 CDS complement(954159..958022) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27450 CDS complement(958022..961189) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27460 CDS complement(961347..961889) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27470 CDS complement(961975..962175) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27480 CDS complement(962172..962840) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27490 CDS 963253..963684 product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000157067.1 transl_table 11 codon_start 1 locus_tag LOCUS_27500 CDS 963827..964867 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27510 CDS 964963..965298 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27520 CDS 965295..966296 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27530 CDS 966344..966598 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27540 CDS 966614..966826 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27550 CDS 966935..967876 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942803.1 transl_table 11 codon_start 1 locus_tag LOCUS_27560 CDS 967879..968637 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27570 CDS 968722..969900 product DUF3150 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942805.1 transl_table 11 codon_start 1 locus_tag LOCUS_27580 CDS 969989..971809 product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942806.1 transl_table 11 codon_start 1 locus_tag LOCUS_27590 CDS 972163..972696 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27600 CDS complement(972674..973051) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27610 CDS 973217..973879 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27620 CDS 974031..974528 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27630 CDS 974644..976407 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27640 CDS 976539..978134 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27650 CDS 978407..978880 product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068477.1 transl_table 11 codon_start 1 locus_tag LOCUS_27660 gene radC CDS complement(979545..979994) product nickel-responsive transcriptional regulator NikR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940151.1 transl_table 11 codon_start 1 locus_tag LOCUS_27670 gene nikR CDS 980125..980703 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27680 CDS 980718..981122 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27690 CDS 981129..981521 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27700 CDS 981518..982132 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27710 CDS 982169..982642 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965607.1 transl_table 11 codon_start 1 locus_tag LOCUS_27720 CDS 982682..983152 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27730 CDS 983199..983774 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27740 CDS 983929..984297 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27750 CDS 984482..985147 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246025.1 transl_table 11 codon_start 1 locus_tag LOCUS_27760 CDS 985144..986469 product two-component system sensor histidine kinase CarS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090493.1 transl_table 11 codon_start 1 locus_tag LOCUS_27770 gene carS CDS 986604..988874 product TonB-dependent receptor family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918028.1 transl_table 11 codon_start 1 locus_tag LOCUS_27780 CDS complement(988953..989156) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27790 CDS complement(989149..989466) product DNA-binding protein HU-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006081127.1 transl_table 11 codon_start 1 locus_tag LOCUS_27800 gene hupB CDS complement(989893..991212) product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177034907.1 transl_table 11 codon_start 1 locus_tag LOCUS_27810 gene ltrA CDS complement(991712..991978) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27820 CDS 993195..993488 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27830 CDS complement(993789..993956) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27840 CDS 994113..994706 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27850 CDS 994718..995185 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27860 CDS 995198..995422 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27870 tRNA complement(995585..995660) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00230 tRNA complement(995684..995760) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00240 tRNA complement(995817..995907) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00250 CDS complement(995918..996109) product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000906486.1 transl_table 11 codon_start 1 locus_tag LOCUS_27880 gene csrA CDS complement(996271..996462) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27890 CDS 997293..997634 product zinc ribbon domain-containing protein YjdM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404727.1 transl_table 11 codon_start 1 locus_tag LOCUS_27900 CDS 998169..999644 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207247.1 transl_table 11 codon_start 1 locus_tag LOCUS_27910 CDS 999724..1000011 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27920 CDS 1000040..1001767 product bifunctional protein-serine/threonine kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965821.1 transl_table 11 codon_start 1 locus_tag LOCUS_27930 CDS 1002259..1003065 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074291.1 transl_table 11 codon_start 1 locus_tag LOCUS_27940 CDS complement(1003277..1005154) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27950 CDS complement(1005151..1007724) product DUF2309 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122713.1 transl_table 11 codon_start 1 locus_tag LOCUS_27960 CDS 1008051..1009697 product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615587.1 transl_table 11 codon_start 1 locus_tag LOCUS_27970 CDS 1009845..1010558 product DUF2490 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945798.1 transl_table 11 codon_start 1 locus_tag LOCUS_27980 CDS 1010609..1013143 product magnesium-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000402038.1 transl_table 11 codon_start 1 locus_tag LOCUS_27990 gene mgtA CDS complement(1013229..1013378) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28000 CDS complement(1013426..1013710) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28010 note possible pseudo, internal stop codon, frameshifted CDS complement(1013771..1014082) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28020 CDS complement(1014576..1015205) product protein-methionine-sulfoxide reductase heme-binding subunit MsrQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527905.1 transl_table 11 codon_start 1 locus_tag LOCUS_28030 gene msrQ CDS complement(1015209..1016141) product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527906.1 transl_table 11 codon_start 1 locus_tag LOCUS_28040 gene msrP CDS complement(1016188..1016922) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28050 CDS complement(1016919..1017440) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28060 CDS complement(1017444..1018220) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28070 CDS complement(1018204..1019085) product DUF692 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173508789.1 transl_table 11 codon_start 1 locus_tag LOCUS_28080 CDS complement(1019220..1019498) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28090 CDS 1019767..1021632 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28100 CDS 1022034..1023380 product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941495.1 transl_table 11 codon_start 1 locus_tag LOCUS_28110 CDS 1023403..1024101 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28120 note possible pseudo, frameshifted CDS 1024071..1024571 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28130 note possible pseudo, frameshifted CDS 1024593..1027661 product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202770.1 transl_table 11 codon_start 1 locus_tag LOCUS_28140 CDS 1027671..1027997 product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140691.1 transl_table 11 codon_start 1 locus_tag LOCUS_28150 CDS 1028003..1029139 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28160 CDS 1029278..1029466 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28170 note possible pseudo, internal stop codon CDS 1029487..1030509 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28180 CDS 1030568..1031992 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28190 CDS 1032081..1033478 product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970749.1 transl_table 11 codon_start 1 locus_tag LOCUS_28200 CDS complement(1035401..1035571) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28210 CDS 1035907..1036170 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28220 CDS complement(1036555..1037583) product DUF4365 and DUF1817 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066499817.1 transl_table 11 codon_start 1 locus_tag LOCUS_28230 CDS complement(1037649..1039418) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974102.1 transl_table 11 codon_start 1 locus_tag LOCUS_28240 CDS complement(1039415..1040596) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28250 CDS complement(1040589..1041665) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546375.1 transl_table 11 codon_start 1 locus_tag LOCUS_28260 CDS complement(1041681..1043534) product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545811.1 transl_table 11 codon_start 1 locus_tag LOCUS_28270 CDS complement(1043710..1044900) product enoyl-ACP reductase FabV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102929.1 transl_table 11 codon_start 1 locus_tag LOCUS_28280 gene fabV CDS 1044990..1045187 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28290 CDS complement(1045261..1047129) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206817666.1 transl_table 11 codon_start 1 locus_tag LOCUS_28300 gene ppiD tRNA complement(1047228..1047304) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00260 tRNA complement(1047311..1047386) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00270 CDS complement(1047400..1047672) product DNA-binding protein HU-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006081127.1 transl_table 11 codon_start 1 locus_tag LOCUS_28310 gene hupB CDS complement(1047880..1050297) product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087926.1 transl_table 11 codon_start 1 locus_tag LOCUS_28320 gene lon CDS complement(1050472..1051749) product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087924.1 transl_table 11 codon_start 1 locus_tag LOCUS_28330 gene clpX CDS complement(1051853..1052488) product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098129.1 transl_table 11 codon_start 1 locus_tag LOCUS_28340 gene clpP CDS complement(1052505..1053800) product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267215.1 transl_table 11 codon_start 1 locus_tag LOCUS_28350 gene tig tRNA complement(1053909..1053992) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00280 CDS 1054062..1054520 product DUF192 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038368.1 transl_table 11 codon_start 1 locus_tag LOCUS_28360 CDS complement(1054523..1056844) product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958589.1 transl_table 11 codon_start 1 locus_tag LOCUS_28370 gene topA CDS complement(1056861..1057328) product DUF494 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038834.1 transl_table 11 codon_start 1 locus_tag LOCUS_28380 CDS complement(1057337..1058392) product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807293.1 transl_table 11 codon_start 1 locus_tag LOCUS_28390 gene dprA CDS complement(1058491..1059522) product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097294.1 transl_table 11 codon_start 1 locus_tag LOCUS_28400 CDS 1059804..1060307 product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401459.1 transl_table 11 codon_start 1 locus_tag LOCUS_28410 gene def CDS 1060320..1061246 product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070447.1 transl_table 11 codon_start 1 locus_tag LOCUS_28420 gene fmt CDS 1061243..1062538 product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114643.1 transl_table 11 codon_start 1 locus_tag LOCUS_28430 gene rsmB CDS 1062552..1063079 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28440 CDS 1063061..1065217 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807333.1 transl_table 11 codon_start 1 locus_tag LOCUS_28450 CDS 1065214..1066575 product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087262.1 transl_table 11 codon_start 1 locus_tag LOCUS_28460 CDS 1066649..1067077 product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002918559.1 transl_table 11 codon_start 1 locus_tag LOCUS_28470 gene rplM CDS 1067093..1067482 product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005336286.1 transl_table 11 codon_start 1 locus_tag LOCUS_28480 gene rpsI CDS complement(1067552..1068064) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28490 CDS 1068407..1069759 product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088036.1 transl_table 11 codon_start 1 locus_tag LOCUS_28500 CDS 1069756..1070424 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088037.1 transl_table 11 codon_start 1 locus_tag LOCUS_28510 CDS complement(1070527..1070943) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28520 CDS complement(1071209..1072012) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28530 CDS complement(1072015..1073220) product DUF3322 and DUF2220 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727563.1 transl_table 11 codon_start 1 locus_tag LOCUS_28540 CDS complement(1073217..1076594) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039227.1 transl_table 11 codon_start 1 locus_tag LOCUS_28550 CDS complement(1076824..1077456) product DUF4194 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727561.1 transl_table 11 codon_start 1 locus_tag LOCUS_28560 CDS complement(1077724..1078320) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201418997.1 transl_table 11 codon_start 1 locus_tag LOCUS_28570 CDS complement(1078323..1079438) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28580 CDS complement(1080177..1081535) product DUF3375 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892661.1 transl_table 11 codon_start 1 locus_tag LOCUS_28590 CDS 1081871..1083607 product acetolactate synthase 3 catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522422.1 transl_table 11 codon_start 1 locus_tag LOCUS_28600 CDS 1083608..1084099 product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186134.1 transl_table 11 codon_start 1 locus_tag LOCUS_28610 gene ilvN CDS 1084132..1085148 product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095066.1 transl_table 11 codon_start 1 locus_tag LOCUS_28620 gene ilvC CDS 1085296..1085994 product outer membrane protein OmpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102209.1 transl_table 11 codon_start 1 locus_tag LOCUS_28630 CDS 1086800..1087540 product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073396.1 transl_table 11 codon_start 1 locus_tag LOCUS_28640 gene pssA CDS 1087544..1088383 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28650 CDS 1088641..1089525 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28660 CDS 1089696..1090574 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28670 CDS 1090799..1091770 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28680 CDS 1092050..1093594 product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522419.1 transl_table 11 codon_start 1 locus_tag LOCUS_28690 CDS 1093608..1094414 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28700 CDS 1094419..1094973 product ribosomal protein S18-alanine N-acetyltransferase RimI/CoxH2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768924.1 transl_table 11 codon_start 1 locus_tag LOCUS_28710 gene rimI CDS complement(1095077..1095244) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28720 CDS 1095823..1095951 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28730 CDS complement(1096549..1098057) product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037727.1 transl_table 11 codon_start 1 locus_tag LOCUS_28740 CDS complement(1098103..1099563) product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118259.1 transl_table 11 codon_start 1 locus_tag LOCUS_28750 gene lnt CDS 1099762..1101270 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28760 CDS complement(1101248..1102147) product 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958093.1 transl_table 11 codon_start 1 locus_tag LOCUS_28770 CDS complement(1102150..1103874) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28780 CDS complement(1103938..1104669) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28790 CDS complement(1104672..1104977) product DUF1244 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000046692.1 transl_table 11 codon_start 1 locus_tag LOCUS_28800 CDS 1105090..1105419 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28810 CDS 1105447..1105989 product septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192037.1 transl_table 11 codon_start 1 locus_tag LOCUS_28820 CDS 1105989..1106291 product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767703.1 transl_table 11 codon_start 1 locus_tag LOCUS_28830 CDS 1106288..1106551 product BolA/IbaG family iron-sulfur metabolism protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199917.1 transl_table 11 codon_start 1 locus_tag LOCUS_28840 CDS 1106566..1107546 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529440.1 transl_table 11 codon_start 1 locus_tag LOCUS_28850 CDS complement(1107638..1107841) product bacterioferritin-associated ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092075.1 transl_table 11 codon_start 1 locus_tag LOCUS_28860 CDS 1108080..1108556 product formate dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064347.1 transl_table 11 codon_start 1 locus_tag LOCUS_28870 CDS 1108556..1110097 product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064348.1 transl_table 11 codon_start 1 locus_tag LOCUS_28880 CDS 1110118..1112970 product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809310.1 transl_table 11 codon_start 1 locus_tag LOCUS_28890 gene fdhF CDS 1112985..1113824 product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037498.1 transl_table 11 codon_start 1 locus_tag LOCUS_28900 gene fdhD CDS 1113828..1114040 product formate dehydrogenase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190152.1 transl_table 11 codon_start 1 locus_tag LOCUS_28910 CDS complement(1114170..1115462) product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706511.1 transl_table 11 codon_start 1 locus_tag LOCUS_28920 CDS complement(1115495..1116142) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28930 CDS complement(1116164..1117522) product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706512.1 transl_table 11 codon_start 1 locus_tag LOCUS_28940 CDS complement(1117524..1119674) product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016356916.1 transl_table 11 codon_start 1 locus_tag LOCUS_28950 CDS complement(1119786..1120823) product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704773.1 transl_table 11 codon_start 1 locus_tag LOCUS_28960 gene truD CDS complement(1120974..1121240) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28970 note possible pseudo, frameshifted CDS complement(1121279..1121689) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28980 CDS complement(1121783..1122079) product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092409793.1 transl_table 11 codon_start 1 locus_tag LOCUS_28990 CDS complement(1122102..1123109) product DUF4325 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682079.1 transl_table 11 codon_start 1 locus_tag LOCUS_29000 CDS complement(1123272..1124525) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29010 CDS complement(1124525..1124917) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29020 CDS 1125271..1126503 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29030 CDS 1126609..1127517 product stage 0 sporulation protein Spo0J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001051832.1 transl_table 11 codon_start 1 locus_tag LOCUS_29040 gene spo0J CDS 1128214..1129230 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29050 CDS 1129699..1130571 product IS5-like element ISVpa3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021706804.1 transl_table 11 codon_start 1 locus_tag LOCUS_29060 CDS 1130688..1130870 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29070 CDS 1130867..1131064 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29080 CDS 1131048..1131659 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29090 CDS 1131649..1133424 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29100 CDS 1133818..1134039 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29110 CDS 1134118..1134627 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29120 CDS complement(1134873..1135037) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29130 CDS complement(1135276..1136859) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29140 CDS complement(1136843..1137358) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29150 CDS complement(1137413..1138957) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29160 CDS complement(1138994..1140811) product cytochrome D1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941908.1 transl_table 11 codon_start 1 locus_tag LOCUS_29170 CDS complement(1140947..1141501) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29180 CDS complement(1141536..1147475) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29190 CDS complement(1148487..1148996) product DUF1993 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083593.1 transl_table 11 codon_start 1 locus_tag LOCUS_29200 CDS 1149154..1150626 product IS1182-like element ISPa22 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112390.1 transl_table 11 codon_start 1 locus_tag LOCUS_29210 CDS 1151208..1153262 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29220 CDS 1153259..1154551 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29230 CDS 1154564..1154761 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29240 CDS 1154748..1155272 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29250 CDS 1155265..1158492 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29260 CDS 1158587..1159186 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29270 CDS complement(1159290..1159682) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29280 CDS 1160000..1160470 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29290 CDS complement(1160951..1164286) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29300 CDS complement(1164408..1164977) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29310 CDS complement(1164968..1166026) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29320 CDS complement(1166082..1167074) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29330 CDS 1168009..1169166 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29340 CDS complement(1169135..1169311) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29350 CDS 1169341..1169985 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29360 CDS 1170115..1171554 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29370 CDS 1171538..1172386 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29380 CDS 1172376..1173809 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29390 CDS 1173809..1174762 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29400 CDS 1174749..1174907 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29410 CDS complement(1175182..1175655) product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068477.1 transl_table 11 codon_start 1 locus_tag LOCUS_29420 gene radC CDS complement(1175744..1176760) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042012908.1 transl_table 11 codon_start 1 locus_tag LOCUS_29430 CDS complement(1176848..1177855) product YqaJ viral recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705014.1 transl_table 11 codon_start 1 locus_tag LOCUS_29440 CDS complement(1178106..1179080) product DUF932 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705015.1 transl_table 11 codon_start 1 locus_tag LOCUS_29450 CDS complement(1179193..1179537) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29460 CDS complement(1179957..1181198) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29470 CDS 1181245..1181649 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29480 CDS 1181727..1182578 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29490 tRNA complement(1182668..1182743) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00290 CDS complement(1182846..1183394) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003395104.1 transl_table 11 codon_start 1 locus_tag LOCUS_29500 CDS complement(1183372..1184745) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094421.1 transl_table 11 codon_start 1 locus_tag LOCUS_29510 CDS complement(1185013..1185288) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29520 CDS complement(1185354..1185557) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29530 CDS 1185852..1186964 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29540 CDS 1187064..1187834 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29550 CDS complement(1188034..1189686) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29560 CDS complement(1189728..1191095) product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209220.1 transl_table 11 codon_start 1 locus_tag LOCUS_29570 gene radA CDS complement(1191108..1191464) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29580 CDS complement(1191468..1191770) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29590 CDS complement(1191944..1192195) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29600 CDS 1192523..1192765 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29610 CDS 1192872..1193711 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29620 CDS 1193745..1194155 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29630 CDS complement(1194320..1195912) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29640 CDS complement(1195973..1197469) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29650 CDS complement(1197518..1199107) product DUF1957 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393415.1 transl_table 11 codon_start 1 locus_tag LOCUS_29660 CDS complement(1199115..1199801) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29670 CDS 1199986..1202184 product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021995.1 transl_table 11 codon_start 1 locus_tag LOCUS_29680 gene glgX CDS complement(1202245..1202757) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29690 CDS complement(1202754..1203389) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29700 CDS complement(1203386..1205194) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29710 CDS 1205331..1206503 product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071212.1 transl_table 11 codon_start 1 locus_tag LOCUS_29720 CDS 1206788..1207078 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29730 CDS 1207238..1207657 product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532891.1 transl_table 11 codon_start 1 locus_tag LOCUS_29740 CDS complement(1207959..1208198) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29750 CDS complement(1208575..1211676) product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328246.1 transl_table 11 codon_start 1 locus_tag LOCUS_29760 CDS complement(1211673..1212785) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267830.1 transl_table 11 codon_start 1 locus_tag LOCUS_29770 CDS complement(1212782..1214341) product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267829.1 transl_table 11 codon_start 1 locus_tag LOCUS_29780 CDS complement(1214331..1214999) product CerR family C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051073379.1 transl_table 11 codon_start 1 locus_tag LOCUS_29790 CDS complement(1215512..1217674) product hydrogenase maturation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880726.1 transl_table 11 codon_start 1 locus_tag LOCUS_29800 CDS complement(1217758..1218783) product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031151.1 transl_table 11 codon_start 1 locus_tag LOCUS_29810 CDS 1219091..1219606 product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626366.1 transl_table 11 codon_start 1 locus_tag LOCUS_29820 CDS 1219619..1220575 product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103466.1 transl_table 11 codon_start 1 locus_tag LOCUS_29830 CDS 1220702..1223047 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226992700.1 transl_table 11 codon_start 1 locus_tag LOCUS_29840 CDS 1223061..1224257 product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919650.1 transl_table 11 codon_start 1 locus_tag LOCUS_29850 CDS 1224429..1225331 product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028720.1 transl_table 11 codon_start 1 locus_tag LOCUS_29860 CDS 1225380..1226708 product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640422.1 transl_table 11 codon_start 1 locus_tag LOCUS_29870 CDS complement(1226717..1226923) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29880 CDS 1227053..1227355 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29890 CDS 1227364..1228212 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720152.1 transl_table 11 codon_start 1 locus_tag LOCUS_29900 CDS 1228226..1229290 product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083076.1 transl_table 11 codon_start 1 locus_tag LOCUS_29910 CDS 1229290..1229754 product guanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245084.1 transl_table 11 codon_start 1 locus_tag LOCUS_29920 gene guaD CDS complement(1229748..1230194) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29930 CDS 1230405..1230965 product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946377.1 transl_table 11 codon_start 1 locus_tag LOCUS_29940 gene hslV CDS 1230970..1232289 product HslU--HslV peptidase ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001293341.1 transl_table 11 codon_start 1 locus_tag LOCUS_29950 gene hslU CDS 1232292..1232681 product DUF971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190130.1 transl_table 11 codon_start 1 locus_tag LOCUS_29960 CDS 1232690..1233439 product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000227958.1 transl_table 11 codon_start 1 locus_tag LOCUS_29970 gene ubiE CDS 1233477..1234085 product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140873.1 transl_table 11 codon_start 1 locus_tag LOCUS_29980 CDS 1234069..1234704 product SCP2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001924284.1 transl_table 11 codon_start 1 locus_tag LOCUS_29990 CDS 1234719..1236287 product ubiquinone biosynthesis regulatory protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948590.1 transl_table 11 codon_start 1 locus_tag LOCUS_30000 gene ubiB CDS 1236455..1237342 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30010 CDS complement(1237679..1237879) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30020 CDS 1238314..1239900 product ExeA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071510.1 transl_table 11 codon_start 1 locus_tag LOCUS_30030 CDS 1239911..1240714 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30040 CDS complement(1240777..1242264) product DcaP family trimeric outer membrane transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042595882.1 transl_table 11 codon_start 1 locus_tag LOCUS_30050 CDS complement(1242268..1242741) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30060 CDS 1242909..1245782 product bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762959.1 transl_table 11 codon_start 1 locus_tag LOCUS_30070 gene glnE CDS 1245847..1246479 product ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060390369.1 transl_table 11 codon_start 1 locus_tag LOCUS_30080 CDS 1246579..1248228 product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968056.1 transl_table 11 codon_start 1 locus_tag LOCUS_30090 CDS complement(1248332..1249210) product TIR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461945.1 transl_table 11 codon_start 1 locus_tag LOCUS_30100 CDS 1249598..1250806 product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390983.1 transl_table 11 codon_start 1 locus_tag LOCUS_30110 CDS 1250803..1252737 product MacB family efflux pump subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390984.1 transl_table 11 codon_start 1 locus_tag LOCUS_30120 CDS 1252740..1254128 product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390985.1 transl_table 11 codon_start 1 locus_tag LOCUS_30130 CDS 1254567..1255475 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30140 CDS complement(1255525..1256511) product IS110-like element IS1663 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930320.1 transl_table 11 codon_start 1 locus_tag LOCUS_30150 CDS complement(1257158..1257688) product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112472.1 transl_table 11 codon_start 1 locus_tag LOCUS_30160 CDS complement(1257747..1257929) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30170 CDS complement(1257989..1258609) product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002761477.1 transl_table 11 codon_start 1 locus_tag LOCUS_30180 CDS complement(1258606..1259370) product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243194.1 transl_table 11 codon_start 1 locus_tag LOCUS_30190 gene xth CDS 1259443..1260846 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039281.1 transl_table 11 codon_start 1 locus_tag LOCUS_30200 CDS complement(1260895..1261383) product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539816.1 transl_table 11 codon_start 1 locus_tag LOCUS_30210 CDS 1262031..1264502 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188913.1 transl_table 11 codon_start 1 locus_tag LOCUS_30220 CDS 1264756..1265997 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30230 CDS 1266065..1266301 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30240 CDS 1266288..1266707 product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_220355038.1 transl_table 11 codon_start 1 locus_tag LOCUS_30250 CDS complement(1266704..1267606) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434910.1 transl_table 11 codon_start 1 locus_tag LOCUS_30260 CDS complement(1267733..1268536) product 4,5-DOPA dioxygenase extradiol inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174107.1 transl_table 11 codon_start 1 locus_tag LOCUS_30270 gene ygiD CDS complement(1268548..1269429) product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770654.1 transl_table 11 codon_start 1 locus_tag LOCUS_30280 CDS complement(1269457..1270056) product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004549943.1 transl_table 11 codon_start 1 locus_tag LOCUS_30290 CDS 1270159..1271058 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971003.1 transl_table 11 codon_start 1 locus_tag LOCUS_30300 CDS 1271203..1271880 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30310 CDS complement(1271974..1273566) product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444186.1 transl_table 11 codon_start 1 locus_tag LOCUS_30320 CDS complement(1273597..1274229) product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964129.1 transl_table 11 codon_start 1 locus_tag LOCUS_30330 gene can CDS complement(1274495..1275190) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389698.1 transl_table 11 codon_start 1 locus_tag LOCUS_30340 CDS 1275344..1275544 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30350 CDS complement(1275569..1276453) product inositol-1-monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370312.1 transl_table 11 codon_start 1 locus_tag LOCUS_30360 gene suhB CDS complement(1276471..1277442) product DUF1679 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261760.1 transl_table 11 codon_start 1 locus_tag LOCUS_30370 CDS 1277586..1278635 product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393512.1 transl_table 11 codon_start 1 locus_tag LOCUS_30380 CDS 1278715..1280586 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30390 CDS 1280583..1280780 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30400 CDS 1280792..1281133 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30410 CDS complement(1281709..1282482) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30420 CDS complement(1282490..1283371) product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070560.1 transl_table 11 codon_start 1 locus_tag LOCUS_30430 gene hslO CDS 1283447..1284079 product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269219.1 transl_table 11 codon_start 1 locus_tag LOCUS_30440 gene msrA CDS 1284336..1286189 product methanol/ethanol family PQQ-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969575.1 transl_table 11 codon_start 1 locus_tag LOCUS_30450 CDS 1286283..1287140 product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966732.1 transl_table 11 codon_start 1 locus_tag LOCUS_30460 CDS complement(1287156..1288628) product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259705.1 transl_table 11 codon_start 1 locus_tag LOCUS_30470 gene malQ CDS complement(1288647..1290338) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30480 CDS complement(1290328..1291608) product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071681.1 transl_table 11 codon_start 1 locus_tag LOCUS_30490 gene glgC CDS 1291824..1294004 product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390326.1 transl_table 11 codon_start 1 locus_tag LOCUS_30500 gene glgB CDS 1294015..1295448 product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020156.1 transl_table 11 codon_start 1 locus_tag LOCUS_30510 gene glgA CDS 1295438..1296229 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30520 CDS 1296348..1297427 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532971.1 transl_table 11 codon_start 1 locus_tag LOCUS_30530 CDS 1297428..1301189 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30540 CDS complement(1301182..1302018) product transporter associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957666.1 transl_table 11 codon_start 1 locus_tag LOCUS_30550 CDS complement(1302015..1302479) product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858677.1 transl_table 11 codon_start 1 locus_tag LOCUS_30560 gene ybeY CDS complement(1302483..1303472) product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763270.1 transl_table 11 codon_start 1 locus_tag LOCUS_30570 CDS complement(1303472..1304827) product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000038553.1 transl_table 11 codon_start 1 locus_tag LOCUS_30580 gene miaB CDS complement(1304933..1305655) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082451.1 transl_table 11 codon_start 1 locus_tag LOCUS_30590 CDS complement(1305703..1306317) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30600 CDS complement(1306418..1307110) product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463447.1 transl_table 11 codon_start 1 locus_tag LOCUS_30610 gene queC CDS complement(1307100..1307744) product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120697.1 transl_table 11 codon_start 1 locus_tag LOCUS_30620 gene queE CDS complement(1307757..1308623) product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004418664.1 transl_table 11 codon_start 1 locus_tag LOCUS_30630 gene ybgF CDS complement(1308620..1309186) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30640 CDS complement(1309251..1310534) product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038134.1 transl_table 11 codon_start 1 locus_tag LOCUS_30650 gene tolB CDS complement(1310557..1312080) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30660 CDS complement(1312089..1312547) product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072689.1 transl_table 11 codon_start 1 locus_tag LOCUS_30670 gene tolR CDS complement(1312544..1313221) product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086125.1 transl_table 11 codon_start 1 locus_tag LOCUS_30680 gene tolQ CDS complement(1313221..1313616) product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001091290.1 transl_table 11 codon_start 1 locus_tag LOCUS_30690 gene ybgC CDS complement(1313635..1314672) product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211198.1 transl_table 11 codon_start 1 locus_tag LOCUS_30700 gene ruvB CDS complement(1314669..1315271) product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086122.1 transl_table 11 codon_start 1 locus_tag LOCUS_30710 gene ruvA CDS complement(1315268..1315714) product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000974712.1 transl_table 11 codon_start 1 locus_tag LOCUS_30720 gene ruvC CDS complement(1315799..1316551) product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072407.1 transl_table 11 codon_start 1 locus_tag LOCUS_30730 CDS complement(1316620..1317261) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30740 CDS complement(1317258..1318874) product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020641.1 transl_table 11 codon_start 1 locus_tag LOCUS_30750 gene serA CDS 1318937..1319413 product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815191.1 transl_table 11 codon_start 1 locus_tag LOCUS_30760 rRNA complement(1319548..1319657) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00070 rRNA complement(1319860..1322752) product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00080 tRNA complement(1323077..1323152) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00300 tRNA complement(1323269..1323345) product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00310 rRNA complement(1323407..1324935) product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00090 CDS complement(1325293..1326489) product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071526.1 transl_table 11 codon_start 1 locus_tag LOCUS_30770 gene tyrS CDS 1326625..1327929 product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129241.1 transl_table 11 codon_start 1 locus_tag LOCUS_30780 CDS 1327913..1329046 product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770633.1 transl_table 11 codon_start 1 locus_tag LOCUS_30790 CDS complement(1329038..1329370) product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194247.1 transl_table 11 codon_start 1 locus_tag LOCUS_30800 gene erpA CDS 1329625..1330302 product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040534536.1 transl_table 11 codon_start 1 locus_tag LOCUS_30810 CDS 1330455..1330952 product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141750.1 transl_table 11 codon_start 1 locus_tag LOCUS_30820 gene sixA CDS complement(1330969..1332108) product heme d1 biosynthesis radical SAM protein NirJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124643914.1 transl_table 11 codon_start 1 locus_tag LOCUS_30830 gene nirJ CDS complement(1332112..1332591) product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084858.1 transl_table 11 codon_start 1 locus_tag LOCUS_30840 CDS complement(1332591..1333034) product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084860.1 transl_table 11 codon_start 1 locus_tag LOCUS_30850 CDS complement(1333037..1333606) product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111534.1 transl_table 11 codon_start 1 locus_tag LOCUS_30860 CDS complement(1333599..1334054) product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084864.1 transl_table 11 codon_start 1 locus_tag LOCUS_30870 CDS complement(1334056..1335234) product heme d1 biosynthesis protein NirF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113241.1 transl_table 11 codon_start 1 locus_tag LOCUS_30880 gene nirF CDS complement(1335886..1336098) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30890 CDS complement(1336192..1336503) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30900 CDS complement(1336500..1338080) product cytochrome D1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068497115.1 transl_table 11 codon_start 1 locus_tag LOCUS_30910 CDS 1338286..1338858 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112585.1 transl_table 11 codon_start 1 locus_tag LOCUS_30920 CDS 1338945..1339928 product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704880.1 transl_table 11 codon_start 1 locus_tag LOCUS_30930 gene pdxA CDS 1339941..1341722 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30940 CDS 1341742..1342533 product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113212.1 transl_table 11 codon_start 1 locus_tag LOCUS_30950 gene rsmA CDS 1342700..1343338 product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406317.1 transl_table 11 codon_start 1 locus_tag LOCUS_30960 gene adk CDS 1343414..1344829 product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091399.1 transl_table 11 codon_start 1 locus_tag LOCUS_30970 gene leuC CDS 1344826..1345464 product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222556.1 transl_table 11 codon_start 1 locus_tag LOCUS_30980 gene leuD CDS 1345486..1346565 product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038427.1 transl_table 11 codon_start 1 locus_tag LOCUS_30990 gene leuB CDS 1346571..1347593 product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948008.1 transl_table 11 codon_start 1 locus_tag LOCUS_31000 CDS 1347609..1350671 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31010 CDS 1350992..1352494 product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986940.1 transl_table 11 codon_start 1 locus_tag LOCUS_31020 CDS complement(1352507..1353364) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102980.1 transl_table 11 codon_start 1 locus_tag LOCUS_31030 CDS complement(1353667..1354173) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31040 CDS 1354842..1355048 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31050 CDS 1355138..1356409 product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187436542.1 transl_table 11 codon_start 1 locus_tag LOCUS_31060 CDS 1356743..1357132 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31070 CDS complement(1357058..1357489) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31080 note possible pseudo, internal stop codon, frameshifted CDS complement(1357501..1358157) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31090 note possible pseudo, internal stop codon, frameshifted CDS complement(1358123..1358308) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31100 CDS complement(1358722..1359702) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31110 CDS 1359835..1360245 product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971139.1 transl_table 11 codon_start 1 locus_tag LOCUS_31120 CDS complement(1360296..1361096) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31130 note possible pseudo, frameshifted CDS complement(1361117..1361383) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31140 note possible pseudo, frameshifted CDS 1361500..1361769 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31150 CDS 1361801..1363387 product IS66 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147237312.1 transl_table 11 codon_start 1 locus_tag LOCUS_31160 CDS 1363495..1363677 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31170 CDS complement(1363940..1364206) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31180 note possible pseudo, frameshifted CDS complement(1364203..1364685) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31190 note possible pseudo, frameshifted CDS complement(1364818..1366812) product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102062.1 transl_table 11 codon_start 1 locus_tag LOCUS_31200 gene parE CDS complement(1366942..1367439) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31210 CDS 1368135..1368329 product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003379121.1 transl_table 11 codon_start 1 locus_tag LOCUS_31220 CDS 1368322..1369215 product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114915.1 transl_table 11 codon_start 1 locus_tag LOCUS_31230 CDS 1369334..1371193 product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266507.1 transl_table 11 codon_start 1 locus_tag LOCUS_31240 gene dxs CDS 1371209..1371724 product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173401881.1 transl_table 11 codon_start 1 locus_tag LOCUS_31250 CDS complement(1371767..1372786) product VacJ family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521932.1 transl_table 11 codon_start 1 locus_tag LOCUS_31260 CDS complement(1372808..1373413) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31270 CDS complement(1373460..1374563) product adenosyl-hopene transferase HpnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387821.1 transl_table 11 codon_start 1 locus_tag LOCUS_31280 gene hpnH CDS 1375003..1376094 product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144046.1 transl_table 11 codon_start 1 locus_tag LOCUS_31290 CDS 1376104..1378062 product squalene--hopene cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529547.1 transl_table 11 codon_start 1 locus_tag LOCUS_31300 gene shc CDS 1378059..1378763 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31310 CDS 1378845..1380230 product aminobacteriohopanetriol synthase HpnO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085794.1 transl_table 11 codon_start 1 locus_tag LOCUS_31320 gene hpnO CDS 1380241..1380600 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31330 CDS 1380606..1382237 product CopD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089646.1 transl_table 11 codon_start 1 locus_tag LOCUS_31340 CDS 1382240..1384102 product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266507.1 transl_table 11 codon_start 1 locus_tag LOCUS_31350 gene dxs CDS 1384111..1384848 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31360 CDS 1384947..1385429 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31370 note possible pseudo, frameshifted CDS 1385426..1385692 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31380 note possible pseudo, frameshifted CDS 1385728..1386495 product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337385.1 transl_table 11 codon_start 1 locus_tag LOCUS_31390 gene gloB CDS 1386581..1387444 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259484.1 transl_table 11 codon_start 1 locus_tag LOCUS_31400 CDS complement(1387446..1388579) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112793.1 transl_table 11 codon_start 1 locus_tag LOCUS_31410 CDS complement(1388830..1389630) product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771252.1 transl_table 11 codon_start 1 locus_tag LOCUS_31420 CDS complement(1389679..1390032) product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091119.1 transl_table 11 codon_start 1 locus_tag LOCUS_31430 CDS complement(1390037..1391038) product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104126.1 transl_table 11 codon_start 1 locus_tag LOCUS_31440 CDS complement(1391038..1391664) product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091125.1 transl_table 11 codon_start 1 locus_tag LOCUS_31450 gene tmk CDS complement(1391661..1392650) product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104128.1 transl_table 11 codon_start 1 locus_tag LOCUS_31460 gene mltG CDS complement(1392653..1393474) product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113994.1 transl_table 11 codon_start 1 locus_tag LOCUS_31470 gene pabC CDS complement(1393505..1394749) product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193086.1 transl_table 11 codon_start 1 locus_tag LOCUS_31480 gene fabF CDS complement(1394840..1395073) product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005300909.1 transl_table 11 codon_start 1 locus_tag LOCUS_31490 gene acpP CDS complement(1395251..1396183) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31500 CDS 1396352..1397038 product VIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918603.1 transl_table 11 codon_start 1 locus_tag LOCUS_31510 CDS 1397159..1397521 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31520 CDS complement(1397652..1398551) product ADP-ribosyl-[dinitrogen reductase] hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388763.1 transl_table 11 codon_start 1 locus_tag LOCUS_31530 gene draG CDS complement(1398548..1399354) product NAD(+)--dinitrogen-reductase ADP-D-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626076.1 transl_table 11 codon_start 1 locus_tag LOCUS_31540 CDS 1399662..1400351 product aquaporin Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705214.1 transl_table 11 codon_start 1 locus_tag LOCUS_31550 gene aqpZ CDS 1401456..1402802 product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_114714636.1 transl_table 11 codon_start 1 locus_tag LOCUS_31560 CDS 1402848..1403576 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31570 CDS 1403576..1404196 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31580 CDS complement(1404121..1404495) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31590 CDS 1404674..1405219 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31600 tRNA 1405270..1405345 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00320 tRNA 1405394..1405467 product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00330 tRNA 1405480..1405555 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00340 CDS complement(1405698..1409624) product FAD/FMN-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189879.1 transl_table 11 codon_start 1 locus_tag LOCUS_31610 CDS complement(1409723..1411390) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31620 CDS 1411701..1413455 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31630 CDS 1413566..1414378 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266520.1 transl_table 11 codon_start 1 locus_tag LOCUS_31640 CDS 1414447..1416708 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31650 CDS 1417030..1418352 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266386.1 transl_table 11 codon_start 1 locus_tag LOCUS_31660 CDS 1418349..1419005 product TIGR02646 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266385.1 transl_table 11 codon_start 1 locus_tag LOCUS_31670 CDS complement(1419243..1420619) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31680 CDS complement(1421270..1422019) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31690 CDS complement(1422395..1423345) product O antigen biosynthesis rhamnosyltransferase RfbN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000705149.1 transl_table 11 codon_start 1 locus_tag LOCUS_31700 gene rfbN CDS complement(1423338..1424540) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023660.1 transl_table 11 codon_start 1 locus_tag LOCUS_31710 CDS complement(1424563..1425432) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897935.1 transl_table 11 codon_start 1 locus_tag LOCUS_31720 CDS complement(1425429..1426220) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946557.1 transl_table 11 codon_start 1 locus_tag LOCUS_31730 CDS complement(1426224..1427153) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31740 CDS complement(1427189..1428508) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31750 CDS complement(1428519..1429763) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31760 CDS complement(1429773..1431992) product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268289.1 transl_table 11 codon_start 1 locus_tag LOCUS_31770 CDS complement(1432130..1433230) product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525085.1 transl_table 11 codon_start 1 locus_tag LOCUS_31780 CDS complement(1433243..1434664) product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037593.1 transl_table 11 codon_start 1 locus_tag LOCUS_31790 CDS complement(1435285..1435851) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31800 CDS complement(1435985..1439485) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31810 CDS complement(1440177..1441451) product heterodisulfide reductase-related iron-sulfur binding cluster inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258001.1 transl_table 11 codon_start 1 locus_tag LOCUS_31820 CDS complement(1441453..1441905) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31830 CDS complement(1441909..1442871) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31840 CDS complement(1442880..1443260) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31850 CDS complement(1443257..1443763) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31860 CDS complement(1443767..1444090) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31870 CDS complement(1444771..1445088) product ferredoxin III, nif-specific inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720698.1 transl_table 11 codon_start 1 locus_tag LOCUS_31880 gene fdxB CDS complement(1445098..1445316) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31890 CDS complement(1445322..1445795) product NifX-associated nitrogen fixation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389938.1 transl_table 11 codon_start 1 locus_tag LOCUS_31900 CDS complement(1446143..1446574) product nitrogen fixation protein NifX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069456695.1 transl_table 11 codon_start 1 locus_tag LOCUS_31910 gene nifX CDS complement(1446619..1448016) product nitrogenase iron-molybdenum cofactor biosynthesis protein NifN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389940.1 transl_table 11 codon_start 1 locus_tag LOCUS_31920 gene nifN CDS complement(1448019..1449497) product nitrogenase iron-molybdenum cofactor biosynthesis protein NifE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084554.1 transl_table 11 codon_start 1 locus_tag LOCUS_31930 gene nifE CDS 1449714..1450571 product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990820.1 transl_table 11 codon_start 1 locus_tag LOCUS_31940 CDS 1450615..1451412 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31950 CDS complement(1451509..1451709) product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941064.1 transl_table 11 codon_start 1 locus_tag LOCUS_31960 CDS complement(1451718..1452995) product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088518.1 transl_table 11 codon_start 1 locus_tag LOCUS_31970 CDS 1453168..1453593 product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114184.1 transl_table 11 codon_start 1 locus_tag LOCUS_31980 gene msrB CDS 1453590..1454897 product M18 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114800.1 transl_table 11 codon_start 1 locus_tag LOCUS_31990 CDS 1454945..1455526 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32000 CDS 1455519..1457879 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32010 CDS 1457888..1460047 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32020 CDS complement(1460044..1460466) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32030 CDS 1460347..1460559 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32040 CDS complement(1460562..1461335) product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087617.1 transl_table 11 codon_start 1 locus_tag LOCUS_32050 gene lpxA CDS complement(1461338..1462222) product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092629.1 transl_table 11 codon_start 1 locus_tag LOCUS_32060 gene xerD CDS complement(1462219..1462725) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32070 CDS complement(1462821..1463168) product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946144.1 transl_table 11 codon_start 1 locus_tag LOCUS_32080 gene rplS CDS complement(1463181..1463921) product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417802.1 transl_table 11 codon_start 1 locus_tag LOCUS_32090 gene trmD CDS complement(1463930..1464421) product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071567.1 transl_table 11 codon_start 1 locus_tag LOCUS_32100 gene rimM CDS complement(1464448..1464699) product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092643.1 transl_table 11 codon_start 1 locus_tag LOCUS_32110 gene rpsP CDS complement(1464788..1466143) product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704629.1 transl_table 11 codon_start 1 locus_tag LOCUS_32120 gene ffh CDS 1466270..1467067 product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187598607.1 transl_table 11 codon_start 1 locus_tag LOCUS_32130 gene ccsA CDS complement(1467113..1469608) product DUF115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073156.1 transl_table 11 codon_start 1 locus_tag LOCUS_32140 CDS complement(1469715..1470572) product flagellin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767010.1 transl_table 11 codon_start 1 locus_tag LOCUS_32150 CDS complement(1471118..1471450) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32160 CDS complement(1471450..1471836) product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082192.1 transl_table 11 codon_start 1 locus_tag LOCUS_32170 gene fliS CDS complement(1471852..1473249) product flagellar filament capping protein FliD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073119.1 transl_table 11 codon_start 1 locus_tag LOCUS_32180 gene fliD CDS complement(1473276..1473713) product flagellar protein FlaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943643.1 transl_table 11 codon_start 1 locus_tag LOCUS_32190 CDS complement(1473776..1474627) product flagellin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767010.1 transl_table 11 codon_start 1 locus_tag LOCUS_32200 CDS complement(1474755..1475807) product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261005.1 transl_table 11 codon_start 1 locus_tag LOCUS_32210 CDS complement(1475811..1476458) product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261004.1 transl_table 11 codon_start 1 locus_tag LOCUS_32220 CDS complement(1476455..1477522) product N-acetylneuraminate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459663.1 transl_table 11 codon_start 1 locus_tag LOCUS_32230 gene neuB CDS complement(1477519..1478697) product UDP-N-acetylglucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403378.1 transl_table 11 codon_start 1 locus_tag LOCUS_32240 gene neuC CDS complement(1478697..1479836) product LegC family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202419.1 transl_table 11 codon_start 1 locus_tag LOCUS_32250 CDS complement(1479829..1480809) product NAD-dependent 4,6-dehydratase LegB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942619.1 transl_table 11 codon_start 1 locus_tag LOCUS_32260 CDS complement(1480806..1481513) product acylneuraminate cytidylyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465710.1 transl_table 11 codon_start 1 locus_tag LOCUS_32270 CDS complement(1481565..1482629) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32280 CDS complement(1482685..1483812) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32290 CDS complement(1483829..1484854) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32300 CDS complement(1485077..1485895) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32310 CDS complement(1485913..1486359) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32320 CDS complement(1486830..1487468) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32330 CDS complement(1488040..1488960) product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002557036.1 transl_table 11 codon_start 1 locus_tag LOCUS_32340 CDS complement(1488960..1490072) product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546476.1 transl_table 11 codon_start 1 locus_tag LOCUS_32350 CDS complement(1490107..1492020) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32360 CDS complement(1492033..1493199) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32370 CDS complement(1493196..1497032) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32380 CDS complement(1497029..1498420) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32390 CDS complement(1498444..1499517) product transketolase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771829.1 transl_table 11 codon_start 1 locus_tag LOCUS_32400 CDS complement(1499510..1500505) product thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957741.1 transl_table 11 codon_start 1 locus_tag LOCUS_32410 CDS complement(1500502..1502022) product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088170.1 transl_table 11 codon_start 1 locus_tag LOCUS_32420 CDS complement(1502027..1502590) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32430 CDS complement(1502601..1503587) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088169.1 transl_table 11 codon_start 1 locus_tag LOCUS_32440 CDS complement(1503597..1504697) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32450 CDS complement(1504828..1507596) product Hsp70 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205537.1 transl_table 11 codon_start 1 locus_tag LOCUS_32460 CDS 1507958..1508881 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32470 CDS complement(1508953..1509615) product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098558.1 transl_table 11 codon_start 1 locus_tag LOCUS_32480 CDS complement(1509612..1510367) product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704774.1 transl_table 11 codon_start 1 locus_tag LOCUS_32490 gene surE CDS 1510468..1511001 product Smr/MutS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957861.1 transl_table 11 codon_start 1 locus_tag LOCUS_32500 CDS 1511255..1512295 product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869637.1 transl_table 11 codon_start 1 locus_tag LOCUS_32510 gene gap CDS complement(1513030..1513410) product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001216360.1 transl_table 11 codon_start 1 locus_tag LOCUS_32520 gene rplQ CDS complement(1513429..1514439) product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209013.1 transl_table 11 codon_start 1 locus_tag LOCUS_32530 gene rpoA CDS complement(1514464..1515084) product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215455.1 transl_table 11 codon_start 1 locus_tag LOCUS_32540 gene rpsD CDS complement(1515103..1515489) product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005319702.1 transl_table 11 codon_start 1 locus_tag LOCUS_32550 gene rpsK CDS complement(1515513..1515869) product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307991.1 transl_table 11 codon_start 1 locus_tag LOCUS_32560 gene rpsM CDS complement(1516078..1517403) product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806926.1 transl_table 11 codon_start 1 locus_tag LOCUS_32570 gene secY CDS complement(1517404..1517838) product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197941.1 transl_table 11 codon_start 1 locus_tag LOCUS_32580 gene rplO CDS complement(1517838..1518023) product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215447.1 transl_table 11 codon_start 1 locus_tag LOCUS_32590 gene rpmD CDS complement(1518030..1518536) product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940115.1 transl_table 11 codon_start 1 locus_tag LOCUS_32600 gene rpsE CDS complement(1518546..1518899) product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070627.1 transl_table 11 codon_start 1 locus_tag LOCUS_32610 gene rplR CDS complement(1518908..1519441) product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091945.1 transl_table 11 codon_start 1 locus_tag LOCUS_32620 gene rplF CDS complement(1519457..1519852) product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007644434.1 transl_table 11 codon_start 1 locus_tag LOCUS_32630 gene rpsH CDS complement(1519881..1520186) product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093701.1 transl_table 11 codon_start 1 locus_tag LOCUS_32640 gene rpsN CDS complement(1520198..1520737) product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215436.1 transl_table 11 codon_start 1 locus_tag LOCUS_32650 gene rplE CDS complement(1520750..1521067) product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070623.1 transl_table 11 codon_start 1 locus_tag LOCUS_32660 gene rplX CDS complement(1521078..1521446) product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307975.1 transl_table 11 codon_start 1 locus_tag LOCUS_32670 gene rplN CDS complement(1521474..1521737) product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093717.1 transl_table 11 codon_start 1 locus_tag LOCUS_32680 gene rpsQ CDS complement(1521740..1521931) product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215432.1 transl_table 11 codon_start 1 locus_tag LOCUS_32690 gene rpmC CDS complement(1521931..1522344) product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555482.1 transl_table 11 codon_start 1 locus_tag LOCUS_32700 gene rplP CDS complement(1522364..1523035) product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036126.1 transl_table 11 codon_start 1 locus_tag LOCUS_32710 gene rpsC CDS complement(1523045..1523377) product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555485.1 transl_table 11 codon_start 1 locus_tag LOCUS_32720 gene rplV CDS complement(1523387..1523659) product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004883670.1 transl_table 11 codon_start 1 locus_tag LOCUS_32730 gene rpsS CDS complement(1523672..1524499) product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004397049.1 transl_table 11 codon_start 1 locus_tag LOCUS_32740 gene rplB CDS complement(1524533..1524832) product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002243944.1 transl_table 11 codon_start 1 locus_tag LOCUS_32750 gene rplW CDS complement(1524829..1525449) product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417226.1 transl_table 11 codon_start 1 locus_tag LOCUS_32760 gene rplD CDS complement(1525453..1526103) product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010672559.1 transl_table 11 codon_start 1 locus_tag LOCUS_32770 gene rplC CDS complement(1526134..1526445) product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307944.1 transl_table 11 codon_start 1 locus_tag LOCUS_32780 gene rpsJ CDS complement(1526451..1527641) product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115146.1 transl_table 11 codon_start 1 locus_tag LOCUS_32790 gene tuf CDS complement(1527668..1529761) product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957451.1 transl_table 11 codon_start 1 locus_tag LOCUS_32800 gene fusA CDS complement(1529785..1530255) product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005306266.1 transl_table 11 codon_start 1 locus_tag LOCUS_32810 gene rpsG CDS complement(1530269..1530643) product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093744.1 transl_table 11 codon_start 1 locus_tag LOCUS_32820 gene rpsL CDS complement(1530794..1535005) product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093745.1 transl_table 11 codon_start 1 locus_tag LOCUS_32830 gene rpoC CDS complement(1535067..1539143) product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114335.1 transl_table 11 codon_start 1 locus_tag LOCUS_32840 gene rpoB CDS complement(1539266..1539634) product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946072.1 transl_table 11 codon_start 1 locus_tag LOCUS_32850 gene rplL CDS complement(1539681..1540205) product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036116.1 transl_table 11 codon_start 1 locus_tag LOCUS_32860 gene rplJ CDS complement(1540365..1541060) product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649467.1 transl_table 11 codon_start 1 locus_tag LOCUS_32870 gene rplA CDS complement(1541060..1541491) product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093751.1 transl_table 11 codon_start 1 locus_tag LOCUS_32880 gene rplK CDS complement(1541591..1542124) product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287510.1 transl_table 11 codon_start 1 locus_tag LOCUS_32890 gene nusG CDS complement(1542124..1542504) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32900 tRNA complement(1542542..1542617) product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00350 CDS complement(1542652..1543842) product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115146.1 transl_table 11 codon_start 1 locus_tag LOCUS_32910 gene tuf tRNA complement(1543884..1543959) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00360 tRNA complement(1543980..1544053) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00370 tmRNA complement(1544072..1544366) product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_tm00020 tRNA complement(1544072..1544156) product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00380 CDS complement(1544809..1545405) product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099279.1 transl_table 11 codon_start 1 locus_tag LOCUS_32920 CDS complement(1545451..1546404) product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036108.1 transl_table 11 codon_start 1 locus_tag LOCUS_32930 tRNA complement(1546440..1546514) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00390 CDS complement(1546524..1547411) product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706938.1 transl_table 11 codon_start 1 locus_tag LOCUS_32940 gene ispE CDS complement(1547396..1547962) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32950 CDS complement(1547959..1549659) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_074907579.1 transl_table 11 codon_start 1 locus_tag LOCUS_32960 CDS 1549830..1551080 product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095001.1 transl_table 11 codon_start 1 locus_tag LOCUS_32970 gene hemA CDS 1551089..1552174 product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772919.1 transl_table 11 codon_start 1 locus_tag LOCUS_32980 gene prfA CDS 1552167..1553027 product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948043.1 transl_table 11 codon_start 1 locus_tag LOCUS_32990 gene prmC CDS 1553024..1553446 product CysO-cysteine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898830.1 transl_table 11 codon_start 1 locus_tag LOCUS_33000 gene mec CDS complement(1553472..1554410) product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928785.1 transl_table 11 codon_start 1 locus_tag LOCUS_33010 CDS complement(1554601..1556190) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33020 CDS complement(1556616..1557467) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33030 CDS 1557648..1559474 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33040 CDS 1559642..1560115 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33050 CDS complement(1560176..1561510) product two-component system response regulator PilR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094694.1 transl_table 11 codon_start 1 locus_tag LOCUS_33060 gene pilR CDS complement(1561513..1563057) product two-component system sensor histidine kinase PilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094692.1 transl_table 11 codon_start 1 locus_tag LOCUS_33070 gene pilS CDS 1563234..1564403 product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367670.1 transl_table 11 codon_start 1 locus_tag LOCUS_33080 gene sucC CDS 1564403..1565278 product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007647520.1 transl_table 11 codon_start 1 locus_tag LOCUS_33090 gene sucD CDS 1565278..1566924 product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815768.1 transl_table 11 codon_start 1 locus_tag LOCUS_33100 CDS 1566928..1568049 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33110 CDS complement(1568128..1571604) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037251825.1 transl_table 11 codon_start 1 locus_tag LOCUS_33120 CDS complement(1571779..1572735) product alpha-E domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920827.1 transl_table 11 codon_start 1 locus_tag LOCUS_33130 CDS complement(1572737..1574191) product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340179.1 transl_table 11 codon_start 1 locus_tag LOCUS_33140 CDS 1574649..1577180 product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105233.1 transl_table 11 codon_start 1 locus_tag LOCUS_33150 CDS 1577191..1578072 product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004407851.1 transl_table 11 codon_start 1 locus_tag LOCUS_33160 CDS 1578240..1582391 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33170 CDS 1582498..1583556 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33180 CDS 1583691..1584314 product inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009872152.1 transl_table 11 codon_start 1 locus_tag LOCUS_33190 CDS 1584501..1584809 product type II toxin-antitoxin system HigB family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040056.1 transl_table 11 codon_start 1 locus_tag LOCUS_33200 CDS 1584799..1585152 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704672.1 transl_table 11 codon_start 1 locus_tag LOCUS_33210 CDS 1585240..1585497 product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242138.1 transl_table 11 codon_start 1 locus_tag LOCUS_33220 CDS 1585481..1585867 product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252024.1 transl_table 11 codon_start 1 locus_tag LOCUS_33230 CDS 1586050..1586748 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33240 CDS complement(1586731..1586964) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33250 CDS 1587368..1588069 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33260 CDS complement(1588245..1590023) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33270 CDS 1590385..1590594 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33280 CDS 1590530..1591231 product HupE/UreJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008460272.1 transl_table 11 codon_start 1 locus_tag LOCUS_33290 CDS 1591224..1591799 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970466.1 transl_table 11 codon_start 1 locus_tag LOCUS_33300 CDS complement(1591878..1592483) product nitrogen fixation protein NifQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009565963.1 transl_table 11 codon_start 1 locus_tag LOCUS_33310 CDS complement(1592522..1592872) product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563670.1 transl_table 11 codon_start 1 locus_tag LOCUS_33320 CDS complement(1592894..1593181) product ferredoxin FdxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723760.1 transl_table 11 codon_start 1 locus_tag LOCUS_33330 gene fdxC CDS complement(1593369..1594646) product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140334.1 transl_table 11 codon_start 1 locus_tag LOCUS_33340 CDS complement(1594643..1595074) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388762.1 transl_table 11 codon_start 1 locus_tag LOCUS_33350 CDS complement(1595074..1595358) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33360 CDS complement(1595557..1597053) product nitrogenase cofactor biosynthesis protein NifB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084568.1 transl_table 11 codon_start 1 locus_tag LOCUS_33370 gene nifB CDS complement(1597291..1598403) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937438.1 transl_table 11 codon_start 1 locus_tag LOCUS_33380 CDS complement(1598409..1599530) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33390 note possible pseudo, internal stop codon CDS complement(1599527..1601308) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001361293.1 transl_table 11 codon_start 1 locus_tag LOCUS_33400 CDS complement(1601305..1602333) product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812256.1 transl_table 11 codon_start 1 locus_tag LOCUS_33410 CDS complement(1602840..1604864) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33420 CDS 1605651..1606268 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113561.1 transl_table 11 codon_start 1 locus_tag LOCUS_33430 CDS 1606573..1607367 product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765436.1 transl_table 11 codon_start 1 locus_tag LOCUS_33440 CDS 1607348..1607605 product phosphopantetheine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074022.1 transl_table 11 codon_start 1 locus_tag LOCUS_33450 CDS complement(1607631..1609523) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33460 CDS complement(1610025..1610471) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33470 CDS complement(1610544..1611938) product phosphomannomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107284302.1 transl_table 11 codon_start 1 locus_tag LOCUS_33480 CDS complement(1611985..1612590) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33490 CDS complement(1612592..1613203) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33500 CDS complement(1613952..1614584) product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071887.1 transl_table 11 codon_start 1 locus_tag LOCUS_33510 CDS complement(1614686..1615060) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141564.1 transl_table 11 codon_start 1 locus_tag LOCUS_33520 CDS complement(1615143..1616648) product DUF853 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023853666.1 transl_table 11 codon_start 1 locus_tag LOCUS_33530 CDS 1617137..1617877 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33540 CDS complement(1618079..1618723) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33550 CDS complement(1618928..1619410) product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772268.1 transl_table 11 codon_start 1 locus_tag LOCUS_33560 CDS 1619570..1620112 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33570 CDS 1620307..1621161 product SIR2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533515.1 transl_table 11 codon_start 1 locus_tag LOCUS_33580 CDS complement(1621201..1622124) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33590 CDS complement(1622127..1625159) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33600 CDS complement(1625164..1625829) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33610 CDS complement(1625983..1627071) product lipocalin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258602.1 transl_table 11 codon_start 1 locus_tag LOCUS_33620 CDS complement(1627099..1629060) product TonB-dependent receptor plug domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262962.1 transl_table 11 codon_start 1 locus_tag LOCUS_33630 CDS complement(1629400..1630476) product molybdenum ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104308.1 transl_table 11 codon_start 1 locus_tag LOCUS_33640 gene modC CDS complement(1630488..1631174) product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088068.1 transl_table 11 codon_start 1 locus_tag LOCUS_33650 gene modB CDS complement(1631449..1631763) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33660 CDS complement(1632164..1633093) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257650.1 transl_table 11 codon_start 1 locus_tag LOCUS_33670 CDS 1633279..1634871 product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921384.1 transl_table 11 codon_start 1 locus_tag LOCUS_33680 CDS 1634868..1636619 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33690 note possible pseudo, frameshifted CDS 1636559..1637449 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33700 note possible pseudo, frameshifted CDS 1637451..1638386 product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813323.1 transl_table 11 codon_start 1 locus_tag LOCUS_33710 gene cysD CDS 1638386..1639708 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33720 CDS 1639741..1640376 product YchE family NAAT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000615840.1 transl_table 11 codon_start 1 locus_tag LOCUS_33730 CDS 1640444..1640689 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33740 CDS complement(1640603..1642966) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265970.1 transl_table 11 codon_start 1 locus_tag LOCUS_33750 CDS complement(1643096..1644142) product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389193.1 transl_table 11 codon_start 1 locus_tag LOCUS_33760 CDS complement(1644197..1644703) product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389192.1 transl_table 11 codon_start 1 locus_tag LOCUS_33770 CDS complement(1644975..1646198) product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919650.1 transl_table 11 codon_start 1 locus_tag LOCUS_33780 CDS complement(1646644..1649094) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33790 CDS complement(1649199..1650230) product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389193.1 transl_table 11 codon_start 1 locus_tag LOCUS_33800 CDS complement(1650238..1650747) product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112642.1 transl_table 11 codon_start 1 locus_tag LOCUS_33810 CDS complement(1651037..1652527) product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141170.1 transl_table 11 codon_start 1 locus_tag LOCUS_33820 gene zwf CDS complement(1652655..1653401) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33830 CDS complement(1653579..1655219) product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094059.1 transl_table 11 codon_start 1 locus_tag LOCUS_33840 gene groL CDS complement(1655275..1655562) product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770495.1 transl_table 11 codon_start 1 locus_tag LOCUS_33850 gene groES CDS 1655768..1656514 product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807436.1 transl_table 11 codon_start 1 locus_tag LOCUS_33860 gene moeB CDS complement(1656576..1656782) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33870 CDS 1656972..1658645 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33880 note possible pseudo, frameshifted CDS 1658648..1659160 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33890 note possible pseudo, frameshifted CDS 1659157..1659663 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33900 note possible pseudo, frameshifted CDS complement(1659631..1660254) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33910 CDS 1660351..1660818 product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096727.1 transl_table 11 codon_start 1 locus_tag LOCUS_33920 CDS complement(1660903..1662132) product pyrophosphate--fructose-6-phosphate 1-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922349.1 transl_table 11 codon_start 1 locus_tag LOCUS_33930 CDS complement(1662203..1662577) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33940 CDS complement(1662690..1663463) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403707.1 transl_table 11 codon_start 1 locus_tag LOCUS_33950 CDS complement(1663475..1663708) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33960 CDS 1663727..1664812 product IS110-like element ISPa11 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147159.1 transl_table 11 codon_start 1 locus_tag LOCUS_33970 CDS complement(1665195..1665968) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403707.1 transl_table 11 codon_start 1 locus_tag LOCUS_33980 CDS complement(1665980..1666702) product DUF445 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263502.1 transl_table 11 codon_start 1 locus_tag LOCUS_33990 CDS 1666780..1667343 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34000 CDS complement(1667405..1668601) product L-2-hydroxyglutarate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198032110.1 transl_table 11 codon_start 1 locus_tag LOCUS_34010 gene lhgO CDS complement(1668585..1669166) product D-glycero-alpha-D-manno-heptose-1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194255.1 transl_table 11 codon_start 1 locus_tag LOCUS_34020 gene gmhB CDS complement(1669182..1670063) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34030 CDS complement(1670515..1672878) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34040 CDS complement(1672885..1674009) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34050 CDS complement(1674177..1675574) product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964010.1 transl_table 11 codon_start 1 locus_tag LOCUS_34060 CDS complement(1675587..1676474) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34070 CDS complement(1676795..1678744) product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976109.1 transl_table 11 codon_start 1 locus_tag LOCUS_34080 CDS complement(1678811..1679272) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34090 CDS complement(1679741..1680466) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34100 CDS complement(1680781..1682127) product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_114714636.1 transl_table 11 codon_start 1 locus_tag LOCUS_34110 CDS complement(1682492..1682740) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34120 note possible pseudo, frameshifted CDS complement(1682901..1683140) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34130 CDS complement(1683294..1683770) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34140 CDS complement(1685539..1685967) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34150 note possible pseudo, internal stop codon, frameshifted CDS 1685959..1686126 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34160 CDS complement(1686171..1686536) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34170 note possible pseudo, internal stop codon, frameshifted CDS complement(1686758..1687711) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34180 CDS complement(1687708..1689873) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34190 CDS complement(1689870..1691804) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34200 CDS complement(1691801..1693330) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34210 CDS complement(1693330..1694610) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103412.1 transl_table 11 codon_start 1 locus_tag LOCUS_34220 CDS complement(1694721..1695422) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289081.1 transl_table 11 codon_start 1 locus_tag LOCUS_34230 CDS complement(1695628..1696227) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34240 CDS complement(1696258..1697196) product NAD-dependent epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858299.1 transl_table 11 codon_start 1 locus_tag LOCUS_34250 CDS complement(1697222..1697806) product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857991.1 transl_table 11 codon_start 1 locus_tag LOCUS_34260 gene gmhA2 CDS complement(1697797..1698516) product D-glycero-D-manno-heptose 1-phosphate guanosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857908.1 transl_table 11 codon_start 1 locus_tag LOCUS_34270 gene hddC CDS complement(1698527..1699696) product DegT/DnrJ/EryC1/StrS aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965477.1 transl_table 11 codon_start 1 locus_tag LOCUS_34280 CDS complement(1699713..1700675) product transketolase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545278.1 transl_table 11 codon_start 1 locus_tag LOCUS_34290 CDS complement(1700672..1701490) product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177224003.1 transl_table 11 codon_start 1 locus_tag LOCUS_34300 CDS complement(1701585..1702580) product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383609.1 transl_table 11 codon_start 1 locus_tag LOCUS_34310 CDS complement(1702585..1703964) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34320 CDS complement(1704635..1705027) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34330 CDS 1705444..1706052 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34340 note possible pseudo, internal stop codon, frameshifted CDS 1706089..1706334 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34350 note possible pseudo, internal stop codon CDS complement(1706301..1706570) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34360 CDS complement(1706677..1707525) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34370 note possible pseudo, frameshifted CDS 1707736..1708575 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34380 CDS 1709320..1710330 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34390 CDS 1710305..1711150 product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530507.1 transl_table 11 codon_start 1 locus_tag LOCUS_34400 CDS complement(1711166..1711348) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34410 CDS complement(1711522..1711926) product HIRAN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940728.1 transl_table 11 codon_start 1 locus_tag LOCUS_34420 CDS complement(1711937..1712989) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34430 CDS complement(1713102..1714076) product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_150678942.1 transl_table 11 codon_start 1 locus_tag LOCUS_34440 CDS 1714437..1714850 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34450 CDS 1714843..1717242 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34460 CDS 1717276..1717722 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34470 CDS 1717712..1718479 product tRNA(His) guanylyltransferase Thg1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060935.1 transl_table 11 codon_start 1 locus_tag LOCUS_34480 CDS 1718581..1719777 product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207588.1 transl_table 11 codon_start 1 locus_tag LOCUS_34490 CDS complement(1720041..1720514) product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000148675.1 transl_table 11 codon_start 1 locus_tag LOCUS_34500 gene radC CDS complement(1720790..1722385) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34510 CDS complement(1722518..1724281) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34520 CDS complement(1724397..1724894) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34530 CDS complement(1725047..1725715) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34540 CDS 1725880..1726257 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34550 CDS complement(1726235..1726771) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34560 CDS complement(1727122..1728942) product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942806.1 transl_table 11 codon_start 1 locus_tag LOCUS_34570 CDS complement(1729027..1730232) product DUF3150 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942805.1 transl_table 11 codon_start 1 locus_tag LOCUS_34580 CDS complement(1730316..1731083) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34590 CDS complement(1731086..1732027) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942803.1 transl_table 11 codon_start 1 locus_tag LOCUS_34600 CDS complement(1732137..1732349) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34610 CDS complement(1732690..1733691) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34620 CDS complement(1733688..1734023) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34630 CDS complement(1734199..1735254) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34640 CDS complement(1735403..1735831) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34650 CDS 1736212..1736889 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34660 CDS 1736886..1737086 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34670 CDS complement(1737301..1738518) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34680 CDS complement(1738648..1738851) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34690 CDS complement(1738802..1739041) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34700 CDS complement(1739286..1739636) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34710 CDS complement(1739638..1741638) product DNA sulfur modification protein DndD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005109923.1 transl_table 11 codon_start 1 locus_tag LOCUS_34720 gene dndD CDS complement(1741635..1743158) product DNA phosphorothioation system sulfurtransferase DndC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005109921.1 transl_table 11 codon_start 1 locus_tag LOCUS_34730 gene dndC CDS complement(1743155..1744156) product DNA sulfur modification protein DndB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005134924.1 transl_table 11 codon_start 1 locus_tag LOCUS_34740 gene dndB CDS 1745362..1746501 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34750 CDS 1746531..1746944 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34760 sequence3 source 1..1702054 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(4444..5688) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34770 CDS 5701..6735 product IS5-like element ISMac22 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022661.1 transl_table 11 codon_start 1 locus_tag LOCUS_34780 CDS complement(6845..9262) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34790 CDS complement(9324..9506) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34800 CDS 9508..10275 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34810 CDS complement(10695..10892) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34820 CDS complement(11041..12690) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34830 CDS complement(12811..13026) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34840 CDS complement(13113..13643) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34850 CDS complement(13764..14426) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34860 CDS 14591..14965 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34870 CDS complement(14943..15476) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34880 CDS complement(15819..17639) product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942806.1 transl_table 11 codon_start 1 locus_tag LOCUS_34890 CDS complement(17724..18929) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34900 CDS complement(19013..19780) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34910 CDS complement(19783..20724) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942803.1 transl_table 11 codon_start 1 locus_tag LOCUS_34920 CDS complement(20879..21100) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34930 CDS complement(21321..22322) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34940 CDS complement(22322..22654) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34950 CDS complement(22773..23825) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34960 CDS complement(23971..24411) product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444870.1 transl_table 11 codon_start 1 locus_tag LOCUS_34970 gene ssb CDS 24850..25524 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34980 CDS 25739..26170 product IS200/IS605-like element ISAzo20 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011236150.1 transl_table 11 codon_start 1 locus_tag LOCUS_34990 gene tnpA CDS complement(26486..27355) product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001277248.1 transl_table 11 codon_start 1 locus_tag LOCUS_35000 CDS 27496..30237 product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091704098.1 transl_table 11 codon_start 1 locus_tag LOCUS_35010 CDS 30538..32112 product type I-E CRISPR-associated protein Cse1/CasA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000366321.1 transl_table 11 codon_start 1 locus_tag LOCUS_35020 gene casA CDS 32113..32676 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35030 CDS 32693..33760 product type I-E CRISPR-associated protein Cas7/Cse4/CasC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044180303.1 transl_table 11 codon_start 1 locus_tag LOCUS_35040 gene cas7e CDS 33770..34552 product type I-E CRISPR-associated protein Cas5/CasD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000666425.1 transl_table 11 codon_start 1 locus_tag LOCUS_35050 gene cas5e CDS 34552..35439 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35060 CDS 35862..36773 product type I-E CRISPR-associated endonuclease Cas1e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942041.1 transl_table 11 codon_start 1 locus_tag LOCUS_35070 gene cas1e CDS 36754..37086 product type I-E CRISPR-associated endoribonuclease Cas2e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942042.1 transl_table 11 codon_start 1 locus_tag LOCUS_35080 gene cas2e repeat_region 37219..39934 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gcgttccccgcacccgcggggatgaaccg CDS complement(40021..42804) product IncHI-type conjugal transfer protein TrhN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000682729.1 transl_table 11 codon_start 1 locus_tag LOCUS_35090 gene trhN CDS complement(42804..43835) product IncHI-type conjugal transfer protein TrhU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011011070.1 transl_table 11 codon_start 1 locus_tag LOCUS_35100 gene trhU CDS complement(43832..44962) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35110 CDS complement(45018..45581) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35120 CDS complement(45586..45903) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35130 CDS complement(45893..48307) product TraC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331477.1 transl_table 11 codon_start 1 locus_tag LOCUS_35140 CDS complement(48304..48567) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35150 CDS complement(48575..48874) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35160 CDS complement(49003..49530) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35170 CDS complement(49527..50336) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35180 CDS complement(50365..51720) product IncHI-type conjugal transfer protein TrhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000351840.1 transl_table 11 codon_start 1 locus_tag LOCUS_35190 gene trhB CDS complement(51720..52673) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35200 CDS complement(52670..53281) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35210 CDS complement(53278..53559) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35220 CDS 53867..54130 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35230 CDS 54251..54568 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35240 note possible pseudo, internal stop codon CDS 54617..54970 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35250 note possible pseudo, internal stop codon CDS complement(55014..55325) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35260 CDS complement(55471..55653) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35270 CDS complement(55912..56400) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35280 CDS complement(56454..56879) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35290 CDS 56839..57048 product DUF3820 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003341842.1 transl_table 11 codon_start 1 locus_tag LOCUS_35300 CDS complement(57411..57920) product DUF1993 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083593.1 transl_table 11 codon_start 1 locus_tag LOCUS_35310 CDS complement(58177..58524) product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037339.1 transl_table 11 codon_start 1 locus_tag LOCUS_35320 CDS 58706..58867 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35330 CDS 59486..59968 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35340 CDS 60046..61035 product aliphatic nitrilase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877947.1 transl_table 11 codon_start 1 locus_tag LOCUS_35350 CDS 61013..62125 product MSMEG_0568 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876804.1 transl_table 11 codon_start 1 locus_tag LOCUS_35360 CDS 62127..62669 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35370 CDS 62666..63634 product methanogenesis marker 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024078.1 transl_table 11 codon_start 1 locus_tag LOCUS_35380 CDS 63637..64812 product MSMEG_0565 family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876802.1 transl_table 11 codon_start 1 locus_tag LOCUS_35390 CDS 64805..65092 product MSMEG_0570 family nitrogen starvation response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891991.1 transl_table 11 codon_start 1 locus_tag LOCUS_35400 CDS 65147..66418 product MSMEG_0569 family flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891990.1 transl_table 11 codon_start 1 locus_tag LOCUS_35410 CDS 66496..67965 product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940696.1 transl_table 11 codon_start 1 locus_tag LOCUS_35420 CDS complement(67962..68213) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35430 note possible pseudo, frameshifted CDS complement(68122..68808) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35440 note possible pseudo, frameshifted CDS complement(68823..70019) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222585.1 transl_table 11 codon_start 1 locus_tag LOCUS_35450 CDS complement(70032..70571) product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088482.1 transl_table 11 codon_start 1 locus_tag LOCUS_35460 CDS complement(70682..71506) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107734.1 transl_table 11 codon_start 1 locus_tag LOCUS_35470 CDS complement(71503..72744) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107732.1 transl_table 11 codon_start 1 locus_tag LOCUS_35480 CDS complement(72756..74282) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35490 CDS complement(74409..75347) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089436.1 transl_table 11 codon_start 1 locus_tag LOCUS_35500 CDS complement(75730..76263) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35510 note possible pseudo, internal stop codon CDS complement(76276..76914) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35520 note possible pseudo, internal stop codon, frameshifted CDS complement(77024..77212) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35530 CDS complement(77695..79056) product IS1182-like element ISBma2 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200740.1 transl_table 11 codon_start 1 locus_tag LOCUS_35540 CDS complement(79186..79818) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35550 CDS complement(79821..81647) product conjugative transfer system coupling protein TraD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205050578.1 transl_table 11 codon_start 1 locus_tag LOCUS_35560 gene traD CDS complement(81644..83905) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35570 CDS 84036..84494 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35580 CDS 84503..85369 product plasmid replication initiator TrfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815848.1 transl_table 11 codon_start 1 locus_tag LOCUS_35590 gene trfA CDS complement(85771..86241) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35600 CDS 86735..87736 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35610 CDS 87733..89172 product conjugal transfer protein TraH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_175404606.1 transl_table 11 codon_start 1 locus_tag LOCUS_35620 CDS 89227..92424 product conjugal transfer protein TraG N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331489.1 transl_table 11 codon_start 1 locus_tag LOCUS_35630 CDS complement(93247..94425) product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035313.1 transl_table 11 codon_start 1 locus_tag LOCUS_35640 CDS complement(95127..95348) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35650 note possible pseudo, frameshifted CDS complement(95345..95770) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35660 note possible pseudo, frameshifted CDS complement(95676..96185) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35670 CDS complement(96433..96984) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35680 CDS complement(96981..97289) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35690 CDS complement(97301..97537) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35700 CDS complement(97562..97957) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35710 CDS complement(98095..98883) product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072060.1 transl_table 11 codon_start 1 locus_tag LOCUS_35720 CDS 99576..100469 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35730 CDS 101353..101877 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35740 CDS complement(102236..102511) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35750 CDS complement(103532..103774) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35760 CDS 104681..105286 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35770 CDS 105593..108223 product chemotaxis protein CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023457.1 transl_table 11 codon_start 1 locus_tag LOCUS_35780 CDS 108207..110441 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35790 CDS complement(110554..110688) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35800 CDS 110725..111345 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35810 CDS 111342..112466 product DUF1207 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873776.1 transl_table 11 codon_start 1 locus_tag LOCUS_35820 CDS complement(112787..113221) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35830 CDS 113721..114074 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35840 CDS complement(114168..115520) product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100366.1 transl_table 11 codon_start 1 locus_tag LOCUS_35850 gene gorA CDS complement(115531..116058) product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003023265.1 transl_table 11 codon_start 1 locus_tag LOCUS_35860 CDS complement(116153..116596) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35870 CDS complement(116644..117141) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35880 CDS complement(117735..117998) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35890 CDS complement(118276..118608) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35900 CDS complement(118589..118774) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35910 CDS 119140..120165 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35920 CDS complement(120367..120903) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35930 CDS complement(121080..123671) product magnesium-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948085.1 transl_table 11 codon_start 1 locus_tag LOCUS_35940 gene mgtA CDS complement(123732..124370) product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141001.1 transl_table 11 codon_start 1 locus_tag LOCUS_35950 CDS complement(124378..126771) product phosphoketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057028.1 transl_table 11 codon_start 1 locus_tag LOCUS_35960 CDS complement(127090..128214) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368483.1 transl_table 11 codon_start 1 locus_tag LOCUS_35970 CDS complement(128221..128526) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35980 CDS complement(128667..131414) product ribosome-associated ATPase/putative transporter RbbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000149182.1 transl_table 11 codon_start 1 locus_tag LOCUS_35990 gene rbbA CDS complement(131411..132541) product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099200.1 transl_table 11 codon_start 1 locus_tag LOCUS_36000 CDS complement(132541..133971) product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393375.1 transl_table 11 codon_start 1 locus_tag LOCUS_36010 CDS 134282..134650 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36020 CDS complement(134711..135421) product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072507.1 transl_table 11 codon_start 1 locus_tag LOCUS_36030 CDS 135892..136194 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36040 CDS 136394..138598 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36050 CDS complement(138679..139410) product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072508.1 transl_table 11 codon_start 1 locus_tag LOCUS_36060 CDS 139801..141762 product squalene--hopene cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387823.1 transl_table 11 codon_start 1 locus_tag LOCUS_36070 gene shc CDS 141778..142140 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36080 CDS complement(142156..142650) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36090 CDS 142837..143145 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36100 CDS complement(143180..143728) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36110 CDS complement(144093..144299) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36120 CDS 144217..144495 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36130 CDS 144514..145398 product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092499.1 transl_table 11 codon_start 1 locus_tag LOCUS_36140 CDS 145405..145671 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36150 CDS 145668..146081 product carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189834.1 transl_table 11 codon_start 1 locus_tag LOCUS_36160 CDS 146221..146793 product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112597.1 transl_table 11 codon_start 1 locus_tag LOCUS_36170 CDS complement(147149..150088) product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087698.1 transl_table 11 codon_start 1 locus_tag LOCUS_36180 CDS complement(150058..150264) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36190 note possible pseudo, frameshifted CDS complement(150267..151724) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087697.1 transl_table 11 codon_start 1 locus_tag LOCUS_36200 CDS complement(151717..153024) product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941984.1 transl_table 11 codon_start 1 locus_tag LOCUS_36210 CDS 154039..154170 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36220 CDS 154236..154394 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36230 CDS 154530..163229 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36240 CDS 163343..163561 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36250 CDS 163598..163915 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36260 CDS complement(164053..164622) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36270 CDS 165245..165421 product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035328.1 transl_table 11 codon_start 1 locus_tag LOCUS_36280 CDS 165732..165851 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36290 CDS complement(166434..166829) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36300 CDS complement(166891..167121) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36310 CDS complement(167136..167501) product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210636.1 transl_table 11 codon_start 1 locus_tag LOCUS_36320 CDS 167835..168890 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36330 CDS 168998..169207 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36340 CDS 169633..171024 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36350 CDS 172254..172475 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36360 CDS 172508..173449 product HPr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626495.1 transl_table 11 codon_start 1 locus_tag LOCUS_36370 CDS 173449..174297 product sulfotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390775.1 transl_table 11 codon_start 1 locus_tag LOCUS_36380 CDS 174368..174661 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36390 CDS complement(174666..175262) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36400 CDS complement(175289..176551) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36410 CDS complement(176542..177699) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36420 CDS complement(177840..178682) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36430 CDS complement(178682..179257) product 2OG-Fe(II) oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390772.1 transl_table 11 codon_start 1 locus_tag LOCUS_36440 CDS 180179..181477 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36450 CDS complement(181464..182138) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942499.1 transl_table 11 codon_start 1 locus_tag LOCUS_36460 CDS 182251..183312 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389250.1 transl_table 11 codon_start 1 locus_tag LOCUS_36470 CDS 183312..184055 product exopolysaccharide biosynthesis glycosyltransferase VpsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001245630.1 transl_table 11 codon_start 1 locus_tag LOCUS_36480 gene vpsK CDS complement(184247..185509) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36490 CDS complement(185502..186125) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36500 CDS 186455..186727 product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000165090.1 transl_table 11 codon_start 1 locus_tag LOCUS_36510 CDS 186724..187623 product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299612.1 transl_table 11 codon_start 1 locus_tag LOCUS_36520 CDS 187976..188668 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36530 CDS complement(188941..189342) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36540 CDS 189397..191217 product lasso peptide isopeptide bond-forming cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528116.1 transl_table 11 codon_start 1 locus_tag LOCUS_36550 CDS 191286..192182 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36560 CDS complement(192179..192712) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36570 CDS complement(192745..193011) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36580 CDS complement(193023..193874) product sulfotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389217.1 transl_table 11 codon_start 1 locus_tag LOCUS_36590 CDS complement(193874..194773) product HPr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389035.1 transl_table 11 codon_start 1 locus_tag LOCUS_36600 CDS complement(194816..194974) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36610 CDS 196067..196231 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36620 note possible pseudo, frameshifted CDS complement(196276..197541) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470608.1 transl_table 11 codon_start 1 locus_tag LOCUS_36630 CDS complement(197541..198533) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36640 CDS complement(198550..200418) product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389237.1 transl_table 11 codon_start 1 locus_tag LOCUS_36650 gene asnB CDS complement(200418..201995) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36660 CDS complement(201992..202936) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36670 CDS complement(203003..203806) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36680 CDS complement(203803..204750) product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626183.1 transl_table 11 codon_start 1 locus_tag LOCUS_36690 CDS complement(204791..206086) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36700 CDS complement(206090..207181) product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871027.1 transl_table 11 codon_start 1 locus_tag LOCUS_36710 gene wecB CDS complement(207188..208309) product D-rhamnosyltransferase WbpZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114105.1 transl_table 11 codon_start 1 locus_tag LOCUS_36720 gene wbpZ CDS complement(208317..209459) product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102573.1 transl_table 11 codon_start 1 locus_tag LOCUS_36730 CDS complement(209491..210606) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36740 CDS complement(210712..211953) product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060802.1 transl_table 11 codon_start 1 locus_tag LOCUS_36750 CDS complement(211957..213579) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528118.1 transl_table 11 codon_start 1 locus_tag LOCUS_36760 CDS 214229..214867 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36770 CDS complement(214947..216632) product carbamoyltransferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815500.1 transl_table 11 codon_start 1 locus_tag LOCUS_36780 CDS 216929..217621 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36790 CDS 217688..218473 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36800 CDS 218528..220456 product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388610.1 transl_table 11 codon_start 1 locus_tag LOCUS_36810 CDS 220560..220844 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36820 CDS 220841..221356 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36830 CDS 221598..221750 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36840 CDS complement(221788..222363) product tail fiber protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070581.1 transl_table 11 codon_start 1 locus_tag LOCUS_36850 CDS complement(222376..222909) product tail fiber protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070581.1 transl_table 11 codon_start 1 locus_tag LOCUS_36860 CDS complement(222930..223436) product tail fiber protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528764.1 transl_table 11 codon_start 1 locus_tag LOCUS_36870 CDS complement(223752..224588) product sulfotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390775.1 transl_table 11 codon_start 1 locus_tag LOCUS_36880 CDS complement(224585..225523) product HPr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389232.1 transl_table 11 codon_start 1 locus_tag LOCUS_36890 CDS complement(225525..225827) product PqqD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626180.1 transl_table 11 codon_start 1 locus_tag LOCUS_36900 CDS complement(225944..227233) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36910 CDS complement(227490..228125) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36920 CDS 228426..228644 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36930 CDS 228678..228866 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36940 CDS 228866..229108 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36950 CDS 229361..229843 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36960 note possible pseudo, frameshifted CDS 229840..230106 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36970 note possible pseudo, frameshifted CDS 230214..231296 product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728430.1 transl_table 11 codon_start 1 locus_tag LOCUS_36980 tRNA complement(231535..231621) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00400 CDS complement(231997..232707) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36990 CDS 232923..233312 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37000 CDS 233412..234233 product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043921634.1 transl_table 11 codon_start 1 locus_tag LOCUS_37010 CDS 234226..235398 product NnrS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072738.1 transl_table 11 codon_start 1 locus_tag LOCUS_37020 CDS complement(235701..236786) product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810695.1 transl_table 11 codon_start 1 locus_tag LOCUS_37030 gene ispG CDS 237023..237751 product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101593.1 transl_table 11 codon_start 1 locus_tag LOCUS_37040 CDS 237893..239284 product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694115.1 transl_table 11 codon_start 1 locus_tag LOCUS_37050 CDS 239284..240483 product NADH:ubiquinone reductase (Na(+)-transporting) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109478.1 transl_table 11 codon_start 1 locus_tag LOCUS_37060 CDS 240476..241339 product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105182.1 transl_table 11 codon_start 1 locus_tag LOCUS_37070 CDS 241349..242017 product NADH:ubiquinone reductase (Na(+)-transporting) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208714.1 transl_table 11 codon_start 1 locus_tag LOCUS_37080 CDS 242017..242625 product NADH:ubiquinone reductase (Na(+)-transporting) subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091182.1 transl_table 11 codon_start 1 locus_tag LOCUS_37090 gene nqrE CDS 242636..243856 product NADH:ubiquinone reductase (Na(+)-transporting) subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951261.1 transl_table 11 codon_start 1 locus_tag LOCUS_37100 gene nqrF CDS 243944..244132 product (Na+)-NQR maturation NqrM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001091359.1 transl_table 11 codon_start 1 locus_tag LOCUS_37110 gene nqrM CDS complement(244161..244733) product alpha-ketoglutarate-dependent dioxygenase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195466.1 transl_table 11 codon_start 1 locus_tag LOCUS_37120 CDS complement(244730..245134) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37130 CDS complement(245249..246592) product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460216.1 transl_table 11 codon_start 1 locus_tag LOCUS_37140 gene xseA CDS 246753..247802 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37150 CDS complement(247765..248424) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260949.1 transl_table 11 codon_start 1 locus_tag LOCUS_37160 tRNA 248489..248565 product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00410 CDS complement(248635..249138) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37170 CDS 249207..249836 product TetR-like C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456899.1 transl_table 11 codon_start 1 locus_tag LOCUS_37180 CDS complement(249775..250950) product lysophospholipid transporter LplT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703329.1 transl_table 11 codon_start 1 locus_tag LOCUS_37190 gene lplT CDS complement(250997..253162) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37200 CDS complement(253373..253990) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37210 CDS complement(254060..255547) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37220 CDS complement(255821..256450) product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388998.1 transl_table 11 codon_start 1 locus_tag LOCUS_37230 CDS 256586..257251 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246025.1 transl_table 11 codon_start 1 locus_tag LOCUS_37240 CDS 257248..258591 product two-component system sensor histidine kinase CarS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090493.1 transl_table 11 codon_start 1 locus_tag LOCUS_37250 gene carS CDS 258627..260018 product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114030.1 transl_table 11 codon_start 1 locus_tag LOCUS_37260 gene argH CDS 260079..260780 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37270 CDS 260777..262006 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37280 CDS 262026..262562 product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212573.1 transl_table 11 codon_start 1 locus_tag LOCUS_37290 CDS 262568..263224 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37300 CDS 263265..263627 product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212575.1 transl_table 11 codon_start 1 locus_tag LOCUS_37310 CDS 263655..264131 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37320 CDS 264144..264890 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37330 CDS 264901..265500 product alpha-ribazole phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112355.1 transl_table 11 codon_start 1 locus_tag LOCUS_37340 CDS 265543..268341 product class I adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114341.1 transl_table 11 codon_start 1 locus_tag LOCUS_37350 CDS 268398..269465 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943375.1 transl_table 11 codon_start 1 locus_tag LOCUS_37360 CDS 269853..271838 product TonB-dependent receptor plug domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262962.1 transl_table 11 codon_start 1 locus_tag LOCUS_37370 CDS 271902..272441 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37380 CDS 272455..277566 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37390 CDS 277559..278419 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37400 CDS complement(278450..279769) product PepSY-associated TM helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140346.1 transl_table 11 codon_start 1 locus_tag LOCUS_37410 CDS 280021..282327 product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104749.1 transl_table 11 codon_start 1 locus_tag LOCUS_37420 CDS 282386..282748 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37430 CDS complement(283144..284883) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926891.1 transl_table 11 codon_start 1 locus_tag LOCUS_37440 CDS complement(285005..285979) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37450 CDS complement(285993..286835) product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114179.1 transl_table 11 codon_start 1 locus_tag LOCUS_37460 CDS complement(286850..287803) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37470 CDS 288342..289181 product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000240501.1 transl_table 11 codon_start 1 locus_tag LOCUS_37480 CDS 289181..290380 product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259351.1 transl_table 11 codon_start 1 locus_tag LOCUS_37490 CDS complement(290657..291271) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066494930.1 transl_table 11 codon_start 1 locus_tag LOCUS_37500 CDS 291375..292241 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37510 CDS 292381..293472 product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693776.1 transl_table 11 codon_start 1 locus_tag LOCUS_37520 gene ychF tRNA 293525..293602 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00420 CDS 294422..294805 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37530 CDS 294802..295641 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37540 note possible pseudo, internal stop codon, frameshifted CDS complement(295645..295857) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37550 CDS 296155..296556 product DUF4260 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088113.1 transl_table 11 codon_start 1 locus_tag LOCUS_37560 CDS 296582..297064 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933501.1 transl_table 11 codon_start 1 locus_tag LOCUS_37570 CDS 297106..297672 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37580 CDS 297781..298440 product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085574.1 transl_table 11 codon_start 1 locus_tag LOCUS_37590 CDS 298525..299250 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942220.1 transl_table 11 codon_start 1 locus_tag LOCUS_37600 CDS 299265..299690 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37610 CDS 299678..300541 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189436615.1 transl_table 11 codon_start 1 locus_tag LOCUS_37620 CDS 300551..300973 product SRPBCC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530569.1 transl_table 11 codon_start 1 locus_tag LOCUS_37630 CDS 301005..301637 product FMN-binding negative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521852.1 transl_table 11 codon_start 1 locus_tag LOCUS_37640 CDS 301711..301866 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37650 CDS 301934..302419 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37660 CDS 302873..303748 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703507.1 transl_table 11 codon_start 1 locus_tag LOCUS_37670 CDS 304201..304428 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37680 CDS 304412..304681 product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971059.1 transl_table 11 codon_start 1 locus_tag LOCUS_37690 CDS 305107..305409 product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003379963.1 transl_table 11 codon_start 1 locus_tag LOCUS_37700 CDS 305955..307286 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37710 CDS 307287..308498 product HipA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014857525.1 transl_table 11 codon_start 1 locus_tag LOCUS_37720 CDS 308647..309267 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37730 CDS 309381..309992 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261106.1 transl_table 11 codon_start 1 locus_tag LOCUS_37740 CDS 309994..310545 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37750 CDS 310539..310853 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37760 CDS complement(311261..311572) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37770 CDS 311770..312087 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37780 CDS complement(312182..312421) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37790 CDS 312660..314051 product glucosylceramidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919625.1 transl_table 11 codon_start 1 locus_tag LOCUS_37800 CDS complement(314059..317226) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582531.1 transl_table 11 codon_start 1 locus_tag LOCUS_37810 CDS 317755..318243 product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088185.1 transl_table 11 codon_start 1 locus_tag LOCUS_37820 CDS 318250..319215 product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764194.1 transl_table 11 codon_start 1 locus_tag LOCUS_37830 CDS complement(319243..319632) product PIN domain nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971327.1 transl_table 11 codon_start 1 locus_tag LOCUS_37840 CDS complement(319629..319823) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37850 CDS 320089..322674 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37860 CDS complement(323055..324530) product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010201131.1 transl_table 11 codon_start 1 locus_tag LOCUS_37870 CDS complement(324527..327718) product multidrug efflux RND transporter permease subunit MexF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089834.1 transl_table 11 codon_start 1 locus_tag LOCUS_37880 gene mexF CDS complement(327722..328969) product multidrug efflux RND transporter periplasmic adaptor subunit MexE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103549.1 transl_table 11 codon_start 1 locus_tag LOCUS_37890 gene mexE CDS 329185..329694 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37900 CDS 329877..330404 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37910 CDS complement(330589..332790) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37920 CDS complement(333228..333899) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088037.1 transl_table 11 codon_start 1 locus_tag LOCUS_37930 CDS 334404..336212 product methanol/ethanol family PQQ-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088953.1 transl_table 11 codon_start 1 locus_tag LOCUS_37940 CDS 336242..337201 product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063174003.1 transl_table 11 codon_start 1 locus_tag LOCUS_37950 CDS 337216..337692 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37960 CDS 337855..338136 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37970 CDS 338416..339516 product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072987.1 transl_table 11 codon_start 1 locus_tag LOCUS_37980 CDS 339522..340148 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37990 CDS 340499..341353 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38000 CDS 341350..342267 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38010 CDS 342264..343247 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38020 CDS 343244..343807 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38030 CDS 343844..344776 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38040 CDS complement(344778..345950) product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000579450.1 transl_table 11 codon_start 1 locus_tag LOCUS_38050 CDS complement(345970..348648) product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973413.1 transl_table 11 codon_start 1 locus_tag LOCUS_38060 CDS complement(348661..349884) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38070 CDS complement(349961..351253) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38080 CDS complement(351284..353044) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38090 CDS complement(353055..354068) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480283.1 transl_table 11 codon_start 1 locus_tag LOCUS_38100 CDS complement(354160..355554) product CmpA/NrtA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106412.1 transl_table 11 codon_start 1 locus_tag LOCUS_38110 CDS 356089..356631 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38120 CDS complement(356826..357002) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38130 CDS complement(357210..358190) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706078.1 transl_table 11 codon_start 1 locus_tag LOCUS_38140 CDS complement(358194..361883) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38150 CDS complement(362321..363259) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38160 CDS complement(363284..363949) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38170 CDS complement(363946..365292) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38180 CDS complement(365512..366213) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38190 CDS 366680..368611 product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869596.1 transl_table 11 codon_start 1 locus_tag LOCUS_38200 gene ftsH CDS complement(369030..371588) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38210 CDS complement(371594..372508) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38220 CDS complement(372781..372969) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38230 CDS complement(372988..373887) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38240 CDS complement(374125..374934) product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903919.1 transl_table 11 codon_start 1 locus_tag LOCUS_38250 CDS 375121..375795 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113463.1 transl_table 11 codon_start 1 locus_tag LOCUS_38260 CDS complement(375926..377785) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38270 CDS complement(377927..379222) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38280 CDS complement(379219..380133) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256857.1 transl_table 11 codon_start 1 locus_tag LOCUS_38290 CDS 380457..381467 product isocitrate/isopropylmalate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_127350626.1 transl_table 11 codon_start 1 locus_tag LOCUS_38300 CDS 381490..382104 product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142575.1 transl_table 11 codon_start 1 locus_tag LOCUS_38310 CDS 382123..384681 product bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818886.1 transl_table 11 codon_start 1 locus_tag LOCUS_38320 gene acnB CDS complement(384808..385293) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38330 CDS complement(385674..386096) product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117900.1 transl_table 11 codon_start 1 locus_tag LOCUS_38340 CDS complement(386164..387021) product penicillin-insensitive murein endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694094.1 transl_table 11 codon_start 1 locus_tag LOCUS_38350 gene mepA CDS complement(387058..388194) product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000797323.1 transl_table 11 codon_start 1 locus_tag LOCUS_38360 CDS complement(388396..389784) product ATP-dependent RNA helicase DbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940864.1 transl_table 11 codon_start 1 locus_tag LOCUS_38370 gene dbpA tRNA complement(390559..390646) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00430 CDS 391024..391446 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38380 CDS 391493..393514 product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000893374.1 transl_table 11 codon_start 1 locus_tag LOCUS_38390 CDS 393595..396582 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037353.1 transl_table 11 codon_start 1 locus_tag LOCUS_38400 CDS 396582..397094 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38410 CDS 397111..400614 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38420 CDS 400997..402808 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38430 CDS 402805..405177 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38440 CDS 405445..406452 product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880031.1 transl_table 11 codon_start 1 locus_tag LOCUS_38450 CDS complement(406977..407555) product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000214742.1 transl_table 11 codon_start 1 locus_tag LOCUS_38460 CDS 407710..408594 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209849.1 transl_table 11 codon_start 1 locus_tag LOCUS_38470 CDS complement(409451..409639) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38480 CDS complement(409924..410397) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38490 CDS complement(410469..411698) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38500 note possible pseudo, frameshifted CDS complement(412019..412927) product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000196715.1 transl_table 11 codon_start 1 locus_tag LOCUS_38510 CDS complement(412924..414402) product RimK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088294.1 transl_table 11 codon_start 1 locus_tag LOCUS_38520 CDS 414558..415661 product DUF2817 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533436.1 transl_table 11 codon_start 1 locus_tag LOCUS_38530 CDS 415658..416776 product GNAT family N-acetyltransferase/peptidase C39 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113487.1 transl_table 11 codon_start 1 locus_tag LOCUS_38540 CDS 416856..417011 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38550 CDS 417140..418324 product alanine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931132.1 transl_table 11 codon_start 1 locus_tag LOCUS_38560 gene alaC CDS 418362..419672 product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109642.1 transl_table 11 codon_start 1 locus_tag LOCUS_38570 CDS 419676..420770 product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002048893.1 transl_table 11 codon_start 1 locus_tag LOCUS_38580 gene thrC CDS 420825..422570 product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100681.1 transl_table 11 codon_start 1 locus_tag LOCUS_38590 gene recJ CDS 422577..424118 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38600 CDS 424099..424794 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38610 CDS 424791..425252 product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072803.1 transl_table 11 codon_start 1 locus_tag LOCUS_38620 CDS 425322..426197 product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086270.1 transl_table 11 codon_start 1 locus_tag LOCUS_38630 gene dapA CDS 426200..426949 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38640 CDS 427049..430942 product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113821.1 transl_table 11 codon_start 1 locus_tag LOCUS_38650 gene purL CDS 431127..432440 product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966731.1 transl_table 11 codon_start 1 locus_tag LOCUS_38660 CDS 432437..433081 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088037.1 transl_table 11 codon_start 1 locus_tag LOCUS_38670 CDS complement(433190..434020) product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074169.1 transl_table 11 codon_start 1 locus_tag LOCUS_38680 CDS complement(434167..435918) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38690 CDS 436044..436526 product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812465.1 transl_table 11 codon_start 1 locus_tag LOCUS_38700 CDS 436549..437268 product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958017.1 transl_table 11 codon_start 1 locus_tag LOCUS_38710 CDS 437395..440004 product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444523.1 transl_table 11 codon_start 1 locus_tag LOCUS_38720 gene gyrA CDS 440007..441086 product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106701.1 transl_table 11 codon_start 1 locus_tag LOCUS_38730 gene serC CDS 441098..442183 product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404232.1 transl_table 11 codon_start 1 locus_tag LOCUS_38740 gene pheA CDS 442195..443298 product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115433.1 transl_table 11 codon_start 1 locus_tag LOCUS_38750 gene hisC CDS 443291..444166 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38760 CDS 444177..445493 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38770 note possible pseudo, frameshifted CDS 445495..446151 product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037341.1 transl_table 11 codon_start 1 locus_tag LOCUS_38780 gene cmk CDS 446248..447909 product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091442.1 transl_table 11 codon_start 1 locus_tag LOCUS_38790 gene rpsA CDS 447943..448281 product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037339.1 transl_table 11 codon_start 1 locus_tag LOCUS_38800 CDS 448449..449408 product acetylxylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970872.1 transl_table 11 codon_start 1 locus_tag LOCUS_38810 CDS 449412..450140 product esterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970873.1 transl_table 11 codon_start 1 locus_tag LOCUS_38820 CDS complement(450174..452078) product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707080.1 transl_table 11 codon_start 1 locus_tag LOCUS_38830 gene ftsH CDS complement(452088..453182) product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227994.1 transl_table 11 codon_start 1 locus_tag LOCUS_38840 CDS complement(453179..453676) product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172593.1 transl_table 11 codon_start 1 locus_tag LOCUS_38850 gene purE CDS 453823..454455 product cytochrome c biogenesis heme-transporting ATPase CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000895172.1 transl_table 11 codon_start 1 locus_tag LOCUS_38860 gene ccmA CDS 454446..455120 product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705298.1 transl_table 11 codon_start 1 locus_tag LOCUS_38870 gene ccmB CDS 455120..455881 product heme ABC transporter permease CcmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036839.1 transl_table 11 codon_start 1 locus_tag LOCUS_38880 gene ccmC CDS 455878..456045 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38890 CDS 456042..456476 product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765255.1 transl_table 11 codon_start 1 locus_tag LOCUS_38900 gene ccmE CDS 456473..458416 product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765253.1 transl_table 11 codon_start 1 locus_tag LOCUS_38910 CDS 458416..458946 product DsbE family thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811410.1 transl_table 11 codon_start 1 locus_tag LOCUS_38920 CDS 458943..459398 product cytochrome c-type biogenesis protein CcmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001918752.1 transl_table 11 codon_start 1 locus_tag LOCUS_38930 CDS 459395..460603 product c-type cytochrome biogenesis protein CcmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083145.1 transl_table 11 codon_start 1 locus_tag LOCUS_38940 gene ccmI CDS 460603..461982 product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087267.1 transl_table 11 codon_start 1 locus_tag LOCUS_38950 gene hemN CDS 462889..463074 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38960 CDS complement(463643..464758) product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795308.1 transl_table 11 codon_start 1 locus_tag LOCUS_38970 gene ald CDS 465022..466683 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38980 CDS complement(466943..467281) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38990 CDS 467678..468640 product YVTN family beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532045.1 transl_table 11 codon_start 1 locus_tag LOCUS_39000 CDS 468637..469374 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088930.1 transl_table 11 codon_start 1 locus_tag LOCUS_39010 CDS 469371..470180 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173657.1 transl_table 11 codon_start 1 locus_tag LOCUS_39020 CDS 470660..472234 product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946608.1 transl_table 11 codon_start 1 locus_tag LOCUS_39030 CDS 472510..473457 product histone deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532793.1 transl_table 11 codon_start 1 locus_tag LOCUS_39040 CDS complement(473485..473976) product cytochrome P460 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941405.1 transl_table 11 codon_start 1 locus_tag LOCUS_39050 CDS 474217..476292 product carbon starvation protein CstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047792095.1 transl_table 11 codon_start 1 locus_tag LOCUS_39060 gene cstA CDS 476762..477445 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39070 CDS complement(477648..478013) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39080 note possible pseudo, internal stop codon, frameshifted CDS complement(478275..479381) product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081326.1 transl_table 11 codon_start 1 locus_tag LOCUS_39090 gene leuB CDS 480083..480958 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464929.1 transl_table 11 codon_start 1 locus_tag LOCUS_39100 CDS complement(481539..482885) product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_114714636.1 transl_table 11 codon_start 1 locus_tag LOCUS_39110 CDS 482970..483164 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39120 CDS complement(483270..483800) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268600.1 transl_table 11 codon_start 1 locus_tag LOCUS_39130 CDS complement(483934..484122) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39140 note possible pseudo, internal stop codon CDS complement(484147..484317) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39150 note possible pseudo, internal stop codon CDS complement(484314..484523) product type II toxin-antitoxin system VapB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106997.1 transl_table 11 codon_start 1 locus_tag LOCUS_39160 CDS 484755..485021 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39170 CDS 485018..485413 product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969348.1 transl_table 11 codon_start 1 locus_tag LOCUS_39180 CDS complement(485720..487237) product alpha-isopropylmalate synthase regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763199.1 transl_table 11 codon_start 1 locus_tag LOCUS_39190 CDS complement(487698..488219) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39200 CDS complement(488545..489354) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39210 CDS 489740..489952 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39220 CDS complement(489956..490795) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39230 note possible pseudo, internal stop codon, frameshifted CDS 491420..491674 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39240 CDS 491658..491966 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39250 CDS 492019..493464 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39260 CDS 493802..494128 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39270 note possible pseudo, internal stop codon CDS complement(494132..494881) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39280 tRNA complement(495351..495437) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00440 CDS complement(495558..496739) product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118408.1 transl_table 11 codon_start 1 locus_tag LOCUS_39290 CDS complement(496845..498332) product exodeoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819831.1 transl_table 11 codon_start 1 locus_tag LOCUS_39300 gene sbcB CDS 498411..499004 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39310 CDS 499073..500026 product cytochrome D1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087474.1 transl_table 11 codon_start 1 locus_tag LOCUS_39320 CDS 500098..500388 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947734.1 transl_table 11 codon_start 1 locus_tag LOCUS_39330 CDS complement(500430..500651) product FeoC-like transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390224.1 transl_table 11 codon_start 1 locus_tag LOCUS_39340 CDS complement(500648..502963) product Fe(2+) transporter permease subunit FeoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390223.1 transl_table 11 codon_start 1 locus_tag LOCUS_39350 gene feoB CDS complement(502960..503193) product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390222.1 transl_table 11 codon_start 1 locus_tag LOCUS_39360 CDS complement(503266..503640) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39370 CDS complement(503643..503852) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39380 CDS 504193..504432 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39390 CDS 504435..505562 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39400 CDS 505588..505917 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39410 CDS 506169..506393 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39420 CDS 506464..507855 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39430 CDS 507855..508253 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39440 CDS 508272..509252 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39450 CDS 509325..509687 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39460 CDS complement(510202..510564) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39470 CDS 510859..513252 product phosphoketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057028.1 transl_table 11 codon_start 1 locus_tag LOCUS_39480 CDS complement(513249..514622) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39490 CDS complement(514619..515875) product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259028.1 transl_table 11 codon_start 1 locus_tag LOCUS_39500 CDS complement(515889..516815) product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257736.1 transl_table 11 codon_start 1 locus_tag LOCUS_39510 CDS complement(516899..517744) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39520 CDS complement(517970..519175) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039084.1 transl_table 11 codon_start 1 locus_tag LOCUS_39530 CDS complement(519193..519603) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39540 CDS complement(519697..520446) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39550 CDS complement(520446..521648) product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039069.1 transl_table 11 codon_start 1 locus_tag LOCUS_39560 CDS complement(521648..523978) product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039076.1 transl_table 11 codon_start 1 locus_tag LOCUS_39570 CDS complement(523982..524614) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39580 CDS complement(524611..525222) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39590 CDS complement(525225..525488) product phosphopantetheine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964357.1 transl_table 11 codon_start 1 locus_tag LOCUS_39600 CDS 525631..525882 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39610 CDS 525879..526136 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39620 CDS 526193..526435 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39630 CDS 526432..527718 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39640 CDS 527890..529317 product D-alanine--poly(phosphoribitol) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030516.1 transl_table 11 codon_start 1 locus_tag LOCUS_39650 CDS 529407..530183 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39660 CDS 530258..530788 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268600.1 transl_table 11 codon_start 1 locus_tag LOCUS_39670 CDS 530782..531300 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39680 CDS complement(531458..532201) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39690 CDS 532389..533552 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973142.1 transl_table 11 codon_start 1 locus_tag LOCUS_39700 CDS 533552..534382 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39710 CDS 534412..534789 product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228235.1 transl_table 11 codon_start 1 locus_tag LOCUS_39720 CDS complement(534853..535419) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39730 CDS complement(535544..535960) product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074029.1 transl_table 11 codon_start 1 locus_tag LOCUS_39740 CDS complement(535962..536939) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39750 note possible pseudo, frameshifted CDS complement(536936..537679) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39760 note possible pseudo, frameshifted CDS complement(537663..538040) product thioester dehydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074026.1 transl_table 11 codon_start 1 locus_tag LOCUS_39770 CDS complement(538043..538690) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815691.1 transl_table 11 codon_start 1 locus_tag LOCUS_39780 CDS complement(538697..538945) product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001987856.1 transl_table 11 codon_start 1 locus_tag LOCUS_39790 CDS complement(539152..539895) product beta-ketoacyl synthase chain length factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765435.1 transl_table 11 codon_start 1 locus_tag LOCUS_39800 CDS complement(539909..541144) product beta-ketoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074037.1 transl_table 11 codon_start 1 locus_tag LOCUS_39810 CDS complement(541138..541866) product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765466.1 transl_table 11 codon_start 1 locus_tag LOCUS_39820 gene fabG CDS complement(541863..542354) product hotdog family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003346295.1 transl_table 11 codon_start 1 locus_tag LOCUS_39830 CDS complement(542326..543495) product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266391.1 transl_table 11 codon_start 1 locus_tag LOCUS_39840 CDS complement(543506..544732) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074032.1 transl_table 11 codon_start 1 locus_tag LOCUS_39850 CDS 544909..546228 product xanthomonadin biosynthesis 3-hydroxybenozate--AMP ligase XanA2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014506148.1 transl_table 11 codon_start 1 locus_tag LOCUS_39860 gene xanA2 CDS complement(546261..547064) product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768766.1 transl_table 11 codon_start 1 locus_tag LOCUS_39870 gene truA CDS complement(547077..547598) product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957994.1 transl_table 11 codon_start 1 locus_tag LOCUS_39880 CDS complement(547595..548959) product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947185.1 transl_table 11 codon_start 1 locus_tag LOCUS_39890 gene rlmD CDS complement(548976..549866) product cysteine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102419.1 transl_table 11 codon_start 1 locus_tag LOCUS_39900 gene cysM CDS 549993..552062 product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206067.1 transl_table 11 codon_start 1 locus_tag LOCUS_39910 gene ppk1 CDS 552071..552790 product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267225.1 transl_table 11 codon_start 1 locus_tag LOCUS_39920 gene dnaQ CDS complement(552819..556346) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39930 CDS complement(556419..556634) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39940 CDS 557052..557516 product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958244.1 transl_table 11 codon_start 1 locus_tag LOCUS_39950 CDS complement(557513..557986) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074117.1 transl_table 11 codon_start 1 locus_tag LOCUS_39960 CDS complement(558985..560298) product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107706.1 transl_table 11 codon_start 1 locus_tag LOCUS_39970 CDS complement(560439..562238) product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173455.1 transl_table 11 codon_start 1 locus_tag LOCUS_39980 CDS complement(562573..562833) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39990 CDS complement(562830..563471) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40000 CDS complement(563468..563971) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40010 CDS complement(563968..564354) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40020 CDS 564978..565481 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40030 CDS complement(565553..567199) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40040 CDS complement(567220..567534) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40050 CDS complement(567850..568110) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40060 CDS complement(568415..570397) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40070 CDS complement(570384..571319) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40080 CDS complement(571312..571578) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40090 CDS complement(571578..571799) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40100 CDS complement(571898..572620) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40110 CDS complement(572621..573874) product integrase arm-type DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530181.1 transl_table 11 codon_start 1 locus_tag LOCUS_40120 tRNA complement(574061..574145) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00450 CDS complement(574194..575048) product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038853.1 transl_table 11 codon_start 1 locus_tag LOCUS_40130 gene rpoH CDS 575485..576951 product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267206.1 transl_table 11 codon_start 1 locus_tag LOCUS_40140 CDS 576966..577850 product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143165.1 transl_table 11 codon_start 1 locus_tag LOCUS_40150 CDS 578040..578369 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40160 note possible pseudo, frameshifted CDS 578374..578694 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40170 note possible pseudo, frameshifted CDS complement(578712..579113) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40180 CDS complement(579162..580385) product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393061.1 transl_table 11 codon_start 1 locus_tag LOCUS_40190 CDS complement(580387..582039) product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393063.1 transl_table 11 codon_start 1 locus_tag LOCUS_40200 CDS complement(582044..582769) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40210 CDS complement(582747..584561) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40220 CDS complement(584923..586005) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40230 CDS complement(586002..586697) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40240 CDS complement(586983..588725) product PglL family O-oligosaccharyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244038.1 transl_table 11 codon_start 1 locus_tag LOCUS_40250 CDS complement(588812..589027) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40260 CDS 588985..589176 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40270 CDS complement(589169..590113) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40280 CDS complement(590401..590640) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40290 CDS complement(590637..591116) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40300 CDS complement(591113..592948) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40310 CDS complement(593594..595123) product threonine ammonia-lyase, biosynthetic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110582.1 transl_table 11 codon_start 1 locus_tag LOCUS_40320 gene ilvA CDS 595314..595991 product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005163342.1 transl_table 11 codon_start 1 locus_tag LOCUS_40330 gene rpiA CDS 596200..597873 product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396100.1 transl_table 11 codon_start 1 locus_tag LOCUS_40340 CDS 598008..599882 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40350 CDS 599907..600290 product bacteriohemerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943560.1 transl_table 11 codon_start 1 locus_tag LOCUS_40360 CDS complement(600604..601380) product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007039689.1 transl_table 11 codon_start 1 locus_tag LOCUS_40370 gene kdsB CDS complement(601377..601568) product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005422539.1 transl_table 11 codon_start 1 locus_tag LOCUS_40380 CDS complement(601561..602562) product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957852.1 transl_table 11 codon_start 1 locus_tag LOCUS_40390 gene lpxK CDS complement(602562..602993) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40400 CDS complement(602993..603607) product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267143.1 transl_table 11 codon_start 1 locus_tag LOCUS_40410 CDS complement(603642..604796) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103817.1 transl_table 11 codon_start 1 locus_tag LOCUS_40420 CDS complement(604797..605885) product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405788.1 transl_table 11 codon_start 1 locus_tag LOCUS_40430 gene aroC CDS complement(605888..606817) product 50S ribosomal protein L3 N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072977.1 transl_table 11 codon_start 1 locus_tag LOCUS_40440 gene prmB CDS 606906..607784 product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114179.1 transl_table 11 codon_start 1 locus_tag LOCUS_40450 CDS 607912..608256 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40460 CDS 608464..609711 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40470 CDS 609941..610330 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40480 CDS 610327..611166 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40490 note possible pseudo, internal stop codon, frameshifted CDS 611212..611436 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40500 note possible pseudo, internal stop codon CDS 611632..612183 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40510 note possible pseudo, frameshifted CDS 612078..612962 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40520 note possible pseudo, frameshifted CDS 613023..613538 product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054412741.1 transl_table 11 codon_start 1 locus_tag LOCUS_40530 CDS complement(613542..614459) product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312586.1 transl_table 11 codon_start 1 locus_tag LOCUS_40540 CDS complement(614463..614843) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40550 CDS complement(614843..617383) product nitrite reductase large subunit NirB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024901082.1 transl_table 11 codon_start 1 locus_tag LOCUS_40560 gene nirB CDS 617814..619292 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40570 CDS 619295..619876 product ANTAR domain-containing response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534620.1 transl_table 11 codon_start 1 locus_tag LOCUS_40580 CDS complement(620159..622093) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40590 CDS 622387..623886 product flagellar hook-length control protein FliK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895570.1 transl_table 11 codon_start 1 locus_tag LOCUS_40600 CDS 624039..625043 product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095990.1 transl_table 11 codon_start 1 locus_tag LOCUS_40610 CDS 625106..625840 product fumarate/nitrate reduction transcriptional regulator Fnr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004408100.1 transl_table 11 codon_start 1 locus_tag LOCUS_40620 gene fnr CDS complement(625845..626609) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000284384.1 transl_table 11 codon_start 1 locus_tag LOCUS_40630 CDS complement(626606..627511) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090885.1 transl_table 11 codon_start 1 locus_tag LOCUS_40640 CDS 627630..629132 product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005731673.1 transl_table 11 codon_start 1 locus_tag LOCUS_40650 gene ppx CDS 629126..630361 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40660 CDS complement(630440..631420) product RNA polymerase sigma factor RpoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003314325.1 transl_table 11 codon_start 1 locus_tag LOCUS_40670 gene rpoS CDS complement(631905..632351) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40680 CDS 632474..632998 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40690 note possible pseudo, frameshifted CDS 632991..634235 product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705495.1 transl_table 11 codon_start 1 locus_tag LOCUS_40700 gene moeA CDS complement(634335..635063) product DUF3581 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073732.1 transl_table 11 codon_start 1 locus_tag LOCUS_40710 CDS complement(635079..635402) product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522276.1 transl_table 11 codon_start 1 locus_tag LOCUS_40720 CDS complement(635393..636556) product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406662.1 transl_table 11 codon_start 1 locus_tag LOCUS_40730 CDS 636667..637098 product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095122.1 transl_table 11 codon_start 1 locus_tag LOCUS_40740 gene dksA CDS 637260..637994 product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115557.1 transl_table 11 codon_start 1 locus_tag LOCUS_40750 gene gluQRS CDS 638021..639961 product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113911.1 transl_table 11 codon_start 1 locus_tag LOCUS_40760 gene acs CDS 639963..640853 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40770 CDS 641299..642819 product DUF4301 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787470.1 transl_table 11 codon_start 1 locus_tag LOCUS_40780 CDS 643212..643367 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40790 CDS 643309..644628 product outer membrane channel protein TolC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262654.1 transl_table 11 codon_start 1 locus_tag LOCUS_40800 gene tolC CDS complement(645572..646918) product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_114714636.1 transl_table 11 codon_start 1 locus_tag LOCUS_40810 CDS complement(647115..647432) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105163.1 transl_table 11 codon_start 1 locus_tag LOCUS_40820 CDS complement(647425..648060) product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121049.1 transl_table 11 codon_start 1 locus_tag LOCUS_40830 CDS complement(648063..648872) product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922000.1 transl_table 11 codon_start 1 locus_tag LOCUS_40840 CDS complement(649194..651173) product exodeoxyribonuclease V subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266565.1 transl_table 11 codon_start 1 locus_tag LOCUS_40850 gene recD CDS complement(651170..654838) product exodeoxyribonuclease V subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103276.1 transl_table 11 codon_start 1 locus_tag LOCUS_40860 gene recB CDS complement(654835..658326) product exodeoxyribonuclease V subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010793829.1 transl_table 11 codon_start 1 locus_tag LOCUS_40870 gene recC CDS complement(658480..659565) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40880 CDS complement(659970..661274) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40890 CDS complement(661407..662162) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40900 CDS 662348..662509 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40910 CDS 662585..662809 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40920 CDS complement(662745..663149) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40930 CDS complement(663211..663609) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40940 CDS complement(663710..666985) product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479332.1 transl_table 11 codon_start 1 locus_tag LOCUS_40950 CDS complement(666982..668079) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839428.1 transl_table 11 codon_start 1 locus_tag LOCUS_40960 CDS complement(668090..669427) product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926923.1 transl_table 11 codon_start 1 locus_tag LOCUS_40970 CDS complement(669515..670786) product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088518.1 transl_table 11 codon_start 1 locus_tag LOCUS_40980 CDS complement(670829..671041) product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941064.1 transl_table 11 codon_start 1 locus_tag LOCUS_40990 CDS complement(671038..671193) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41000 CDS complement(671205..672344) product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195344.1 transl_table 11 codon_start 1 locus_tag LOCUS_41010 gene cydB CDS complement(672369..673919) product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195345.1 transl_table 11 codon_start 1 locus_tag LOCUS_41020 CDS complement(673909..674145) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41030 CDS complement(674699..675355) product thiopurine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766796.1 transl_table 11 codon_start 1 locus_tag LOCUS_41040 CDS 675861..676292 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41050 CDS complement(676634..679693) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41060 CDS complement(680121..680675) product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003023254.1 transl_table 11 codon_start 1 locus_tag LOCUS_41070 CDS complement(680685..681269) product NTP transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401864.1 transl_table 11 codon_start 1 locus_tag LOCUS_41080 CDS complement(681262..682383) product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030710.1 transl_table 11 codon_start 1 locus_tag LOCUS_41090 CDS complement(682631..683014) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41100 CDS 684232..684981 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41110 CDS 685179..686012 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41120 CDS 686206..688407 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41130 CDS complement(688684..689805) product XdhC/CoxI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072950.1 transl_table 11 codon_start 1 locus_tag LOCUS_41140 CDS complement(690100..690900) product 2,3-dihydro-2,3-dihydroxybenzoate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244476.1 transl_table 11 codon_start 1 locus_tag LOCUS_41150 CDS complement(690897..692960) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41160 CDS complement(692960..693943) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206817729.1 transl_table 11 codon_start 1 locus_tag LOCUS_41170 CDS complement(693940..694962) product Fe(3+)-siderophore ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001277880.1 transl_table 11 codon_start 1 locus_tag LOCUS_41180 gene fepD CDS complement(694959..695897) product amonabactin ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705834.1 transl_table 11 codon_start 1 locus_tag LOCUS_41190 CDS complement(695894..696682) product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816565.1 transl_table 11 codon_start 1 locus_tag LOCUS_41200 CDS complement(696801..697688) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820327.1 transl_table 11 codon_start 1 locus_tag LOCUS_41210 CDS 697939..699912 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339007.1 transl_table 11 codon_start 1 locus_tag LOCUS_41220 CDS 699919..701139 product isochorismate synthase DhbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001001954.1 transl_table 11 codon_start 1 locus_tag LOCUS_41230 gene dhbC CDS 701136..702773 product (2,3-dihydroxybenzoyl)adenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243083.1 transl_table 11 codon_start 1 locus_tag LOCUS_41240 CDS 702770..703648 product isochorismatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228749.1 transl_table 11 codon_start 1 locus_tag LOCUS_41250 CDS 703645..704928 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41260 CDS complement(704990..705265) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41270 CDS complement(705290..705421) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41280 CDS complement(705465..706232) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41290 note possible pseudo, internal stop codon CDS complement(706311..707717) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41300 note possible pseudo, internal stop codon CDS complement(707714..708187) product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639856.1 transl_table 11 codon_start 1 locus_tag LOCUS_41310 CDS 708674..709009 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41320 CDS 709146..709286 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41330 CDS 709669..709926 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41340 CDS complement(710044..710844) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41350 CDS 711577..711762 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41360 note possible pseudo, frameshifted CDS 711921..712124 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41370 note possible pseudo, frameshifted CDS 712203..712937 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41380 CDS 713144..713620 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41390 note possible pseudo, internal stop codon CDS 713633..714415 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41400 note possible pseudo, internal stop codon CDS complement(714688..716034) product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_114714636.1 transl_table 11 codon_start 1 locus_tag LOCUS_41410 CDS 716590..716787 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41420 CDS complement(716795..717889) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256070.1 transl_table 11 codon_start 1 locus_tag LOCUS_41430 CDS complement(717902..718279) product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404257.1 transl_table 11 codon_start 1 locus_tag LOCUS_41440 CDS complement(718307..719347) product zinc-binding alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902730.1 transl_table 11 codon_start 1 locus_tag LOCUS_41450 CDS complement(719344..720060) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41460 note possible pseudo, frameshifted CDS complement(720038..720685) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41470 note possible pseudo, frameshifted CDS complement(720989..722263) product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119323.1 transl_table 11 codon_start 1 locus_tag LOCUS_41480 CDS complement(722325..723095) product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071010.1 transl_table 11 codon_start 1 locus_tag LOCUS_41490 CDS complement(723375..723893) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41500 CDS complement(723893..724732) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41510 CDS complement(724725..725303) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41520 CDS complement(725300..726346) product baseplate J/gp47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937528.1 transl_table 11 codon_start 1 locus_tag LOCUS_41530 CDS complement(726343..726741) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41540 CDS complement(726735..726923) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41550 CDS complement(726925..727422) product phage baseplate assembly protein V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001259080.1 transl_table 11 codon_start 1 locus_tag LOCUS_41560 CDS complement(727403..728446) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41570 CDS complement(728439..729602) product DNA circularization N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940121.1 transl_table 11 codon_start 1 locus_tag LOCUS_41580 CDS complement(729602..731572) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41590 CDS complement(731775..732194) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41600 CDS complement(732205..733599) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41610 CDS complement(733609..733974) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41620 CDS complement(734050..735510) product phage tail sheath subtilisin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940124.1 transl_table 11 codon_start 1 locus_tag LOCUS_41630 CDS complement(735507..735995) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41640 CDS complement(735995..736498) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41650 CDS complement(736498..737187) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41660 CDS complement(737254..738144) product Mu-like prophage major head subunit gpT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693526.1 transl_table 11 codon_start 1 locus_tag LOCUS_41670 CDS complement(738179..739186) product phage protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002232421.1 transl_table 11 codon_start 1 locus_tag LOCUS_41680 CDS complement(739418..739660) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41690 CDS complement(739854..740258) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41700 CDS complement(740261..740713) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41710 CDS complement(740706..740879) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41720 CDS complement(740879..741388) product host-nuclease inhibitor Gam family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140136.1 transl_table 11 codon_start 1 locus_tag LOCUS_41730 CDS complement(741458..742012) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41740 CDS complement(742009..742374) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41750 CDS complement(742385..742588) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41760 CDS complement(742585..743004) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41770 CDS complement(743013..743951) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005708986.1 transl_table 11 codon_start 1 locus_tag LOCUS_41780 CDS complement(743948..744271) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41790 CDS complement(744280..745941) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41800 CDS complement(745953..747011) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41810 CDS complement(747004..747243) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41820 CDS 747288..747704 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41830 CDS 747720..747965 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41840 CDS 747966..748451 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41850 CDS 748464..748955 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41860 CDS 748966..749364 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41870 CDS 749380..749718 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41880 CDS complement(750021..750719) product DUF2786 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072609.1 transl_table 11 codon_start 1 locus_tag LOCUS_41890 CDS complement(750716..750889) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41900 CDS complement(750874..751107) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41910 CDS complement(751111..751740) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41920 CDS 751885..752055 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41930 CDS 752058..752384 product DUF4406 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014592.1 transl_table 11 codon_start 1 locus_tag LOCUS_41940 CDS 752381..752716 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41950 CDS 752713..753042 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41960 CDS 753045..753539 product DUF1804 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213715.1 transl_table 11 codon_start 1 locus_tag LOCUS_41970 CDS 753532..754119 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41980 CDS 754112..755806 product phage terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939974.1 transl_table 11 codon_start 1 locus_tag LOCUS_41990 gene terL CDS 755799..756179 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42000 CDS 756172..756438 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42010 CDS 756435..758021 product DUF935 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869229.1 transl_table 11 codon_start 1 locus_tag LOCUS_42020 CDS 758018..758326 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42030 CDS 758323..759621 product PBECR2 nuclease fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_110752062.1 transl_table 11 codon_start 1 locus_tag LOCUS_42040 CDS 759726..760247 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42050 CDS 760920..762392 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42060 CDS 762695..763354 product CerR family C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937368.1 transl_table 11 codon_start 1 locus_tag LOCUS_42070 CDS 763351..764622 product MdtA/MuxA family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815035.1 transl_table 11 codon_start 1 locus_tag LOCUS_42080 CDS 764626..767769 product multidrug efflux RND transporter permease subunit MuxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089920.1 transl_table 11 codon_start 1 locus_tag LOCUS_42090 gene muxB CDS 767766..770891 product multidrug efflux RND transporter permease subunit MdtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815800.1 transl_table 11 codon_start 1 locus_tag LOCUS_42100 gene mdtC CDS 770926..772383 product multidrug efflux RND transporter outer membrane subunit OpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089909.1 transl_table 11 codon_start 1 locus_tag LOCUS_42110 gene opmB CDS 772604..773011 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42120 CDS 773008..773721 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42130 CDS complement(773902..775203) product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922914.1 transl_table 11 codon_start 1 locus_tag LOCUS_42140 CDS complement(775324..777132) product allophanate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140963.1 transl_table 11 codon_start 1 locus_tag LOCUS_42150 gene atzF CDS complement(777129..780737) product urea carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045751776.1 transl_table 11 codon_start 1 locus_tag LOCUS_42160 gene uca CDS complement(780807..781445) product urea carboxylase-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096803.1 transl_table 11 codon_start 1 locus_tag LOCUS_42170 CDS complement(781471..782202) product urea carboxylase-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420904.1 transl_table 11 codon_start 1 locus_tag LOCUS_42180 CDS complement(782221..783060) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966753.1 transl_table 11 codon_start 1 locus_tag LOCUS_42190 CDS complement(783066..783794) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140177.1 transl_table 11 codon_start 1 locus_tag LOCUS_42200 CDS complement(783891..784886) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143100.1 transl_table 11 codon_start 1 locus_tag LOCUS_42210 CDS complement(785357..789628) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42220 CDS complement(789630..794726) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42230 CDS complement(794840..796300) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42240 CDS complement(796483..796668) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42250 CDS 796997..797806 product sulfate ABC transporter permease subunit CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942000.1 transl_table 11 codon_start 1 locus_tag LOCUS_42260 gene cysT CDS 797815..798678 product sulfate ABC transporter permease subunit CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142072.1 transl_table 11 codon_start 1 locus_tag LOCUS_42270 gene cysW CDS 798743..799786 product sulfate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536166.1 transl_table 11 codon_start 1 locus_tag LOCUS_42280 CDS 799895..800797 product CysB family HTH-type transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193901.1 transl_table 11 codon_start 1 locus_tag LOCUS_42290 CDS 801130..802107 product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222180.1 transl_table 11 codon_start 1 locus_tag LOCUS_42300 gene cysK CDS 802104..803033 product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194474.1 transl_table 11 codon_start 1 locus_tag LOCUS_42310 CDS 803135..804052 product family 2A encapsulin nanocompartment shell protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107594.1 transl_table 11 codon_start 1 locus_tag LOCUS_42320 CDS 804039..805682 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42330 CDS complement(805877..807517) product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926123.1 transl_table 11 codon_start 1 locus_tag LOCUS_42340 CDS complement(807605..808243) product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521881.1 transl_table 11 codon_start 1 locus_tag LOCUS_42350 CDS complement(808248..808970) product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349084.1 transl_table 11 codon_start 1 locus_tag LOCUS_42360 CDS complement(808973..809563) product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521881.1 transl_table 11 codon_start 1 locus_tag LOCUS_42370 CDS complement(809574..809927) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42380 CDS complement(810314..811777) product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120393.1 transl_table 11 codon_start 1 locus_tag LOCUS_42390 CDS complement(811882..814218) product PSD1 and planctomycete cytochrome C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615801.1 transl_table 11 codon_start 1 locus_tag LOCUS_42400 CDS complement(814284..814790) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42410 CDS complement(815423..816199) product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118181.1 transl_table 11 codon_start 1 locus_tag LOCUS_42420 note possible pseudo, frameshifted CDS complement(816097..816381) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42430 CDS complement(816456..819275) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112659.1 transl_table 11 codon_start 1 locus_tag LOCUS_42440 CDS complement(819544..822567) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42450 CDS 823284..824723 product aryl-sulfate sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003144052.1 transl_table 11 codon_start 1 locus_tag LOCUS_42460 CDS 824901..825356 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42470 CDS complement(825395..826471) product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407646.1 transl_table 11 codon_start 1 locus_tag LOCUS_42480 CDS 827292..827519 product Sec-independent protein translocase subunit TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815808.1 transl_table 11 codon_start 1 locus_tag LOCUS_42490 gene tatA CDS 827816..830992 product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140878.1 transl_table 11 codon_start 1 locus_tag LOCUS_42500 CDS 830999..832216 product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140877.1 transl_table 11 codon_start 1 locus_tag LOCUS_42510 CDS complement(832268..832768) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072248.1 transl_table 11 codon_start 1 locus_tag LOCUS_42520 CDS complement(832765..833874) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42530 CDS complement(834101..834940) product drug/metabolite exporter YedA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038991.1 transl_table 11 codon_start 1 locus_tag LOCUS_42540 gene yedA CDS complement(835685..836371) product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070545.1 transl_table 11 codon_start 1 locus_tag LOCUS_42550 gene ribB CDS complement(836818..837624) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970116.1 transl_table 11 codon_start 1 locus_tag LOCUS_42560 CDS 837734..838195 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42570 CDS complement(838238..838624) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42580 note possible pseudo, frameshifted CDS complement(838546..839181) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42590 note possible pseudo, frameshifted CDS complement(839391..839942) product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202239.1 transl_table 11 codon_start 1 locus_tag LOCUS_42600 CDS complement(840361..840843) product DUF1697 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921635.1 transl_table 11 codon_start 1 locus_tag LOCUS_42610 CDS complement(840881..841300) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42620 CDS complement(841344..843119) product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895584.1 transl_table 11 codon_start 1 locus_tag LOCUS_42630 CDS complement(843316..843801) product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005304871.1 transl_table 11 codon_start 1 locus_tag LOCUS_42640 CDS 843902..845677 product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815908.1 transl_table 11 codon_start 1 locus_tag LOCUS_42650 gene leuA CDS 845692..846138 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42660 note possible pseudo, internal stop codon CDS 846056..846238 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42670 CDS complement(846678..847637) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42680 CDS complement(847755..848315) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42690 CDS complement(848460..848918) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42700 CDS complement(849252..849743) product lpg2434 family Dot/Icm T4SS effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948137.1 transl_table 11 codon_start 1 locus_tag LOCUS_42710 CDS complement(849779..850279) product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809462.1 transl_table 11 codon_start 1 locus_tag LOCUS_42720 CDS complement(850276..851154) product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001005489.1 transl_table 11 codon_start 1 locus_tag LOCUS_42730 gene ilvE CDS complement(851170..852108) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969724.1 transl_table 11 codon_start 1 locus_tag LOCUS_42740 CDS 852257..853225 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42750 note possible pseudo, frameshifted CDS 853144..853668 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42760 note possible pseudo, frameshifted CDS complement(853931..854707) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522540.1 transl_table 11 codon_start 1 locus_tag LOCUS_42770 CDS 854799..855590 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021804.1 transl_table 11 codon_start 1 locus_tag LOCUS_42780 CDS 855818..856099 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42790 CDS 856096..856617 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42800 CDS 856617..857102 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42810 CDS 857157..857876 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42820 CDS complement(857983..858255) product DNA-binding protein HU-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087931.1 transl_table 11 codon_start 1 locus_tag LOCUS_42830 gene hupB CDS complement(858324..861329) product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055064929.1 transl_table 11 codon_start 1 locus_tag LOCUS_42840 CDS complement(861457..862572) product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000368910.1 transl_table 11 codon_start 1 locus_tag LOCUS_42850 CDS complement(862569..863573) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42860 CDS complement(863563..865122) product IS21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_128955176.1 transl_table 11 codon_start 1 locus_tag LOCUS_42870 gene istA CDS 865224..865652 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42880 CDS 866224..866562 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42890 CDS complement(866513..867637) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42900 CDS 867978..870578 product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098485.1 transl_table 11 codon_start 1 locus_tag LOCUS_42910 gene mutS CDS 870719..872980 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42920 CDS 873213..874559 product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_114714636.1 transl_table 11 codon_start 1 locus_tag LOCUS_42930 CDS 874784..875230 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42940 CDS 875245..875835 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42950 CDS complement(875889..876599) product DsbC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035896.1 transl_table 11 codon_start 1 locus_tag LOCUS_42960 CDS complement(876663..878027) product sigma E protease regulator RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406254.1 transl_table 11 codon_start 1 locus_tag LOCUS_42970 gene rseP CDS complement(878031..879215) product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266975.1 transl_table 11 codon_start 1 locus_tag LOCUS_42980 gene ispC CDS complement(879212..880135) product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368161.1 transl_table 11 codon_start 1 locus_tag LOCUS_42990 gene cdsA CDS complement(880176..880940) product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705097.1 transl_table 11 codon_start 1 locus_tag LOCUS_43000 gene uppS CDS complement(880953..881510) product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947438.1 transl_table 11 codon_start 1 locus_tag LOCUS_43010 gene frr CDS complement(881515..882234) product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036563.1 transl_table 11 codon_start 1 locus_tag LOCUS_43020 gene pyrH CDS complement(882318..883199) product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947440.1 transl_table 11 codon_start 1 locus_tag LOCUS_43030 gene tsf CDS complement(883319..884062) product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092394.1 transl_table 11 codon_start 1 locus_tag LOCUS_43040 gene rpsB CDS 884344..885108 product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947446.1 transl_table 11 codon_start 1 locus_tag LOCUS_43050 gene map CDS 885105..887750 product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113862.1 transl_table 11 codon_start 1 locus_tag LOCUS_43060 CDS complement(887755..888264) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43070 note possible pseudo, frameshifted CDS complement(888231..888974) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43080 note possible pseudo, frameshifted CDS 889227..894710 product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121651396.1 transl_table 11 codon_start 1 locus_tag LOCUS_43090 CDS 894812..896551 product sulfite reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970681.1 transl_table 11 codon_start 1 locus_tag LOCUS_43100 CDS 896625..896834 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43110 CDS complement(896979..897245) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43120 CDS complement(897255..897848) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43130 CDS complement(897859..898212) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43140 CDS 898533..898805 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43150 note possible pseudo, internal stop codon CDS 898812..900881 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43160 note possible pseudo, internal stop codon CDS 901257..902579 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43170 note possible pseudo, frameshifted CDS complement(902806..903153) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43180 CDS complement(903154..903588) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43190 CDS complement(903801..904238) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43200 CDS complement(904610..905581) product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707304.1 transl_table 11 codon_start 1 locus_tag LOCUS_43210 CDS complement(905805..906938) product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162139532.1 transl_table 11 codon_start 1 locus_tag LOCUS_43220 CDS complement(906940..907551) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261106.1 transl_table 11 codon_start 1 locus_tag LOCUS_43230 CDS complement(907665..908279) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43240 CDS complement(908284..908655) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000800772.1 transl_table 11 codon_start 1 locus_tag LOCUS_43250 CDS complement(908977..909273) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43260 CDS complement(909351..909803) product protein tyrosine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206995.1 transl_table 11 codon_start 1 locus_tag LOCUS_43270 CDS complement(909875..910270) product tautomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206529.1 transl_table 11 codon_start 1 locus_tag LOCUS_43280 CDS complement(911145..911834) product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532554.1 transl_table 11 codon_start 1 locus_tag LOCUS_43290 CDS complement(911858..912811) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_185965189.1 transl_table 11 codon_start 1 locus_tag LOCUS_43300 CDS complement(912990..913595) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43310 CDS complement(913866..914330) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233166.1 transl_table 11 codon_start 1 locus_tag LOCUS_43320 CDS complement(914355..915017) product FMN-binding negative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206488.1 transl_table 11 codon_start 1 locus_tag LOCUS_43330 CDS complement(915017..915406) product tautomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005666933.1 transl_table 11 codon_start 1 locus_tag LOCUS_43340 CDS complement(915440..916129) product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705790.1 transl_table 11 codon_start 1 locus_tag LOCUS_43350 CDS complement(916153..916968) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189436615.1 transl_table 11 codon_start 1 locus_tag LOCUS_43360 CDS complement(916956..918029) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43370 note possible pseudo, frameshifted CDS complement(918019..918255) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43380 note possible pseudo, frameshifted CDS complement(918522..918914) product DUF4260 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088113.1 transl_table 11 codon_start 1 locus_tag LOCUS_43390 CDS complement(919110..919922) product shikimate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086325.1 transl_table 11 codon_start 1 locus_tag LOCUS_43400 CDS complement(919974..920309) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43410 CDS complement(920660..921220) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43420 CDS complement(921430..921771) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044173324.1 transl_table 11 codon_start 1 locus_tag LOCUS_43430 CDS complement(921783..922208) product DUF4442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888662.1 transl_table 11 codon_start 1 locus_tag LOCUS_43440 CDS complement(922258..922776) product class IV adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195801.1 transl_table 11 codon_start 1 locus_tag LOCUS_43450 CDS complement(922788..923903) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43460 CDS complement(923911..924342) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259124.1 transl_table 11 codon_start 1 locus_tag LOCUS_43470 CDS 924578..925288 product autoinducer binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004206379.1 transl_table 11 codon_start 1 locus_tag LOCUS_43480 CDS complement(925348..926268) product drug/metabolite exporter YedA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210807.1 transl_table 11 codon_start 1 locus_tag LOCUS_43490 gene yedA CDS complement(926265..926489) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43500 CDS complement(926609..927100) product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005304871.1 transl_table 11 codon_start 1 locus_tag LOCUS_43510 CDS 927201..928976 product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815908.1 transl_table 11 codon_start 1 locus_tag LOCUS_43520 gene leuA CDS 928991..929437 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43530 note possible pseudo, internal stop codon CDS 929355..929537 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43540 CDS 930001..930174 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43550 CDS complement(930178..931017) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43560 note possible pseudo, internal stop codon, frameshifted CDS complement(931014..931403) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43570 CDS complement(931725..932000) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43580 CDS complement(932118..934616) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43590 CDS complement(934633..936936) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43600 CDS complement(937061..937351) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43610 CDS 937423..937737 product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083824.1 transl_table 11 codon_start 1 locus_tag LOCUS_43620 CDS 937776..938144 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43630 CDS 938274..939620 product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_114714636.1 transl_table 11 codon_start 1 locus_tag LOCUS_43640 CDS 939569..940126 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43650 CDS complement(940269..941246) product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222180.1 transl_table 11 codon_start 1 locus_tag LOCUS_43660 gene cysK CDS 941600..942076 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43670 note possible pseudo, internal stop codon CDS 942089..942871 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43680 note possible pseudo, internal stop codon CDS complement(943659..943982) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43690 CDS complement(944138..944845) product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938322.1 transl_table 11 codon_start 1 locus_tag LOCUS_43700 CDS complement(944888..948781) product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151655988.1 transl_table 11 codon_start 1 locus_tag LOCUS_43710 gene hrpA CDS complement(948855..949259) product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140980.1 transl_table 11 codon_start 1 locus_tag LOCUS_43720 CDS complement(949256..949510) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43730 CDS 950182..950931 product DUF2971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074041.1 transl_table 11 codon_start 1 locus_tag LOCUS_43740 CDS 951014..951868 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43750 CDS 952110..952586 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43760 CDS complement(952641..952928) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43770 CDS complement(953040..954167) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43780 CDS complement(954247..954633) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43790 note possible pseudo, internal stop codon CDS complement(954819..955601) product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990687.1 transl_table 11 codon_start 1 locus_tag LOCUS_43800 CDS complement(955756..958725) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43810 CDS complement(958725..959711) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43820 CDS complement(959708..961159) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43830 CDS complement(961185..961520) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43840 CDS complement(961714..962472) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43850 CDS 963462..963722 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43860 CDS 964158..966125 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870254.1 transl_table 11 codon_start 1 locus_tag LOCUS_43870 CDS 966194..968197 product TonB-dependent receptor plug domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262962.1 transl_table 11 codon_start 1 locus_tag LOCUS_43880 CDS 968357..968860 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43890 CDS 968893..971637 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43900 CDS 971637..973781 product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942572.1 transl_table 11 codon_start 1 locus_tag LOCUS_43910 CDS 973783..976623 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43920 CDS complement(976620..977450) product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693963.1 transl_table 11 codon_start 1 locus_tag LOCUS_43930 CDS complement(977450..979297) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085865.1 transl_table 11 codon_start 1 locus_tag LOCUS_43940 CDS 979284..981266 product lytic transglycosylase Slt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113975.1 transl_table 11 codon_start 1 locus_tag LOCUS_43950 gene slt CDS 981343..981858 product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087475.1 transl_table 11 codon_start 1 locus_tag LOCUS_43960 gene fabA CDS 981869..983089 product beta-ketoacyl-ACP synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114255.1 transl_table 11 codon_start 1 locus_tag LOCUS_43970 gene fabB CDS 983137..983994 product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925707.1 transl_table 11 codon_start 1 locus_tag LOCUS_43980 gene ttcA CDS 984010..985056 product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244356.1 transl_table 11 codon_start 1 locus_tag LOCUS_43990 gene galE CDS complement(985053..986300) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44000 CDS 986442..986981 product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626366.1 transl_table 11 codon_start 1 locus_tag LOCUS_44010 CDS 987054..988016 product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388639.1 transl_table 11 codon_start 1 locus_tag LOCUS_44020 CDS 988213..990681 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44030 CDS 990913..992079 product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919650.1 transl_table 11 codon_start 1 locus_tag LOCUS_44040 CDS 992356..993243 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44050 CDS complement(993358..995193) product Hsp70 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539133.1 transl_table 11 codon_start 1 locus_tag LOCUS_44060 CDS complement(995190..995840) product DUF2760 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262095.1 transl_table 11 codon_start 1 locus_tag LOCUS_44070 CDS complement(995955..996341) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44080 CDS 996389..996583 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44090 CDS complement(996649..997047) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44100 CDS 997303..998238 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44110 CDS 998388..998849 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44120 CDS 998878..999498 product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974773.1 transl_table 11 codon_start 1 locus_tag LOCUS_44130 CDS 999709..1000512 product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225376.1 transl_table 11 codon_start 1 locus_tag LOCUS_44140 CDS 1000509..1002629 product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100007.1 transl_table 11 codon_start 1 locus_tag LOCUS_44150 CDS complement(1002646..1003596) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44160 CDS complement(1003593..1004696) product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388688.1 transl_table 11 codon_start 1 locus_tag LOCUS_44170 CDS complement(1004693..1005688) product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257103.1 transl_table 11 codon_start 1 locus_tag LOCUS_44180 CDS complement(1006401..1007213) product TIGR04325 family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001084681.1 transl_table 11 codon_start 1 locus_tag LOCUS_44190 CDS complement(1007210..1007947) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44200 CDS complement(1007944..1008621) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44210 CDS complement(1008585..1008761) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44220 CDS complement(1008817..1009785) product hemolytic protein HlpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058218.1 transl_table 11 codon_start 1 locus_tag LOCUS_44230 CDS complement(1009974..1010237) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44240 CDS complement(1010200..1010868) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44250 note possible pseudo, internal stop codon, frameshifted CDS complement(1011091..1011963) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44260 CDS complement(1011960..1012760) product FkbM family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_214431907.1 transl_table 11 codon_start 1 locus_tag LOCUS_44270 CDS complement(1012761..1013048) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44280 CDS complement(1013513..1014127) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44290 CDS complement(1014171..1015526) product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939580.1 transl_table 11 codon_start 1 locus_tag LOCUS_44300 CDS complement(1015542..1016426) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44310 CDS complement(1016426..1017496) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44320 CDS complement(1017545..1018786) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44330 CDS complement(1018811..1019938) product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417780.1 transl_table 11 codon_start 1 locus_tag LOCUS_44340 CDS complement(1020070..1021875) product sodium-extruding oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480900.1 transl_table 11 codon_start 1 locus_tag LOCUS_44350 gene oadA CDS complement(1021929..1022168) product OadG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001894876.1 transl_table 11 codon_start 1 locus_tag LOCUS_44360 CDS complement(1022357..1022830) product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015443925.1 transl_table 11 codon_start 1 locus_tag LOCUS_44370 CDS complement(1022835..1023359) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44380 CDS complement(1023441..1023875) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44390 CDS complement(1023872..1025218) product poly-beta-1,6-N-acetyl-D-glucosamine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206025.1 transl_table 11 codon_start 1 locus_tag LOCUS_44400 gene pgaC CDS complement(1025226..1027139) product poly-beta-1,6-N-acetyl-D-glucosamine N-deacetylase PgaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206024.1 transl_table 11 codon_start 1 locus_tag LOCUS_44410 gene pgaB CDS 1027485..1029077 product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615587.1 transl_table 11 codon_start 1 locus_tag LOCUS_44420 CDS 1029207..1030490 product DUF2130 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211409870.1 transl_table 11 codon_start 1 locus_tag LOCUS_44430 CDS 1030680..1031954 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035889.1 transl_table 11 codon_start 1 locus_tag LOCUS_44440 CDS 1031914..1032603 product DUF4276 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224619.1 transl_table 11 codon_start 1 locus_tag LOCUS_44450 CDS 1032756..1033010 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44460 note possible pseudo, internal stop codon CDS 1033166..1033477 product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139205698.1 transl_table 11 codon_start 1 locus_tag LOCUS_44470 CDS 1033516..1034121 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44480 note possible pseudo, frameshifted CDS 1034139..1034360 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44490 note possible pseudo, frameshifted CDS 1034694..1036247 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225878.1 transl_table 11 codon_start 1 locus_tag LOCUS_44500 CDS complement(1036263..1037462) product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205497.1 transl_table 11 codon_start 1 locus_tag LOCUS_44510 CDS 1037587..1038867 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921296.1 transl_table 11 codon_start 1 locus_tag LOCUS_44520 CDS 1039041..1039370 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44530 CDS complement(1039513..1043664) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122252.1 transl_table 11 codon_start 1 locus_tag LOCUS_44540 CDS complement(1043852..1044739) product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329405.1 transl_table 11 codon_start 1 locus_tag LOCUS_44550 gene sucD CDS complement(1044765..1045982) product malate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329404.1 transl_table 11 codon_start 1 locus_tag LOCUS_44560 CDS complement(1046129..1047082) product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081163160.1 transl_table 11 codon_start 1 locus_tag LOCUS_44570 CDS 1047290..1048456 product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529882.1 transl_table 11 codon_start 1 locus_tag LOCUS_44580 CDS 1048794..1049330 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44590 CDS 1049468..1050319 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44600 CDS 1050376..1051347 product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969966.1 transl_table 11 codon_start 1 locus_tag LOCUS_44610 CDS complement(1051471..1052580) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44620 CDS 1053480..1053956 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44630 note possible pseudo, internal stop codon CDS 1053969..1054751 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44640 note possible pseudo, internal stop codon CDS 1054930..1055325 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44650 CDS 1055460..1056806 product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_114714636.1 transl_table 11 codon_start 1 locus_tag LOCUS_44660 CDS complement(1057042..1057764) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44670 CDS complement(1057857..1060115) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44680 CDS complement(1060245..1061162) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44690 CDS complement(1061786..1062598) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44700 CDS complement(1063005..1066367) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44710 CDS complement(1066327..1066566) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44720 CDS complement(1066568..1066981) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44730 CDS complement(1067959..1068123) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44740 CDS 1068212..1068844 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44750 CDS 1068907..1069722 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44760 CDS 1069942..1071471 product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391431.1 transl_table 11 codon_start 1 locus_tag LOCUS_44770 CDS 1072159..1074309 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44780 CDS 1074548..1075183 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44790 CDS complement(1075354..1075866) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44800 CDS complement(1076257..1077012) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44810 CDS complement(1077009..1077749) product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189091.1 transl_table 11 codon_start 1 locus_tag LOCUS_44820 CDS complement(1077746..1078735) product bifunctional biotin--[acetyl-CoA-carboxylase] ligase/biotin operon repressor BirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707707.1 transl_table 11 codon_start 1 locus_tag LOCUS_44830 gene birA CDS complement(1078777..1079361) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44840 CDS complement(1079453..1079809) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44850 CDS complement(1079817..1080206) product sulfurtransferase complex subunit TusD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099035.1 transl_table 11 codon_start 1 locus_tag LOCUS_44860 gene tusD CDS 1080334..1081785 product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457720.1 transl_table 11 codon_start 1 locus_tag LOCUS_44870 CDS 1082262..1082501 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44880 CDS 1082507..1084690 product bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404001.1 transl_table 11 codon_start 1 locus_tag LOCUS_44890 gene spoT CDS 1084692..1085087 product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102981.1 transl_table 11 codon_start 1 locus_tag LOCUS_44900 CDS 1085128..1087215 product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096624.1 transl_table 11 codon_start 1 locus_tag LOCUS_44910 gene recG CDS 1087219..1087791 product chorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070536.1 transl_table 11 codon_start 1 locus_tag LOCUS_44920 CDS complement(1088691..1089287) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44930 CDS complement(1089284..1090486) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931301.1 transl_table 11 codon_start 1 locus_tag LOCUS_44940 CDS complement(1090968..1091639) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44950 CDS complement(1091641..1092651) product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337358.1 transl_table 11 codon_start 1 locus_tag LOCUS_44960 CDS 1092729..1093268 product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687524.1 transl_table 11 codon_start 1 locus_tag LOCUS_44970 CDS complement(1093371..1093910) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44980 CDS 1094477..1094662 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44990 CDS 1094664..1095023 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45000 CDS complement(1095117..1095548) product YcgN family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005300228.1 transl_table 11 codon_start 1 locus_tag LOCUS_45010 CDS complement(1095553..1096515) product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086480063.1 transl_table 11 codon_start 1 locus_tag LOCUS_45020 gene ftsX CDS complement(1096518..1097174) product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769957.1 transl_table 11 codon_start 1 locus_tag LOCUS_45030 gene ftsE CDS complement(1097194..1099158) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45040 CDS complement(1099163..1099750) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815732.1 transl_table 11 codon_start 1 locus_tag LOCUS_45050 CDS complement(1099743..1100486) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119510.1 transl_table 11 codon_start 1 locus_tag LOCUS_45060 CDS 1100576..1100833 product twin transmembrane helix small protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815736.1 transl_table 11 codon_start 1 locus_tag LOCUS_45070 CDS complement(1100897..1101772) product cytochrome c oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038909.1 transl_table 11 codon_start 1 locus_tag LOCUS_45080 CDS complement(1101784..1102326) product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074204.1 transl_table 11 codon_start 1 locus_tag LOCUS_45090 CDS complement(1102482..1104098) product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083723.1 transl_table 11 codon_start 1 locus_tag LOCUS_45100 gene ctaD CDS complement(1104152..1105243) product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106288.1 transl_table 11 codon_start 1 locus_tag LOCUS_45110 gene coxB CDS complement(1105536..1105931) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45120 CDS complement(1105986..1106681) product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035832.1 transl_table 11 codon_start 1 locus_tag LOCUS_45130 gene bioD CDS complement(1106678..1107466) product malonyl-ACP O-methyltransferase BioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705389.1 transl_table 11 codon_start 1 locus_tag LOCUS_45140 gene bioC CDS complement(1107463..1108224) product pimeloyl-ACP methyl ester esterase BioH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001060070.1 transl_table 11 codon_start 1 locus_tag LOCUS_45150 gene bioH CDS complement(1108221..1109381) product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103160.1 transl_table 11 codon_start 1 locus_tag LOCUS_45160 gene bioF CDS complement(1109381..1110370) product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705387.1 transl_table 11 codon_start 1 locus_tag LOCUS_45170 gene bioB CDS 1110439..1111140 product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444136.1 transl_table 11 codon_start 1 locus_tag LOCUS_45180 CDS complement(1111150..1112751) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45190 CDS 1112978..1113514 product flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532041.1 transl_table 11 codon_start 1 locus_tag LOCUS_45200 CDS 1113511..1114905 product DUF6513 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532040.1 transl_table 11 codon_start 1 locus_tag LOCUS_45210 CDS 1115062..1115424 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45220 CDS 1115421..1115792 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45230 CDS complement(1115800..1116876) product PA0069 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968856.1 transl_table 11 codon_start 1 locus_tag LOCUS_45240 CDS complement(1117377..1117838) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45250 CDS 1117847..1118863 product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000529292.1 transl_table 11 codon_start 1 locus_tag LOCUS_45260 gene nagZ CDS 1118856..1119401 product hypoxanthine-guanine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957989.1 transl_table 11 codon_start 1 locus_tag LOCUS_45270 CDS 1119398..1120138 product S-methyl-5'-thioinosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091193.1 transl_table 11 codon_start 1 locus_tag LOCUS_45280 CDS complement(1120236..1120430) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45290 CDS 1120553..1121011 product thiosulfate oxidation carrier protein SoxY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024119460.1 transl_table 11 codon_start 1 locus_tag LOCUS_45300 gene soxY CDS 1121013..1121324 product thiosulfate oxidation carrier complex protein SoxZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083832.1 transl_table 11 codon_start 1 locus_tag LOCUS_45310 gene soxZ CDS complement(1121333..1122247) product beta-ribofuranosylaminobenzene 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532030.1 transl_table 11 codon_start 1 locus_tag LOCUS_45320 CDS complement(1122327..1123004) product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038720.1 transl_table 11 codon_start 1 locus_tag LOCUS_45330 CDS complement(1123001..1123927) product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870598.1 transl_table 11 codon_start 1 locus_tag LOCUS_45340 CDS complement(1123931..1124857) product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943987.1 transl_table 11 codon_start 1 locus_tag LOCUS_45350 CDS 1125016..1126572 product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005422759.1 transl_table 11 codon_start 1 locus_tag LOCUS_45360 gene pntA CDS 1126583..1127971 product Re/Si-specific NAD(P)(+) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705257.1 transl_table 11 codon_start 1 locus_tag LOCUS_45370 gene pntB CDS complement(1128053..1128676) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45380 CDS 1128872..1129183 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45390 CDS 1129193..1129615 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45400 CDS complement(1129851..1130156) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45410 CDS complement(1130278..1131078) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45420 CDS 1131755..1132237 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45430 CDS complement(1132659..1134311) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45440 CDS complement(1134308..1135582) product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895459.1 transl_table 11 codon_start 1 locus_tag LOCUS_45450 CDS complement(1135943..1136503) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45460 CDS complement(1136655..1137389) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45470 CDS complement(1137376..1138440) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45480 CDS complement(1138433..1139689) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45490 CDS complement(1139730..1139858) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45500 CDS complement(1140160..1141578) product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764764.1 transl_table 11 codon_start 1 locus_tag LOCUS_45510 CDS complement(1141607..1142551) product MucB/RseB C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349517.1 transl_table 11 codon_start 1 locus_tag LOCUS_45520 CDS complement(1142556..1143062) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45530 CDS complement(1143073..1143663) product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085543.1 transl_table 11 codon_start 1 locus_tag LOCUS_45540 gene rpoE CDS 1143911..1145446 product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704743.1 transl_table 11 codon_start 1 locus_tag LOCUS_45550 gene nadB CDS 1145636..1147357 product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071465.1 transl_table 11 codon_start 1 locus_tag LOCUS_45560 CDS 1147372..1148388 product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072067.1 transl_table 11 codon_start 1 locus_tag LOCUS_45570 CDS 1148381..1149157 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072068.1 transl_table 11 codon_start 1 locus_tag LOCUS_45580 CDS complement(1149167..1149484) product H-NS histone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331338.1 transl_table 11 codon_start 1 locus_tag LOCUS_45590 CDS complement(1149547..1150242) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45600 CDS 1150382..1153225 product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191889.1 transl_table 11 codon_start 1 locus_tag LOCUS_45610 CDS 1153215..1154405 product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946280.1 transl_table 11 codon_start 1 locus_tag LOCUS_45620 gene odhB CDS 1154465..1155103 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525684.1 transl_table 11 codon_start 1 locus_tag LOCUS_45630 CDS complement(1155148..1155594) product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689406.1 transl_table 11 codon_start 1 locus_tag LOCUS_45640 CDS 1155705..1156043 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45650 CDS 1156036..1156641 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45660 CDS 1156642..1158147 product nitric-oxide reductase subunit NorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113237.1 transl_table 11 codon_start 1 locus_tag LOCUS_45670 gene norB CDS complement(1158240..1158482) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45680 CDS 1158927..1159382 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45690 CDS complement(1159974..1161557) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45700 CDS complement(1161538..1163277) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45710 CDS 1163393..1163827 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45720 CDS complement(1163829..1164488) product DUF2959 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074052.1 transl_table 11 codon_start 1 locus_tag LOCUS_45730 CDS complement(1164481..1165047) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45740 CDS complement(1165044..1166417) product aminodeoxychorismate synthase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001063909.1 transl_table 11 codon_start 1 locus_tag LOCUS_45750 gene pabB CDS complement(1166497..1167543) product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532038.1 transl_table 11 codon_start 1 locus_tag LOCUS_45760 CDS complement(1167553..1168548) product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876468.1 transl_table 11 codon_start 1 locus_tag LOCUS_45770 CDS 1168569..1169252 product HisA/HisF-related TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082827384.1 transl_table 11 codon_start 1 locus_tag LOCUS_45780 CDS complement(1169309..1169824) product formaldehyde-activating enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532036.1 transl_table 11 codon_start 1 locus_tag LOCUS_45790 gene fae CDS complement(1169910..1170755) product triphosphoribosyl-dephospho-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082827560.1 transl_table 11 codon_start 1 locus_tag LOCUS_45800 CDS complement(1170770..1171615) product RimK family alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532034.1 transl_table 11 codon_start 1 locus_tag LOCUS_45810 CDS complement(1171761..1172744) product methenyltetrahydromethanopterin cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532033.1 transl_table 11 codon_start 1 locus_tag LOCUS_45820 gene mch CDS complement(1172750..1173850) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45830 tRNA 1173926..1174015 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00460 CDS complement(1175207..1175689) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45840 CDS 1175909..1176121 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45850 CDS complement(1176125..1176964) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45860 note possible pseudo, internal stop codon, frameshifted CDS complement(1176961..1177350) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45870 CDS 1177687..1178526 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45880 CDS 1178573..1178872 product type II toxin-antitoxin system toxin HigB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640638.1 transl_table 11 codon_start 1 locus_tag LOCUS_45890 gene higB CDS 1178875..1179153 product putative addiction module antidote protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388215.1 transl_table 11 codon_start 1 locus_tag LOCUS_45900 CDS 1179452..1180282 product IS5-like element ISVpa3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021706804.1 transl_table 11 codon_start 1 locus_tag LOCUS_45910 tRNA complement(1180415..1180491) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00470 CDS complement(1181618..1182130) product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073310.1 transl_table 11 codon_start 1 locus_tag LOCUS_45920 CDS complement(1182114..1183046) product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707094.1 transl_table 11 codon_start 1 locus_tag LOCUS_45930 gene thiL CDS complement(1183046..1183489) product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093308.1 transl_table 11 codon_start 1 locus_tag LOCUS_45940 gene nusB CDS complement(1183489..1183965) product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555427.1 transl_table 11 codon_start 1 locus_tag LOCUS_45950 gene ribE CDS complement(1184028..1185140) product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707098.1 transl_table 11 codon_start 1 locus_tag LOCUS_45960 gene ribBA CDS complement(1185137..1185793) product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093316.1 transl_table 11 codon_start 1 locus_tag LOCUS_45970 CDS complement(1185831..1186091) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45980 CDS complement(1186096..1187187) product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095839.1 transl_table 11 codon_start 1 locus_tag LOCUS_45990 gene ribD CDS complement(1187177..1187635) product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107181.1 transl_table 11 codon_start 1 locus_tag LOCUS_46000 gene nrdR CDS complement(1187720..1191109) product mechanosensitive channel MscK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463895.1 transl_table 11 codon_start 1 locus_tag LOCUS_46010 gene mscK CDS 1191137..1191796 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46020 CDS 1191840..1192094 product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096057.1 transl_table 11 codon_start 1 locus_tag LOCUS_46030 gene grxC CDS complement(1192235..1192813) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46040 CDS complement(1192900..1194090) product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267161.1 transl_table 11 codon_start 1 locus_tag LOCUS_46050 CDS complement(1194102..1195613) product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091383.1 transl_table 11 codon_start 1 locus_tag LOCUS_46060 gene purF CDS complement(1195626..1196144) product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113932.1 transl_table 11 codon_start 1 locus_tag LOCUS_46070 CDS complement(1196187..1197029) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46080 CDS complement(1197041..1198306) product bifunctional tetrahydrofolate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706173.1 transl_table 11 codon_start 1 locus_tag LOCUS_46090 gene folC CDS complement(1198318..1199259) product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706493.1 transl_table 11 codon_start 1 locus_tag LOCUS_46100 gene accD CDS complement(1199284..1200087) product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187543.1 transl_table 11 codon_start 1 locus_tag LOCUS_46110 gene trpA CDS complement(1200084..1201286) product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528977.1 transl_table 11 codon_start 1 locus_tag LOCUS_46120 gene trpB CDS complement(1201292..1201912) product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104200.1 transl_table 11 codon_start 1 locus_tag LOCUS_46130 CDS complement(1201896..1202075) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46140 CDS complement(1202032..1202793) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46150 CDS complement(1202846..1203871) product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073947.1 transl_table 11 codon_start 1 locus_tag LOCUS_46160 CDS complement(1203887..1204453) product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390527.1 transl_table 11 codon_start 1 locus_tag LOCUS_46170 CDS complement(1204459..1204944) product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948526.1 transl_table 11 codon_start 1 locus_tag LOCUS_46180 gene smpB CDS 1205045..1206403 product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958644.1 transl_table 11 codon_start 1 locus_tag LOCUS_46190 CDS 1206404..1206841 product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420637.1 transl_table 11 codon_start 1 locus_tag LOCUS_46200 CDS 1206831..1207112 product RnfH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105028.1 transl_table 11 codon_start 1 locus_tag LOCUS_46210 CDS 1207286..1208041 product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065085.1 transl_table 11 codon_start 1 locus_tag LOCUS_46220 CDS 1208038..1208229 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46230 CDS 1209030..1209209 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46240 CDS complement(1209243..1209434) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46250 CDS complement(1209580..1211286) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46260 CDS complement(1211291..1212646) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46270 CDS 1212925..1213233 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46280 CDS 1213359..1213964 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992379.1 transl_table 11 codon_start 1 locus_tag LOCUS_46290 CDS 1213957..1214817 product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970756.1 transl_table 11 codon_start 1 locus_tag LOCUS_46300 CDS 1215220..1215819 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46310 CDS complement(1215866..1216273) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46320 CDS 1216695..1218071 product chromate efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096587.1 transl_table 11 codon_start 1 locus_tag LOCUS_46330 gene chrA CDS 1218915..1219739 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46340 CDS 1219760..1220536 product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103062.1 transl_table 11 codon_start 1 locus_tag LOCUS_46350 CDS 1220536..1220946 product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018517.1 transl_table 11 codon_start 1 locus_tag LOCUS_46360 CDS 1221105..1221998 product YghX family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382657.1 transl_table 11 codon_start 1 locus_tag LOCUS_46370 gene yghX CDS 1222017..1222727 product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813013.1 transl_table 11 codon_start 1 locus_tag LOCUS_46380 CDS 1222763..1223224 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46390 CDS 1223523..1223915 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46400 CDS 1224013..1225359 product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_114714636.1 transl_table 11 codon_start 1 locus_tag LOCUS_46410 CDS 1225406..1225966 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46420 CDS complement(1225898..1226452) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46430 note possible pseudo, internal stop codon CDS complement(1226504..1226923) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46440 note possible pseudo, internal stop codon CDS complement(1227076..1228422) product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_114714636.1 transl_table 11 codon_start 1 locus_tag LOCUS_46450 CDS complement(1230060..1231931) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46460 CDS complement(1232133..1232888) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46470 CDS complement(1232885..1234129) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46480 CDS complement(1234132..1236093) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46490 CDS complement(1236142..1236990) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46500 CDS complement(1236996..1237742) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361352.1 transl_table 11 codon_start 1 locus_tag LOCUS_46510 CDS complement(1237750..1238415) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476340.1 transl_table 11 codon_start 1 locus_tag LOCUS_46520 CDS complement(1238452..1239321) product basic amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877742.1 transl_table 11 codon_start 1 locus_tag LOCUS_46530 CDS 1239834..1240151 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46540 note possible pseudo, internal stop codon, frameshifted CDS complement(1240553..1243012) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925780.1 transl_table 11 codon_start 1 locus_tag LOCUS_46550 CDS 1243372..1243578 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46560 CDS complement(1243678..1244238) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46570 CDS complement(1244248..1244706) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46580 CDS 1244932..1245072 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46590 CDS 1245083..1245991 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46600 CDS 1246114..1247535 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46610 CDS complement(1248752..1251268) product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929425.1 transl_table 11 codon_start 1 locus_tag LOCUS_46620 CDS complement(1251655..1252866) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46630 CDS complement(1252935..1253450) product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114482.1 transl_table 11 codon_start 1 locus_tag LOCUS_46640 CDS complement(1253682..1254608) product CysB family HTH-type transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193901.1 transl_table 11 codon_start 1 locus_tag LOCUS_46650 CDS complement(1254959..1258885) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46660 CDS complement(1258935..1260077) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46670 CDS complement(1260314..1261795) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46680 CDS complement(1261805..1263178) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46690 CDS complement(1263279..1264319) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46700 CDS 1264433..1264939 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46710 CDS 1265033..1265389 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46720 CDS complement(1265547..1266977) product glutamate-cysteine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927109.1 transl_table 11 codon_start 1 locus_tag LOCUS_46730 CDS complement(1266991..1267350) product DUF4186 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096609.1 transl_table 11 codon_start 1 locus_tag LOCUS_46740 CDS complement(1267360..1268373) product dihydroorotate dehydrogenase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257947.1 transl_table 11 codon_start 1 locus_tag LOCUS_46750 CDS complement(1268366..1271998) product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933292.1 transl_table 11 codon_start 1 locus_tag LOCUS_46760 gene nifJ CDS complement(1272307..1272849) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46770 CDS complement(1272941..1273420) product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941140.1 transl_table 11 codon_start 1 locus_tag LOCUS_46780 CDS complement(1273574..1273945) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46790 CDS complement(1274014..1275798) product murein L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531691.1 transl_table 11 codon_start 1 locus_tag LOCUS_46800 CDS 1276154..1277446 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46810 CDS 1277462..1277677 product DUF2905 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632579.1 transl_table 11 codon_start 1 locus_tag LOCUS_46820 CDS 1277701..1278204 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46830 CDS 1278222..1278395 product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727946.1 transl_table 11 codon_start 1 locus_tag LOCUS_46840 CDS complement(1278415..1278768) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46850 CDS complement(1278874..1279839) product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678885.1 transl_table 11 codon_start 1 locus_tag LOCUS_46860 gene hflC CDS complement(1279836..1280813) product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678884.1 transl_table 11 codon_start 1 locus_tag LOCUS_46870 gene hflK CDS complement(1280933..1284196) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46880 CDS 1284512..1285057 product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257872.1 transl_table 11 codon_start 1 locus_tag LOCUS_46890 gene bcp CDS complement(1285116..1286105) product magnesium and cobalt transport protein CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037478.1 transl_table 11 codon_start 1 locus_tag LOCUS_46900 CDS complement(1286118..1287323) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46910 CDS 1287470..1290181 product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545171.1 transl_table 11 codon_start 1 locus_tag LOCUS_46920 CDS complement(1290290..1291087) product flagellin Hag inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166847803.1 transl_table 11 codon_start 1 locus_tag LOCUS_46930 gene hag CDS complement(1291151..1291540) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46940 CDS 1291857..1292147 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46950 CDS complement(1292295..1293260) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46960 CDS 1293497..1295278 product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763446.1 transl_table 11 codon_start 1 locus_tag LOCUS_46970 CDS complement(1295430..1295585) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46980 CDS complement(1295790..1296506) product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073261.1 transl_table 11 codon_start 1 locus_tag LOCUS_46990 CDS 1296663..1297748 product IS110-like element ISPa11 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147159.1 transl_table 11 codon_start 1 locus_tag LOCUS_47000 CDS complement(1298166..1301414) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47010 CDS complement(1301439..1302068) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47020 CDS complement(1302186..1302749) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47030 note possible pseudo, frameshifted CDS complement(1302676..1304841) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47040 note possible pseudo, frameshifted CDS 1305309..1305959 product DUF2076 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972190.1 transl_table 11 codon_start 1 locus_tag LOCUS_47050 CDS complement(1306274..1308496) product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071036.1 transl_table 11 codon_start 1 locus_tag LOCUS_47060 gene katG CDS 1308781..1309656 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036068.1 transl_table 11 codon_start 1 locus_tag LOCUS_47070 CDS 1310065..1310364 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47080 CDS 1310402..1310593 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47090 CDS 1310676..1311461 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47100 CDS 1311465..1312205 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47110 CDS 1312205..1312627 product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194258.1 transl_table 11 codon_start 1 locus_tag LOCUS_47120 CDS 1312893..1315094 product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173315.1 transl_table 11 codon_start 1 locus_tag LOCUS_47130 CDS 1315107..1316231 product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088170.1 transl_table 11 codon_start 1 locus_tag LOCUS_47140 CDS 1316231..1316461 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47150 CDS 1316947..1319268 product TonB-dependent hemoglobin/transferrin/lactoferrin family receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036004.1 transl_table 11 codon_start 1 locus_tag LOCUS_47160 CDS 1319280..1319528 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47170 CDS 1319675..1320415 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47180 CDS 1320526..1321539 product hemin-degrading factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405436.1 transl_table 11 codon_start 1 locus_tag LOCUS_47190 CDS 1321622..1322158 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47200 CDS 1322313..1323215 product hemin ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140583.1 transl_table 11 codon_start 1 locus_tag LOCUS_47210 CDS 1323212..1324306 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405433.1 transl_table 11 codon_start 1 locus_tag LOCUS_47220 CDS 1324308..1325123 product heme ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405435.1 transl_table 11 codon_start 1 locus_tag LOCUS_47230 CDS complement(1325139..1325348) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47240 CDS complement(1325339..1325515) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47250 CDS 1325605..1326576 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47260 CDS 1326918..1329140 product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974567.1 transl_table 11 codon_start 1 locus_tag LOCUS_47270 CDS 1329768..1331045 product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093492.1 transl_table 11 codon_start 1 locus_tag LOCUS_47280 CDS 1331054..1332202 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225636.1 transl_table 11 codon_start 1 locus_tag LOCUS_47290 CDS 1332442..1332660 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47300 CDS 1332645..1332851 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47310 CDS 1333076..1333369 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47320 CDS 1333462..1333866 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47330 CDS 1334338..1337100 product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930957.1 transl_table 11 codon_start 1 locus_tag LOCUS_47340 CDS 1337087..1339195 product peptidase domain-containing ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004545619.1 transl_table 11 codon_start 1 locus_tag LOCUS_47350 CDS complement(1339262..1339507) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47360 CDS complement(1339560..1339769) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47370 CDS 1340204..1342396 product TonB-dependent siderophore receptor PiuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112850.1 transl_table 11 codon_start 1 locus_tag LOCUS_47380 gene piuA CDS 1342515..1343225 product PepSY-associated TM helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004203432.1 transl_table 11 codon_start 1 locus_tag LOCUS_47390 CDS 1343229..1343912 product Fe2+-dependent dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037901.1 transl_table 11 codon_start 1 locus_tag LOCUS_47400 CDS 1344366..1346375 product TonB-dependent receptor plug domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262962.1 transl_table 11 codon_start 1 locus_tag LOCUS_47410 CDS complement(1346399..1347217) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275157.1 transl_table 11 codon_start 1 locus_tag LOCUS_47420 CDS complement(1347291..1349993) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47430 CDS complement(1350000..1353299) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47440 CDS complement(1353303..1353848) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47450 CDS complement(1354043..1356505) product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173315.1 transl_table 11 codon_start 1 locus_tag LOCUS_47460 CDS complement(1356791..1357240) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47470 CDS complement(1357261..1357674) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47480 CDS complement(1357708..1358256) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496407.1 transl_table 11 codon_start 1 locus_tag LOCUS_47490 CDS complement(1358280..1359107) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47500 CDS 1359436..1360230 product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401743.1 transl_table 11 codon_start 1 locus_tag LOCUS_47510 CDS complement(1360247..1361329) product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444592.1 transl_table 11 codon_start 1 locus_tag LOCUS_47520 gene amrS CDS 1361484..1362263 product AmmeMemoRadiSam system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388207.1 transl_table 11 codon_start 1 locus_tag LOCUS_47530 gene amrB CDS 1362250..1362807 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47540 CDS 1363012..1364478 product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000301727.1 transl_table 11 codon_start 1 locus_tag LOCUS_47550 gene zwf CDS 1364510..1365220 product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072453.1 transl_table 11 codon_start 1 locus_tag LOCUS_47560 gene pgl CDS 1365325..1367145 product phosphogluconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072452.1 transl_table 11 codon_start 1 locus_tag LOCUS_47570 gene edd CDS 1367288..1368733 product decarboxylating NADP(+)-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477829.1 transl_table 11 codon_start 1 locus_tag LOCUS_47580 gene gnd CDS 1368824..1369453 product 2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973900.1 transl_table 11 codon_start 1 locus_tag LOCUS_47590 CDS 1369562..1370116 product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112597.1 transl_table 11 codon_start 1 locus_tag LOCUS_47600 CDS complement(1370172..1370585) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47610 CDS complement(1370635..1371648) product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941130.1 transl_table 11 codon_start 1 locus_tag LOCUS_47620 CDS complement(1371651..1372688) product DUF898 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941131.1 transl_table 11 codon_start 1 locus_tag LOCUS_47630 CDS 1372902..1374482 product PAS domain-containing methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133503194.1 transl_table 11 codon_start 1 locus_tag LOCUS_47640 CDS complement(1374608..1375174) product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958122.1 transl_table 11 codon_start 1 locus_tag LOCUS_47650 CDS 1375272..1380392 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686845.1 transl_table 11 codon_start 1 locus_tag LOCUS_47660 CDS 1380421..1381122 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47670 CDS 1381143..1383533 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47680 CDS 1383639..1384310 product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869007.1 transl_table 11 codon_start 1 locus_tag LOCUS_47690 gene rpe CDS complement(1384383..1384658) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47700 CDS complement(1384592..1385518) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47710 CDS 1385821..1386021 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47720 CDS 1386465..1387679 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47730 CDS complement(1387658..1388422) product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388831.1 transl_table 11 codon_start 1 locus_tag LOCUS_47740 CDS complement(1388507..1389775) product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003344468.1 transl_table 11 codon_start 1 locus_tag LOCUS_47750 CDS complement(1389933..1390271) product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780326.1 transl_table 11 codon_start 1 locus_tag LOCUS_47760 gene glnK CDS complement(1390453..1391877) product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707418.1 transl_table 11 codon_start 1 locus_tag LOCUS_47770 gene amt CDS complement(1391879..1392217) product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780326.1 transl_table 11 codon_start 1 locus_tag LOCUS_47780 gene glnK CDS complement(1392601..1392780) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47790 CDS 1392779..1394002 product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922914.1 transl_table 11 codon_start 1 locus_tag LOCUS_47800 CDS 1394167..1395576 product glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000110151.1 transl_table 11 codon_start 1 locus_tag LOCUS_47810 gene glnA CDS complement(1395703..1396242) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47820 CDS 1396321..1397700 product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113084.1 transl_table 11 codon_start 1 locus_tag LOCUS_47830 CDS complement(1397822..1398388) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47840 CDS 1398753..1398893 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47850 CDS complement(1399089..1399757) product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946684.1 transl_table 11 codon_start 1 locus_tag LOCUS_47860 CDS 1399883..1400275 product group II truncated hemoglobin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526443.1 transl_table 11 codon_start 1 locus_tag LOCUS_47870 CDS 1400281..1402185 product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112436.1 transl_table 11 codon_start 1 locus_tag LOCUS_47880 CDS 1402172..1402843 product transglutaminase-like cysteine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083022.1 transl_table 11 codon_start 1 locus_tag LOCUS_47890 CDS 1402840..1403574 product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810266.1 transl_table 11 codon_start 1 locus_tag LOCUS_47900 CDS 1403574..1404053 product protein disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109277682.1 transl_table 11 codon_start 1 locus_tag LOCUS_47910 CDS complement(1404077..1404466) product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707404.1 transl_table 11 codon_start 1 locus_tag LOCUS_47920 CDS complement(1404471..1405115) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47930 CDS 1405366..1407495 product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940288.1 transl_table 11 codon_start 1 locus_tag LOCUS_47940 gene pta CDS 1407492..1408019 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47950 CDS 1408044..1409249 product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209611261.1 transl_table 11 codon_start 1 locus_tag LOCUS_47960 CDS complement(1409267..1409503) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47970 CDS 1409537..1411567 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037788.1 transl_table 11 codon_start 1 locus_tag LOCUS_47980 CDS 1411650..1412867 product zinc metallochaperone GTPase ZigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105544.1 transl_table 11 codon_start 1 locus_tag LOCUS_47990 gene zigA CDS 1412860..1413105 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48000 CDS 1413102..1413887 product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930274.1 transl_table 11 codon_start 1 locus_tag LOCUS_48010 CDS 1413898..1414614 product DUF1826 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768309.1 transl_table 11 codon_start 1 locus_tag LOCUS_48020 CDS 1414625..1416310 product formylmethanofuran dehydrogenase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532027.1 transl_table 11 codon_start 1 locus_tag LOCUS_48030 CDS 1416354..1417142 product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195713.1 transl_table 11 codon_start 1 locus_tag LOCUS_48040 gene folE2 CDS 1417153..1418148 product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003537568.1 transl_table 11 codon_start 1 locus_tag LOCUS_48050 CDS 1418332..1419312 product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446428.1 transl_table 11 codon_start 1 locus_tag LOCUS_48060 CDS 1419547..1420017 product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071356.1 transl_table 11 codon_start 1 locus_tag LOCUS_48070 gene bfr CDS complement(1420131..1423289) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48080 CDS complement(1423342..1425990) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48090 CDS complement(1425987..1428308) product PAS domain S-box protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706046.1 transl_table 11 codon_start 1 locus_tag LOCUS_48100 CDS complement(1428326..1429246) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48110 CDS complement(1429254..1430354) product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706047.1 transl_table 11 codon_start 1 locus_tag LOCUS_48120 CDS 1430653..1431762 product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201420264.1 transl_table 11 codon_start 1 locus_tag LOCUS_48130 gene tgt CDS complement(1431834..1432985) product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942901.1 transl_table 11 codon_start 1 locus_tag LOCUS_48140 gene lpxB CDS complement(1433047..1434144) product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942902.1 transl_table 11 codon_start 1 locus_tag LOCUS_48150 CDS complement(1434157..1435095) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942903.1 transl_table 11 codon_start 1 locus_tag LOCUS_48160 CDS 1435467..1436933 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48170 CDS 1436936..1437442 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48180 CDS 1437454..1438035 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48190 CDS 1438051..1439667 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48200 CDS complement(1439712..1440269) product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072775209.1 transl_table 11 codon_start 1 locus_tag LOCUS_48210 CDS complement(1440279..1442528) product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958271.1 transl_table 11 codon_start 1 locus_tag LOCUS_48220 CDS complement(1442584..1442793) product heavy-metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217091.1 transl_table 11 codon_start 1 locus_tag LOCUS_48230 CDS 1442914..1444119 product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945874.1 transl_table 11 codon_start 1 locus_tag LOCUS_48240 CDS 1444148..1444585 product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815278.1 transl_table 11 codon_start 1 locus_tag LOCUS_48250 CDS 1444587..1445210 product high frequency lysogenization protein HflD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767416.1 transl_table 11 codon_start 1 locus_tag LOCUS_48260 gene hflD CDS 1445218..1446033 product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704183.1 transl_table 11 codon_start 1 locus_tag LOCUS_48270 gene mutM CDS complement(1446039..1447742) product fused response regulator/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268439.1 transl_table 11 codon_start 1 locus_tag LOCUS_48280 CDS 1447818..1448183 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48290 CDS complement(1448191..1448427) product TIGR02647 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003344490.1 transl_table 11 codon_start 1 locus_tag LOCUS_48300 CDS complement(1448452..1449234) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48310 CDS complement(1449234..1450313) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037914.1 transl_table 11 codon_start 1 locus_tag LOCUS_48320 CDS complement(1450323..1450958) product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721665.1 transl_table 11 codon_start 1 locus_tag LOCUS_48330 CDS complement(1451026..1451346) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48340 CDS complement(1451703..1452065) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48350 CDS complement(1452172..1452579) product ketosteroid isomerase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972626.1 transl_table 11 codon_start 1 locus_tag LOCUS_48360 CDS complement(1452642..1453178) product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086044.1 transl_table 11 codon_start 1 locus_tag LOCUS_48370 gene cobO CDS 1453270..1453596 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48380 CDS complement(1453483..1453743) product SemiSWEET transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089200.1 transl_table 11 codon_start 1 locus_tag LOCUS_48390 CDS complement(1453759..1453953) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48400 CDS complement(1453959..1456265) product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405080.1 transl_table 11 codon_start 1 locus_tag LOCUS_48410 gene ftsK CDS 1456437..1457393 product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941156.1 transl_table 11 codon_start 1 locus_tag LOCUS_48420 gene trxB CDS complement(1457437..1458009) product phosphatidylethanolamine N-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064509340.1 transl_table 11 codon_start 1 locus_tag LOCUS_48430 CDS 1458098..1458796 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256714.1 transl_table 11 codon_start 1 locus_tag LOCUS_48440 CDS 1458793..1461204 product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927835.1 transl_table 11 codon_start 1 locus_tag LOCUS_48450 CDS 1461231..1463438 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48460 CDS 1463435..1465621 product CHASE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070883.1 transl_table 11 codon_start 1 locus_tag LOCUS_48470 CDS 1465611..1466057 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977989.1 transl_table 11 codon_start 1 locus_tag LOCUS_48480 CDS 1466063..1467727 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48490 CDS complement(1467757..1468170) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48500 CDS complement(1468339..1469838) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000160471.1 transl_table 11 codon_start 1 locus_tag LOCUS_48510 CDS complement(1469838..1471421) product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005098467.1 transl_table 11 codon_start 1 locus_tag LOCUS_48520 CDS complement(1471434..1472969) product phytoene desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334293.1 transl_table 11 codon_start 1 locus_tag LOCUS_48530 CDS 1473285..1474130 product serine protein kinase RIO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095255.1 transl_table 11 codon_start 1 locus_tag LOCUS_48540 CDS complement(1474195..1474365) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48550 CDS complement(1474493..1476847) product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114512.1 transl_table 11 codon_start 1 locus_tag LOCUS_48560 CDS complement(1476844..1477311) product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038959.1 transl_table 11 codon_start 1 locus_tag LOCUS_48570 CDS complement(1477834..1478577) product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704857.1 transl_table 11 codon_start 1 locus_tag LOCUS_48580 CDS 1479788..1480204 product DUF393 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125616.1 transl_table 11 codon_start 1 locus_tag LOCUS_48590 CDS 1480229..1480846 product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932797.1 transl_table 11 codon_start 1 locus_tag LOCUS_48600 CDS 1480856..1481221 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48610 CDS 1481432..1482571 product ATP-dependent RNA helicase RhlE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007135.1 transl_table 11 codon_start 1 locus_tag LOCUS_48620 gene rhlE CDS complement(1483116..1484231) product DUF1624 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265890.1 transl_table 11 codon_start 1 locus_tag LOCUS_48630 CDS 1484370..1484618 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48640 CDS 1484681..1485355 product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462744.1 transl_table 11 codon_start 1 locus_tag LOCUS_48650 CDS 1485672..1487336 product murein L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531691.1 transl_table 11 codon_start 1 locus_tag LOCUS_48660 CDS complement(1487402..1488379) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48670 CDS complement(1488536..1488700) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48680 CDS 1488944..1489165 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48690 CDS 1489451..1490773 product DUF3422 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391173.1 transl_table 11 codon_start 1 locus_tag LOCUS_48700 CDS 1491010..1491180 product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770288.1 transl_table 11 codon_start 1 locus_tag LOCUS_48710 CDS complement(1491252..1492961) product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102377.1 transl_table 11 codon_start 1 locus_tag LOCUS_48720 CDS 1493125..1493763 product UvrY/SirA/GacA family response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706579.1 transl_table 11 codon_start 1 locus_tag LOCUS_48730 gene uvrY CDS complement(1493807..1494712) product methylenetetrahydromethanopterin dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532031.1 transl_table 11 codon_start 1 locus_tag LOCUS_48740 CDS complement(1494760..1495668) product methylenetetrahydromethanopterin dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532031.1 transl_table 11 codon_start 1 locus_tag LOCUS_48750 CDS complement(1495755..1496540) product inositol-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003314166.1 transl_table 11 codon_start 1 locus_tag LOCUS_48760 gene suhB CDS 1496667..1497365 product tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958024.1 transl_table 11 codon_start 1 locus_tag LOCUS_48770 gene trmJ CDS 1497370..1498122 product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100615.1 transl_table 11 codon_start 1 locus_tag LOCUS_48780 gene cysE CDS 1498411..1498896 product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552474.1 transl_table 11 codon_start 1 locus_tag LOCUS_48790 gene iscR CDS 1498896..1499999 product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388823.1 transl_table 11 codon_start 1 locus_tag LOCUS_48800 CDS 1500015..1500338 product iron-sulfur cluster assembly protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039700.1 transl_table 11 codon_start 1 locus_tag LOCUS_48810 gene iscA CDS complement(1500389..1500733) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072091.1 transl_table 11 codon_start 1 locus_tag LOCUS_48820 CDS 1500932..1501459 product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193946.1 transl_table 11 codon_start 1 locus_tag LOCUS_48830 gene def CDS 1501471..1502385 product quinoprotein relay system zinc metallohydrolase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966742.1 transl_table 11 codon_start 1 locus_tag LOCUS_48840 CDS 1502404..1503237 product quinoprotein dehydrogenase-associated SoxYZ-like carrier inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966743.1 transl_table 11 codon_start 1 locus_tag LOCUS_48850 CDS 1503237..1503575 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48860 CDS complement(1503711..1504613) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48870 CDS complement(1504642..1505640) product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072773820.1 transl_table 11 codon_start 1 locus_tag LOCUS_48880 CDS complement(1505937..1506665) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48890 CDS complement(1507192..1508694) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48900 CDS complement(1509061..1509462) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48910 CDS 1509887..1510294 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48920 CDS 1510730..1512622 product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707080.1 transl_table 11 codon_start 1 locus_tag LOCUS_48930 gene ftsH CDS 1512846..1514384 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48940 CDS 1514503..1514973 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142755.1 transl_table 11 codon_start 1 locus_tag LOCUS_48950 CDS 1515004..1515273 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48960 CDS 1515289..1516446 product multidrug transporter subunit MdtN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063445824.1 transl_table 11 codon_start 1 locus_tag LOCUS_48970 gene mdtN CDS 1516443..1518716 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48980 CDS complement(1519059..1519373) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48990 CDS 1519562..1520908 product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_114714636.1 transl_table 11 codon_start 1 locus_tag LOCUS_49000 CDS complement(1521665..1522306) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49010 CDS complement(1522732..1523997) product HupE/UreJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142975.1 transl_table 11 codon_start 1 locus_tag LOCUS_49020 CDS complement(1523994..1525169) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929157.1 transl_table 11 codon_start 1 locus_tag LOCUS_49030 CDS complement(1525230..1526870) product DUF4331 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929156.1 transl_table 11 codon_start 1 locus_tag LOCUS_49040 CDS complement(1526963..1527841) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49050 CDS 1528112..1528729 product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142702.1 transl_table 11 codon_start 1 locus_tag LOCUS_49060 CDS 1528735..1529574 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49070 CDS complement(1529613..1531205) product ABC-F family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705884.1 transl_table 11 codon_start 1 locus_tag LOCUS_49080 CDS 1531352..1532038 product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262281.1 transl_table 11 codon_start 1 locus_tag LOCUS_49090 CDS 1532051..1532353 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49100 CDS complement(1532451..1532612) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49110 CDS 1532809..1533111 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49120 CDS 1533193..1534443 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49130 CDS complement(1534498..1538928) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49140 CDS complement(1538934..1539878) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49150 CDS complement(1539929..1542079) product TonB-dependent vitamin B12 receptor BtuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815316.1 transl_table 11 codon_start 1 locus_tag LOCUS_49160 gene btuB CDS complement(1542285..1544123) product bifunctional protein-serine/threonine kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965821.1 transl_table 11 codon_start 1 locus_tag LOCUS_49170 CDS complement(1544143..1544586) product cyanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082956.1 transl_table 11 codon_start 1 locus_tag LOCUS_49180 gene cynS CDS complement(1544663..1545475) product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965820.1 transl_table 11 codon_start 1 locus_tag LOCUS_49190 CDS 1546012..1547214 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49200 CDS 1547217..1548347 product glutathionylspermidine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222139.1 transl_table 11 codon_start 1 locus_tag LOCUS_49210 CDS 1548350..1548766 product DUF350 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084988.1 transl_table 11 codon_start 1 locus_tag LOCUS_49220 CDS 1548771..1549577 product two-component system response regulator CreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170873813.1 transl_table 11 codon_start 1 locus_tag LOCUS_49230 gene creB CDS 1549574..1551004 product two-component system sensor histidine kinase CreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113267.1 transl_table 11 codon_start 1 locus_tag LOCUS_49240 gene creC CDS complement(1551050..1551298) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49250 CDS 1551362..1551988 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49260 CDS 1552494..1553057 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49270 CDS 1553068..1553430 product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212575.1 transl_table 11 codon_start 1 locus_tag LOCUS_49280 CDS 1553585..1554670 product IS110-like element ISPa11 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147159.1 transl_table 11 codon_start 1 locus_tag LOCUS_49290 CDS 1555243..1555992 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49300 CDS 1556161..1556793 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184839.1 transl_table 11 codon_start 1 locus_tag LOCUS_49310 CDS 1556837..1557361 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49320 CDS complement(1557489..1559876) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49330 CDS complement(1559933..1560796) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49340 CDS complement(1560819..1561877) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49350 CDS complement(1561895..1562791) product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870179.1 transl_table 11 codon_start 1 locus_tag LOCUS_49360 CDS complement(1562807..1563460) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49370 CDS complement(1563474..1566446) product glycyl radical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388658.1 transl_table 11 codon_start 1 locus_tag LOCUS_49380 CDS complement(1566871..1568376) product phenylacetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928913.1 transl_table 11 codon_start 1 locus_tag LOCUS_49390 CDS 1568431..1569453 product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255943.1 transl_table 11 codon_start 1 locus_tag LOCUS_49400 CDS complement(1569502..1570596) product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030869444.1 transl_table 11 codon_start 1 locus_tag LOCUS_49410 gene nadA CDS complement(1570668..1571063) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49420 CDS complement(1571223..1571771) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49430 CDS 1572048..1572977 product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144264.1 transl_table 11 codon_start 1 locus_tag LOCUS_49440 CDS 1573057..1573713 product TMEM165/GDT1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941521.1 transl_table 11 codon_start 1 locus_tag LOCUS_49450 CDS 1573738..1577835 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49460 CDS complement(1578015..1579163) product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389826.1 transl_table 11 codon_start 1 locus_tag LOCUS_49470 gene rnd CDS 1579365..1581695 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_178372678.1 transl_table 11 codon_start 1 locus_tag LOCUS_49480 CDS complement(1581727..1582269) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49490 CDS complement(1582276..1583562) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115345.1 transl_table 11 codon_start 1 locus_tag LOCUS_49500 CDS complement(1583570..1586428) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49510 CDS 1586524..1587525 product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244442.1 transl_table 11 codon_start 1 locus_tag LOCUS_49520 CDS 1587522..1588220 product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463963.1 transl_table 11 codon_start 1 locus_tag LOCUS_49530 CDS complement(1588217..1588642) product CopD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958512.1 transl_table 11 codon_start 1 locus_tag LOCUS_49540 CDS complement(1588660..1589112) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49550 CDS complement(1589240..1589611) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49560 CDS complement(1589660..1590385) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038929.1 transl_table 11 codon_start 1 locus_tag LOCUS_49570 CDS complement(1590462..1592039) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49580 CDS complement(1592244..1593281) product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194429.1 transl_table 11 codon_start 1 locus_tag LOCUS_49590 gene pyrC CDS 1593395..1593658 product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772089.1 transl_table 11 codon_start 1 locus_tag LOCUS_49600 CDS 1593748..1595538 product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554661.1 transl_table 11 codon_start 1 locus_tag LOCUS_49610 gene aspS CDS 1595784..1596059 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49620 CDS complement(1596151..1597128) product elongation factor P--(R)-beta-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175550.1 transl_table 11 codon_start 1 locus_tag LOCUS_49630 gene epmA CDS complement(1597125..1597694) product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444882.1 transl_table 11 codon_start 1 locus_tag LOCUS_49640 gene efp CDS 1597768..1598754 product EF-P beta-lysylation protein EpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940544.1 transl_table 11 codon_start 1 locus_tag LOCUS_49650 gene epmB CDS 1598854..1602852 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49660 CDS 1602857..1603780 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49670 CDS 1603870..1604595 product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766954.1 transl_table 11 codon_start 1 locus_tag LOCUS_49680 CDS 1604607..1605560 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49690 CDS complement(1605615..1606358) product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130802.1 transl_table 11 codon_start 1 locus_tag LOCUS_49700 CDS complement(1606363..1607106) product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370292.1 transl_table 11 codon_start 1 locus_tag LOCUS_49710 gene pdxJ CDS complement(1607180..1607881) product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005654053.1 transl_table 11 codon_start 1 locus_tag LOCUS_49720 gene recO CDS complement(1607881..1608771) product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003363707.1 transl_table 11 codon_start 1 locus_tag LOCUS_49730 gene era CDS complement(1608768..1609451) product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460683.1 transl_table 11 codon_start 1 locus_tag LOCUS_49740 gene rnc CDS complement(1609448..1609825) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49750 CDS complement(1609922..1610698) product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444404.1 transl_table 11 codon_start 1 locus_tag LOCUS_49760 gene lepB CDS complement(1610711..1612510) product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000790168.1 transl_table 11 codon_start 1 locus_tag LOCUS_49770 gene lepA CDS complement(1612582..1613319) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49780 CDS complement(1613319..1616819) product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114676.1 transl_table 11 codon_start 1 locus_tag LOCUS_49790 gene smc CDS 1617201..1618649 product sodium:proton antiporter NhaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482814.1 transl_table 11 codon_start 1 locus_tag LOCUS_49800 gene nhaD CDS 1618658..1620226 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49810 CDS 1620223..1620921 product two-component system response regulator KdpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039223.1 transl_table 11 codon_start 1 locus_tag LOCUS_49820 gene kdpE CDS complement(1621191..1621550) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49830 CDS 1621845..1622234 product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056073.1 transl_table 11 codon_start 1 locus_tag LOCUS_49840 gene queF CDS 1622241..1622525 product EscU/YscU/HrcU family type III secretion system export apparatus switch protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947507.1 transl_table 11 codon_start 1 locus_tag LOCUS_49850 CDS 1622522..1623382 product archaetidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113924.1 transl_table 11 codon_start 1 locus_tag LOCUS_49860 gene asd CDS 1623491..1623841 product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947718.1 transl_table 11 codon_start 1 locus_tag LOCUS_49870 gene yajC CDS 1623917..1625764 product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262437.1 transl_table 11 codon_start 1 locus_tag LOCUS_49880 gene secD CDS 1625912..1626343 product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092811.1 transl_table 11 codon_start 1 locus_tag LOCUS_49890 gene ndk CDS 1626318..1627430 product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219171.1 transl_table 11 codon_start 1 locus_tag LOCUS_49900 gene rlmN CDS 1627420..1628181 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49910 CDS 1628201..1629487 product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705646.1 transl_table 11 codon_start 1 locus_tag LOCUS_49920 gene hisS CDS 1629521..1630177 product YfgM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106650.1 transl_table 11 codon_start 1 locus_tag LOCUS_49930 CDS 1630263..1631417 product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010428301.1 transl_table 11 codon_start 1 locus_tag LOCUS_49940 gene bamB CDS 1631422..1632813 product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000249413.1 transl_table 11 codon_start 1 locus_tag LOCUS_49950 gene der CDS 1632834..1633331 product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195100.1 transl_table 11 codon_start 1 locus_tag LOCUS_49960 gene tpx CDS complement(1633409..1633963) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49970 CDS complement(1634114..1634503) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49980 CDS complement(1634545..1634790) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49990 CDS 1634962..1635465 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50000 CDS complement(1635657..1636169) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50010 CDS complement(1636383..1638251) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50020 CDS complement(1638340..1639152) product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072508.1 transl_table 11 codon_start 1 locus_tag LOCUS_50030 CDS 1639542..1643180 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50040 CDS 1643177..1643776 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087542.1 transl_table 11 codon_start 1 locus_tag LOCUS_50050 CDS 1643984..1644178 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50060 CDS 1644626..1644937 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50070 CDS complement(1644955..1645776) product thermonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105331.1 transl_table 11 codon_start 1 locus_tag LOCUS_50080 CDS 1645792..1646337 product DUF1415 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071856.1 transl_table 11 codon_start 1 locus_tag LOCUS_50090 CDS 1646661..1649378 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50100 CDS 1649466..1650713 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50110 note possible pseudo, internal stop codon CDS 1650706..1651869 product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704392.1 transl_table 11 codon_start 1 locus_tag LOCUS_50120 CDS complement(1652292..1652993) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50130 CDS 1653077..1653403 product DUF2288 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268691.1 transl_table 11 codon_start 1 locus_tag LOCUS_50140 CDS complement(1653345..1654010) product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206314.1 transl_table 11 codon_start 1 locus_tag LOCUS_50150 CDS 1654047..1654391 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50160 CDS complement(1654452..1655738) product ATP-dependent RNA helicase RhlE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168103.1 transl_table 11 codon_start 1 locus_tag LOCUS_50170 gene rhlE CDS 1655889..1656251 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50180 CDS complement(1656305..1659067) product RNA polymerase-associated protein RapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948005.1 transl_table 11 codon_start 1 locus_tag LOCUS_50190 gene rapA CDS 1659266..1659703 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942658.1 transl_table 11 codon_start 1 locus_tag LOCUS_50200 CDS complement(1659748..1660554) product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400159.1 transl_table 11 codon_start 1 locus_tag LOCUS_50210 gene dapB CDS complement(1660558..1661697) product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095211.1 transl_table 11 codon_start 1 locus_tag LOCUS_50220 gene dnaJ CDS complement(1661740..1662033) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50230 CDS complement(1662030..1662254) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50240 CDS complement(1662291..1662476) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50250 CDS complement(1662532..1663254) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50260 CDS complement(1663365..1665299) product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770882.1 transl_table 11 codon_start 1 locus_tag LOCUS_50270 gene dnaK CDS complement(1665371..1666009) product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095213.1 transl_table 11 codon_start 1 locus_tag LOCUS_50280 gene grpE CDS complement(1666060..1667112) product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029628994.1 transl_table 11 codon_start 1 locus_tag LOCUS_50290 gene hrcA CDS complement(1667455..1667607) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50300 CDS complement(1667658..1667987) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50310 CDS complement(1668223..1670715) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545674.1 transl_table 11 codon_start 1 locus_tag LOCUS_50320 CDS complement(1670899..1674864) product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876975.1 transl_table 11 codon_start 1 locus_tag LOCUS_50330 CDS complement(1674851..1675186) product DUF2149 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024303.1 transl_table 11 codon_start 1 locus_tag LOCUS_50340 CDS complement(1675164..1675772) product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763053.1 transl_table 11 codon_start 1 locus_tag LOCUS_50350 CDS complement(1675990..1677096) product HupE/UreJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142975.1 transl_table 11 codon_start 1 locus_tag LOCUS_50360 CDS complement(1677107..1679308) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089686.1 transl_table 11 codon_start 1 locus_tag LOCUS_50370 CDS complement(1679396..1680826) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50380 CDS complement(1681210..1681674) product nickel-responsive transcriptional regulator NikR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001190057.1 transl_table 11 codon_start 1 locus_tag LOCUS_50390 gene nikR CDS 1681818..1682396 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50400 CDS 1682407..1682817 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50410 CDS 1682836..1683222 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50420 CDS 1683219..1683833 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50430 CDS 1683974..1684468 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965607.1 transl_table 11 codon_start 1 locus_tag LOCUS_50440 CDS complement(1684551..1684919) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50450 CDS complement(1685087..1685647) product HupE/UreJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003368916.1 transl_table 11 codon_start 1 locus_tag LOCUS_50460 CDS complement(1686300..1688567) product TonB-dependent receptor family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918028.1 transl_table 11 codon_start 1 locus_tag LOCUS_50470 CDS complement(1688761..1689195) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50480 CDS complement(1689653..1690663) product fructose-bisphosphate aldolase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763563.1 transl_table 11 codon_start 1 locus_tag LOCUS_50490 gene fba CDS complement(1690746..1692170) product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546569.1 transl_table 11 codon_start 1 locus_tag LOCUS_50500 CDS complement(1692160..1694226) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50510 CDS complement(1694223..1695188) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50520 CDS 1695744..1696586 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50530 CDS complement(1696741..1696956) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50540 CDS complement(1697544..1697864) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50550 CDS complement(1698396..1698734) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50560 CDS 1699034..1701961 product SNF2-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000286652.1 transl_table 11 codon_start 1 locus_tag LOCUS_50570 sequence4 source 1..95309 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 227..2791 product conjugal transfer protein TrbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974837.1 transl_table 11 codon_start 1 locus_tag LOCUS_50580 CDS 2788..3540 product conjugal transfer protein TrbF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970261.1 transl_table 11 codon_start 1 locus_tag LOCUS_50590 CDS 3558..4460 product P-type conjugative transfer protein TrbG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974834.1 transl_table 11 codon_start 1 locus_tag LOCUS_50600 gene trbG CDS 4678..4902 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50610 CDS 4907..6310 product IncP-type conjugal transfer protein TrbI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974832.1 transl_table 11 codon_start 1 locus_tag LOCUS_50620 gene trbI CDS 6334..7137 product P-type conjugative transfer protein TrbJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815844.1 transl_table 11 codon_start 1 locus_tag LOCUS_50630 gene trbJ CDS 7144..7428 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50640 CDS 7528..8835 product P-type conjugative transfer protein TrbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205280.1 transl_table 11 codon_start 1 locus_tag LOCUS_50650 gene trbL CDS 8850..9488 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50660 CDS 10235..10723 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50670 CDS 11223..12776 product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193365322.1 transl_table 11 codon_start 1 locus_tag LOCUS_50680 CDS complement(13793..15583) product AIPR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044008002.1 transl_table 11 codon_start 1 locus_tag LOCUS_50690 CDS complement(15583..16605) product PD-(D/E)XK motif protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383505.1 transl_table 11 codon_start 1 locus_tag LOCUS_50700 CDS complement(16589..19507) product Z1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383504.1 transl_table 11 codon_start 1 locus_tag LOCUS_50710 CDS complement(19508..21016) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383503.1 transl_table 11 codon_start 1 locus_tag LOCUS_50720 CDS complement(21003..23195) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50730 CDS complement(23611..24024) product type II toxin-antitoxin system antitoxin HicB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077627724.1 transl_table 11 codon_start 1 locus_tag LOCUS_50740 gene hicB CDS complement(24144..24320) product type II toxin-antitoxin system mRNA interferase toxin HicA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000813797.1 transl_table 11 codon_start 1 locus_tag LOCUS_50750 gene hicA CDS complement(24524..24718) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50760 CDS 24815..25414 product translesion error-prone DNA polymerase V autoproteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011946663.1 transl_table 11 codon_start 1 locus_tag LOCUS_50770 gene umuD CDS complement(25840..26631) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231443.1 transl_table 11 codon_start 1 locus_tag LOCUS_50780 CDS complement(26680..27075) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50790 CDS complement(27111..27410) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50800 CDS complement(27419..28420) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50810 CDS 28542..28838 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50820 CDS complement(29047..29289) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50830 CDS complement(29293..29913) product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000086527.1 transl_table 11 codon_start 1 locus_tag LOCUS_50840 CDS complement(30162..30389) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50850 CDS complement(30424..31362) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50860 CDS 31565..32935 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50870 CDS complement(33052..33345) product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037339.1 transl_table 11 codon_start 1 locus_tag LOCUS_50880 CDS complement(33462..33737) product DNA-binding protein HU-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006081127.1 transl_table 11 codon_start 1 locus_tag LOCUS_50890 gene hupB CDS 33736..34113 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50900 CDS 34214..36004 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50910 CDS complement(36272..36493) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50920 CDS complement(36643..37272) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50930 CDS complement(37312..37761) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50940 CDS 38072..38653 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50950 CDS complement(38735..41800) product Tn3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077210409.1 transl_table 11 codon_start 1 locus_tag LOCUS_50960 CDS 41956..42588 product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074453.1 transl_table 11 codon_start 1 locus_tag LOCUS_50970 CDS 43342..43563 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50980 CDS 43740..47549 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50990 CDS 47527..47946 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51000 CDS 48922..50244 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51010 CDS 50232..51401 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51020 CDS 51962..52711 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51030 CDS 53194..53559 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51040 CDS 53598..53813 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51050 CDS complement(53854..54081) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51060 CDS complement(54195..54959) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51070 CDS complement(55115..55387) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51080 CDS complement(55560..65594) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51090 CDS complement(65606..65845) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51100 CDS complement(65829..68027) product type IA DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001235749.1 transl_table 11 codon_start 1 locus_tag LOCUS_51110 CDS complement(68042..68563) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51120 CDS complement(68560..70473) product conjugal transfer protein TraG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368406.1 transl_table 11 codon_start 1 locus_tag LOCUS_51130 CDS complement(70727..72919) product relaxase/mobilization nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009938884.1 transl_table 11 codon_start 1 locus_tag LOCUS_51140 CDS complement(72945..73307) product conjugal transfer transcriptional regulator TraJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039733.1 transl_table 11 codon_start 1 locus_tag LOCUS_51150 gene traJ CDS 73635..74009 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51160 CDS 74009..74737 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51170 CDS 74737..75183 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51180 CDS complement(75426..76085) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51190 CDS complement(76165..77322) product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775476.1 transl_table 11 codon_start 1 locus_tag LOCUS_51200 CDS complement(77322..78080) product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002656688.1 transl_table 11 codon_start 1 locus_tag LOCUS_51210 CDS complement(78077..78367) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51220 CDS complement(78519..78839) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51230 CDS complement(78993..79388) product antirestriction protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017277562.1 transl_table 11 codon_start 1 locus_tag LOCUS_51240 CDS complement(79518..79931) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51250 CDS complement(80162..80317) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51260 repeat_region 80642..80843 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ccgcgacctattccccctg CDS complement(80993..81916) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51270 CDS 82545..82874 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51280 CDS 82892..84934 product siderophore enterobactin receptor FepA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001350196.1 transl_table 11 codon_start 1 locus_tag LOCUS_51290 gene fepA CDS 84934..86241 product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257389.1 transl_table 11 codon_start 1 locus_tag LOCUS_51300 CDS 86329..87261 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51310 CDS complement(87236..87847) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51320 note possible pseudo, frameshifted CDS complement(87772..88041) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51330 CDS complement(88686..89549) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51340 CDS complement(89530..90459) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51350 CDS 90828..91790 product P-type conjugative transfer ATPase TrbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970254.1 transl_table 11 codon_start 1 locus_tag LOCUS_51360 gene trbB CDS 91801..92301 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51370 CDS 92633..95197 product conjugal transfer protein TrbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974837.1 transl_table 11 codon_start 1 locus_tag LOCUS_51380