COMMON DATATYPE type WGS KEYWORD keyword WGS KEYWORD keyword STANDARD_DRAFT DBLINK project biosample SUBMITTER ab_name ab_name ab_name contact email phone fax institute country city street zip REFERENCE title ab_name ab_name ab_name status Unpublished year COMMENT line Annotated by DFAST v.1.2.20 (https://dfast.nig.ac.jp) ST_COMMENT tagset_id Genome-Assembly-Data Assembly Method Genome Coverage Sequencing Technology sequence001 source 1..271901 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 131..922 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096937.1 transl_table 11 codon_start 1 locus_tag LOCUS_00010 CDS complement(935..1924) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096668.1 transl_table 11 codon_start 1 locus_tag LOCUS_00020 CDS complement(2083..2388) product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000212648.1 transl_table 11 codon_start 1 locus_tag LOCUS_00030 CDS complement(2421..3539) product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000456065.1 transl_table 11 codon_start 1 locus_tag LOCUS_00040 CDS complement(3747..4868) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226918.1 transl_table 11 codon_start 1 locus_tag LOCUS_00050 CDS 5056..5955 product transcriptional regulator NodD1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084820.1 transl_table 11 codon_start 1 locus_tag LOCUS_00060 gene nodD1 CDS 6091..7248 product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921526.1 transl_table 11 codon_start 1 locus_tag LOCUS_00070 CDS 7275..8195 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089167.1 transl_table 11 codon_start 1 locus_tag LOCUS_00080 CDS 8198..8563 product Rieske (2Fe-2S) protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089166.1 transl_table 11 codon_start 1 locus_tag LOCUS_00090 CDS 8541..9521 product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089162.1 transl_table 11 codon_start 1 locus_tag LOCUS_00100 CDS 9536..10339 product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174479.1 transl_table 11 codon_start 1 locus_tag LOCUS_00110 CDS complement(10391..11149) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00120 tRNA complement(11673..11749) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00010 tRNA complement(11761..11837) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00020 CDS complement(11989..13377) product multidrug efflux MATE transporter MdtK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001175077.1 transl_table 11 codon_start 1 locus_tag LOCUS_00130 CDS 13579..14220 product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000493947.1 transl_table 11 codon_start 1 locus_tag LOCUS_00140 gene ribE CDS complement(14257..15405) product cyclopropane fatty acyl phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098886.1 transl_table 11 codon_start 1 locus_tag LOCUS_00150 gene cfa CDS complement(15695..16900) product purine nucleoside transporter PunC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001182326.1 transl_table 11 codon_start 1 locus_tag LOCUS_00160 gene punC CDS 17013..17945 product DNA-binding transcriptional activator PunR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000269501.1 transl_table 11 codon_start 1 locus_tag LOCUS_00170 gene punR CDS complement(17942..18967) product HTH-type transcriptional repressor PurR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190985.1 transl_table 11 codon_start 1 locus_tag LOCUS_00180 gene purR CDS 19516..20682 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000701040.1 transl_table 11 codon_start 1 locus_tag LOCUS_00190 CDS complement(20755..21336) product superoxide dismutase [Fe] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007283.1 transl_table 11 codon_start 1 locus_tag LOCUS_00200 gene sodB CDS complement(21462..21917) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00210 CDS 22045..22362 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00220 CDS 22606..22953 product monothiol glutaredoxin 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003832760.1 transl_table 11 codon_start 1 locus_tag LOCUS_00230 gene grxD CDS complement(23067..23711) product ribonuclease T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001282267.1 transl_table 11 codon_start 1 locus_tag LOCUS_00240 gene rnt CDS complement(23813..24220) product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001237802.1 transl_table 11 codon_start 1 locus_tag LOCUS_00250 gene gloA CDS complement(24311..25408) product N-ethylmaleimide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000093589.1 transl_table 11 codon_start 1 locus_tag LOCUS_00260 gene nemA CDS complement(25466..26065) product DNA-binding transcriptional regulator NemR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001032947.1 transl_table 11 codon_start 1 locus_tag LOCUS_00270 gene nemR CDS 26168..26407 product DUF1289 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000840481.1 transl_table 11 codon_start 1 locus_tag LOCUS_00280 CDS 26457..27353 product aldo/keto reductase family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000250656.1 transl_table 11 codon_start 1 locus_tag LOCUS_00290 CDS 27433..27954 product superoxide dismutase [Cu-Zn] SodC2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000826818.1 transl_table 11 codon_start 1 locus_tag LOCUS_00300 gene sodC2 CDS complement(27955..29970) product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000777620.1 transl_table 11 codon_start 1 locus_tag LOCUS_00310 CDS complement(29971..30756) product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000016506.1 transl_table 11 codon_start 1 locus_tag LOCUS_00320 CDS 31269..31703 product transcriptional regulator SlyA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445639.1 transl_table 11 codon_start 1 locus_tag LOCUS_00330 gene slyA CDS complement(31745..32212) product outer membrane lipoprotein SlyB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000597179.1 transl_table 11 codon_start 1 locus_tag LOCUS_00340 gene slyB CDS 32483..33604 product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096911.1 transl_table 11 codon_start 1 locus_tag LOCUS_00350 gene anmK CDS 33698..34021 product C-type lysozyme inhibitor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000061974.1 transl_table 11 codon_start 1 locus_tag LOCUS_00360 gene mliC CDS 34080..34736 product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001282325.1 transl_table 11 codon_start 1 locus_tag LOCUS_00370 gene pdxH CDS 34863..36137 product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000168626.1 transl_table 11 codon_start 1 locus_tag LOCUS_00380 gene tyrS CDS 36205..37065 product pyridoxal kinase PdxY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096907.1 transl_table 11 codon_start 1 locus_tag LOCUS_00390 gene pdxY CDS complement(37163..37768) product glutathione transferase GstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096906.1 transl_table 11 codon_start 1 locus_tag LOCUS_00400 gene gstA CDS complement(37875..39374) product dipeptide/tripeptide permease DtpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100913.1 transl_table 11 codon_start 1 locus_tag LOCUS_00410 gene dtpA CDS complement(39976..40611) product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001030339.1 transl_table 11 codon_start 1 locus_tag LOCUS_00420 gene nth CDS complement(40608..41306) product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001289628.1 transl_table 11 codon_start 1 locus_tag LOCUS_00430 CDS complement(41310..41930) product electron transport complex subunit RsxG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000920789.1 transl_table 11 codon_start 1 locus_tag LOCUS_00440 gene rsxG CDS complement(41934..42992) product electron transport complex subunit RsxD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000231922.1 transl_table 11 codon_start 1 locus_tag LOCUS_00450 gene rsxD CDS complement(42993..44927) product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000915678.1 transl_table 11 codon_start 1 locus_tag LOCUS_00460 gene rsxC CDS complement(44920..45498) product electron transport complex subunit RsxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001092600.1 transl_table 11 codon_start 1 locus_tag LOCUS_00470 gene rsxB CDS complement(45498..46079) product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000133193.1 transl_table 11 codon_start 1 locus_tag LOCUS_00480 gene rsxA CDS complement(46156..46596) product DUF2569 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000214061.1 transl_table 11 codon_start 1 locus_tag LOCUS_00490 CDS complement(46675..46890) product transcription modulator YdgT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000217946.1 transl_table 11 codon_start 1 locus_tag LOCUS_00500 gene ydgT CDS complement(47160..47342) product division septum protein Blr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001307228.1 transl_table 11 codon_start 1 locus_tag LOCUS_00510 gene blr CDS 47527..48567 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300538.1 transl_table 11 codon_start 1 locus_tag LOCUS_00520 CDS complement(48867..49868) product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000565566.1 transl_table 11 codon_start 1 locus_tag LOCUS_00530 gene add CDS complement(49972..51144) product bifunctional maltose regulon transcriptional repressor/cystathionine beta-lyase MalY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000459387.1 transl_table 11 codon_start 1 locus_tag LOCUS_00540 gene malY CDS complement(51155..52747) product PTS maltose transporter subunit IICB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125611.1 transl_table 11 codon_start 1 locus_tag LOCUS_00550 gene malX CDS 52924..53952 product mal regulon transcriptional regulator MalI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179510.1 transl_table 11 codon_start 1 locus_tag LOCUS_00560 gene malI CDS complement(53999..55507) product YdgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000753325.1 transl_table 11 codon_start 1 locus_tag LOCUS_00570 CDS complement(55609..56784) product mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001170654.1 transl_table 11 codon_start 1 locus_tag LOCUS_00580 gene manA CDS 57002..58648 product class I fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000066639.1 transl_table 11 codon_start 1 locus_tag LOCUS_00590 gene fumB CDS 58789..60192 product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001099112.1 transl_table 11 codon_start 1 locus_tag LOCUS_00600 gene fumC CDS complement(60189..61118) product DNA replication terminus site-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309528.1 transl_table 11 codon_start 1 locus_tag LOCUS_00610 gene tus CDS complement(61208..62494) product two-component system sensor histidine kinase RstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000732951.1 transl_table 11 codon_start 1 locus_tag LOCUS_00620 gene rstB CDS complement(62507..63241) product two-component system response regulator RstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001080045.1 transl_table 11 codon_start 1 locus_tag LOCUS_00630 gene rstA CDS 63368..63703 product GlpM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000524877.1 transl_table 11 codon_start 1 locus_tag LOCUS_00640 CDS complement(63700..64422) product dihydromonapterin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000513673.1 transl_table 11 codon_start 1 locus_tag LOCUS_00650 gene folM CDS complement(64483..65865) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000412379.1 transl_table 11 codon_start 1 locus_tag LOCUS_00660 CDS complement(66118..67062) product DUF1471 family protein YdgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000769322.1 transl_table 11 codon_start 1 locus_tag LOCUS_00670 gene ydgH CDS 67590..69122 product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219360.1 transl_table 11 codon_start 1 locus_tag LOCUS_00680 gene pntA CDS 69133..70521 product Re/Si-specific NAD(P)(+) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096868.1 transl_table 11 codon_start 1 locus_tag LOCUS_00690 gene pntB CDS complement(70605..71639) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118268.1 transl_table 11 codon_start 1 locus_tag LOCUS_00700 CDS 72057..72419 product multidrug/spermidine efflux SMR transporter subunit MdtJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029882799.1 transl_table 11 codon_start 1 locus_tag LOCUS_00710 gene mdtJ CDS 72406..72735 product multidrug/spermidine efflux SMR transporter subunit MdtI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366783.1 transl_table 11 codon_start 1 locus_tag LOCUS_00720 gene mdtI CDS complement(72774..73595) product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000549642.1 transl_table 11 codon_start 1 locus_tag LOCUS_00730 CDS complement(73865..74137) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00740 CDS complement(74271..75527) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091806.1 transl_table 11 codon_start 1 locus_tag LOCUS_00750 CDS complement(75541..75705) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00760 CDS 75649..76548 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019571.1 transl_table 11 codon_start 1 locus_tag LOCUS_00770 CDS 76676..77896 product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000225096.1 transl_table 11 codon_start 1 locus_tag LOCUS_00780 CDS 78022..78717 product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000919236.1 transl_table 11 codon_start 1 locus_tag LOCUS_00790 gene bioD CDS complement(78836..79978) product osmoprotectant ABC transporter ATP-binding protein OsmV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000593089.1 transl_table 11 codon_start 1 locus_tag LOCUS_00800 gene osmV CDS complement(79978..80625) product osmoprotectant ABC transporter permease OsmW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000379676.1 transl_table 11 codon_start 1 locus_tag LOCUS_00810 gene osmW CDS complement(80635..81537) product osmoprotectant ABC transporter substrate-binding protein OsmX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001211196.1 transl_table 11 codon_start 1 locus_tag LOCUS_00820 gene osmX CDS complement(81566..82276) product osmoprotectant ABC transporter permease OsmY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000547814.1 transl_table 11 codon_start 1 locus_tag LOCUS_00830 gene osmY CDS complement(82571..83185) product Tat proofreading chaperone DmsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000206559.1 transl_table 11 codon_start 1 locus_tag LOCUS_00840 gene dmsD CDS complement(83322..83627) product DUF1161 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300836.1 transl_table 11 codon_start 1 locus_tag LOCUS_00850 CDS complement(83747..84307) product spermidine N1-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001138584.1 transl_table 11 codon_start 1 locus_tag LOCUS_00860 gene speG CDS complement(84340..84681) product DUF1283 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001066440.1 transl_table 11 codon_start 1 locus_tag LOCUS_00870 CDS 84998..85264 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00880 CDS 85340..86713 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000192118.1 transl_table 11 codon_start 1 locus_tag LOCUS_00890 CDS 86896..88302 product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096788.1 transl_table 11 codon_start 1 locus_tag LOCUS_00900 gene uxaC CDS 88325..89869 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096787.1 transl_table 11 codon_start 1 locus_tag LOCUS_00910 CDS 90030..91496 product mannitol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096786.1 transl_table 11 codon_start 1 locus_tag LOCUS_00920 CDS complement(91588..91791) product putative selenium delivery protein YdfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000989267.1 transl_table 11 codon_start 1 locus_tag LOCUS_00930 gene ydfZ CDS complement(91983..92669) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000215563.1 transl_table 11 codon_start 1 locus_tag LOCUS_00940 CDS complement(92757..93503) product bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000636564.1 transl_table 11 codon_start 1 locus_tag LOCUS_00950 gene ydfG CDS 93640..95685 product peptidyl-dipeptidase Dcp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014640153.1 transl_table 11 codon_start 1 locus_tag LOCUS_00960 gene dcp CDS complement(95839..96117) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00970 CDS complement(96222..96584) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00980 CDS complement(96866..97396) product 2-oxo-tetronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001235351.1 transl_table 11 codon_start 1 locus_tag LOCUS_00990 CDS complement(97393..97845) product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096670.1 transl_table 11 codon_start 1 locus_tag LOCUS_01000 CDS complement(97855..98364) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705355.1 transl_table 11 codon_start 1 locus_tag LOCUS_01010 CDS 98505..98897 product YdeI family stress tolerance OB fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000671733.1 transl_table 11 codon_start 1 locus_tag LOCUS_01020 gene ydeI CDS 99087..99260 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01030 CDS 99892..100995 product cobalamin-independent methionine synthase II family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096637.1 transl_table 11 codon_start 1 locus_tag LOCUS_01040 CDS 101213..102484 product urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096636.1 transl_table 11 codon_start 1 locus_tag LOCUS_01050 gene urtA CDS 102531..104105 product urea ABC transporter permease subunit UrtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096635.1 transl_table 11 codon_start 1 locus_tag LOCUS_01060 gene urtB CDS 104105..105178 product urea ABC transporter permease subunit UrtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096634.1 transl_table 11 codon_start 1 locus_tag LOCUS_01070 gene urtC CDS 105178..105975 product urea ABC transporter ATP-binding protein UrtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096633.1 transl_table 11 codon_start 1 locus_tag LOCUS_01080 gene urtD CDS 105985..106683 product urea ABC transporter ATP-binding subunit UrtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096632.1 transl_table 11 codon_start 1 locus_tag LOCUS_01090 gene urtE CDS complement(106690..107877) product efflux MFS transporter YdeE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001054189.1 transl_table 11 codon_start 1 locus_tag LOCUS_01100 gene ydeE CDS 108080..108979 product O-acetylserine/cysteine exporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000087216.1 transl_table 11 codon_start 1 locus_tag LOCUS_01110 gene eamA CDS complement(109045..109263) product multiple antibiotic resistance protein MarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366734.1 transl_table 11 codon_start 1 locus_tag LOCUS_01120 gene marB CDS complement(109298..109678) product MDR efflux pump AcrAB transcriptional activator MarA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091194.1 transl_table 11 codon_start 1 locus_tag LOCUS_01130 gene marA CDS complement(109700..110134) product multiple antibiotic resistance transcriptional regulator MarR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843414.1 transl_table 11 codon_start 1 locus_tag LOCUS_01140 gene marR CDS 110391..111056 product MarC family NAAT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000968968.1 transl_table 11 codon_start 1 locus_tag LOCUS_01150 CDS complement(111108..112304) product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000154617.1 transl_table 11 codon_start 1 locus_tag LOCUS_01160 CDS 112502..113290 product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096624.1 transl_table 11 codon_start 1 locus_tag LOCUS_01170 CDS complement(113360..114640) product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000177663.1 transl_table 11 codon_start 1 locus_tag LOCUS_01180 CDS complement(114665..115837) product exo-alpha-sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096621.1 transl_table 11 codon_start 1 locus_tag LOCUS_01190 CDS complement(115865..116626) product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000480548.1 transl_table 11 codon_start 1 locus_tag LOCUS_01200 CDS complement(116736..117620) product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705319.1 transl_table 11 codon_start 1 locus_tag LOCUS_01210 CDS complement(117640..118770) product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705320.1 transl_table 11 codon_start 1 locus_tag LOCUS_01220 CDS complement(118934..119815) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000366501.1 transl_table 11 codon_start 1 locus_tag LOCUS_01230 CDS 119914..121302 product succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296740.1 transl_table 11 codon_start 1 locus_tag LOCUS_01240 gene sad CDS 121400..122329 product glutaminase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257409.1 transl_table 11 codon_start 1 locus_tag LOCUS_01250 gene glsB CDS 122329..122691 product DUF4186 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000992456.1 transl_table 11 codon_start 1 locus_tag LOCUS_01260 CDS 122922..124310 product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000558044.1 transl_table 11 codon_start 1 locus_tag LOCUS_01270 CDS 124544..125995 product tagaturonate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000854624.1 transl_table 11 codon_start 1 locus_tag LOCUS_01280 gene uxaB CDS 126207..127127 product bestrophin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001670736.1 transl_table 11 codon_start 1 locus_tag LOCUS_01290 CDS complement(127132..127893) product trans-aconitate 2-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001286595.1 transl_table 11 codon_start 1 locus_tag LOCUS_01300 gene tam CDS complement(128042..129199) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01310 CDS 129334..129576 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01320 CDS 129573..131078 product sodium/pantothenate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902082.1 transl_table 11 codon_start 1 locus_tag LOCUS_01330 gene panF CDS 131126..132082 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01340 CDS 132087..132788 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01350 CDS 133065..134099 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01360 CDS complement(134857..136086) product type II toxin-antitoxin system HipA family toxin YjjJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815521.1 transl_table 11 codon_start 1 locus_tag LOCUS_01370 gene yjjJ CDS complement(136363..136698) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01380 CDS complement(136830..137138) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206310.1 transl_table 11 codon_start 1 locus_tag LOCUS_01390 CDS 137362..138738 product glycoside hydrolase family 10 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032715566.1 transl_table 11 codon_start 1 locus_tag LOCUS_01400 CDS complement(138743..139501) product DNA-binding transcriptional repressor BluR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000332300.1 transl_table 11 codon_start 1 locus_tag LOCUS_01410 gene bluR CDS complement(139627..140847) product diguanylate phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096959.1 transl_table 11 codon_start 1 locus_tag LOCUS_01420 CDS 141190..141429 product regulatory protein YcgZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096960.1 transl_table 11 codon_start 1 locus_tag LOCUS_01430 gene ycgZ CDS 141486..141788 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367638.1 transl_table 11 codon_start 1 locus_tag LOCUS_01440 CDS 141834..142100 product biofilm development regulator YmgB/AriR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367639.1 transl_table 11 codon_start 1 locus_tag LOCUS_01450 CDS complement(142149..142940) product OBAP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000698597.1 transl_table 11 codon_start 1 locus_tag LOCUS_01460 CDS complement(142941..145016) product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096571.1 transl_table 11 codon_start 1 locus_tag LOCUS_01470 gene glgX CDS complement(145016..147589) product malto-oligosyltrehalose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000613170.1 transl_table 11 codon_start 1 locus_tag LOCUS_01480 gene treY CDS complement(147586..149373) product malto-oligosyltrehalose trehalohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000095550.1 transl_table 11 codon_start 1 locus_tag LOCUS_01490 gene treZ CDS 149930..151312 product diguanylate cyclase DosC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000426292.1 transl_table 11 codon_start 1 locus_tag LOCUS_01500 gene dosC CDS 151339..153744 product oxygen-sensing cyclic-di-GMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001513298.1 transl_table 11 codon_start 1 locus_tag LOCUS_01510 gene dosP CDS complement(153752..154636) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096988.1 transl_table 11 codon_start 1 locus_tag LOCUS_01520 CDS 154785..155483 product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096989.1 transl_table 11 codon_start 1 locus_tag LOCUS_01530 CDS 155495..156127 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01540 CDS 156100..156549 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01550 note possible pseudo, frameshifted CDS 156561..157331 product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366937.1 transl_table 11 codon_start 1 locus_tag LOCUS_01560 CDS complement(157401..157832) product peroxiredoxin OsmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000152305.1 transl_table 11 codon_start 1 locus_tag LOCUS_01570 gene osmC CDS 158171..158386 product biofilm-dependent modulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000495700.1 transl_table 11 codon_start 1 locus_tag LOCUS_01580 gene bdm CDS 158478..158621 product stationary-phase-induced ribosome-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000841554.1 transl_table 11 codon_start 1 locus_tag LOCUS_01590 gene sra CDS 158781..160478 product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000433464.1 transl_table 11 codon_start 1 locus_tag LOCUS_01600 gene maeA CDS 160663..160941 product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000605675.1 transl_table 11 codon_start 1 locus_tag LOCUS_01610 CDS 160941..161225 product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000781370.1 transl_table 11 codon_start 1 locus_tag LOCUS_01620 CDS complement(161283..161885) product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210169.1 transl_table 11 codon_start 1 locus_tag LOCUS_01630 gene ppa CDS complement(162011..162667) product formate dehydrogenase-N subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045648.1 transl_table 11 codon_start 1 locus_tag LOCUS_01640 gene fdnI CDS complement(162660..163544) product formate dehydrogenase N subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001240581.1 transl_table 11 codon_start 1 locus_tag LOCUS_01650 gene fdnH CDS complement(163557..166604) product formate dehydrogenase-N subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_154231912.1 transl_table 11 codon_start 1 transl_except (pos:166017..166019,aa:Sec) note codon on position 196 is selenocysteine opal codon. locus_tag LOCUS_01660 gene fdnG CDS 166947..167771 product aromatic amino acid efflux DMT transporter YddG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000198214.1 transl_table 11 codon_start 1 locus_tag LOCUS_01670 gene yddG CDS 168277..169377 product porin OmpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096520.1 transl_table 11 codon_start 1 locus_tag LOCUS_01680 CDS 169469..169897 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01690 CDS complement(169899..171386) product methyl viologen efflux MFS transporter SmvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000489748.1 transl_table 11 codon_start 1 locus_tag LOCUS_01700 gene smvA CDS 171504..172091 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000121044.1 transl_table 11 codon_start 1 locus_tag LOCUS_01710 CDS 172313..173701 product NarK family nitrate/nitrite MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000198245.1 transl_table 11 codon_start 1 locus_tag LOCUS_01720 CDS 173804..177544 product nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000040363.1 transl_table 11 codon_start 1 locus_tag LOCUS_01730 CDS 177541..179085 product nitrate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000702603.1 transl_table 11 codon_start 1 locus_tag LOCUS_01740 gene narH CDS 179085..179780 product nitrate reductase molybdenum cofactor assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001166289.1 transl_table 11 codon_start 1 locus_tag LOCUS_01750 gene narW CDS 179777..180457 product respiratory nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000617123.1 transl_table 11 codon_start 1 locus_tag LOCUS_01760 gene narI CDS 180792..183776 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01770 CDS complement(183951..184796) product N-hydroxyarylamine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187915.1 transl_table 11 codon_start 1 locus_tag LOCUS_01780 gene nhoA CDS 184934..185503 product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000077280.1 transl_table 11 codon_start 1 locus_tag LOCUS_01790 CDS complement(185519..186136) product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000598868.1 transl_table 11 codon_start 1 locus_tag LOCUS_01800 CDS complement(186222..187382) product YncE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545699.1 transl_table 11 codon_start 1 locus_tag LOCUS_01810 CDS 187897..189657 product TonB-dependent receptor PqqU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000689374.1 transl_table 11 codon_start 1 locus_tag LOCUS_01820 gene pqqU note possible pseudo, frameshifted CDS complement(189714..190379) product colanic acid/biofilm transcriptional regulator McbR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001119592.1 transl_table 11 codon_start 1 locus_tag LOCUS_01830 gene mcbR CDS complement(190603..191640) product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001682108.1 transl_table 11 codon_start 1 locus_tag LOCUS_01840 CDS complement(191698..192273) product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366420.1 transl_table 11 codon_start 1 locus_tag LOCUS_01850 CDS 192311..192829 product L-methionine sulfoximine/L-methionine sulfone acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001310799.1 transl_table 11 codon_start 1 locus_tag LOCUS_01860 gene mddA CDS 192826..193275 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001076520.1 transl_table 11 codon_start 1 locus_tag LOCUS_01870 CDS complement(193320..193553) product DUF2526 family protein YdcY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000018633.1 transl_table 11 codon_start 1 locus_tag LOCUS_01880 gene ydcY CDS 193770..195071 product virulence-associated effector SrfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001129948.1 transl_table 11 codon_start 1 locus_tag LOCUS_01890 gene srfA CDS 195076..198057 product virulence factor SrfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000960825.1 transl_table 11 codon_start 1 locus_tag LOCUS_01900 CDS 198054..200204 product virulence-associated effector SrfC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000165637.1 transl_table 11 codon_start 1 locus_tag LOCUS_01910 gene srfC CDS complement(200211..200384) product orphan toxin OrtT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000061178.1 transl_table 11 codon_start 1 locus_tag LOCUS_01920 gene ortT CDS complement(200771..202195) product aminobutyraldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001163903.1 transl_table 11 codon_start 1 locus_tag LOCUS_01930 gene patD CDS complement(202217..203023) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000555471.1 transl_table 11 codon_start 1 locus_tag LOCUS_01940 CDS complement(203013..203957) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001251315.1 transl_table 11 codon_start 1 locus_tag LOCUS_01950 CDS complement(203958..204971) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000220396.1 transl_table 11 codon_start 1 locus_tag LOCUS_01960 CDS complement(204988..206133) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047447.1 transl_table 11 codon_start 1 locus_tag LOCUS_01970 CDS complement(206458..207867) product GntR family transcriptional regulator YdcR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000760699.1 transl_table 11 codon_start 1 locus_tag LOCUS_01980 gene ycdR CDS complement(207960..208397) product type II toxin-antitoxin system antitoxin HicB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001209405.1 transl_table 11 codon_start 1 locus_tag LOCUS_01990 gene hicB CDS 208661..208891 product DUF2554 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096641.1 transl_table 11 codon_start 1 locus_tag LOCUS_02000 CDS complement(208888..210852) product 23S rRNA 5-hydroxycytidine C2501 synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301045.1 transl_table 11 codon_start 1 locus_tag LOCUS_02010 gene rlhA CDS complement(210931..211467) product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000369547.1 transl_table 11 codon_start 1 locus_tag LOCUS_02020 CDS 211562..212728 product BenE family transporter YdcO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001349372.1 transl_table 11 codon_start 1 locus_tag LOCUS_02030 gene ydcO CDS complement(212705..213580) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096645.1 transl_table 11 codon_start 1 locus_tag LOCUS_02040 CDS 213752..214645 product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096646.1 transl_table 11 codon_start 1 locus_tag LOCUS_02050 CDS complement(214708..215376) product DUF3313 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001261013.1 transl_table 11 codon_start 1 locus_tag LOCUS_02060 CDS complement(215531..216127) product tellurite resistance methyltransferase TehB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000586739.1 transl_table 11 codon_start 1 locus_tag LOCUS_02070 gene tehB CDS complement(216130..217128) product dicarboxylate transporter/tellurite-resistance protein TehA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000336113.1 transl_table 11 codon_start 1 locus_tag LOCUS_02080 gene tehA CDS 217242..218222 product YdcK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000599089.1 transl_table 11 codon_start 1 locus_tag LOCUS_02090 gene ydcK CDS complement(218205..218759) product 50S ribosomal protein L7/L12-serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299372.1 transl_table 11 codon_start 1 locus_tag LOCUS_02100 gene rimL CDS complement(218897..219124) product YdcH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296778.1 transl_table 11 codon_start 1 locus_tag LOCUS_02110 CDS complement(219287..220906) product glucan biosynthesis protein OpgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000375956.1 transl_table 11 codon_start 1 locus_tag LOCUS_02120 gene opgD CDS complement(221162..222676) product carboxylesterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000933982.1 transl_table 11 codon_start 1 locus_tag LOCUS_02130 CDS complement(222716..224059) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000013789.1 transl_table 11 codon_start 1 locus_tag LOCUS_02140 CDS 224297..225037 product protocatechuate 3,4-dioxygenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366378.1 transl_table 11 codon_start 1 locus_tag LOCUS_02150 gene pcaH CDS 225034..225654 product protocatechuate 3,4-dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366377.1 transl_table 11 codon_start 1 locus_tag LOCUS_02160 gene pcaG CDS 225859..226782 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366376.1 transl_table 11 codon_start 1 locus_tag LOCUS_02170 CDS complement(226865..228538) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419375.1 transl_table 11 codon_start 1 locus_tag LOCUS_02180 CDS complement(228703..229821) product S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096677.1 transl_table 11 codon_start 1 locus_tag LOCUS_02190 CDS 230938..231465 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02200 note possible pseudo, frameshifted CDS 231515..231898 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02210 note possible pseudo, frameshifted CDS complement(232509..233036) product cytochrome b561 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000428998.1 transl_table 11 codon_start 1 locus_tag LOCUS_02220 gene cybB CDS 233227..234228 product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000048667.1 transl_table 11 codon_start 1 locus_tag LOCUS_02230 gene gap CDS complement(234285..235724) product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000115947.1 transl_table 11 codon_start 1 locus_tag LOCUS_02240 gene aldA CDS complement(235925..236716) product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001098505.1 transl_table 11 codon_start 1 locus_tag LOCUS_02250 CDS 237110..238429 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015489.1 transl_table 11 codon_start 1 locus_tag LOCUS_02260 CDS complement(238551..240503) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02270 CDS complement(240670..244572) product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000139614.1 transl_table 11 codon_start 1 locus_tag LOCUS_02280 gene hrpA CDS 244837..245442 product FMN-dependent NADH-azoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000048924.1 transl_table 11 codon_start 1 locus_tag LOCUS_02290 gene azoR CDS complement(245473..245775) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02300 note possible pseudo, frameshifted CDS complement(245980..246387) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209765.1 transl_table 11 codon_start 1 locus_tag LOCUS_02310 CDS complement(246375..247649) product phosphatase PAP2/dual specificity phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000627350.1 transl_table 11 codon_start 1 locus_tag LOCUS_02320 CDS complement(247646..249406) product bifunctional alpha/beta hydrolase/class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000431834.1 transl_table 11 codon_start 1 locus_tag LOCUS_02330 CDS complement(249399..250037) product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209768.1 transl_table 11 codon_start 1 locus_tag LOCUS_02340 CDS complement(250043..250960) product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209769.1 transl_table 11 codon_start 1 locus_tag LOCUS_02350 CDS complement(250957..251391) product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000177537.1 transl_table 11 codon_start 1 locus_tag LOCUS_02360 CDS complement(251493..251816) product YdbL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366327.1 transl_table 11 codon_start 1 locus_tag LOCUS_02370 CDS complement(251824..252015) product YnbE family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000784063.1 transl_table 11 codon_start 1 locus_tag LOCUS_02380 CDS complement(252012..254651) product YdbH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000900912.1 transl_table 11 codon_start 1 locus_tag LOCUS_02390 CDS 254877..255545 product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_214551167.1 transl_table 11 codon_start 1 locus_tag LOCUS_02400 CDS 256200..259427 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02410 CDS 259778..260767 product D-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000762205.1 transl_table 11 codon_start 1 locus_tag LOCUS_02420 gene ldhA CDS 260871..261293 product heat shock protein HslJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309480.1 transl_table 11 codon_start 1 locus_tag LOCUS_02430 gene hslJ CDS 261371..261502 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02440 CDS complement(261711..262238) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02450 CDS 262840..266364 product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000628243.1 transl_table 11 codon_start 1 locus_tag LOCUS_02460 gene nifJ CDS 266720..267853 product porin OmpS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000824321.1 transl_table 11 codon_start 1 locus_tag LOCUS_02470 gene ompS2 CDS 268046..268480 product universal stress protein UspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001082296.1 transl_table 11 codon_start 1 locus_tag LOCUS_02480 gene uspF CDS complement(269277..270287) product type III secretion system effector zinc metalloprotease NleC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115801843.1 transl_table 11 codon_start 1 locus_tag LOCUS_02490 gene nleC CDS complement(270330..270500) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02500 note possible pseudo, frameshifted CDS complement(271200..271784) product DUF1076 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000741395.1 transl_table 11 codon_start 1 locus_tag LOCUS_02510 sequence002 source 1..236808 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(553..2667) product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099032.1 transl_table 11 codon_start 1 locus_tag LOCUS_02520 gene fusA CDS complement(2764..3234) product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369416.1 transl_table 11 codon_start 1 locus_tag LOCUS_02530 gene rpsG CDS complement(3331..3705) product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000246815.1 transl_table 11 codon_start 1 locus_tag LOCUS_02540 gene rpsL CDS complement(3831..4118) product sulfurtransferase complex subunit TusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000903377.1 transl_table 11 codon_start 1 locus_tag LOCUS_02550 gene tusB CDS complement(4126..4485) product sulfurtransferase complex subunit TusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000820718.1 transl_table 11 codon_start 1 locus_tag LOCUS_02560 gene tusC CDS complement(4485..4871) product sulfurtransferase complex subunit TusD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001209706.1 transl_table 11 codon_start 1 locus_tag LOCUS_02570 gene tusD CDS complement(4871..5593) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091471.1 transl_table 11 codon_start 1 locus_tag LOCUS_02580 CDS complement(5760..6584) product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000838261.1 transl_table 11 codon_start 1 locus_tag LOCUS_02590 gene fkpA CDS 6807..7025 product SlyX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001152702.1 transl_table 11 codon_start 1 locus_tag LOCUS_02600 CDS complement(7208..7810) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02610 CDS complement(7905..8105) product YheV family putative zinc ribbon protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001007730.1 transl_table 11 codon_start 1 locus_tag LOCUS_02620 CDS complement(8115..9920) product glutathione-regulated potassium-efflux system protein KefB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000399162.1 transl_table 11 codon_start 1 locus_tag LOCUS_02630 gene kefB CDS complement(9920..10471) product glutathione-regulated potassium-efflux system ancillary protein KefG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297514.1 transl_table 11 codon_start 1 locus_tag LOCUS_02640 gene kefG CDS 10609..12510 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000634840.1 transl_table 11 codon_start 1 locus_tag LOCUS_02650 CDS 12526..13458 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099042.1 transl_table 11 codon_start 1 locus_tag LOCUS_02660 CDS complement(13557..14453) product malonate decarboxylase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420731.1 transl_table 11 codon_start 1 locus_tag LOCUS_02670 gene mdcH CDS complement(14454..15071) product malonate decarboxylase holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099044.1 transl_table 11 codon_start 1 locus_tag LOCUS_02680 CDS complement(15075..16034) product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099045.1 transl_table 11 codon_start 1 locus_tag LOCUS_02690 CDS complement(16159..16962) product biotin-independent malonate decarboxylase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099046.1 transl_table 11 codon_start 1 locus_tag LOCUS_02700 gene mdcE CDS complement(16959..17792) product biotin-independent malonate decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099047.1 transl_table 11 codon_start 1 locus_tag LOCUS_02710 CDS complement(17785..18084) product malonate decarboxylase acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099048.1 transl_table 11 codon_start 1 locus_tag LOCUS_02720 gene mdcC CDS complement(18106..18951) product triphosphoribosyl-dephospho-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099049.1 transl_table 11 codon_start 1 locus_tag LOCUS_02730 CDS complement(18951..20606) product malonate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099050.1 transl_table 11 codon_start 1 locus_tag LOCUS_02740 gene mdcA CDS 20857..21873 product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057395.1 transl_table 11 codon_start 1 locus_tag LOCUS_02750 CDS 21876..22094 product YheU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000586568.1 transl_table 11 codon_start 1 locus_tag LOCUS_02760 CDS 22149..23018 product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274690.1 transl_table 11 codon_start 1 locus_tag LOCUS_02770 CDS complement(23149..23553) product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001148908.1 transl_table 11 codon_start 1 locus_tag LOCUS_02780 CDS 23855..24487 product cAMP-activated global transcriptional regulator CRP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000242758.1 transl_table 11 codon_start 1 locus_tag LOCUS_02790 gene crp CDS 24540..26627 product YccS/YhfK family putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012135464.1 transl_table 11 codon_start 1 locus_tag LOCUS_02800 CDS complement(26897..28117) product bifunctional acetylornithine/succinyldiaminopimelate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190012.1 transl_table 11 codon_start 1 locus_tag LOCUS_02810 gene argD CDS complement(28203..28766) product aminodeoxychorismate synthase component 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000601848.1 transl_table 11 codon_start 1 locus_tag LOCUS_02820 gene pabA CDS complement(28798..29400) product putative adenosine monophosphate-protein transferase Fic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001280679.1 transl_table 11 codon_start 1 locus_tag LOCUS_02830 CDS complement(29390..29557) product YhfG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000736862.1 transl_table 11 codon_start 1 locus_tag LOCUS_02840 CDS complement(29665..30237) product peptidylprolyl isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000920482.1 transl_table 11 codon_start 1 locus_tag LOCUS_02850 gene ppiA CDS 30529..31710 product MFS transporter TsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000185243.1 transl_table 11 codon_start 1 locus_tag LOCUS_02860 gene tsgA CDS 32015..34558 product NADPH-nitrite reductase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049259.1 transl_table 11 codon_start 1 locus_tag LOCUS_02870 gene nirB CDS 34555..34881 product nitrite reductase small subunit NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084764.1 transl_table 11 codon_start 1 locus_tag LOCUS_02880 gene nirD CDS 35044..35853 product nitrite transporter NirC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000493575.1 transl_table 11 codon_start 1 locus_tag LOCUS_02890 gene nirC CDS 35865..37238 product siroheme synthase CysG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000349908.1 transl_table 11 codon_start 1 locus_tag LOCUS_02900 gene cysG CDS 37495..37662 product YhfL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001031834.1 transl_table 11 codon_start 1 locus_tag LOCUS_02910 CDS complement(37727..38731) product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000165552.1 transl_table 11 codon_start 1 locus_tag LOCUS_02920 gene trpS CDS complement(38724..39482) product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001031720.1 transl_table 11 codon_start 1 locus_tag LOCUS_02930 gene gph CDS complement(39475..40152) product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000816280.1 transl_table 11 codon_start 1 locus_tag LOCUS_02940 gene rpe CDS complement(40170..41018) product adenine-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099069.1 transl_table 11 codon_start 1 locus_tag LOCUS_02950 gene dam CDS complement(41138..42424) product cell division protein DamX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000343137.1 transl_table 11 codon_start 1 locus_tag LOCUS_02960 gene damX CDS complement(42522..43610) product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000439848.1 transl_table 11 codon_start 1 locus_tag LOCUS_02970 gene aroB CDS complement(43659..44180) product shikimate kinase AroK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818621.1 transl_table 11 codon_start 1 locus_tag LOCUS_02980 gene aroK CDS complement(44488..45726) product DNA uptake porin HofQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000815997.1 transl_table 11 codon_start 1 locus_tag LOCUS_02990 gene hofQ CDS complement(45638..46042) product DNA utilization protein HofP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602548.1 transl_table 11 codon_start 1 locus_tag LOCUS_03000 gene hofP CDS complement(46035..46400) product DNA utilization protein HofO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000367372.1 transl_table 11 codon_start 1 locus_tag LOCUS_03010 gene hofO CDS complement(46474..47010) product DNA utilization protein HofN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001069323.1 transl_table 11 codon_start 1 locus_tag LOCUS_03020 gene hofN CDS complement(47010..47789) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000874746.1 transl_table 11 codon_start 1 locus_tag LOCUS_03030 CDS 47931..50462 product peptidoglycan glycosyltransferase/peptidoglycan DD-transpeptidase MrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021013215.1 transl_table 11 codon_start 1 locus_tag LOCUS_03040 gene mrcA CDS complement(50742..51302) product ADP compounds hydrolase NudE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045739.1 transl_table 11 codon_start 1 locus_tag LOCUS_03050 gene nudE CDS 51626..53758 product intracellular growth attenuator protein IgaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000104086.1 transl_table 11 codon_start 1 locus_tag LOCUS_03060 gene igaA CDS 53824..54492 product GMP/IMP nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001520508.1 transl_table 11 codon_start 1 locus_tag LOCUS_03070 gene yrfG CDS 54503..54904 product ribosome-associated heat shock protein Hsp15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000660483.1 transl_table 11 codon_start 1 locus_tag LOCUS_03080 gene hslR CDS 54929..55807 product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001775502.1 transl_table 11 codon_start 1 locus_tag LOCUS_03090 gene hslO CDS 56183..56608 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03100 note possible pseudo, internal stop codon CDS 56621..57802 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03110 note possible pseudo, internal stop codon CDS complement(57928..59271) product two-component system sensor histidine kinase EnvZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001253815.1 transl_table 11 codon_start 1 locus_tag LOCUS_03120 gene envZ CDS complement(59277..59996) product two-component system response regulator OmpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001157751.1 transl_table 11 codon_start 1 locus_tag LOCUS_03130 gene ompR CDS 60223..60696 product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000856744.1 transl_table 11 codon_start 1 locus_tag LOCUS_03140 gene greB CDS 60783..63101 product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000980674.1 transl_table 11 codon_start 1 locus_tag LOCUS_03150 CDS 63477..63704 product ferrous iron transporter A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001160955.1 transl_table 11 codon_start 1 locus_tag LOCUS_03160 gene feoA CDS 63723..66050 product Fe(2+) transporter permease subunit FeoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000736984.1 transl_table 11 codon_start 1 locus_tag LOCUS_03170 gene feoB CDS 66060..66296 product [Fe-S]-dependent transcriptional repressor FeoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295699.1 transl_table 11 codon_start 1 locus_tag LOCUS_03180 gene feoC CDS 66487..67428 product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000749985.1 transl_table 11 codon_start 1 locus_tag LOCUS_03190 CDS complement(67470..68240) product pimeloyl-ACP methyl ester esterase BioH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001060070.1 transl_table 11 codon_start 1 locus_tag LOCUS_03200 gene bioH CDS 68278..68961 product DNA utilization protein GntX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000958739.1 transl_table 11 codon_start 1 locus_tag LOCUS_03210 gene gntX CDS 69020..69595 product Fe-S biogenesis protein NfuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000619389.1 transl_table 11 codon_start 1 locus_tag LOCUS_03220 gene nfuA CDS 69984..71300 product gluconate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001131741.1 transl_table 11 codon_start 1 locus_tag LOCUS_03230 gene gntT CDS complement(71426..73513) product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444364.1 transl_table 11 codon_start 1 locus_tag LOCUS_03240 gene malQ CDS complement(73523..75916) product maltodextrin phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000082255.1 transl_table 11 codon_start 1 locus_tag LOCUS_03250 gene malP CDS 76301..76780 product Hcp family type VI secretion system effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001284200.1 transl_table 11 codon_start 1 locus_tag LOCUS_03260 CDS 76911..77675 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000908057.1 transl_table 11 codon_start 1 locus_tag LOCUS_03270 CDS 77685..78113 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03280 CDS 78489..81194 product HTH-type transcriptional regulator MalT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000907046.1 transl_table 11 codon_start 1 locus_tag LOCUS_03290 gene malT CDS complement(81238..81996) product DeoR/GlpR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000815087.1 transl_table 11 codon_start 1 locus_tag LOCUS_03300 CDS complement(82096..82926) product rhomboid family intramembrane serine protease GlpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000928731.1 transl_table 11 codon_start 1 locus_tag LOCUS_03310 gene glpG CDS complement(83002..83328) product thiosulfate sulfurtransferase GlpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000434523.1 transl_table 11 codon_start 1 locus_tag LOCUS_03320 gene glpE CDS 83526..85034 product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000448178.1 transl_table 11 codon_start 1 locus_tag LOCUS_03330 gene glpD CDS complement(85138..87585) product glycogen phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000993423.1 transl_table 11 codon_start 1 locus_tag LOCUS_03340 gene glgP CDS complement(87605..89038) product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001197646.1 transl_table 11 codon_start 1 locus_tag LOCUS_03350 gene glgA CDS complement(89038..90333) product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000253993.1 transl_table 11 codon_start 1 locus_tag LOCUS_03360 gene glgC CDS complement(90348..92324) product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000192508.1 transl_table 11 codon_start 1 locus_tag LOCUS_03370 gene glgX CDS complement(92321..94507) product 1,4-alpha-glucan branching enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001283726.1 transl_table 11 codon_start 1 locus_tag LOCUS_03380 gene glgB CDS complement(94872..95975) product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799956.1 transl_table 11 codon_start 1 locus_tag LOCUS_03390 gene asd CDS 96209..96760 product NAAT family transporter YhgN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001002544.1 transl_table 11 codon_start 1 locus_tag LOCUS_03400 gene yhgN CDS complement(97019..98284) product gluconate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105950.1 transl_table 11 codon_start 1 locus_tag LOCUS_03410 gene gntU CDS complement(98363..98851) product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000108330.1 transl_table 11 codon_start 1 locus_tag LOCUS_03420 gene gntK CDS complement(99030..99968) product gluconate operon transcriptional repressor GntR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000218790.1 transl_table 11 codon_start 1 locus_tag LOCUS_03430 gene gntR CDS complement(100118..100813) product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000639789.1 transl_table 11 codon_start 1 locus_tag LOCUS_03440 CDS complement(100937..101974) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000236293.1 transl_table 11 codon_start 1 locus_tag LOCUS_03450 CDS 102446..102934 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301731.1 transl_table 11 codon_start 1 locus_tag LOCUS_03460 gene yhhY CDS 103193..104401 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03470 CDS 104403..104708 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03480 CDS complement(104808..106403) product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000805086.1 transl_table 11 codon_start 1 locus_tag LOCUS_03490 gene ggt CDS 106673..107050 product DUF2756 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099122.1 transl_table 11 codon_start 1 locus_tag LOCUS_03500 CDS complement(107034..107780) product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000073603.1 transl_table 11 codon_start 1 locus_tag LOCUS_03510 gene ugpQ CDS complement(107777..108847) product sn-glycerol-3-phosphate import ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099124.1 transl_table 11 codon_start 1 locus_tag LOCUS_03520 CDS complement(108849..109694) product sn-glycerol-3-phosphate ABC transporter permease UgpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000572199.1 transl_table 11 codon_start 1 locus_tag LOCUS_03530 gene ugpE CDS complement(109691..110578) product sn-glycerol-3-phosphate ABC transporter permease UgpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099126.1 transl_table 11 codon_start 1 locus_tag LOCUS_03540 gene ugpA CDS complement(110679..111995) product sn-glycerol-3-phosphate ABC transporter substrate-binding protein UgpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028028113.1 transl_table 11 codon_start 1 locus_tag LOCUS_03550 gene ugpB CDS complement(112234..112602) product type II toxin-antitoxin system death-on-curing family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816307.1 transl_table 11 codon_start 1 locus_tag LOCUS_03560 CDS complement(112599..112820) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03570 CDS complement(112961..113674) product high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000416891.1 transl_table 11 codon_start 1 locus_tag LOCUS_03580 gene livF CDS complement(113676..114443) product high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369325.1 transl_table 11 codon_start 1 locus_tag LOCUS_03590 gene livG CDS complement(114440..115717) product branched chain amino acid ABC transporter permease LivM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000803784.1 transl_table 11 codon_start 1 locus_tag LOCUS_03600 gene livM CDS complement(115714..116640) product high-affinity branched-chain amino acid ABC transporter permease LivH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099131.1 transl_table 11 codon_start 1 locus_tag LOCUS_03610 gene livH CDS complement(116702..117826) product high-affinity branched-chain amino acid ABC transporter substrate-binding protein LivK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000822976.1 transl_table 11 codon_start 1 locus_tag LOCUS_03620 gene livK CDS 118228..118620 product aspartate 1-decarboxylase autocleavage activator PanM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000778873.1 transl_table 11 codon_start 1 locus_tag LOCUS_03630 gene panM CDS complement(118711..119808) product branched chain amino acid ABC transporter substrate-binding protein LivJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001021996.1 transl_table 11 codon_start 1 locus_tag LOCUS_03640 gene livJ CDS complement(120067..121269) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105913.1 transl_table 11 codon_start 1 locus_tag LOCUS_03650 CDS complement(121410..122675) product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099137.1 transl_table 11 codon_start 1 locus_tag LOCUS_03660 CDS 122794..124287 product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005066896.1 transl_table 11 codon_start 1 locus_tag LOCUS_03670 CDS complement(124394..125248) product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000159621.1 transl_table 11 codon_start 1 locus_tag LOCUS_03680 gene rpoH CDS complement(125505..126563) product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001042003.1 transl_table 11 codon_start 1 locus_tag LOCUS_03690 gene ftsX CDS complement(126556..127224) product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000617729.1 transl_table 11 codon_start 1 locus_tag LOCUS_03700 gene ftsE CDS complement(127227..128711) product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118701.1 transl_table 11 codon_start 1 locus_tag LOCUS_03710 gene ftsY CDS 128836..129411 product 16S rRNA (guanine(966)-N(2))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000743275.1 transl_table 11 codon_start 1 locus_tag LOCUS_03720 gene rsmD CDS 129422..129691 product DUF1145 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295207.1 transl_table 11 codon_start 1 locus_tag LOCUS_03730 CDS complement(129713..130075) product DUF2500 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000042855.1 transl_table 11 codon_start 1 locus_tag LOCUS_03740 CDS 130217..130843 product lysoplasmalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000964735.1 transl_table 11 codon_start 1 locus_tag LOCUS_03750 CDS 130920..133118 product Zn(II)/Cd(II)/Pb(II) translocating P-type ATPase ZntA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000106671.1 transl_table 11 codon_start 1 locus_tag LOCUS_03760 gene zntA CDS complement(133308..134594) product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099149.1 transl_table 11 codon_start 1 locus_tag LOCUS_03770 CDS complement(134605..135114) product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099148.1 transl_table 11 codon_start 1 locus_tag LOCUS_03780 CDS complement(135138..136109) product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099147.1 transl_table 11 codon_start 1 locus_tag LOCUS_03790 CDS complement(136301..136552) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000156431.1 transl_table 11 codon_start 1 locus_tag LOCUS_03800 CDS complement(136536..137684) product type VI secretion system tube protein TssD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001280050.1 transl_table 11 codon_start 1 locus_tag LOCUS_03810 gene tssD CDS complement(138118..138360) product sulfurtransferase TusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001541054.1 transl_table 11 codon_start 1 locus_tag LOCUS_03820 gene tusA CDS 138619..139284 product 7-cyano-7-deazaguanine/7-aminomethyl-7-deazaguanine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001100467.1 transl_table 11 codon_start 1 locus_tag LOCUS_03830 CDS 139357..139914 product DcrB family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099152.1 transl_table 11 codon_start 1 locus_tag LOCUS_03840 CDS complement(139904..141136) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000240225.1 transl_table 11 codon_start 1 locus_tag LOCUS_03850 CDS 141270..142319 product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300885.1 transl_table 11 codon_start 1 locus_tag LOCUS_03860 CDS 142681..143070 product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301470.1 transl_table 11 codon_start 1 locus_tag LOCUS_03870 CDS 143148..144209 product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000273200.1 transl_table 11 codon_start 1 locus_tag LOCUS_03880 CDS 144264..144986 product beta-ketoacyl synthase chain length factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301843.1 transl_table 11 codon_start 1 locus_tag LOCUS_03890 CDS 144983..145804 product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001302735.1 transl_table 11 codon_start 1 locus_tag LOCUS_03900 CDS 145776..146036 product phosphopantetheine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001148684.1 transl_table 11 codon_start 1 locus_tag LOCUS_03910 CDS 146048..146299 product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000139646.1 transl_table 11 codon_start 1 locus_tag LOCUS_03920 CDS 146305..146886 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000014366.1 transl_table 11 codon_start 1 locus_tag LOCUS_03930 CDS 146883..148244 product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000815059.1 transl_table 11 codon_start 1 locus_tag LOCUS_03940 CDS 148231..148584 product beta-hydroxyacyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002431781.1 transl_table 11 codon_start 1 locus_tag LOCUS_03950 CDS 148575..150266 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703719.1 transl_table 11 codon_start 1 locus_tag LOCUS_03960 CDS 150270..150692 product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369298.1 transl_table 11 codon_start 1 locus_tag LOCUS_03970 CDS 150689..151294 product outer membrane lipoprotein carrier protein LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000670562.1 transl_table 11 codon_start 1 locus_tag LOCUS_03980 CDS 151263..153581 product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703721.1 transl_table 11 codon_start 1 locus_tag LOCUS_03990 CDS 153644..154201 product DUF3261 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000597700.1 transl_table 11 codon_start 1 locus_tag LOCUS_04000 CDS 154203..155372 product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703723.1 transl_table 11 codon_start 1 locus_tag LOCUS_04010 CDS 155369..155845 product 3-hydroxy-fatty acyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020249.1 transl_table 11 codon_start 1 locus_tag LOCUS_04020 CDS 155842..156573 product 3-ketoacyl-ACP reductase FabG2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091664.1 transl_table 11 codon_start 1 locus_tag LOCUS_04030 CDS 156570..157799 product beta-ketoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000198472.1 transl_table 11 codon_start 1 locus_tag LOCUS_04040 CDS 157801..158385 product 4'-phosphopantetheinyl transferase AcpT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000285765.1 transl_table 11 codon_start 1 locus_tag LOCUS_04050 gene acpT CDS complement(158382..158888) product phenolic acid decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099178.1 transl_table 11 codon_start 1 locus_tag LOCUS_04060 CDS 158988..159848 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703733.1 transl_table 11 codon_start 1 locus_tag LOCUS_04070 CDS 159979..161550 product nickel ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000953364.1 transl_table 11 codon_start 1 locus_tag LOCUS_04080 gene nikA CDS 161550..162494 product nickel ABC transporter permease subunit NikB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000947084.1 transl_table 11 codon_start 1 locus_tag LOCUS_04090 gene nikB CDS 162491..163324 product nickel ABC transporter permease subunit NikC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001008954.1 transl_table 11 codon_start 1 locus_tag LOCUS_04100 gene nikC CDS 163324..164088 product nickel import ATP-binding protein NikD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001136210.1 transl_table 11 codon_start 1 locus_tag LOCUS_04110 gene nikD CDS 164085..164885 product nickel import ATP-binding protein NikE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000173631.1 transl_table 11 codon_start 1 locus_tag LOCUS_04120 gene nikE CDS 164898..165299 product nickel-responsive transcriptional regulator NikR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001190057.1 transl_table 11 codon_start 1 locus_tag LOCUS_04130 gene nikR CDS complement(165592..165951) product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703740.1 transl_table 11 codon_start 1 locus_tag LOCUS_04140 CDS complement(165948..166223) product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703741.1 transl_table 11 codon_start 1 locus_tag LOCUS_04150 CDS 166691..167644 product hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250916.1 transl_table 11 codon_start 1 locus_tag LOCUS_04160 CDS 167655..168353 product RraA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368484.1 transl_table 11 codon_start 1 locus_tag LOCUS_04170 CDS 168419..169813 product anion permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001036475.1 transl_table 11 codon_start 1 locus_tag LOCUS_04180 CDS 169826..170989 product metallo-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000977198.1 transl_table 11 codon_start 1 locus_tag LOCUS_04190 CDS 171074..172957 product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861721.1 transl_table 11 codon_start 1 locus_tag LOCUS_04200 CDS complement(173118..174398) product DUF1996 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000773796.1 transl_table 11 codon_start 1 locus_tag LOCUS_04210 CDS complement(174511..175707) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000439232.1 transl_table 11 codon_start 1 locus_tag LOCUS_04220 CDS 175938..177437 product inorganic phosphate transporter PitA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000902764.1 transl_table 11 codon_start 1 locus_tag LOCUS_04230 gene pitA CDS complement(177560..177895) product universal stress protein UspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626193.1 transl_table 11 codon_start 1 locus_tag LOCUS_04240 gene uspB CDS 178296..178730 product universal stress protein UspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323571.1 transl_table 11 codon_start 1 locus_tag LOCUS_04250 gene uspA CDS 179038..180309 product dipeptide/tripeptide permease DtpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703744.1 transl_table 11 codon_start 1 locus_tag LOCUS_04260 gene dtpB CDS 180337..180510 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04270 note possible pseudo, internal stop codon CDS 180690..180845 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04280 note possible pseudo, internal stop codon CDS complement(181026..181775) product 16S rRNA (guanine(1516)-N(2))-methyltransferase RsmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686608.1 transl_table 11 codon_start 1 locus_tag LOCUS_04290 gene rsmJ CDS complement(181772..183814) product oligopeptidase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001337565.1 transl_table 11 codon_start 1 locus_tag LOCUS_04300 gene prlC CDS 184029..184871 product 23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954235.1 transl_table 11 codon_start 1 locus_tag LOCUS_04310 CDS 184943..186295 product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000160795.1 transl_table 11 codon_start 1 locus_tag LOCUS_04320 gene gorA CDS complement(186345..187388) product asparaginase AnsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246337.1 transl_table 11 codon_start 1 locus_tag LOCUS_04330 gene ansZ CDS complement(187442..188761) product anaerobic C4-dicarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000498698.1 transl_table 11 codon_start 1 locus_tag LOCUS_04340 CDS complement(188813..189661) product fructoselysine 6-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966764.1 transl_table 11 codon_start 1 locus_tag LOCUS_04350 CDS complement(189725..190699) product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966767.1 transl_table 11 codon_start 1 locus_tag LOCUS_04360 CDS complement(190877..191596) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000572570.1 transl_table 11 codon_start 1 locus_tag LOCUS_04370 CDS complement(191759..193267) product cytochrome c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000784837.1 transl_table 11 codon_start 1 locus_tag LOCUS_04380 gene ccp CDS 193573..195222 product alpha,alpha-trehalase TreF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000934251.1 transl_table 11 codon_start 1 locus_tag LOCUS_04390 gene treF CDS complement(195271..195684) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04400 CDS complement(195693..196640) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04410 CDS complement(196965..197564) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001167660.1 transl_table 11 codon_start 1 locus_tag LOCUS_04420 CDS complement(197787..198011) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04430 CDS 198517..199416 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369250.1 transl_table 11 codon_start 1 locus_tag LOCUS_04440 CDS 199467..200498 product inner membrane protein YhjD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000191231.1 transl_table 11 codon_start 1 locus_tag LOCUS_04450 gene yhjD CDS 200901..202223 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001148985.1 transl_table 11 codon_start 1 locus_tag LOCUS_04460 CDS complement(202271..204325) product AsmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296794.1 transl_table 11 codon_start 1 locus_tag LOCUS_04470 CDS complement(204403..205170) product cyclic-guanylate-specific phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000595629.1 transl_table 11 codon_start 1 locus_tag LOCUS_04480 gene pdeH CDS 205398..206327 product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037582.1 transl_table 11 codon_start 1 locus_tag LOCUS_04490 CDS complement(206381..207880) product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001163136.1 transl_table 11 codon_start 1 locus_tag LOCUS_04500 CDS complement(208101..209387) product C4-dicarboxylate transporter DctC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000858232.1 transl_table 11 codon_start 1 locus_tag LOCUS_04510 gene dctA CDS complement(209554..211512) product biofilm formation regulator HmsP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014344205.1 transl_table 11 codon_start 1 locus_tag LOCUS_04520 gene hmsP CDS complement(211721..215233) product cellulose synthase complex outer membrane protein BcsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001225139.1 transl_table 11 codon_start 1 locus_tag LOCUS_04530 gene bcsC CDS complement(215431..216540) product cellulose synthase complex periplasmic endoglucanase BcsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001304954.1 transl_table 11 codon_start 1 locus_tag LOCUS_04540 gene bcsZ CDS complement(216544..218895) product cellulose biosynthesis cyclic di-GMP-binding regulatory protein BcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001307454.1 transl_table 11 codon_start 1 locus_tag LOCUS_04550 gene bcsB CDS complement(218906..221527) product UDP-forming cellulose synthase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001275344.1 transl_table 11 codon_start 1 locus_tag LOCUS_04560 gene bcsA CDS complement(221524..222291) product cellulose biosynthesis protein BcsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000279528.1 transl_table 11 codon_start 1 locus_tag LOCUS_04570 gene bcsQ CDS complement(222303..222491) product cellulose biosynthesis protein BcsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099220.1 transl_table 11 codon_start 1 locus_tag LOCUS_04580 gene bcsR CDS 222778..224337 product cellulose biosynthesis c-di-GMP-binding protein BcsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001204931.1 transl_table 11 codon_start 1 locus_tag LOCUS_04590 gene bcsE CDS 224334..224525 product cellulose biosynthesis protein BcsF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000988308.1 transl_table 11 codon_start 1 locus_tag LOCUS_04600 gene bcsF CDS 224522..226201 product cellulose biosynthesis protein BcsG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000191563.1 transl_table 11 codon_start 1 locus_tag LOCUS_04610 gene bcsG CDS 226744..228039 product aromatic amino acid transport family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295225.1 transl_table 11 codon_start 1 locus_tag LOCUS_04620 CDS complement(228133..229146) product dipeptide ABC transporter ATP-binding subunit DppF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000103568.1 transl_table 11 codon_start 1 locus_tag LOCUS_04630 gene dppF CDS complement(229143..230126) product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196507.1 transl_table 11 codon_start 1 locus_tag LOCUS_04640 gene dppD CDS complement(230137..231039) product dipeptide ABC transporter permease DppC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020684504.1 transl_table 11 codon_start 1 locus_tag LOCUS_04650 gene dppC CDS complement(231049..232068) product dipeptide ABC transporter permease DppB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000938843.1 transl_table 11 codon_start 1 locus_tag LOCUS_04660 gene dppB CDS complement(232244..233824) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038418419.1 transl_table 11 codon_start 1 locus_tag LOCUS_04670 tRNA complement(234716..234792) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00030 CDS complement(234883..236574) product kdo(2)-lipid A phosphoethanolamine 7''-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069557.1 transl_table 11 codon_start 1 locus_tag LOCUS_04680 gene eptB sequence003 source 1..143900 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(50..1240) product NO-inducible flavohemoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000883143.1 transl_table 11 codon_start 1 locus_tag LOCUS_04690 gene hmpA CDS 1566..2825 product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000919149.1 transl_table 11 codon_start 1 locus_tag LOCUS_04700 gene glyA CDS complement(2950..4146) product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001200769.1 transl_table 11 codon_start 1 locus_tag LOCUS_04710 CDS 4260..7526 product DUF5107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050717203.1 transl_table 11 codon_start 1 locus_tag LOCUS_04720 CDS 7598..9037 product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202206.1 transl_table 11 codon_start 1 locus_tag LOCUS_04730 CDS 9031..9876 product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266699.1 transl_table 11 codon_start 1 locus_tag LOCUS_04740 CDS 9965..11104 product 3-phenylpropionate MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173729.1 transl_table 11 codon_start 1 locus_tag LOCUS_04750 CDS complement(11096..12376) product stationary phase inducible protein CsiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000982954.1 transl_table 11 codon_start 1 locus_tag LOCUS_04760 gene csiE CDS complement(12598..13197) product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210048.1 transl_table 11 codon_start 1 locus_tag LOCUS_04770 CDS complement(13194..14831) product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210047.1 transl_table 11 codon_start 1 locus_tag LOCUS_04780 CDS complement(14848..15801) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210046.1 transl_table 11 codon_start 1 locus_tag LOCUS_04790 CDS complement(15803..16792) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210045.1 transl_table 11 codon_start 1 locus_tag LOCUS_04800 CDS complement(16785..18293) product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210044.1 transl_table 11 codon_start 1 locus_tag LOCUS_04810 CDS complement(18399..19382) product autoinducer 2 ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210043.1 transl_table 11 codon_start 1 locus_tag LOCUS_04820 CDS 19794..20432 product DUF1007 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098298.1 transl_table 11 codon_start 1 locus_tag LOCUS_04830 CDS 20423..21403 product nickel/cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098297.1 transl_table 11 codon_start 1 locus_tag LOCUS_04840 CDS complement(21495..22298) product inositol-1-monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098296.1 transl_table 11 codon_start 1 locus_tag LOCUS_04850 gene suhB CDS 22417..23151 product tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940032.1 transl_table 11 codon_start 1 locus_tag LOCUS_04860 gene trmJ CDS 23335..23826 product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001241346.1 transl_table 11 codon_start 1 locus_tag LOCUS_04870 gene iscR CDS 23940..25154 product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703173.1 transl_table 11 codon_start 1 locus_tag LOCUS_04880 gene iscS CDS 25180..25566 product Fe-S cluster assembly scaffold IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860661.1 transl_table 11 codon_start 1 locus_tag LOCUS_04890 gene iscU CDS 25586..25909 product iron-sulfur cluster assembly protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000028952.1 transl_table 11 codon_start 1 locus_tag LOCUS_04900 gene iscA CDS 26107..26622 product co-chaperone HscB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000384411.1 transl_table 11 codon_start 1 locus_tag LOCUS_04910 gene hscB CDS 26638..28488 product Fe-S protein assembly chaperone HscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196613.1 transl_table 11 codon_start 1 locus_tag LOCUS_04920 gene hscA CDS 28490..28825 product ISC system 2Fe-2S type ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001124471.1 transl_table 11 codon_start 1 locus_tag LOCUS_04930 gene fdx CDS 28837..29037 product Fe-S cluster assembly protein IscX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000523616.1 transl_table 11 codon_start 1 locus_tag LOCUS_04940 gene iscX CDS 29090..30373 product aminopeptidase PepB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000133543.1 transl_table 11 codon_start 1 locus_tag LOCUS_04950 gene pepB CDS 30478..31254 product enhanced serine sensitivity protein SseB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001337650.1 transl_table 11 codon_start 1 locus_tag LOCUS_04960 gene sseB CDS complement(31491..32342) product 3-mercaptopyruvate sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000108626.1 transl_table 11 codon_start 1 locus_tag LOCUS_04970 gene sseA CDS 32552..37504 product alpha2-macroglobulin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000736368.1 transl_table 11 codon_start 1 locus_tag LOCUS_04980 gene yfhM CDS 37505..39073 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04990 note possible pseudo, frameshifted CDS 39172..39807 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05000 note possible pseudo, frameshifted CDS 39975..40406 product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000963846.1 transl_table 11 codon_start 1 locus_tag LOCUS_05010 gene ndk CDS 40568..41734 product bifunctional tRNA (adenosine(37)-C2)-methyltransferase TrmG/ribosomal RNA large subunit methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098279.1 transl_table 11 codon_start 1 locus_tag LOCUS_05020 CDS 42023..43021 product cytoskeleton protein RodZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001090905.1 transl_table 11 codon_start 1 locus_tag LOCUS_05030 gene rodZ CDS 43048..44166 product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098277.1 transl_table 11 codon_start 1 locus_tag LOCUS_05040 gene ispG CDS 44277..45551 product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107147.1 transl_table 11 codon_start 1 locus_tag LOCUS_05050 gene hisS CDS 45565..46185 product ancillary SecYEG translocon subunit YfgM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000409195.1 transl_table 11 codon_start 1 locus_tag LOCUS_05060 gene yfgM CDS 46196..47374 product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001177033.1 transl_table 11 codon_start 1 locus_tag LOCUS_05070 gene bamB CDS 47493..48965 product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000249413.1 transl_table 11 codon_start 1 locus_tag LOCUS_05080 gene der CDS 49018..49239 product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000402503.1 transl_table 11 codon_start 1 locus_tag LOCUS_05090 CDS complement(49236..49586) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098269.1 transl_table 11 codon_start 1 locus_tag LOCUS_05100 CDS complement(49587..50606) product M4 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098268.1 transl_table 11 codon_start 1 locus_tag LOCUS_05110 CDS complement(50670..52043) product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000953156.1 transl_table 11 codon_start 1 locus_tag LOCUS_05120 gene xseA CDS 52204..53670 product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296289.1 transl_table 11 codon_start 1 locus_tag LOCUS_05130 gene guaB CDS 53731..55308 product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098264.1 transl_table 11 codon_start 1 locus_tag LOCUS_05140 gene guaA CDS complement(55612..55914) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05150 CDS 56226..58394 product sensor domain-containing phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000773655.1 transl_table 11 codon_start 1 locus_tag LOCUS_05160 CDS complement(58402..59943) product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001121364.1 transl_table 11 codon_start 1 locus_tag LOCUS_05170 gene ppx CDS complement(59948..62014) product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000529558.1 transl_table 11 codon_start 1 locus_tag LOCUS_05180 gene ppk1 CDS complement(62189..62830) product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001028612.1 transl_table 11 codon_start 1 locus_tag LOCUS_05190 gene purN CDS complement(62830..64008) product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295474.1 transl_table 11 codon_start 1 locus_tag LOCUS_05200 gene purM CDS 64134..64760 product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000706208.1 transl_table 11 codon_start 1 locus_tag LOCUS_05210 gene upp CDS 64856..66145 product uracil permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000198341.1 transl_table 11 codon_start 1 locus_tag LOCUS_05220 gene uraA CDS 66195..66941 product DnaA inactivator Hda inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000247065.1 transl_table 11 codon_start 1 locus_tag LOCUS_05230 CDS complement(66919..67125) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05240 CDS complement(67233..67853) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05250 note possible pseudo, internal stop codon, frameshifted CDS complement(67998..68357) product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000166449.1 transl_table 11 codon_start 1 locus_tag LOCUS_05260 gene arsC CDS complement(68398..69861) product beta-barrel assembly-enhancing protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000489667.1 transl_table 11 codon_start 1 locus_tag LOCUS_05270 gene bepA CDS 70085..71149 product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000892044.1 transl_table 11 codon_start 1 locus_tag LOCUS_05280 CDS 71305..71976 product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095262.1 transl_table 11 codon_start 1 locus_tag LOCUS_05290 CDS 71978..72439 product YjiG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038418507.1 transl_table 11 codon_start 1 locus_tag LOCUS_05300 CDS 72451..73614 product beta-aspartyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000568414.1 transl_table 11 codon_start 1 locus_tag LOCUS_05310 gene iadA CDS complement(73698..74168) product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068682.1 transl_table 11 codon_start 1 locus_tag LOCUS_05320 gene bcp CDS complement(74168..74740) product glycine cleavage system transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000176187.1 transl_table 11 codon_start 1 locus_tag LOCUS_05330 CDS 74886..75764 product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000494019.1 transl_table 11 codon_start 1 locus_tag LOCUS_05340 gene dapA CDS 75781..76815 product outer membrane protein assembly factor BamC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331881.1 transl_table 11 codon_start 1 locus_tag LOCUS_05350 gene bamC CDS 77006..77719 product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295467.1 transl_table 11 codon_start 1 locus_tag LOCUS_05360 gene purC CDS 77848..78714 product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001267503.1 transl_table 11 codon_start 1 locus_tag LOCUS_05370 CDS 78729..80738 product tRNA cytosine(34) acetyltransferase TmcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829314.1 transl_table 11 codon_start 1 locus_tag LOCUS_05380 gene tmcA CDS 80812..81510 product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000679812.1 transl_table 11 codon_start 1 locus_tag LOCUS_05390 gene ypfH CDS complement(81592..81792) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05400 CDS complement(81819..82946) product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001277830.1 transl_table 11 codon_start 1 locus_tag LOCUS_05410 gene dapE CDS complement(82950..83306) product ArsC family reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000258247.1 transl_table 11 codon_start 1 locus_tag LOCUS_05420 CDS complement(83853..85628) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05430 note possible pseudo, internal stop codon CDS complement(85650..87020) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05440 note possible pseudo, internal stop codon CDS complement(87139..88845) product nitrate/nitrite two-component system sensor histidine kinase NarQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309642.1 transl_table 11 codon_start 1 locus_tag LOCUS_05450 gene narQ CDS 89051..91009 product formate-dependent uric acid utilization protein AegA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078843.1 transl_table 11 codon_start 1 locus_tag LOCUS_05460 gene aegA CDS 91404..91979 product GDP-mannose pyrophosphatase NudK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001330582.1 transl_table 11 codon_start 1 locus_tag LOCUS_05470 gene nudK CDS 92106..93146 product DUF1176 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001270537.1 transl_table 11 codon_start 1 locus_tag LOCUS_05480 CDS complement(93197..95191) product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000087345.1 transl_table 11 codon_start 1 locus_tag LOCUS_05490 gene tkt CDS complement(95211..96161) product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001072436.1 transl_table 11 codon_start 1 locus_tag LOCUS_05500 gene tal CDS 96438..98717 product NADP-dependent oxaloacetate-decarboxylating malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000344299.1 transl_table 11 codon_start 1 locus_tag LOCUS_05510 gene maeB CDS 98878..99213 product ethanolamine utilization microcompartment protein EutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001031444.1 transl_table 11 codon_start 1 locus_tag LOCUS_05520 gene eutS CDS 99226..99705 product ethanolamine utilization acetate kinase EutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000820751.1 transl_table 11 codon_start 1 locus_tag LOCUS_05530 gene eutP CDS 99683..100372 product ethanolamine utilization acetate kinase EutQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000733871.1 transl_table 11 codon_start 1 locus_tag LOCUS_05540 gene eutQ CDS 100369..101172 product ethanolamine utilization cob(I)yrinic acid a,c-diamide adenosyltransferase EutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651289.1 transl_table 11 codon_start 1 locus_tag LOCUS_05550 gene eutT CDS 101169..102185 product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000582913.1 transl_table 11 codon_start 1 locus_tag LOCUS_05560 gene pta CDS 102221..102511 product ethanolamine utilization microcompartment protein EutM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000387713.1 transl_table 11 codon_start 1 locus_tag LOCUS_05570 gene eutM CDS 102621..102908 product ethanolamine utilization microcompartment protein EutN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001522340.1 transl_table 11 codon_start 1 locus_tag LOCUS_05580 gene eutN CDS 102920..104323 product aldehyde dehydrogenase EutE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001075647.1 transl_table 11 codon_start 1 locus_tag LOCUS_05590 CDS 104334..105173 product ethanolamine utilization protein EutJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000929675.1 transl_table 11 codon_start 1 locus_tag LOCUS_05600 gene eutJ CDS 105163..106350 product ethanolamine utilization ethanol dehydrogenase EutG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001147519.1 transl_table 11 codon_start 1 locus_tag LOCUS_05610 gene eutG CDS 106390..107616 product ethanolamine utilization protein EutH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000512370.1 transl_table 11 codon_start 1 locus_tag LOCUS_05620 gene eutH CDS 107613..109016 product ethanolamine ammonia-lyase reactivating factor EutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001097523.1 transl_table 11 codon_start 1 locus_tag LOCUS_05630 gene eutA CDS 109028..110389 product ethanolamine ammonia-lyase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000769994.1 transl_table 11 codon_start 1 locus_tag LOCUS_05640 gene eutB CDS 110410..111306 product ethanolamine ammonia-lyase subunit EutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000372351.1 transl_table 11 codon_start 1 locus_tag LOCUS_05650 gene eutC CDS 111316..111975 product ethanolamine utilization microcompartment protein EutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001111056.1 transl_table 11 codon_start 1 locus_tag LOCUS_05660 gene eutL CDS 111988..112485 product ethanolamine utilization microcompartment protein EutK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000606260.1 transl_table 11 codon_start 1 locus_tag LOCUS_05670 gene eutK CDS 112533..113585 product HTH-type transcriptional regulator EutR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000753659.1 transl_table 11 codon_start 1 locus_tag LOCUS_05680 gene eutR CDS complement(113900..114799) product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000801336.1 transl_table 11 codon_start 1 locus_tag LOCUS_05690 gene hemF CDS complement(114802..115671) product N-acetylmuramoyl-L-alanine amidase AmiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000102891.1 transl_table 11 codon_start 1 locus_tag LOCUS_05700 gene amiA CDS 115885..116310 product GNAT family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098209.1 transl_table 11 codon_start 1 locus_tag LOCUS_05710 CDS 116297..116746 product DUF2919 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300381.1 transl_table 11 codon_start 1 locus_tag LOCUS_05720 CDS 116806..117381 product RpoE-regulated lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000838944.1 transl_table 11 codon_start 1 locus_tag LOCUS_05730 CDS 117477..118376 product porphyrinogen peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084583.1 transl_table 11 codon_start 1 locus_tag LOCUS_05740 gene yfeX CDS 118613..119404 product SDR family oxidoreductase UcpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000517460.1 transl_table 11 codon_start 1 locus_tag LOCUS_05750 gene ucpA CDS 119557..120573 product thiosulfate/sulfate ABC transporter substrate-binding protein CysP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000290222.1 transl_table 11 codon_start 1 locus_tag LOCUS_05760 gene cysP CDS 120573..121406 product sulfate/thiosulfate ABC transporter permease CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000881746.1 transl_table 11 codon_start 1 locus_tag LOCUS_05770 gene cysT CDS 121406..122281 product sulfate/thiosulfate ABC transporter permease CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000852703.1 transl_table 11 codon_start 1 locus_tag LOCUS_05780 gene cysW CDS 122271..123368 product sulfate/thiosulfate ABC transporter ATP-binding protein CysA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000021036.1 transl_table 11 codon_start 1 locus_tag LOCUS_05790 gene cysA CDS 123436..124347 product cysteine synthase CysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001093881.1 transl_table 11 codon_start 1 locus_tag LOCUS_05800 gene cysM CDS complement(124388..126223) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05810 CDS complement(126243..127958) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05820 CDS complement(128452..129150) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05830 note possible pseudo, frameshifted CDS complement(129120..129743) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05840 note possible pseudo, frameshifted CDS 129826..130686 product pyridoxine/pyridoxal/pyridoxamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000529606.1 transl_table 11 codon_start 1 locus_tag LOCUS_05850 gene pdxK CDS complement(130853..131362) product PTS glucose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000522253.1 transl_table 11 codon_start 1 locus_tag LOCUS_05860 gene crr CDS complement(131403..133130) product phosphoenolpyruvate-protein phosphotransferase PtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000623136.1 transl_table 11 codon_start 1 locus_tag LOCUS_05870 gene ptsI CDS complement(133177..133434) product phosphocarrier protein Hpr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000487600.1 transl_table 11 codon_start 1 locus_tag LOCUS_05880 gene ptsH CDS complement(133816..134787) product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013878168.1 transl_table 11 codon_start 1 locus_tag LOCUS_05890 gene cysK CDS complement(134951..135712) product sulfate transporter CysZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000255008.1 transl_table 11 codon_start 1 locus_tag LOCUS_05900 gene cysZ CDS 135943..136938 product cell division protein ZipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000983126.1 transl_table 11 codon_start 1 locus_tag LOCUS_05910 gene zipA CDS 137010..139025 product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000443681.1 transl_table 11 codon_start 1 locus_tag LOCUS_05920 gene ligA CDS 139027..139245 product DUF3820 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000410201.1 transl_table 11 codon_start 1 locus_tag LOCUS_05930 CDS complement(139242..140240) product bile acid:sodium symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000765569.1 transl_table 11 codon_start 1 locus_tag LOCUS_05940 CDS 140330..141256 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001109834.1 transl_table 11 codon_start 1 locus_tag LOCUS_05950 CDS 141670..142233 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05960 CDS complement(143463..143900) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05970 sequence004 source 1..134508 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 136..1185 product thiosulfate utilization transporter TsuA/YeeE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000492324.1 transl_table 11 codon_start 1 locus_tag LOCUS_05980 gene tsuA CDS 1201..1428 product thiosulfate utilization sulfurtransferase TsuB/YeeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000985273.1 transl_table 11 codon_start 1 locus_tag LOCUS_05990 gene tsuB CDS complement(1465..2889) product exodeoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000980584.1 transl_table 11 codon_start 1 locus_tag LOCUS_06000 gene sbcB CDS 3253..4302 product serine-type D-Ala-D-Ala carboxypeptidase DacD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097838.1 transl_table 11 codon_start 1 locus_tag LOCUS_06010 gene dacD CDS 4424..4897 product DNA gyrase inhibitor SbmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001105393.1 transl_table 11 codon_start 1 locus_tag LOCUS_06020 gene sbmC CDS 5025..5606 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06030 note possible pseudo, frameshifted CDS 5660..6082 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06040 note possible pseudo, frameshifted CDS 6243..6578 product DUF496 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010432067.1 transl_table 11 codon_start 1 locus_tag LOCUS_06050 CDS complement(6608..7474) product L-threonine kinase PduX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001201312.1 transl_table 11 codon_start 1 locus_tag LOCUS_06060 CDS complement(7565..8776) product propanediol utilization propionate kinase PduW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000120652.1 transl_table 11 codon_start 1 locus_tag LOCUS_06070 gene pduW CDS complement(8761..9213) product propanediol utilization protein PduV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000826280.1 transl_table 11 codon_start 1 locus_tag LOCUS_06080 gene pduV CDS complement(9218..9568) product propanediol utilization microcompartment protein PduU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000441103.1 transl_table 11 codon_start 1 locus_tag LOCUS_06090 gene pduU CDS complement(9568..10122) product propanediol utilization microcompartment protein PduT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000075775.1 transl_table 11 codon_start 1 locus_tag LOCUS_06100 gene pduT CDS complement(10125..11480) product cobalamin reductase PduS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000058762.1 transl_table 11 codon_start 1 locus_tag LOCUS_06110 gene pduS CDS complement(11477..12589) product 1-propanol dehydrogenase PduQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001091440.1 transl_table 11 codon_start 1 locus_tag LOCUS_06120 CDS complement(12600..13985) product CoA-acylating propionaldehyde dehydrogenase PduP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001097666.1 transl_table 11 codon_start 1 locus_tag LOCUS_06130 gene pduP CDS complement(13982..14989) product two-domain cob(I)yrinic acid a,c-diamide adenosyltransferase PduO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001029486.1 transl_table 11 codon_start 1 locus_tag LOCUS_06140 gene pduO CDS complement(14999..15274) product propanediol utilization microcompartment protein PduN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000549827.1 transl_table 11 codon_start 1 locus_tag LOCUS_06150 gene pduN CDS complement(15278..15769) product propanediol utilization microcompartment protein PduM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012961.1 transl_table 11 codon_start 1 locus_tag LOCUS_06160 gene pduM CDS complement(15766..16398) product phosphate propanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000356724.1 transl_table 11 codon_start 1 locus_tag LOCUS_06170 CDS complement(16404..16865) product propanediol utilization microcompartment protein PduK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001284376.1 transl_table 11 codon_start 1 locus_tag LOCUS_06180 gene pduK CDS complement(16889..17164) product propanediol utilization microcompartment protein PduJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001057752.1 transl_table 11 codon_start 1 locus_tag LOCUS_06190 gene pduJ CDS complement(17184..17534) product propanediol dehydratase reactivase beta subunit PduH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000377971.1 transl_table 11 codon_start 1 locus_tag LOCUS_06200 gene pduH CDS complement(17524..19356) product propanediol dehydratase reactivase alpha subunit PduG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001268875.1 transl_table 11 codon_start 1 locus_tag LOCUS_06210 gene pduG CDS complement(19372..19893) product propanediol dehydratase small subunit PduE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001090601.1 transl_table 11 codon_start 1 locus_tag LOCUS_06220 gene pduE CDS complement(19907..20575) product propanediol dehydratase medium subunit PduD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000405054.1 transl_table 11 codon_start 1 locus_tag LOCUS_06230 gene pduD CDS complement(20586..22250) product propanediol dehydratase large subunit PduC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001256897.1 transl_table 11 codon_start 1 locus_tag LOCUS_06240 gene pduC CDS complement(22269..23081) product propanediol utilization microcompartment protein PduB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000097484.1 transl_table 11 codon_start 1 locus_tag LOCUS_06250 gene pduB CDS complement(23078..23362) product propanediol utilization microcompartment protein PduA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001183614.1 transl_table 11 codon_start 1 locus_tag LOCUS_06260 gene pduA CDS 23883..24698 product propanediol diffusion facilitator PduF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001000027.1 transl_table 11 codon_start 1 locus_tag LOCUS_06270 gene pduF CDS 24897..25814 product regulatory protein PocR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000622044.1 transl_table 11 codon_start 1 locus_tag LOCUS_06280 gene pocR CDS 26471..27595 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06290 note possible pseudo, frameshifted CDS 27483..27851 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06300 note possible pseudo, frameshifted CDS 27848..28807 product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153666.1 transl_table 11 codon_start 1 locus_tag LOCUS_06310 gene cbiB CDS 28819..29451 product cobalt-precorrin-8 methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816687.1 transl_table 11 codon_start 1 locus_tag LOCUS_06320 CDS 29448..30587 product cobalt-precorrin-5B (C(1))-methyltransferase CbiD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292925.1 transl_table 11 codon_start 1 locus_tag LOCUS_06330 gene cbiD CDS 30581..31186 product cobalt-precorrin-7 (C(5))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000958833.1 transl_table 11 codon_start 1 locus_tag LOCUS_06340 CDS 31176..31730 product decarboxylating cobalt-precorrin-6B (C(15))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000650991.1 transl_table 11 codon_start 1 locus_tag LOCUS_06350 CDS 31723..32496 product cobalt-precorrin-4 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004870.1 transl_table 11 codon_start 1 locus_tag LOCUS_06360 CDS 32477..33532 product cobalt-precorrin 5A hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001098913.1 transl_table 11 codon_start 1 locus_tag LOCUS_06370 gene cbiG CDS 33532..34257 product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000953643.1 transl_table 11 codon_start 1 locus_tag LOCUS_06380 CDS 34254..35054 product cobalt-precorrin-6A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816684.1 transl_table 11 codon_start 1 locus_tag LOCUS_06390 CDS 35051..35845 product sirohydrochlorin cobaltochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168485.1 transl_table 11 codon_start 1 locus_tag LOCUS_06400 CDS 35842..36555 product cobalt-factor II C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001013551.1 transl_table 11 codon_start 1 locus_tag LOCUS_06410 CDS 36552..37289 product cobalt ECF transporter S component CbiM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816682.1 transl_table 11 codon_start 1 locus_tag LOCUS_06420 gene cbiM CDS 37291..37572 product energy-coupling factor ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000753216.1 transl_table 11 codon_start 1 locus_tag LOCUS_06430 CDS 37559..38236 product energy-coupling factor ABC transporter transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147138.1 transl_table 11 codon_start 1 locus_tag LOCUS_06440 CDS 38245..39066 product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000881535.1 transl_table 11 codon_start 1 locus_tag LOCUS_06450 CDS 39066..40586 product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000189676.1 transl_table 11 codon_start 1 locus_tag LOCUS_06460 CDS 40583..41128 product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000973185.1 transl_table 11 codon_start 1 locus_tag LOCUS_06470 gene cobU CDS 41125..41868 product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297350.1 transl_table 11 codon_start 1 locus_tag LOCUS_06480 gene cobS CDS 41894..42958 product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001193966.1 transl_table 11 codon_start 1 locus_tag LOCUS_06490 gene cobT CDS 43056..43979 product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001350523.1 transl_table 11 codon_start 1 locus_tag LOCUS_06500 gene ldtA CDS complement(44069..45541) product C4-dicarboxylate transporter DcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262088.1 transl_table 11 codon_start 1 locus_tag LOCUS_06510 gene dcuC CDS complement(45546..46679) product beta-aspartyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_128783587.1 transl_table 11 codon_start 1 locus_tag LOCUS_06520 gene iadA CDS 46951..47724 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262090.1 transl_table 11 codon_start 1 locus_tag LOCUS_06530 tRNA complement(47956..48031) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00040 CDS 48365..49678 product toxic metabolite efflux MATE transporter YeeO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000943916.1 transl_table 11 codon_start 1 locus_tag LOCUS_06540 gene yeeO note possible pseudo, frameshifted tRNA 49778..49853 product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00050 CDS complement(49909..51363) product AMP nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001060231.1 transl_table 11 codon_start 1 locus_tag LOCUS_06550 gene amn CDS complement(51480..52796) product shikimate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000378596.1 transl_table 11 codon_start 1 locus_tag LOCUS_06560 gene shiA CDS 53102..53860 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06570 CDS 54066..54719 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762387.1 transl_table 11 codon_start 1 locus_tag LOCUS_06580 CDS 54712..56244 product GH3 auxin-responsive promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463528.1 transl_table 11 codon_start 1 locus_tag LOCUS_06590 CDS 56251..57642 product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392350.1 transl_table 11 codon_start 1 locus_tag LOCUS_06600 CDS 57642..58988 product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940915.1 transl_table 11 codon_start 1 locus_tag LOCUS_06610 CDS 58988..60013 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06620 CDS 60010..61320 product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392350.1 transl_table 11 codon_start 1 locus_tag LOCUS_06630 CDS 61317..62660 product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392350.1 transl_table 11 codon_start 1 locus_tag LOCUS_06640 CDS 62667..63311 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06650 CDS 63268..63858 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06660 CDS complement(63940..64869) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06670 CDS 65143..67959 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06680 CDS complement(68381..68938) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06690 CDS complement(68938..69831) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06700 CDS complement(70375..70629) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06710 note possible pseudo, internal stop codon, frameshifted CDS complement(71260..71784) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06720 CDS complement(71804..73003) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06730 CDS complement(73031..73387) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06740 CDS complement(73411..73593) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06750 CDS complement(73593..74561) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06760 CDS complement(74574..74747) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06770 CDS 75221..75451 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06780 CDS 76423..77310 product integrase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000511773.1 transl_table 11 codon_start 1 locus_tag LOCUS_06790 CDS complement(77979..79241) product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000059623.1 transl_table 11 codon_start 1 locus_tag LOCUS_06800 tRNA complement(79403..79478) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00060 CDS 79806..80723 product nitrogen assimilation transcriptional regulator NAC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010432103.1 transl_table 11 codon_start 1 locus_tag LOCUS_06810 gene nac CDS 80824..81774 product HTH-type transcriptional regulator Cbl inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001011008.1 transl_table 11 codon_start 1 locus_tag LOCUS_06820 gene cbl tRNA complement(81811..81886) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00070 CDS complement(81986..82732) product DgsA anti-repressor MtfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000598924.1 transl_table 11 codon_start 1 locus_tag LOCUS_06830 gene mtfA tRNA 82877..82966 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00080 CDS 83255..84100 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06840 CDS 84267..84506 product AlpA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001071599.1 transl_table 11 codon_start 1 locus_tag LOCUS_06850 CDS 84587..84877 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06860 CDS 84929..85225 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06870 CDS 85325..85567 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06880 CDS complement(85641..86045) product H-NS family nucleoid-associated regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287388.1 transl_table 11 codon_start 1 locus_tag LOCUS_06890 CDS complement(86202..86681) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06900 CDS complement(86787..87455) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06910 CDS complement(88645..89514) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06920 CDS complement(90017..90202) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06930 CDS complement(90433..90906) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06940 CDS 91142..91396 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06950 CDS 91341..91871 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06960 CDS complement(92070..93500) product DUF2971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073169946.1 transl_table 11 codon_start 1 locus_tag LOCUS_06970 CDS complement(93599..95113) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06980 CDS complement(95934..96086) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06990 CDS 96759..97064 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07000 CDS complement(97769..98515) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07010 CDS complement(98759..99985) product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009938417.1 transl_table 11 codon_start 1 locus_tag LOCUS_07020 CDS complement(100485..101660) product porin OmpS1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001080666.1 transl_table 11 codon_start 1 locus_tag LOCUS_07030 gene ompS1 CDS 102292..102561 product cell division protein DrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097751.1 transl_table 11 codon_start 1 locus_tag LOCUS_07040 gene drpB CDS 102614..103312 product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000377043.1 transl_table 11 codon_start 1 locus_tag LOCUS_07050 CDS 103402..104796 product DNA-cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001157258.1 transl_table 11 codon_start 1 locus_tag LOCUS_07060 gene dcm CDS 104777..105244 product VSPR family DNA mismatch endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228686.1 transl_table 11 codon_start 1 locus_tag LOCUS_07070 gene vsr CDS complement(105236..106156) product drug/metabolite exporter YedA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001212262.1 transl_table 11 codon_start 1 locus_tag LOCUS_07080 gene yedA CDS 106334..107245 product DUF808 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000922686.1 transl_table 11 codon_start 1 locus_tag LOCUS_07090 CDS 107322..107507 product YodC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001178602.1 transl_table 11 codon_start 1 locus_tag LOCUS_07100 CDS 107625..109319 product cellulose biosynthesis regulator diguanylate cyclase DgcQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001350521.1 transl_table 11 codon_start 1 locus_tag LOCUS_07110 gene dgcQ CDS complement(109316..110131) product mannosyl-3-phosphoglycerate phosphatase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000491520.1 transl_table 11 codon_start 1 locus_tag LOCUS_07120 CDS complement(110420..110647) product YodD family peroxide/acid resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000844798.1 transl_table 11 codon_start 1 locus_tag LOCUS_07130 gene yodD CDS 110776..110964 product protein DsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000867218.1 transl_table 11 codon_start 1 locus_tag LOCUS_07140 gene dsrB CDS complement(111018..111641) product transcriptional regulator RcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000103987.1 transl_table 11 codon_start 1 locus_tag LOCUS_07150 gene rcsA CDS complement(111922..112716) product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000983988.1 transl_table 11 codon_start 1 locus_tag LOCUS_07160 gene fliR CDS complement(112726..112995) product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187358.1 transl_table 11 codon_start 1 locus_tag LOCUS_07170 gene fliQ CDS complement(113005..113742) product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001253411.1 transl_table 11 codon_start 1 locus_tag LOCUS_07180 gene fliP CDS complement(113742..114116) product flagellar biosynthetic protein FliO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000978276.1 transl_table 11 codon_start 1 locus_tag LOCUS_07190 gene fliO CDS complement(114119..114532) product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008500318.1 transl_table 11 codon_start 1 locus_tag LOCUS_07200 gene fliN CDS complement(114529..115533) product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000502815.1 transl_table 11 codon_start 1 locus_tag LOCUS_07210 gene fliM CDS complement(115538..116005) product flagellar basal body-associated protein FliL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132172.1 transl_table 11 codon_start 1 locus_tag LOCUS_07220 gene fliL CDS complement(116110..117297) product flagellar hook length control protein FliK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000631663.1 transl_table 11 codon_start 1 locus_tag LOCUS_07230 gene fliK CDS complement(117294..117737) product flagellar export protein FliJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000807579.1 transl_table 11 codon_start 1 locus_tag LOCUS_07240 gene fliJ CDS complement(117759..119129) product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097732.1 transl_table 11 codon_start 1 locus_tag LOCUS_07250 gene fliI CDS complement(119129..119836) product flagellar assembly protein FliH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000064158.1 transl_table 11 codon_start 1 locus_tag LOCUS_07260 gene fliH CDS complement(119829..120827) product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000067950.1 transl_table 11 codon_start 1 locus_tag LOCUS_07270 gene fliG CDS complement(120820..122502) product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001276841.1 transl_table 11 codon_start 1 locus_tag LOCUS_07280 gene fliF CDS 122719..123033 product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274299.1 transl_table 11 codon_start 1 locus_tag LOCUS_07290 gene fliE CDS 123161..123457 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07300 CDS complement(123586..124533) product omptin family outer membrane protease OmpT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001201840.1 transl_table 11 codon_start 1 locus_tag LOCUS_07310 gene ompT CDS complement(124731..124964) product sulfurtransferase-like selenium metabolism protein YedF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000790504.1 transl_table 11 codon_start 1 locus_tag LOCUS_07320 gene yedF CDS complement(124961..126166) product selenium metabolism membrane protein YedE/FdhT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000580669.1 transl_table 11 codon_start 1 locus_tag LOCUS_07330 gene yedE CDS 126353..126766 product lipoprotein YedD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000754694.1 transl_table 11 codon_start 1 locus_tag LOCUS_07340 gene yedD CDS complement(126804..128291) product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001245695.1 transl_table 11 codon_start 1 locus_tag LOCUS_07350 gene amyA CDS complement(128359..128730) product flagella biosynthesis regulatory protein FliT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000204899.1 transl_table 11 codon_start 1 locus_tag LOCUS_07360 gene fliT CDS complement(128730..129137) product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000287765.1 transl_table 11 codon_start 1 locus_tag LOCUS_07370 gene fliS CDS complement(129153..130553) product flagellar filament capping protein FliD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000146805.1 transl_table 11 codon_start 1 locus_tag LOCUS_07380 gene fliD CDS 130793..132052 product FliC/FljB family flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704962.1 transl_table 11 codon_start 1 locus_tag LOCUS_07390 CDS complement(132170..133150) product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815648.1 transl_table 11 codon_start 1 locus_tag LOCUS_07400 CDS complement(133217..133540) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07410 CDS 133776..134234 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07420 sequence005 source 1..132015 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(29..2014) product ligand-gated channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707645.1 transl_table 11 codon_start 1 locus_tag LOCUS_07430 CDS complement(2347..3186) product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000425438.1 transl_table 11 codon_start 1 locus_tag LOCUS_07440 gene yeiG CDS 3494..4162 product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097957.1 transl_table 11 codon_start 1 locus_tag LOCUS_07450 gene folE CDS 4177..5334 product DUF418 domain-containing protein YeiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000440902.1 transl_table 11 codon_start 1 locus_tag LOCUS_07460 gene yeiB CDS 5477..6502 product HTH-type transcriptional regulator GalS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000628655.1 transl_table 11 codon_start 1 locus_tag LOCUS_07470 gene galS CDS 6797..7795 product galactose/glucose ABC transporter substrate-binding protein MglB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001036964.1 transl_table 11 codon_start 1 locus_tag LOCUS_07480 gene mglB CDS 7902..9383 product galactose/methyl galactoside ABC transporter ATP-binding protein MglA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000255032.1 transl_table 11 codon_start 1 locus_tag LOCUS_07490 gene mglA CDS 9399..10409 product galactose/methyl galactoside ABC transporter permease MglC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001275103.1 transl_table 11 codon_start 1 locus_tag LOCUS_07500 gene mglC CDS complement(10452..10691) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07510 CDS complement(10708..10974) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097951.1 transl_table 11 codon_start 1 locus_tag LOCUS_07520 CDS complement(10997..11716) product outer membrane permeability protein SanA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097950.1 transl_table 11 codon_start 1 locus_tag LOCUS_07530 gene sanA CDS complement(11838..12722) product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000553529.1 transl_table 11 codon_start 1 locus_tag LOCUS_07540 gene cdd CDS complement(12852..13547) product CidB/LrgB family autolysis modulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000968208.1 transl_table 11 codon_start 1 locus_tag LOCUS_07550 CDS complement(13544..13942) product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299855.1 transl_table 11 codon_start 1 locus_tag LOCUS_07560 CDS complement(14073..14981) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000024658.1 transl_table 11 codon_start 1 locus_tag LOCUS_07570 CDS 15108..16469 product aromatic acid/H+ symport family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000194233.1 transl_table 11 codon_start 1 locus_tag LOCUS_07580 CDS 16481..17518 product gentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001289858.1 transl_table 11 codon_start 1 locus_tag LOCUS_07590 gene gtdA CDS 17530..18234 product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000196038.1 transl_table 11 codon_start 1 locus_tag LOCUS_07600 CDS 18243..18887 product maleylacetoacetate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000781184.1 transl_table 11 codon_start 1 locus_tag LOCUS_07610 gene maiA CDS 18902..20095 product 3-hydroxybenzoate 6-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000150113.1 transl_table 11 codon_start 1 locus_tag LOCUS_07620 CDS 20227..20856 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07630 note possible pseudo, internal stop codon CDS 20890..21168 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07640 note possible pseudo, internal stop codon CDS 21571..22974 product multidrug resistance outer membrane protein MdtQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001081453.1 transl_table 11 codon_start 1 locus_tag LOCUS_07650 gene mdtQ CDS 23041..23802 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000169612.1 transl_table 11 codon_start 1 locus_tag LOCUS_07660 CDS complement(23821..24390) product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000930540.1 transl_table 11 codon_start 1 locus_tag LOCUS_07670 CDS 24557..25144 product Yip1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295454.1 transl_table 11 codon_start 1 locus_tag LOCUS_07680 CDS 25313..26239 product D-alanyl-D-alanine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295432.1 transl_table 11 codon_start 1 locus_tag LOCUS_07690 gene pbpG CDS 26850..27071 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07700 CDS 27369..28823 product PAAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097669.1 transl_table 11 codon_start 1 locus_tag LOCUS_07710 CDS 28801..29187 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07720 CDS complement(29385..29939) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097939.1 transl_table 11 codon_start 1 locus_tag LOCUS_07730 CDS complement(30041..31771) product D-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000097356.1 transl_table 11 codon_start 1 locus_tag LOCUS_07740 gene dld CDS 32027..34324 product beta-glucosidase BglX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000871488.1 transl_table 11 codon_start 1 locus_tag LOCUS_07750 gene bglX CDS 34558..36162 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104676.1 transl_table 11 codon_start 1 locus_tag LOCUS_07760 CDS 36166..37008 product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770800.1 transl_table 11 codon_start 1 locus_tag LOCUS_07770 CDS 37278..37655 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07780 note possible pseudo, frameshifted CDS 37683..38660 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07790 note possible pseudo, internal stop codon CDS 38705..40261 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096070.1 transl_table 11 codon_start 1 locus_tag LOCUS_07800 CDS 40254..41543 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000991765.1 transl_table 11 codon_start 1 locus_tag LOCUS_07810 CDS 41627..42544 product glycine betaine ABC transporter substrate-binding protein OsmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001131279.1 transl_table 11 codon_start 1 locus_tag LOCUS_07820 gene osmF CDS 42570..43727 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278105.1 transl_table 11 codon_start 1 locus_tag LOCUS_07830 CDS 43720..44667 product glycine betaine ABC transporter ATP binding protein YehX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569315.1 transl_table 11 codon_start 1 locus_tag LOCUS_07840 gene yehX CDS 44651..45382 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000824854.1 transl_table 11 codon_start 1 locus_tag LOCUS_07850 CDS complement(45530..46261) product HTH-type transcriptional regulator MlrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001240398.1 transl_table 11 codon_start 1 locus_tag LOCUS_07860 gene mlrA CDS 46484..48169 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000272839.1 transl_table 11 codon_start 1 locus_tag LOCUS_07870 CDS 48166..48885 product two-component system response regulator BtsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000598632.1 transl_table 11 codon_start 1 locus_tag LOCUS_07880 gene btsR CDS 48932..49399 product DUF1456 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097929.1 transl_table 11 codon_start 1 locus_tag LOCUS_07890 CDS complement(49530..51563) product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296226.1 transl_table 11 codon_start 1 locus_tag LOCUS_07900 gene metG CDS 51729..52838 product iron-sulfur cluster carrier protein ApbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001005448.1 transl_table 11 codon_start 1 locus_tag LOCUS_07910 gene apbC CDS 53250..53780 product fimbrial protein YehD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000830686.1 transl_table 11 codon_start 1 locus_tag LOCUS_07920 gene yehD CDS 53839..54519 product fimbrial biogenesis chaperone StcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000698775.1 transl_table 11 codon_start 1 locus_tag LOCUS_07930 gene stcB CDS 54548..57034 product fimbrial biogenesis outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000945390.1 transl_table 11 codon_start 1 locus_tag LOCUS_07940 CDS 57050..58072 product putative fimbrial-like adhesin protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000702202.1 transl_table 11 codon_start 1 locus_tag LOCUS_07950 CDS complement(58114..58440) product Ni(II)/Co(II) efflux transporter accessory subunit RcnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000837534.1 transl_table 11 codon_start 1 locus_tag LOCUS_07960 gene rcnB CDS 58851..59648 product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001182157.1 transl_table 11 codon_start 1 locus_tag LOCUS_07970 gene thiM CDS 59635..60435 product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000822268.1 transl_table 11 codon_start 1 locus_tag LOCUS_07980 gene thiD CDS 60477..61223 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000434040.1 transl_table 11 codon_start 1 locus_tag LOCUS_07990 CDS complement(61228..62193) product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000012008.1 transl_table 11 codon_start 1 locus_tag LOCUS_08000 CDS complement(62190..63194) product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000846212.1 transl_table 11 codon_start 1 locus_tag LOCUS_08010 CDS complement(63191..64462) product nucleoside permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000858692.1 transl_table 11 codon_start 1 locus_tag LOCUS_08020 CDS 64713..65765 product class I fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008500869.1 transl_table 11 codon_start 1 locus_tag LOCUS_08030 gene fbaB CDS 66011..67165 product mandelate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010210634.1 transl_table 11 codon_start 1 locus_tag LOCUS_08040 CDS 67301..68848 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104458.1 transl_table 11 codon_start 1 locus_tag LOCUS_08050 CDS 68845..69882 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010220797.1 transl_table 11 codon_start 1 locus_tag LOCUS_08060 CDS 69879..70778 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245922.1 transl_table 11 codon_start 1 locus_tag LOCUS_08070 CDS 70750..71613 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104459.1 transl_table 11 codon_start 1 locus_tag LOCUS_08080 CDS 71624..72397 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104460.1 transl_table 11 codon_start 1 locus_tag LOCUS_08090 CDS complement(72452..73351) product lipid kinase YegS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000807362.1 transl_table 11 codon_start 1 locus_tag LOCUS_08100 gene yegS CDS complement(73510..74268) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08110 CDS complement(74741..76102) product tRNA 5-hydroxyuridine modification protein YegQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001517981.1 transl_table 11 codon_start 1 locus_tag LOCUS_08120 gene yegQ CDS complement(76265..76975) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000586683.1 transl_table 11 codon_start 1 locus_tag LOCUS_08130 CDS complement(77003..77725) product two-component system response regulator BaeR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000137875.1 transl_table 11 codon_start 1 locus_tag LOCUS_08140 gene baeR CDS complement(77722..79125) product two-component system sensor histidine kinase BaeS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000870082.1 transl_table 11 codon_start 1 locus_tag LOCUS_08150 gene baeS CDS complement(79122..80537) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130872.1 transl_table 11 codon_start 1 locus_tag LOCUS_08160 CDS complement(80534..83614) product multidrug efflux RND transporter permease subunit MdtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000667528.1 transl_table 11 codon_start 1 locus_tag LOCUS_08170 gene mdtC CDS complement(83615..86737) product multidrug efflux RND transporter permease subunit MdtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001197875.1 transl_table 11 codon_start 1 locus_tag LOCUS_08180 gene mdtB CDS complement(86737..87984) product multidrug efflux RND transporter subunit MdtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000678979.1 transl_table 11 codon_start 1 locus_tag LOCUS_08190 gene mdtA CDS complement(88422..89780) product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000469740.1 transl_table 11 codon_start 1 locus_tag LOCUS_08200 gene yegD CDS 89911..90780 product DNA-3-methyladenine glycosylase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000288389.1 transl_table 11 codon_start 1 locus_tag LOCUS_08210 gene alkA CDS complement(90748..93720) product MASE1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000042960.1 transl_table 11 codon_start 1 locus_tag LOCUS_08220 CDS 94023..94664 product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132082.1 transl_table 11 codon_start 1 locus_tag LOCUS_08230 gene udk CDS 94756..95337 product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001234768.1 transl_table 11 codon_start 1 locus_tag LOCUS_08240 gene dcd CDS 95359..97209 product outer membrane assembly protein AsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001252349.1 transl_table 11 codon_start 1 locus_tag LOCUS_08250 gene asmA CDS complement(97567..99150) product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000454718.1 transl_table 11 codon_start 1 locus_tag LOCUS_08260 CDS 99916..100959 product polysaccharide export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000978074.1 transl_table 11 codon_start 1 locus_tag LOCUS_08270 CDS 100965..101411 product low molecular weight protein-tyrosine-phosphatase Wzb inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097882.1 transl_table 11 codon_start 1 locus_tag LOCUS_08280 gene wzb CDS 101411..103573 product tyrosine-protein kinase Wzc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000137223.1 transl_table 11 codon_start 1 locus_tag LOCUS_08290 gene wzc CDS 103675..104517 product colanic acid biosynthesis glycosyltransferase WcaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097880.1 transl_table 11 codon_start 1 locus_tag LOCUS_08300 gene wcaA CDS 104520..105008 product colanic acid biosynthesis acetyltransferase WcaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000888736.1 transl_table 11 codon_start 1 locus_tag LOCUS_08310 gene wcaB CDS 105005..106222 product colanic acid biosynthesis glycosyltransferase WcaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001023926.1 transl_table 11 codon_start 1 locus_tag LOCUS_08320 gene wcaC CDS 106197..107417 product colanic acid polymerase WcaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000107774.1 transl_table 11 codon_start 1 locus_tag LOCUS_08330 gene wcaD CDS 107431..108177 product colanic acid biosynthesis glycosyltransferase WcaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000927017.1 transl_table 11 codon_start 1 locus_tag LOCUS_08340 gene wcaE CDS 108192..108740 product colanic acid biosynthesis acetyltransferase WcaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001153547.1 transl_table 11 codon_start 1 locus_tag LOCUS_08350 gene wcaF CDS 108767..109888 product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000048162.1 transl_table 11 codon_start 1 locus_tag LOCUS_08360 gene gmd CDS 109891..110856 product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097874.1 transl_table 11 codon_start 1 locus_tag LOCUS_08370 CDS 110859..111338 product GDP-mannose mannosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097873.1 transl_table 11 codon_start 1 locus_tag LOCUS_08380 CDS 111335..112558 product colanic acid biosynthesis fucosyltransferase WcaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000699650.1 transl_table 11 codon_start 1 locus_tag LOCUS_08390 gene wcaI CDS 112562..113998 product mannose-1-phosphate guanyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000079256.1 transl_table 11 codon_start 1 locus_tag LOCUS_08400 gene cpsB CDS 114158..115528 product colanic acid biosynthesis phosphomannomutase CpsG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602262.1 transl_table 11 codon_start 1 locus_tag LOCUS_08410 gene cpsG CDS 115583..116977 product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000183160.1 transl_table 11 codon_start 1 locus_tag LOCUS_08420 gene wcaJ CDS 116979..118457 product colanic acid undecaprenyl disphosphate flippase WzxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000058479.1 transl_table 11 codon_start 1 locus_tag LOCUS_08430 gene wzxC CDS 118516..119796 product colanic acid biosynthesis pyruvyl transferase WcaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000770864.1 transl_table 11 codon_start 1 locus_tag LOCUS_08440 gene wcaK CDS 119793..121013 product colanic acid biosynthesis glycosyltransferase WcaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868505.1 transl_table 11 codon_start 1 locus_tag LOCUS_08450 gene wcaL CDS 121024..122427 product colanic acid biosynthesis protein WcaM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001116116.1 transl_table 11 codon_start 1 locus_tag LOCUS_08460 gene wcaM CDS 122606..123499 product GalU regulator GalF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000981469.1 transl_table 11 codon_start 1 locus_tag LOCUS_08470 gene galF CDS 123858..124958 product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000699450.1 transl_table 11 codon_start 1 locus_tag LOCUS_08480 gene rfbB CDS 124958..125857 product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001023616.1 transl_table 11 codon_start 1 locus_tag LOCUS_08490 gene rfbD CDS 125909..126787 product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857508.1 transl_table 11 codon_start 1 locus_tag LOCUS_08500 gene rfbA CDS 126792..127340 product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001100803.1 transl_table 11 codon_start 1 locus_tag LOCUS_08510 gene rfbC CDS 127356..128396 product glycoside hydrolase family 99-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476092.1 transl_table 11 codon_start 1 locus_tag LOCUS_08520 CDS 128393..129604 product O148 family O-antigen flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000739384.1 transl_table 11 codon_start 1 locus_tag LOCUS_08530 gene wzx CDS 129607..130599 product stealth family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225420236.1 transl_table 11 codon_start 1 locus_tag LOCUS_08540 CDS 130726..131691 product O104 family O-antigen polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000205117.1 transl_table 11 codon_start 1 locus_tag LOCUS_08550 gene wzy sequence006 source 1..124495 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(11..931) product kdo(2)-lipid IV(A) palmitoleoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000484431.1 transl_table 11 codon_start 1 locus_tag LOCUS_08560 gene lpxP CDS 1736..2503 product basic amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705157.1 transl_table 11 codon_start 1 locus_tag LOCUS_08570 CDS 2567..3331 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705158.1 transl_table 11 codon_start 1 locus_tag LOCUS_08580 CDS 3318..4040 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705159.1 transl_table 11 codon_start 1 locus_tag LOCUS_08590 CDS complement(4093..4581) product DcrB-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168514.1 transl_table 11 codon_start 1 locus_tag LOCUS_08600 CDS complement(4607..6391) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08610 CDS complement(6385..7731) product GlcNAc-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816678.1 transl_table 11 codon_start 1 locus_tag LOCUS_08620 CDS complement(7757..8743) product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168519.1 transl_table 11 codon_start 1 locus_tag LOCUS_08630 CDS complement(8747..9817) product type VI secretion system ImpA family N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816677.1 transl_table 11 codon_start 1 locus_tag LOCUS_08640 CDS complement(9814..10845) product type VI secretion system baseplate subunit TssG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211583.1 transl_table 11 codon_start 1 locus_tag LOCUS_08650 gene tssG CDS complement(10842..12722) product type VI secretion system baseplate subunit TssF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816676.1 transl_table 11 codon_start 1 locus_tag LOCUS_08660 gene tssF CDS 13013..15715 product type VI secretion system ATPase TssH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215317.1 transl_table 11 codon_start 1 locus_tag LOCUS_08670 gene tssH CDS 15800..16339 product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211580.1 transl_table 11 codon_start 1 locus_tag LOCUS_08680 CDS 16425..17180 product fimbria/pilus periplasmic chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019080952.1 transl_table 11 codon_start 1 locus_tag LOCUS_08690 CDS 17217..19814 product fimbrial biogenesis outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168527.1 transl_table 11 codon_start 1 locus_tag LOCUS_08700 CDS 19805..20353 product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816673.1 transl_table 11 codon_start 1 locus_tag LOCUS_08710 CDS 20444..20962 product type VI secretion system contractile sheath small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211575.1 transl_table 11 codon_start 1 locus_tag LOCUS_08720 gene tssB CDS 20984..22483 product type VI secretion system contractile sheath large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004699298.1 transl_table 11 codon_start 1 locus_tag LOCUS_08730 gene tssC CDS 22643..23128 product Hcp family type VI secretion system effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211573.1 transl_table 11 codon_start 1 locus_tag LOCUS_08740 CDS 23186..23746 product type VI secretion system lipoprotein TssJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211572.1 transl_table 11 codon_start 1 locus_tag LOCUS_08750 gene tssJ CDS 23750..25096 product type VI secretion system baseplate subunit TssK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211571.1 transl_table 11 codon_start 1 locus_tag LOCUS_08760 gene tssK CDS 25078..26451 product type VI secretion system protein TssL, long form inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816670.1 transl_table 11 codon_start 1 locus_tag LOCUS_08770 gene tssL CDS 26463..28886 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08780 note possible pseudo, frameshifted CDS 28855..30291 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08790 note possible pseudo, frameshifted CDS 30964..33306 product type VI secretion system Vgr family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209683.1 transl_table 11 codon_start 1 locus_tag LOCUS_08800 CDS 33367..33630 product PAAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168539.1 transl_table 11 codon_start 1 locus_tag LOCUS_08810 CDS 33614..34477 product TagK domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168541.1 transl_table 11 codon_start 1 locus_tag LOCUS_08820 CDS 34495..35292 product type VI secretion system accessory protein TagJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209685.1 transl_table 11 codon_start 1 locus_tag LOCUS_08830 CDS 35279..35782 product type VI secretion system baseplate subunit TssE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168546.1 transl_table 11 codon_start 1 locus_tag LOCUS_08840 CDS 36011..38920 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08850 CDS complement(39415..40254) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387789.1 transl_table 11 codon_start 1 locus_tag LOCUS_08860 CDS complement(40268..40594) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387790.1 transl_table 11 codon_start 1 locus_tag LOCUS_08870 CDS complement(40599..41132) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387791.1 transl_table 11 codon_start 1 locus_tag LOCUS_08880 CDS 41298..42206 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387792.1 transl_table 11 codon_start 1 locus_tag LOCUS_08890 CDS 42590..43081 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08900 CDS 43104..43364 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08910 CDS complement(43567..44517) product bifunctional helix-turn-helix transcriptional regulator/GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049034212.1 transl_table 11 codon_start 1 locus_tag LOCUS_08920 CDS complement(44514..44714) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08930 CDS complement(45021..45269) product DUF2442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023517660.1 transl_table 11 codon_start 1 locus_tag LOCUS_08940 CDS complement(45253..45495) product DUF4160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933584.1 transl_table 11 codon_start 1 locus_tag LOCUS_08950 tRNA complement(46561..46635) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00090 CDS complement(46710..47639) product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000377769.1 transl_table 11 codon_start 1 locus_tag LOCUS_08960 CDS 47929..48684 product phospholipid-binding lipoprotein MlaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776787.1 transl_table 11 codon_start 1 locus_tag LOCUS_08970 gene mlaA CDS complement(48805..50142) product long-chain fatty acid transporter FadL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420287.1 transl_table 11 codon_start 1 locus_tag LOCUS_08980 gene fadL CDS 50507..50791 product YfcZ/YiiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000030904.1 transl_table 11 codon_start 1 locus_tag LOCUS_08990 CDS 50965..52275 product acetyl-CoA C-acyltransferase FadI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000531952.1 transl_table 11 codon_start 1 locus_tag LOCUS_09000 gene fadI CDS 52275..54419 product fatty acid oxidation complex subunit alpha FadJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000424986.1 transl_table 11 codon_start 1 locus_tag LOCUS_09010 gene fadJ CDS 54630..55115 product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014832802.1 transl_table 11 codon_start 1 locus_tag LOCUS_09020 gene sixA CDS complement(55211..55762) product endonuclease SmrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000730806.1 transl_table 11 codon_start 1 locus_tag LOCUS_09030 gene smrB CDS 55928..56860 product 50S ribosomal protein L3 N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001542329.1 transl_table 11 codon_start 1 locus_tag LOCUS_09040 gene prmB CDS 56892..57977 product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297933.1 transl_table 11 codon_start 1 locus_tag LOCUS_09050 gene aroC CDS 57981..58805 product penicillin-insensitive murein endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043802.1 transl_table 11 codon_start 1 locus_tag LOCUS_09060 gene mepA CDS 58805..59617 product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000368599.1 transl_table 11 codon_start 1 locus_tag LOCUS_09070 CDS 59614..60162 product elongation factor P hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001089220.1 transl_table 11 codon_start 1 locus_tag LOCUS_09080 gene epmC CDS 60196..60474 product YfcL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000559749.1 transl_table 11 codon_start 1 locus_tag LOCUS_09090 CDS complement(60535..62535) product bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000816082.1 transl_table 11 codon_start 1 locus_tag LOCUS_09100 gene mnmC CDS 62694..63911 product beta-ketoacyl-ACP synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098145.1 transl_table 11 codon_start 1 locus_tag LOCUS_09110 gene fabB CDS 64018..65196 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000127714.1 transl_table 11 codon_start 1 locus_tag LOCUS_09120 CDS complement(65193..66200) product flagella biosynthesis regulator Flk inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000553395.1 transl_table 11 codon_start 1 locus_tag LOCUS_09130 gene flk CDS 66301..67437 product 4-phosphoerythronate dehydrogenase PdxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000699178.1 transl_table 11 codon_start 1 locus_tag LOCUS_09140 gene pdxB CDS 67499..68512 product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001289141.1 transl_table 11 codon_start 1 locus_tag LOCUS_09150 CDS 68512..69321 product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001283586.1 transl_table 11 codon_start 1 locus_tag LOCUS_09160 gene truA CDS 69345..70004 product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000364318.1 transl_table 11 codon_start 1 locus_tag LOCUS_09170 CDS 70154..71068 product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000118383.1 transl_table 11 codon_start 1 locus_tag LOCUS_09180 gene accD CDS 71260..72528 product bifunctional tetrahydrofolate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000792271.1 transl_table 11 codon_start 1 locus_tag LOCUS_09190 gene folC CDS 72518..73180 product cell division protein DedD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000157040.1 transl_table 11 codon_start 1 locus_tag LOCUS_09200 gene dedD CDS 73401..73889 product colicin V production protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098135.1 transl_table 11 codon_start 1 locus_tag LOCUS_09210 gene cvpA CDS 73924..75441 product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365559.1 transl_table 11 codon_start 1 locus_tag LOCUS_09220 gene purF CDS complement(75487..77448) product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001026882.1 transl_table 11 codon_start 1 locus_tag LOCUS_09230 CDS complement(77435..78859) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000204802.1 transl_table 11 codon_start 1 locus_tag LOCUS_09240 CDS 79239..80240 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189263.1 transl_table 11 codon_start 1 locus_tag LOCUS_09250 CDS 80283..80852 product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000825691.1 transl_table 11 codon_start 1 locus_tag LOCUS_09260 gene ubiX CDS 81126..81908 product lysine/arginine/ornithine ABC transporter substrate-binding protein ArgT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000754418.1 transl_table 11 codon_start 1 locus_tag LOCUS_09270 gene argT CDS 82154..82936 product histidine ABC transporter substrate-binding protein HisJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000737621.1 transl_table 11 codon_start 1 locus_tag LOCUS_09280 gene hisJ CDS 83365..84051 product histidine ABC transporter permease HisQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000965498.1 transl_table 11 codon_start 1 locus_tag LOCUS_09290 CDS 84048..84755 product histidine ABC transporter permease HisM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569771.1 transl_table 11 codon_start 1 locus_tag LOCUS_09300 gene hisM CDS 84769..85542 product histidine ABC transporter ATP-binding protein HisP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001293612.1 transl_table 11 codon_start 1 locus_tag LOCUS_09310 gene hisP CDS complement(85632..86135) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098129.1 transl_table 11 codon_start 1 locus_tag LOCUS_09320 CDS complement(86205..87098) product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001028341.1 transl_table 11 codon_start 1 locus_tag LOCUS_09330 CDS complement(87119..87481) product dihydroneopterin triphosphate 2'-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000068457.1 transl_table 11 codon_start 1 locus_tag LOCUS_09340 gene folX CDS complement(87535..88182) product GSH-dependent disulfide bond oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000566559.1 transl_table 11 codon_start 1 locus_tag LOCUS_09350 gene yfcG CDS 88321..88965 product glutathione transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000042440.1 transl_table 11 codon_start 1 locus_tag LOCUS_09360 gene yfcF CDS 89022..89573 product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000977007.1 transl_table 11 codon_start 1 locus_tag LOCUS_09370 gene yfcE CDS 89630..90220 product NUDIX hydrolase YfcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000230215.1 transl_table 11 codon_start 1 locus_tag LOCUS_09380 gene yfcD CDS complement(90225..91244) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098122.1 transl_table 11 codon_start 1 locus_tag LOCUS_09390 CDS 91494..91937 product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098121.1 transl_table 11 codon_start 1 locus_tag LOCUS_09400 CDS 92016..92288 product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000699818.1 transl_table 11 codon_start 1 locus_tag LOCUS_09410 CDS 92351..93739 product PTS ascorbate transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001681684.1 transl_table 11 codon_start 1 locus_tag LOCUS_09420 CDS 93736..94566 product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001103260.1 transl_table 11 codon_start 1 locus_tag LOCUS_09430 CDS 94559..95512 product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098117.1 transl_table 11 codon_start 1 locus_tag LOCUS_09440 CDS complement(95701..97227) product putative basic amino acid antiporter YfcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000117932.1 transl_table 11 codon_start 1 locus_tag LOCUS_09450 gene yfcC CDS complement(97433..99574) product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000086690.1 transl_table 11 codon_start 1 locus_tag LOCUS_09460 gene pta CDS complement(99653..100714) product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000095689.1 transl_table 11 codon_start 1 locus_tag LOCUS_09470 gene ackA CDS 101274..101651 product terminus macrodomain insulation protein YfbV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000106616.1 transl_table 11 codon_start 1 locus_tag LOCUS_09480 gene yfbV CDS 101744..102238 product YfbU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000426135.1 transl_table 11 codon_start 1 locus_tag LOCUS_09490 CDS 102249..102908 product sugar phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021013205.1 transl_table 11 codon_start 1 locus_tag LOCUS_09500 CDS 102988..104820 product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012899.1 transl_table 11 codon_start 1 locus_tag LOCUS_09510 CDS complement(104887..105486) product 5'-deoxynucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000813857.1 transl_table 11 codon_start 1 locus_tag LOCUS_09520 gene yfbR CDS complement(105580..106794) product alanine transaminase AlaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000074540.1 transl_table 11 codon_start 1 locus_tag LOCUS_09530 gene alaA CDS 107711..108649 product transcriptional regulator LrhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000622290.1 transl_table 11 codon_start 1 locus_tag LOCUS_09540 gene lrhA CDS 109277..109720 product NADH-quinone oxidoreductase subunit NuoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062997.1 transl_table 11 codon_start 1 locus_tag LOCUS_09550 gene nuoA CDS 109736..110398 product NADH-quinone oxidoreductase subunit NuoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000386728.1 transl_table 11 codon_start 1 locus_tag LOCUS_09560 gene nuoB CDS 110523..112325 product NADH-quinone oxidoreductase subunit C/D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000247855.1 transl_table 11 codon_start 1 locus_tag LOCUS_09570 gene nuoC CDS 112328..112828 product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545038.1 transl_table 11 codon_start 1 locus_tag LOCUS_09580 gene nuoE CDS 112825..114162 product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000789502.1 transl_table 11 codon_start 1 locus_tag LOCUS_09590 gene nuoF CDS 114191..116917 product NADH-quinone oxidoreductase subunit NuoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001518099.1 transl_table 11 codon_start 1 locus_tag LOCUS_09600 gene nuoG CDS 116914..117891 product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000118519.1 transl_table 11 codon_start 1 locus_tag LOCUS_09610 gene nuoH CDS 117906..118448 product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000172747.1 transl_table 11 codon_start 1 locus_tag LOCUS_09620 gene nuoI CDS 118460..119014 product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000393511.1 transl_table 11 codon_start 1 locus_tag LOCUS_09630 gene nuoJ CDS 119011..119313 product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000612644.1 transl_table 11 codon_start 1 locus_tag LOCUS_09640 gene nuoK CDS 119310..121151 product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001056574.1 transl_table 11 codon_start 1 locus_tag LOCUS_09650 gene nuoL CDS 121309..122838 product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000926422.1 transl_table 11 codon_start 1 locus_tag LOCUS_09660 gene nuoM CDS 122845..124302 product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000156669.1 transl_table 11 codon_start 1 locus_tag LOCUS_09670 gene nuoN sequence007 source 1..119745 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(17..529) product gp16 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001214362.1 transl_table 11 codon_start 1 locus_tag LOCUS_09680 CDS 600..839 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09690 CDS complement(820..1107) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09700 CDS complement(1112..1252) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09710 CDS complement(1245..1577) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09720 CDS complement(2129..2644) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000465559.1 transl_table 11 codon_start 1 locus_tag LOCUS_09730 CDS complement(2644..3177) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000564280.1 transl_table 11 codon_start 1 locus_tag LOCUS_09740 CDS complement(3181..3759) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09750 CDS complement(3844..4374) product host-nuclease inhibitor Gam family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001129553.1 transl_table 11 codon_start 1 locus_tag LOCUS_09760 CDS complement(4386..4679) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049304.1 transl_table 11 codon_start 1 locus_tag LOCUS_09770 CDS complement(4684..4959) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049432.1 transl_table 11 codon_start 1 locus_tag LOCUS_09780 CDS complement(5034..5264) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001057199.1 transl_table 11 codon_start 1 locus_tag LOCUS_09790 CDS complement(5251..5670) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09800 CDS complement(5683..5904) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000268103.1 transl_table 11 codon_start 1 locus_tag LOCUS_09810 CDS complement(5907..6839) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000129790.1 transl_table 11 codon_start 1 locus_tag LOCUS_09820 CDS complement(6915..9002) product Mu transposase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000289290.1 transl_table 11 codon_start 1 locus_tag LOCUS_09830 CDS complement(9005..9160) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09840 CDS 9412..9966 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001224024.1 transl_table 11 codon_start 1 locus_tag LOCUS_09850 CDS 10221..10835 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09860 CDS 10946..11719 product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001083899.1 transl_table 11 codon_start 1 locus_tag LOCUS_09870 CDS complement(11882..12742) product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000812294.1 transl_table 11 codon_start 1 locus_tag LOCUS_09880 gene rsmI CDS 12807..14858 product penicillin-binding protein activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000249248.1 transl_table 11 codon_start 1 locus_tag LOCUS_09890 CDS 14816..15211 product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000246837.1 transl_table 11 codon_start 1 locus_tag LOCUS_09900 CDS 15231..15821 product DnaA initiator-associating protein DiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000893483.1 transl_table 11 codon_start 1 locus_tag LOCUS_09910 gene diaA CDS 15831..16406 product division/outer membrane stress-associated lipid-binding lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000646033.1 transl_table 11 codon_start 1 locus_tag LOCUS_09920 gene dolP CDS complement(16500..17537) product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147632.1 transl_table 11 codon_start 1 locus_tag LOCUS_09930 CDS complement(17815..18453) product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084526.1 transl_table 11 codon_start 1 locus_tag LOCUS_09940 CDS 18582..19100 product protein/nucleic acid deglycase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037599.1 transl_table 11 codon_start 1 locus_tag LOCUS_09950 gene yhbO CDS complement(19080..19523) product YhbP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000449453.1 transl_table 11 codon_start 1 locus_tag LOCUS_09960 CDS 19575..19868 product DNA damage response exodeoxyribonuclease YhbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000189325.1 transl_table 11 codon_start 1 locus_tag LOCUS_09970 gene yhbQ CDS complement(19855..20358) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000908562.1 transl_table 11 codon_start 1 locus_tag LOCUS_09980 CDS complement(20352..20876) product SCP2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884720.1 transl_table 11 codon_start 1 locus_tag LOCUS_09990 CDS 21097..22092 product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000421305.1 transl_table 11 codon_start 1 locus_tag LOCUS_10000 CDS 22101..22979 product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000877709.1 transl_table 11 codon_start 1 locus_tag LOCUS_10010 CDS 23300..24307 product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130426.1 transl_table 11 codon_start 1 locus_tag LOCUS_10020 CDS complement(24396..25640) product tryptophan permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224390.1 transl_table 11 codon_start 1 locus_tag LOCUS_10030 gene mtr CDS complement(25785..27665) product ATP-dependent RNA helicase DeaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295553.1 transl_table 11 codon_start 1 locus_tag LOCUS_10040 gene deaD CDS complement(27844..28605) product lipoprotein NlpI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000802087.1 transl_table 11 codon_start 1 locus_tag LOCUS_10050 gene nlpI CDS complement(28838..30973) product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298330.1 transl_table 11 codon_start 1 locus_tag LOCUS_10060 gene pnp CDS complement(31217..31486) product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000059465.1 transl_table 11 codon_start 1 locus_tag LOCUS_10070 gene rpsO CDS complement(31640..32584) product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000089698.1 transl_table 11 codon_start 1 locus_tag LOCUS_10080 gene truB CDS complement(32584..32985) product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040205.1 transl_table 11 codon_start 1 locus_tag LOCUS_10090 gene rbfA CDS complement(33142..35826) product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000131175.1 transl_table 11 codon_start 1 locus_tag LOCUS_10100 gene infB CDS complement(35851..37338) product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001031057.1 transl_table 11 codon_start 1 locus_tag LOCUS_10110 gene nusA CDS complement(37367..37789) product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300397.1 transl_table 11 codon_start 1 locus_tag LOCUS_10120 gene rimP tRNA complement(38027..38103) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00100 CDS 38400..39743 product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000207645.1 transl_table 11 codon_start 1 locus_tag LOCUS_10130 gene argG CDS 40110..42401 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10140 CDS 42419..42700 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10150 tRNA complement(42719..42805) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00110 CDS complement(42815..43147) product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000272680.1 transl_table 11 codon_start 1 locus_tag LOCUS_10160 gene secG CDS complement(43362..44492) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10170 CDS complement(44489..45334) product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262625.1 transl_table 11 codon_start 1 locus_tag LOCUS_10180 CDS complement(45514..46362) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10190 CDS complement(46377..47405) product toxin-coregulated pilus assembly protein TcpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000691946.1 transl_table 11 codon_start 1 locus_tag LOCUS_10200 gene tcpE CDS complement(47389..48933) product toxin-coregulated pilus assembly ATPase TcpT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020697.1 transl_table 11 codon_start 1 locus_tag LOCUS_10210 gene tcpT CDS complement(48930..49499) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10220 CDS complement(49487..50383) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10230 CDS complement(50387..50929) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10240 CDS complement(50942..52411) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10250 CDS complement(52419..52850) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10260 CDS complement(52881..54764) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10270 CDS complement(54883..55599) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10280 CDS complement(56000..57337) product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000071169.1 transl_table 11 codon_start 1 locus_tag LOCUS_10290 gene glmM CDS complement(57330..58178) product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000764731.1 transl_table 11 codon_start 1 locus_tag LOCUS_10300 gene folP CDS complement(58265..60205) product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098921.1 transl_table 11 codon_start 1 locus_tag LOCUS_10310 gene ftsH CDS complement(60296..60925) product 23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000145975.1 transl_table 11 codon_start 1 locus_tag LOCUS_10320 gene rlmE CDS 61013..61345 product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000196654.1 transl_table 11 codon_start 1 locus_tag LOCUS_10330 gene yhbY CDS complement(61501..61977) product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001148008.1 transl_table 11 codon_start 1 locus_tag LOCUS_10340 gene greA CDS 62335..63654 product serine-type D-Ala-D-Ala carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001212651.1 transl_table 11 codon_start 1 locus_tag LOCUS_10350 gene dacB CDS complement(63686..66010) product phosphatidylglycerol--membrane-oligosaccharide glycerophosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704310.1 transl_table 11 codon_start 1 locus_tag LOCUS_10360 gene opgB CDS complement(66136..67308) product Obg family GTPase CgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000673554.1 transl_table 11 codon_start 1 locus_tag LOCUS_10370 gene cgtA CDS complement(67324..68289) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000813052.1 transl_table 11 codon_start 1 locus_tag LOCUS_10380 CDS complement(68419..68676) product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004385076.1 transl_table 11 codon_start 1 locus_tag LOCUS_10390 gene rpmA CDS complement(68696..69007) product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000271401.1 transl_table 11 codon_start 1 locus_tag LOCUS_10400 gene rplU CDS 69222..70238 product octaprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001047336.1 transl_table 11 codon_start 1 locus_tag LOCUS_10410 gene ispB CDS 70462..70749 product DNA-binding transcriptional regulator SfsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444167.1 transl_table 11 codon_start 1 locus_tag LOCUS_10420 gene sfsB CDS complement(70804..72063) product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000357259.1 transl_table 11 codon_start 1 locus_tag LOCUS_10430 gene murA CDS complement(72117..72371) product BolA family iron metabolism protein IbaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000568740.1 transl_table 11 codon_start 1 locus_tag LOCUS_10440 gene ibaG CDS complement(72540..72836) product lipid asymmetry maintenance protein MlaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004488.1 transl_table 11 codon_start 1 locus_tag LOCUS_10450 gene mlaB CDS complement(72836..73471) product phospholipid-binding protein MlaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000476475.1 transl_table 11 codon_start 1 locus_tag LOCUS_10460 gene mlaC CDS complement(73490..74041) product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001193591.1 transl_table 11 codon_start 1 locus_tag LOCUS_10470 gene mlaD CDS complement(74046..74828) product lipid asymmetry maintenance ABC transporter permease subunit MlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000925792.1 transl_table 11 codon_start 1 locus_tag LOCUS_10480 gene mlaE CDS complement(74836..75648) product phospholipid ABC transporter ATP-binding protein MlaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000531560.1 transl_table 11 codon_start 1 locus_tag LOCUS_10490 gene mlaF CDS 75847..76824 product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000922739.1 transl_table 11 codon_start 1 locus_tag LOCUS_10500 CDS 76838..77719 product arabinose-5-phosphate isomerase KdsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000018616.1 transl_table 11 codon_start 1 locus_tag LOCUS_10510 gene kdsD CDS 77844..78410 product 3-deoxy-manno-octulosonate-8-phosphatase KdsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000030005.1 transl_table 11 codon_start 1 locus_tag LOCUS_10520 gene kdsC CDS 78407..78982 product LPS export ABC transporter periplasmic protein LptC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000030537.1 transl_table 11 codon_start 1 locus_tag LOCUS_10530 gene lptC CDS 78951..79505 product lipopolysaccharide ABC transporter substrate-binding protein LptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000669770.1 transl_table 11 codon_start 1 locus_tag LOCUS_10540 gene lptA CDS 79512..80237 product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224104.1 transl_table 11 codon_start 1 locus_tag LOCUS_10550 gene lptB CDS 80285..81718 product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809051.1 transl_table 11 codon_start 1 locus_tag LOCUS_10560 gene rpoN CDS 81741..82028 product ribosome hibernation promoting factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098943.1 transl_table 11 codon_start 1 locus_tag LOCUS_10570 gene hpf CDS 82147..82638 product PTS IIA-like nitrogen regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000609332.1 transl_table 11 codon_start 1 locus_tag LOCUS_10580 gene ptsN CDS 82684..83538 product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000243746.1 transl_table 11 codon_start 1 locus_tag LOCUS_10590 gene rapZ CDS 83535..83807 product PTS phosphocarrier protein NPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000216797.1 transl_table 11 codon_start 1 locus_tag LOCUS_10600 gene npr CDS 84003..84635 product PhoP regulatory network protein YrbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000620409.1 transl_table 11 codon_start 1 locus_tag LOCUS_10610 gene yrbL CDS complement(84755..85474) product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098946.1 transl_table 11 codon_start 1 locus_tag LOCUS_10620 gene mtgA CDS complement(85471..86124) product isoprenoid biosynthesis glyoxalase ElbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000719819.1 transl_table 11 codon_start 1 locus_tag LOCUS_10630 gene elbB CDS complement(86353..88689) product aerobic respiration two-component sensor histidine kinase ArcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809818.1 transl_table 11 codon_start 1 locus_tag LOCUS_10640 gene arcB CDS complement(88869..89933) product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705361.1 transl_table 11 codon_start 1 locus_tag LOCUS_10650 gene uxuA CDS 90232..91251 product Zn-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096790.1 transl_table 11 codon_start 1 locus_tag LOCUS_10660 CDS 91335..92618 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000824230.1 transl_table 11 codon_start 1 locus_tag LOCUS_10670 CDS complement(92665..93582) product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296449.1 transl_table 11 codon_start 1 locus_tag LOCUS_10680 CDS 94269..98729 product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001364217.1 transl_table 11 codon_start 1 locus_tag LOCUS_10690 gene gltB CDS 98742..100160 product glutamate synthase subunit GltD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000081705.1 transl_table 11 codon_start 1 locus_tag LOCUS_10700 gene gltD CDS 100419..101669 product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076275.1 transl_table 11 codon_start 1 locus_tag LOCUS_10710 gene codB CDS 101659..102939 product cytosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001180693.1 transl_table 11 codon_start 1 locus_tag LOCUS_10720 CDS complement(103036..103503) product N-acetylneuraminate anomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000979902.1 transl_table 11 codon_start 1 locus_tag LOCUS_10730 gene nanQ CDS complement(103500..104375) product N-acetylmannosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000208982.1 transl_table 11 codon_start 1 locus_tag LOCUS_10740 gene nanK CDS complement(104372..105061) product N-acetylmannosamine-6-phosphate 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300570.1 transl_table 11 codon_start 1 locus_tag LOCUS_10750 CDS complement(105109..106599) product sialic acid transporter NanT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000108473.1 transl_table 11 codon_start 1 locus_tag LOCUS_10760 gene nanT CDS complement(106694..107587) product N-acetylneuraminate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001029662.1 transl_table 11 codon_start 1 locus_tag LOCUS_10770 gene nanA CDS complement(107708..108490) product transcriptional regulator NanR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000382926.1 transl_table 11 codon_start 1 locus_tag LOCUS_10780 gene nanR CDS complement(108611..109111) product ClpXP protease specificity-enhancing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000366112.1 transl_table 11 codon_start 1 locus_tag LOCUS_10790 gene sspB CDS complement(109117..109755) product stringent starvation protein SspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257300.1 transl_table 11 codon_start 1 locus_tag LOCUS_10800 gene sspA CDS complement(110058..110450) product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829818.1 transl_table 11 codon_start 1 locus_tag LOCUS_10810 gene rpsI CDS complement(110466..110894) product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000847559.1 transl_table 11 codon_start 1 locus_tag LOCUS_10820 gene rplM CDS complement(111133..112254) product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192347.1 transl_table 11 codon_start 1 locus_tag LOCUS_10830 gene zapE CDS 112448..112846 product Z-ring associated protein ZapG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000481183.1 transl_table 11 codon_start 1 locus_tag LOCUS_10840 gene zapG CDS 113017..114384 product serine endoprotease DegQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000716695.1 transl_table 11 codon_start 1 locus_tag LOCUS_10850 gene degQ CDS 114474..115541 product outer membrane-stress sensor serine endopeptidase DegS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000497705.1 transl_table 11 codon_start 1 locus_tag LOCUS_10860 gene degS CDS complement(115636..116574) product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295272.1 transl_table 11 codon_start 1 locus_tag LOCUS_10870 gene mdh CDS 116989..117459 product transcriptional regulator ArgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001257846.1 transl_table 11 codon_start 1 locus_tag LOCUS_10880 gene argR CDS 117828..118091 product peroxide/acid stress response protein YhcN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098973.1 transl_table 11 codon_start 1 locus_tag LOCUS_10890 gene yhcN CDS complement(118241..118420) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10900 CDS complement(118683..119219) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10910 CDS complement(119216..119380) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10920 CDS complement(119395..119604) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10930 sequence008 source 1..111180 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(971..1177) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10940 tRNA complement(3674..3761) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00120 CDS complement(4088..4306) product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040187.1 transl_table 11 codon_start 1 locus_tag LOCUS_10950 gene infA CDS complement(4604..5308) product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001241673.1 transl_table 11 codon_start 1 locus_tag LOCUS_10960 gene aat CDS complement(5351..7072) product cysteine/glutathione ABC transporter ATP-binding protein/permease CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001202188.1 transl_table 11 codon_start 1 locus_tag LOCUS_10970 gene cydC CDS complement(7073..8767) product cysteine/glutathione ABC transporter permease/ATP-binding protein CydD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044527.1 transl_table 11 codon_start 1 locus_tag LOCUS_10980 gene cydD CDS complement(8954..9922) product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000537432.1 transl_table 11 codon_start 1 locus_tag LOCUS_10990 gene trxB CDS complement(9930..10139) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11000 CDS 10467..10961 product leucine-responsive transcriptional regulator Lrp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228469.1 transl_table 11 codon_start 1 locus_tag LOCUS_11010 gene lrp CDS 11103..15083 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11020 CDS 15229..15840 product outer membrane lipoprotein chaperone LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295343.1 transl_table 11 codon_start 1 locus_tag LOCUS_11030 gene lolA CDS 15849..17192 product replication-associated recombination protein RarA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000067785.1 transl_table 11 codon_start 1 locus_tag LOCUS_11040 gene rarA CDS 17284..18576 product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000886697.1 transl_table 11 codon_start 1 locus_tag LOCUS_11050 gene serS CDS 18802..21246 product dimethylsulfoxide reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000850260.1 transl_table 11 codon_start 1 locus_tag LOCUS_11060 gene dmsA CDS 21257..21874 product dimethylsulfoxide reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000213069.1 transl_table 11 codon_start 1 locus_tag LOCUS_11070 gene dmsB CDS 21876..22739 product dimethyl sulfoxide reductase anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000534681.1 transl_table 11 codon_start 1 locus_tag LOCUS_11080 CDS complement(22870..23496) product isochorismate family cysteine hydrolase YcaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000165876.1 transl_table 11 codon_start 1 locus_tag LOCUS_11090 gene ycaC CDS 23810..24955 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000109295.1 transl_table 11 codon_start 1 locus_tag LOCUS_11100 CDS 25168..26592 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001134259.1 transl_table 11 codon_start 1 locus_tag LOCUS_11110 CDS complement(26587..27030) product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705656.1 transl_table 11 codon_start 1 locus_tag LOCUS_11120 CDS complement(27082..27993) product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391781.1 transl_table 11 codon_start 1 locus_tag LOCUS_11130 CDS complement(27993..28790) product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003389978.1 transl_table 11 codon_start 1 locus_tag LOCUS_11140 CDS complement(28803..30068) product PTS ascorbate transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222248.1 transl_table 11 codon_start 1 locus_tag LOCUS_11150 CDS complement(30086..30361) product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435756.1 transl_table 11 codon_start 1 locus_tag LOCUS_11160 CDS 30482..31330 product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001052933.1 transl_table 11 codon_start 1 locus_tag LOCUS_11170 CDS complement(31336..32127) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11180 CDS complement(32194..32934) product pyruvate formate lyase 1-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367479.1 transl_table 11 codon_start 1 locus_tag LOCUS_11190 gene pflA CDS complement(33126..35408) product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292799.1 transl_table 11 codon_start 1 locus_tag LOCUS_11200 gene pflB CDS complement(35466..36323) product formate transporter FocA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642539.1 transl_table 11 codon_start 1 locus_tag LOCUS_11210 gene focA CDS complement(36729..38489) product 30S ribosomal protein S12 methylthiotransferase accessory factor YcaO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301741.1 transl_table 11 codon_start 1 locus_tag LOCUS_11220 gene ycaO CDS 38626..39318 product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642849.1 transl_table 11 codon_start 1 locus_tag LOCUS_11230 CDS 39516..40604 product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029882989.1 transl_table 11 codon_start 1 locus_tag LOCUS_11240 gene serC CDS 40677..41960 product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097306.1 transl_table 11 codon_start 1 locus_tag LOCUS_11250 gene aroA CDS 42298..42981 product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125016.1 transl_table 11 codon_start 1 locus_tag LOCUS_11260 gene cmk CDS 43094..44767 product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140324.1 transl_table 11 codon_start 1 locus_tag LOCUS_11270 gene rpsA CDS 44922..45206 product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167332.1 transl_table 11 codon_start 1 locus_tag LOCUS_11280 gene ihfB CDS 45407..47671 product ComEC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000705724.1 transl_table 11 codon_start 1 locus_tag LOCUS_11290 CDS 47708..49456 product lipid A ABC transporter ATP-binding protein/permease MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000551246.1 transl_table 11 codon_start 1 locus_tag LOCUS_11300 gene msbA CDS 49453..50430 product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000561698.1 transl_table 11 codon_start 1 locus_tag LOCUS_11310 gene lpxK CDS 50472..51704 product crosslink repair DNA glycosylase YcaQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000056536.1 transl_table 11 codon_start 1 locus_tag LOCUS_11320 gene ycaQ CDS 51756..51938 product protein YcaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000350058.1 transl_table 11 codon_start 1 locus_tag LOCUS_11330 gene ycaR CDS 51935..52681 product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000011612.1 transl_table 11 codon_start 1 locus_tag LOCUS_11340 gene kdsB CDS 52833..53726 product YcbJ family phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000436890.1 transl_table 11 codon_start 1 locus_tag LOCUS_11350 CDS complement(53791..54558) product envelope biogenesis factor ElyC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000899546.1 transl_table 11 codon_start 1 locus_tag LOCUS_11360 gene elyC CDS 54693..55505 product tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001154025.1 transl_table 11 codon_start 1 locus_tag LOCUS_11370 gene cmoM CDS 55498..56820 product chromosome partition protein MukF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001288827.1 transl_table 11 codon_start 1 locus_tag LOCUS_11380 gene mukF CDS 56801..57505 product chromosome partition protein MukE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295347.1 transl_table 11 codon_start 1 locus_tag LOCUS_11390 gene mukE CDS 57505..61953 product chromosome partition protein MukB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000572668.1 transl_table 11 codon_start 1 locus_tag LOCUS_11400 gene mukB CDS 62468..66487 product inverse autotransporter beta-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097618.1 transl_table 11 codon_start 1 locus_tag LOCUS_11410 CDS 66665..68485 product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097291.1 transl_table 11 codon_start 1 locus_tag LOCUS_11420 gene ldtD CDS 68663..69211 product YcbK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295932.1 transl_table 11 codon_start 1 locus_tag LOCUS_11430 CDS 69231..69878 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097289.1 transl_table 11 codon_start 1 locus_tag LOCUS_11440 CDS complement(69963..71153) product aspartate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000462680.1 transl_table 11 codon_start 1 locus_tag LOCUS_11450 gene aspC CDS complement(71337..72461) product porin OmpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000977905.1 transl_table 11 codon_start 1 locus_tag LOCUS_11460 gene ompF CDS complement(73047..74447) product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000117883.1 transl_table 11 codon_start 1 locus_tag LOCUS_11470 gene asnS CDS complement(74612..75814) product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001305916.1 transl_table 11 codon_start 1 locus_tag LOCUS_11480 gene pncB CDS 76081..78693 product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000193813.1 transl_table 11 codon_start 1 locus_tag LOCUS_11490 gene pepN CDS complement(78865..79632) product aliphatic sulfonates ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001090487.1 transl_table 11 codon_start 1 locus_tag LOCUS_11500 gene ssuB CDS complement(79629..80420) product aliphatic sulfonate ABC transporter permease SsuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000235203.1 transl_table 11 codon_start 1 locus_tag LOCUS_11510 gene ssuC CDS complement(80432..81577) product FMNH2-dependent alkanesulfonate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000055996.1 transl_table 11 codon_start 1 locus_tag LOCUS_11520 gene ssuD CDS complement(81574..82548) product aliphatic sulfonate ABC transporter substrate-binding protein SsuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226260.1 transl_table 11 codon_start 1 locus_tag LOCUS_11530 gene ssuA CDS complement(82541..83116) product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097270.1 transl_table 11 codon_start 1 locus_tag LOCUS_11540 gene ssuE CDS 83360..84370 product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295934.1 transl_table 11 codon_start 1 locus_tag LOCUS_11550 gene pyrD CDS 84547..85089 product cell division protein ZapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295353.1 transl_table 11 codon_start 1 locus_tag LOCUS_11560 gene zapC CDS complement(85086..86153) product 6-N-hydroxylaminopurine resistance protein YcbX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000258204.1 transl_table 11 codon_start 1 locus_tag LOCUS_11570 gene ycbX CDS 86293..88401 product bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001086472.1 transl_table 11 codon_start 1 locus_tag LOCUS_11580 gene rlmKL CDS 88414..90321 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000053089.1 transl_table 11 codon_start 1 locus_tag LOCUS_11590 CDS 90336..91598 product membrane integrity-associated transporter subunit PqiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000333164.1 transl_table 11 codon_start 1 locus_tag LOCUS_11600 gene pqiA CDS 91588..93228 product intermembrane transport protein PqiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000433416.1 transl_table 11 codon_start 1 locus_tag LOCUS_11610 gene pqiB CDS 93225..93788 product membrane integrity-associated transporter subunit PqiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000759136.1 transl_table 11 codon_start 1 locus_tag LOCUS_11620 gene pqiC CDS complement(94307..94825) product bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097260.1 transl_table 11 codon_start 1 locus_tag LOCUS_11630 gene fabA CDS complement(94894..96654) product Lon protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000156455.1 transl_table 11 codon_start 1 locus_tag LOCUS_11640 CDS 96840..97292 product macrodomain Ter protein MatP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000877174.1 transl_table 11 codon_start 1 locus_tag LOCUS_11650 gene matP CDS complement(97375..98430) product porin OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011378625.1 transl_table 11 codon_start 1 locus_tag LOCUS_11660 gene ompA CDS complement(98786..99238) product cell division inhibitor SulA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000288723.1 transl_table 11 codon_start 1 locus_tag LOCUS_11670 gene sulA CDS 99513..100142 product TfoX/Sxy family DNA transformation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001202371.1 transl_table 11 codon_start 1 locus_tag LOCUS_11680 CDS complement(100096..102258) product YccS family putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000950867.1 transl_table 11 codon_start 1 locus_tag LOCUS_11690 gene yccS CDS complement(102276..102722) product YccF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001261222.1 transl_table 11 codon_start 1 locus_tag LOCUS_11700 CDS 102845..104899 product DNA helicase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000420536.1 transl_table 11 codon_start 1 locus_tag LOCUS_11710 gene helD CDS complement(104930..105388) product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000424181.1 transl_table 11 codon_start 1 locus_tag LOCUS_11720 gene mgsA CDS complement(105482..106144) product DUF2057 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000847791.1 transl_table 11 codon_start 1 locus_tag LOCUS_11730 CDS 106318..106731 product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097249.1 transl_table 11 codon_start 1 locus_tag LOCUS_11740 CDS complement(106784..107101) product heat shock protein HspQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000561983.1 transl_table 11 codon_start 1 locus_tag LOCUS_11750 gene hspQ CDS complement(107159..108349) product 23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116317.1 transl_table 11 codon_start 1 locus_tag LOCUS_11760 gene rlmI CDS 108444..108725 product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000072884.1 transl_table 11 codon_start 1 locus_tag LOCUS_11770 gene yccX CDS complement(108722..109051) product sulfurtransferase TusE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000904439.1 transl_table 11 codon_start 1 locus_tag LOCUS_11780 gene tusE CDS complement(109142..109801) product FtsH protease modulator YccA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000375136.1 transl_table 11 codon_start 1 locus_tag LOCUS_11790 gene yccA tRNA 110076..110163 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00130 CDS complement(110246..110875) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11800 note possible pseudo, frameshifted sequence009 source 1..109349 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1220..1513) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11810 note possible pseudo, internal stop codon CDS complement(1553..2584) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11820 note possible pseudo, internal stop codon CDS complement(2639..2944) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011550888.1 transl_table 11 codon_start 1 locus_tag LOCUS_11830 CDS complement(3010..4734) product NERD domain-containing protein/DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024133114.1 transl_table 11 codon_start 1 locus_tag LOCUS_11840 CDS complement(4933..5508) product Ail/Lom family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000605048.1 transl_table 11 codon_start 1 locus_tag LOCUS_11850 CDS complement(6051..6446) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11860 CDS complement(6424..6774) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11870 CDS complement(6882..7454) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11880 CDS complement(7484..7819) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11890 CDS complement(8032..8493) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11900 CDS complement(8480..17308) product hemagglutinin repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224144836.1 transl_table 11 codon_start 1 locus_tag LOCUS_11910 CDS complement(17324..17851) product cyclolysin-activating lysine-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929994.1 transl_table 11 codon_start 1 locus_tag LOCUS_11920 gene cyaC CDS complement(17861..19270) product ShlB/FhaC/HecB family hemolysin secretion/activation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704284.1 transl_table 11 codon_start 1 locus_tag LOCUS_11930 CDS complement(20412..20720) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124173.1 transl_table 11 codon_start 1 locus_tag LOCUS_11940 CDS complement(20741..21364) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001260266.1 transl_table 11 codon_start 1 locus_tag LOCUS_11950 CDS complement(21473..22339) product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000878218.1 transl_table 11 codon_start 1 locus_tag LOCUS_11960 CDS complement(22336..22635) product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000149473.1 transl_table 11 codon_start 1 locus_tag LOCUS_11970 CDS complement(23342..23725) product putative zinc ribbon protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000271022.1 transl_table 11 codon_start 1 locus_tag LOCUS_11980 CDS complement(23986..24555) product inovirus Gp2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000148641.1 transl_table 11 codon_start 1 locus_tag LOCUS_11990 CDS complement(25206..25418) product hemolysin expression modulator Hha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012908811.1 transl_table 11 codon_start 1 locus_tag LOCUS_12000 gene hha CDS 26119..26325 product AlpA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001095912.1 transl_table 11 codon_start 1 locus_tag LOCUS_12010 CDS 26411..26983 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001170560.1 transl_table 11 codon_start 1 locus_tag LOCUS_12020 CDS 28479..29498 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001388379.1 transl_table 11 codon_start 1 locus_tag LOCUS_12030 CDS 29608..30480 product GTPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001322100.1 transl_table 11 codon_start 1 locus_tag LOCUS_12040 CDS 30853..33699 product Ag43/Cah family autotransporter adhesin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000820574.1 transl_table 11 codon_start 1 locus_tag LOCUS_12050 CDS 34026..34844 product DUF932 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001234603.1 transl_table 11 codon_start 1 locus_tag LOCUS_12060 CDS 34935..35420 product antirestriction protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000214398.1 transl_table 11 codon_start 1 locus_tag LOCUS_12070 CDS 35436..35912 product RadC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001186738.1 transl_table 11 codon_start 1 locus_tag LOCUS_12080 CDS 35975..36196 product DUF987 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000692323.1 transl_table 11 codon_start 1 locus_tag LOCUS_12090 CDS 36215..36859 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000086757.1 transl_table 11 codon_start 1 locus_tag LOCUS_12100 CDS 36909..37277 product type IV toxin-antitoxin system YeeU family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012908802.1 transl_table 11 codon_start 1 locus_tag LOCUS_12110 CDS 37366..37743 product TA system toxin CbtA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000771609.1 transl_table 11 codon_start 1 locus_tag LOCUS_12120 CDS 37740..38228 product DUF5983 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976859.1 transl_table 11 codon_start 1 locus_tag LOCUS_12130 CDS 38245..38442 product DUF957 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000839270.1 transl_table 11 codon_start 1 locus_tag LOCUS_12140 CDS 38524..39009 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12150 note possible pseudo, internal stop codon CDS 39139..39369 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12160 note possible pseudo, internal stop codon CDS 39854..40141 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12170 note possible pseudo, frameshifted CDS complement(40807..40995) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000193665.1 transl_table 11 codon_start 1 locus_tag LOCUS_12180 CDS complement(41018..41368) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12190 note possible pseudo, internal stop codon CDS 42481..43086 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12200 CDS 42977..43510 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12210 CDS 43958..44131 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12220 CDS 44124..44405 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12230 CDS complement(44508..44813) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12240 CDS complement(45528..46097) product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147567.1 transl_table 11 codon_start 1 locus_tag LOCUS_12250 CDS complement(46746..47042) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016154338.1 transl_table 11 codon_start 1 locus_tag LOCUS_12260 CDS complement(47243..47539) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12270 CDS complement(48301..48930) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12280 CDS complement(48931..50364) product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817017.1 transl_table 11 codon_start 1 locus_tag LOCUS_12290 tRNA complement(50688..50761) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00140 CDS complement(50840..51589) product amidase activator ActS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272558.1 transl_table 11 codon_start 1 locus_tag LOCUS_12300 gene actS CDS 51863..52408 product isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000133998.1 transl_table 11 codon_start 1 locus_tag LOCUS_12310 gene idi CDS complement(52486..54003) product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098608.1 transl_table 11 codon_start 1 locus_tag LOCUS_12320 gene lysS CDS complement(54013..54894) product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001701073.1 transl_table 11 codon_start 1 locus_tag LOCUS_12330 gene prfB note possible pseudo, frameshifted CDS complement(55203..56936) product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000813193.1 transl_table 11 codon_start 1 locus_tag LOCUS_12340 gene recJ CDS complement(56942..57655) product bifunctional protein-disulfide isomerase/oxidoreductase DsbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000745614.1 transl_table 11 codon_start 1 locus_tag LOCUS_12350 gene dsbC CDS complement(57679..58605) product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098612.1 transl_table 11 codon_start 1 locus_tag LOCUS_12360 gene xerD CDS 58673..59197 product flavodoxin FldB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001055874.1 transl_table 11 codon_start 1 locus_tag LOCUS_12370 gene fldB CDS complement(59241..59648) product protein YgfX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000244777.1 transl_table 11 codon_start 1 locus_tag LOCUS_12380 CDS complement(59629..59895) product FAD assembly factor SdhE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000354046.1 transl_table 11 codon_start 1 locus_tag LOCUS_12390 gene sdhE CDS 60152..61132 product tRNA-modifying protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000886092.1 transl_table 11 codon_start 1 locus_tag LOCUS_12400 gene ygfZ CDS complement(61214..61876) product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000250289.1 transl_table 11 codon_start 1 locus_tag LOCUS_12410 CDS complement(62039..62350) product N(4)-acetylcytidine aminohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001182971.1 transl_table 11 codon_start 1 locus_tag LOCUS_12420 gene yqfB CDS 62540..62755 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12430 note possible pseudo, frameshifted CDS 62781..63974 product 6-phospho-beta-glucosidase BglA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369787.1 transl_table 11 codon_start 1 locus_tag LOCUS_12440 gene bglA note possible pseudo, frameshifted CDS complement(64115..66988) product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000195023.1 transl_table 11 codon_start 1 locus_tag LOCUS_12450 gene gcvP CDS complement(67161..67550) product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295377.1 transl_table 11 codon_start 1 locus_tag LOCUS_12460 gene gcvH CDS complement(67576..68670) product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000068738.1 transl_table 11 codon_start 1 locus_tag LOCUS_12470 gene gcvT CDS complement(69120..70322) product FAD-dependent 2-octaprenylphenol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192154.1 transl_table 11 codon_start 1 locus_tag LOCUS_12480 gene ubiI CDS complement(70566..71744) product 2-octaprenyl-6-methoxyphenyl hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000111225.1 transl_table 11 codon_start 1 locus_tag LOCUS_12490 gene ubiH CDS complement(71741..73057) product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000193684.1 transl_table 11 codon_start 1 locus_tag LOCUS_12500 gene pepP CDS complement(73085..73669) product YecA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027229.1 transl_table 11 codon_start 1 locus_tag LOCUS_12510 CDS 73831..74160 product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001276011.1 transl_table 11 codon_start 1 locus_tag LOCUS_12520 gene zapA CDS 74457..75005 product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621052.1 transl_table 11 codon_start 1 locus_tag LOCUS_12530 CDS 75010..75393 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12540 CDS 75845..76135 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12550 note possible pseudo, internal stop codon CDS 76160..76291 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12560 note possible pseudo, internal stop codon CDS complement(76394..77626) product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001151621.1 transl_table 11 codon_start 1 locus_tag LOCUS_12570 gene serA CDS complement(77882..78541) product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000189743.1 transl_table 11 codon_start 1 locus_tag LOCUS_12580 gene rpiA CDS 78702..79595 product DNA-binding transcriptional regulator ArgP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000828351.1 transl_table 11 codon_start 1 locus_tag LOCUS_12590 gene argP CDS complement(79600..80499) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095499.1 transl_table 11 codon_start 1 locus_tag LOCUS_12600 CDS complement(80492..81727) product multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001532645.1 transl_table 11 codon_start 1 locus_tag LOCUS_12610 gene nadR CDS complement(81947..83329) product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001029698.1 transl_table 11 codon_start 1 locus_tag LOCUS_12620 gene radA CDS complement(83404..84372) product phosphoserine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001132964.1 transl_table 11 codon_start 1 locus_tag LOCUS_12630 gene serB CDS 84490..85134 product YtjB family periplasmic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090060.1 transl_table 11 codon_start 1 locus_tag LOCUS_12640 CDS 85155..86171 product lipoate--protein ligase LplA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105844.1 transl_table 11 codon_start 1 locus_tag LOCUS_12650 gene lplA CDS 86362..87051 product DUF1120 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098963.1 transl_table 11 codon_start 1 locus_tag LOCUS_12660 CDS complement(87123..87842) product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224864.1 transl_table 11 codon_start 1 locus_tag LOCUS_12670 gene deoD CDS complement(87945..89168) product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095491.1 transl_table 11 codon_start 1 locus_tag LOCUS_12680 gene deoB CDS complement(89220..90542) product thymidine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000477838.1 transl_table 11 codon_start 1 locus_tag LOCUS_12690 gene deoA CDS complement(90699..91478) product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095489.1 transl_table 11 codon_start 1 locus_tag LOCUS_12700 gene deoC CDS 91740..93290 product YjjI family glycine radical enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001143253.1 transl_table 11 codon_start 1 locus_tag LOCUS_12710 CDS 93262..94125 product YjjW family glycine radical enzyme activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001088367.1 transl_table 11 codon_start 1 locus_tag LOCUS_12720 CDS complement(94157..94933) product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000119010.1 transl_table 11 codon_start 1 locus_tag LOCUS_12730 CDS complement(94930..96003) product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000531551.1 transl_table 11 codon_start 1 locus_tag LOCUS_12740 CDS complement(96127..96288) product DUF1328 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000176651.1 transl_table 11 codon_start 1 locus_tag LOCUS_12750 CDS complement(96416..97033) product molecular chaperone OsmY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000178963.1 transl_table 11 codon_start 1 locus_tag LOCUS_12760 gene osmY CDS complement(97440..99026) product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000175968.1 transl_table 11 codon_start 1 locus_tag LOCUS_12770 gene prfC CDS 100886..101173 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12780 note possible pseudo, internal stop codon, frameshifted CDS 101492..102145 product type III secretion system effector ADP-ribosyltransferase EspJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000022458.1 transl_table 11 codon_start 1 locus_tag LOCUS_12790 gene espJ CDS 103010..103603 product DUF1076 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012908743.1 transl_table 11 codon_start 1 locus_tag LOCUS_12800 CDS complement(103968..104537) product T3SS effector caspase inhibitor NleF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000938103.1 transl_table 11 codon_start 1 locus_tag LOCUS_12810 gene nleF CDS complement(104603..105349) product type III secretion system effector kinase NleH1-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000950979.1 transl_table 11 codon_start 1 locus_tag LOCUS_12820 gene nleH1-2 CDS complement(105624..105851) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12830 note possible pseudo, internal stop codon, frameshifted CDS 106825..107712 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12840 sequence010 source 1..103498 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(4..1605) product multicopper oxidase CueO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001189657.1 transl_table 11 codon_start 1 locus_tag LOCUS_12850 gene cueO CDS 1722..2069 product YacC family pilotin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295568.1 transl_table 11 codon_start 1 locus_tag LOCUS_12860 CDS 2174..3040 product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818411.1 transl_table 11 codon_start 1 locus_tag LOCUS_12870 gene speE CDS 3056..3850 product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000734301.1 transl_table 11 codon_start 1 locus_tag LOCUS_12880 gene speD CDS complement(4162..4941) product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000678254.1 transl_table 11 codon_start 1 locus_tag LOCUS_12890 CDS complement(4951..5934) product D-threonate 4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000448742.1 transl_table 11 codon_start 1 locus_tag LOCUS_12900 CDS complement(5924..7195) product D-threonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000783298.1 transl_table 11 codon_start 1 locus_tag LOCUS_12910 CDS complement(7192..8145) product 2-keto-3-deoxygluconate permease 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001022089.1 transl_table 11 codon_start 1 locus_tag LOCUS_12920 CDS complement(8327..8689) product protein YacL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000384306.1 transl_table 11 codon_start 1 locus_tag LOCUS_12930 gene yacL CDS complement(8891..11488) product bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095602.1 transl_table 11 codon_start 1 locus_tag LOCUS_12940 gene acnB CDS 11890..13506 product DUF3300 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000174529.1 transl_table 11 codon_start 1 locus_tag LOCUS_12950 CDS 13519..14310 product DUF2950 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000757452.1 transl_table 11 codon_start 1 locus_tag LOCUS_12960 CDS complement(14389..15813) product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001519338.1 transl_table 11 codon_start 1 locus_tag LOCUS_12970 gene lpdA CDS complement(16012..17622) product pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095598.1 transl_table 11 codon_start 1 locus_tag LOCUS_12980 gene aceF CDS complement(17637..20300) product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003851.1 transl_table 11 codon_start 1 locus_tag LOCUS_12990 gene aceE CDS complement(20459..21223) product pyruvate dehydrogenase complex transcriptional repressor PdhR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331776.1 transl_table 11 codon_start 1 locus_tag LOCUS_13000 gene pdhR CDS 21786..23159 product aromatic amino acid transporter AroP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095594.1 transl_table 11 codon_start 1 locus_tag LOCUS_13010 gene aroP CDS 23319..24725 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000357550.1 transl_table 11 codon_start 1 locus_tag LOCUS_13020 CDS 24725..25675 product family 43 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000024772.1 transl_table 11 codon_start 1 locus_tag LOCUS_13030 CDS complement(25908..26762) product beta-lactamase regulator AmpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000171985.1 transl_table 11 codon_start 1 locus_tag LOCUS_13040 gene ampE CDS complement(26759..27322) product 1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000936326.1 transl_table 11 codon_start 1 locus_tag LOCUS_13050 gene ampD CDS 27410..28303 product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001135168.1 transl_table 11 codon_start 1 locus_tag LOCUS_13060 gene nadC CDS 28502..28954 product prepilin peptidase-dependent pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000360891.1 transl_table 11 codon_start 1 locus_tag LOCUS_13070 gene ppdD CDS 28951..30336 product type II secretion system protein GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001025202.1 transl_table 11 codon_start 1 locus_tag LOCUS_13080 gene gspE CDS 30326..31528 product protein transport protein HofC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000157271.1 transl_table 11 codon_start 1 locus_tag LOCUS_13090 gene hofC CDS complement(31600..32643) product GMP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001217338.1 transl_table 11 codon_start 1 locus_tag LOCUS_13100 gene guaC CDS 32869..33489 product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001269520.1 transl_table 11 codon_start 1 locus_tag LOCUS_13110 gene coaE CDS 33489..34232 product cell division protein ZapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000557441.1 transl_table 11 codon_start 1 locus_tag LOCUS_13120 gene zapD CDS 34242..34436 product DNA gyrase inhibitor YacG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000005042.1 transl_table 11 codon_start 1 locus_tag LOCUS_13130 gene yacG CDS complement(34536..34934) product 8-oxo-dGTP diphosphatase MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000736063.1 transl_table 11 codon_start 1 locus_tag LOCUS_13140 gene mutT CDS complement(35041..37746) product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000905763.1 transl_table 11 codon_start 1 locus_tag LOCUS_13150 gene secA CDS complement(37808..38365) product secA translation cis-regulator SecM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000014320.1 transl_table 11 codon_start 1 locus_tag LOCUS_13160 gene secM CDS complement(38590..39507) product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000595474.1 transl_table 11 codon_start 1 locus_tag LOCUS_13170 gene lpxC CDS complement(39608..40759) product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004857884.1 transl_table 11 codon_start 1 locus_tag LOCUS_13180 gene ftsZ CDS complement(40876..42138) product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000588463.1 transl_table 11 codon_start 1 locus_tag LOCUS_13190 gene ftsA CDS complement(42135..42965) product cell division protein FtsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000075728.1 transl_table 11 codon_start 1 locus_tag LOCUS_13200 gene ftsQ CDS complement(42967..43887) product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130059.1 transl_table 11 codon_start 1 locus_tag LOCUS_13210 gene ddlB CDS complement(43880..45355) product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096072.1 transl_table 11 codon_start 1 locus_tag LOCUS_13220 gene murC CDS complement(45413..46480) product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000016560.1 transl_table 11 codon_start 1 locus_tag LOCUS_13230 gene murG CDS complement(46477..47721) product cell division protein FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001239803.1 transl_table 11 codon_start 1 locus_tag LOCUS_13240 gene ftsW CDS complement(47721..49037) product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000796441.1 transl_table 11 codon_start 1 locus_tag LOCUS_13250 gene murD CDS complement(49040..50122) product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501985.1 transl_table 11 codon_start 1 locus_tag LOCUS_13260 gene mraY CDS complement(50116..51474) product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626670.1 transl_table 11 codon_start 1 locus_tag LOCUS_13270 gene murF CDS complement(51471..52886) product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000775075.1 transl_table 11 codon_start 1 locus_tag LOCUS_13280 gene murE CDS complement(52945..54702) product peptidoglycan glycosyltransferase FtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642235.1 transl_table 11 codon_start 1 locus_tag LOCUS_13290 gene ftsI CDS complement(54718..55083) product cell division protein FtsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625651.1 transl_table 11 codon_start 1 locus_tag LOCUS_13300 gene ftsL CDS complement(55080..56021) product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000970440.1 transl_table 11 codon_start 1 locus_tag LOCUS_13310 gene rsmH CDS complement(56023..56481) product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000488291.1 transl_table 11 codon_start 1 locus_tag LOCUS_13320 gene mraZ CDS complement(57096..58127) product catabolite repressor/activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000762401.1 transl_table 11 codon_start 1 locus_tag LOCUS_13330 gene cra CDS complement(58358..58849) product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001563086.1 transl_table 11 codon_start 1 locus_tag LOCUS_13340 gene ilvN CDS complement(58852..60408) product acetolactate synthase 3 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000425632.1 transl_table 11 codon_start 1 locus_tag LOCUS_13350 gene ilvI CDS 60409..60591 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13360 CDS complement(60903..61748) product transcriptional regulator LeuO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001115424.1 transl_table 11 codon_start 1 locus_tag LOCUS_13370 gene leuO CDS 62688..64259 product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000082846.1 transl_table 11 codon_start 1 locus_tag LOCUS_13380 gene leuA CDS 64259..65350 product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000042356.1 transl_table 11 codon_start 1 locus_tag LOCUS_13390 gene leuB CDS 65353..66753 product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140652.1 transl_table 11 codon_start 1 locus_tag LOCUS_13400 gene leuC CDS 66764..67369 product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818262.1 transl_table 11 codon_start 1 locus_tag LOCUS_13410 gene leuD CDS complement(67487..68665) product sugar efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095558.1 transl_table 11 codon_start 1 locus_tag LOCUS_13420 CDS complement(68737..68934) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13430 CDS 69003..70658 product DNA-binding transcriptional regulator SgrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297366.1 transl_table 11 codon_start 1 locus_tag LOCUS_13440 gene sgrR CDS 70845..71828 product thiamine ABC transporter substrate binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001306203.1 transl_table 11 codon_start 1 locus_tag LOCUS_13450 gene thiB CDS 71804..73414 product thiamine/thiamine pyrophosphate ABC transporter permease ThiP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000235674.1 transl_table 11 codon_start 1 locus_tag LOCUS_13460 gene thiP CDS 73398..74108 product thiamine ABC transporter ATP-binding protein ThiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000915973.1 transl_table 11 codon_start 1 locus_tag LOCUS_13470 gene thiQ CDS complement(74293..75060) product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001148403.1 transl_table 11 codon_start 1 locus_tag LOCUS_13480 CDS complement(75146..76024) product arabinose operon transcriptional regulator AraC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300811.1 transl_table 11 codon_start 1 locus_tag LOCUS_13490 gene araC CDS 76363..78072 product ribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000951805.1 transl_table 11 codon_start 1 locus_tag LOCUS_13500 gene araB CDS 78083..79585 product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000151715.1 transl_table 11 codon_start 1 locus_tag LOCUS_13510 gene araA CDS 79811..80506 product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000888666.1 transl_table 11 codon_start 1 locus_tag LOCUS_13520 gene araD CDS complement(80542..80925) product DUF4751 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001103153.1 transl_table 11 codon_start 1 locus_tag LOCUS_13530 CDS 81330..83681 product DNA polymerase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000035641.1 transl_table 11 codon_start 1 locus_tag LOCUS_13540 gene polB CDS 83880..86786 product RNA polymerase-associated protein RapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001116972.1 transl_table 11 codon_start 1 locus_tag LOCUS_13550 gene rapA CDS 86798..87457 product bifunctional tRNA pseudouridine(32) synthase/23S rRNA pseudouridine(746) synthase RluA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000525176.1 transl_table 11 codon_start 1 locus_tag LOCUS_13560 gene rluA CDS complement(87567..88382) product co-chaperone DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001200573.1 transl_table 11 codon_start 1 locus_tag LOCUS_13570 gene djlA CDS 88637..90994 product LPS assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000746151.1 transl_table 11 codon_start 1 locus_tag LOCUS_13580 gene lptD CDS 91048..92334 product peptidylprolyl isomerase SurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000800457.1 transl_table 11 codon_start 1 locus_tag LOCUS_13590 gene surA CDS 92334..93323 product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000241259.1 transl_table 11 codon_start 1 locus_tag LOCUS_13600 gene pdxA CDS 93320..94141 product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001065372.1 transl_table 11 codon_start 1 locus_tag LOCUS_13610 gene rsmA CDS 94144..94521 product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000610896.1 transl_table 11 codon_start 1 locus_tag LOCUS_13620 gene apaG CDS 94532..95380 product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) ApaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257211.1 transl_table 11 codon_start 1 locus_tag LOCUS_13630 gene apaH CDS complement(95425..95904) product type 3 dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000624378.1 transl_table 11 codon_start 1 locus_tag LOCUS_13640 gene folA CDS complement(96089..97963) product glutathione-regulated potassium-efflux system protein KefC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000377186.1 transl_table 11 codon_start 1 locus_tag LOCUS_13650 gene kefC CDS complement(97956..98486) product glutathione-regulated potassium-efflux system oxidoreductase KefF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000600737.1 transl_table 11 codon_start 1 locus_tag LOCUS_13660 gene kefF CDS 99076..101739 product autotransporter outer membrane beta-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186277866.1 transl_table 11 codon_start 1 locus_tag LOCUS_13670 CDS complement(101792..102025) product YgdI/YgdR family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095533.1 transl_table 11 codon_start 1 locus_tag LOCUS_13680 CDS complement(102130..103404) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001183198.1 transl_table 11 codon_start 1 locus_tag LOCUS_13690 sequence011 source 1..95864 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(60..1403) product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000372866.1 transl_table 11 codon_start 1 locus_tag LOCUS_13700 gene gdhA CDS 1640..1915 product YnjH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000085233.1 transl_table 11 codon_start 1 locus_tag LOCUS_13710 CDS complement(1875..2288) product CTP pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000781866.1 transl_table 11 codon_start 1 locus_tag LOCUS_13720 gene nudG CDS 2367..2936 product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097040.1 transl_table 11 codon_start 1 locus_tag LOCUS_13730 CDS 2929..3552 product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001371603.1 transl_table 11 codon_start 1 locus_tag LOCUS_13740 CDS complement(3588..4895) product thiosulfate sulfurtransferase YnjE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298226.1 transl_table 11 codon_start 1 locus_tag LOCUS_13750 gene ynjE CDS complement(4982..5614) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602300.1 transl_table 11 codon_start 1 locus_tag LOCUS_13760 CDS complement(5614..7149) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224939.1 transl_table 11 codon_start 1 locus_tag LOCUS_13770 CDS complement(7122..8285) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001215309.1 transl_table 11 codon_start 1 locus_tag LOCUS_13780 CDS complement(8288..8962) product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097034.1 transl_table 11 codon_start 1 locus_tag LOCUS_13790 CDS complement(8972..9778) product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000673909.1 transl_table 11 codon_start 1 locus_tag LOCUS_13800 gene xthA CDS 10223..11443 product succinylornithine/acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000082001.1 transl_table 11 codon_start 1 locus_tag LOCUS_13810 gene astC CDS 11440..12474 product arginine N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000989429.1 transl_table 11 codon_start 1 locus_tag LOCUS_13820 gene astA CDS 12471..13949 product succinylglutamate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000177206.1 transl_table 11 codon_start 1 locus_tag LOCUS_13830 gene astD CDS 13946..15289 product N-succinylarginine dihydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000994973.1 transl_table 11 codon_start 1 locus_tag LOCUS_13840 gene astB CDS 15282..16250 product succinylglutamate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000368506.1 transl_table 11 codon_start 1 locus_tag LOCUS_13850 gene astE CDS 16599..17084 product ATP-independent periplasmic protein-refolding chaperone Spy inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001228991.1 transl_table 11 codon_start 1 locus_tag LOCUS_13860 gene spy CDS complement(17249..18046) product excinuclease Cho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000252363.1 transl_table 11 codon_start 1 locus_tag LOCUS_13870 gene cho CDS complement(18254..19081) product ammonia-dependent NAD(+) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000174989.1 transl_table 11 codon_start 1 locus_tag LOCUS_13880 gene nadE CDS 19300..19641 product osmotically-inducible lipoprotein OsmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001039301.1 transl_table 11 codon_start 1 locus_tag LOCUS_13890 gene osmE CDS 19939..20259 product PTS N,N'-diacetylchitobiose transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000412161.1 transl_table 11 codon_start 1 locus_tag LOCUS_13900 gene chbB CDS 20342..21604 product PTS N,N'-diacetylchitobiose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000073041.1 transl_table 11 codon_start 1 locus_tag LOCUS_13910 gene chbC CDS 21508..21699 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13920 note possible pseudo, frameshifted CDS 21752..22102 product PTS N,N'-diacetylchitobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000968919.1 transl_table 11 codon_start 1 locus_tag LOCUS_13930 gene chbA CDS 22113..22958 product transcriptional regulator ChbR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000983647.1 transl_table 11 codon_start 1 locus_tag LOCUS_13940 gene chbR CDS 23080..24435 product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000078748.1 transl_table 11 codon_start 1 locus_tag LOCUS_13950 gene celF CDS 24447..25205 product chitin disaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000442732.1 transl_table 11 codon_start 1 locus_tag LOCUS_13960 gene chbG CDS complement(25256..27514) product catalase HPII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019093.1 transl_table 11 codon_start 1 locus_tag LOCUS_13970 gene katE CDS complement(28029..29420) product cystine/sulfocysteine:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001010711.1 transl_table 11 codon_start 1 locus_tag LOCUS_13980 gene tcyP CDS complement(29555..30142) product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295408.1 transl_table 11 codon_start 1 locus_tag LOCUS_13990 CDS complement(30238..30999) product 2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097013.1 transl_table 11 codon_start 1 locus_tag LOCUS_14000 gene kduD CDS complement(31149..31817) product hexitol phosphatase HxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000106859.1 transl_table 11 codon_start 1 locus_tag LOCUS_14010 gene hxpB CDS 31944..32480 product YniB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000222158.1 transl_table 11 codon_start 1 locus_tag LOCUS_14020 CDS complement(32525..33385) product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000267670.1 transl_table 11 codon_start 1 locus_tag LOCUS_14030 CDS complement(33492..33782) product type V toxin-antitoxin system endoribonuclease antitoxin GhoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000146133.1 transl_table 11 codon_start 1 locus_tag LOCUS_14040 gene ghoS CDS complement(33883..34815) product 6-phosphofructokinase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000251727.1 transl_table 11 codon_start 1 locus_tag LOCUS_14050 gene pfkB CDS 35103..35861 product YdiY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000771396.1 transl_table 11 codon_start 1 locus_tag LOCUS_14060 CDS 36127..36345 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097006.1 transl_table 11 codon_start 1 locus_tag LOCUS_14070 CDS 36962..38830 product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001144226.1 transl_table 11 codon_start 1 locus_tag LOCUS_14080 gene thrS CDS 38942..39376 product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000058403.1 transl_table 11 codon_start 1 locus_tag LOCUS_14090 gene infC CDS 39474..39671 product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001124225.1 transl_table 11 codon_start 1 locus_tag LOCUS_14100 gene rpmI CDS 39791..40147 product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124850.1 transl_table 11 codon_start 1 locus_tag LOCUS_14110 gene rplT CDS 40557..41540 product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000018588.1 transl_table 11 codon_start 1 locus_tag LOCUS_14120 gene pheS CDS 41556..43943 product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000672328.1 transl_table 11 codon_start 1 locus_tag LOCUS_14130 gene pheT CDS 43948..44247 product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001229265.1 transl_table 11 codon_start 1 locus_tag LOCUS_14140 gene ihfA CDS 44348..45337 product vitamin B12 ABC transporter permease BtuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000956518.1 transl_table 11 codon_start 1 locus_tag LOCUS_14150 gene btuC CDS 45399..45950 product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181565.1 transl_table 11 codon_start 1 locus_tag LOCUS_14160 CDS 45950..46696 product vitamin B12 ABC transporter ATP-binding protein BtuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000029466.1 transl_table 11 codon_start 1 locus_tag LOCUS_14170 gene btuD CDS 46768..47232 product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001213259.1 transl_table 11 codon_start 1 locus_tag LOCUS_14180 CDS 47456..48169 product anti-FlhDC factor YdiV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000561998.1 transl_table 11 codon_start 1 locus_tag LOCUS_14190 gene ydiV CDS 48231..49673 product protein adenylyltransferase SelO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000175592.1 transl_table 11 codon_start 1 locus_tag LOCUS_14200 gene selO CDS complement(49710..49898) product hemin uptake protein HemP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000089115.1 transl_table 11 codon_start 1 locus_tag LOCUS_14210 gene hemP CDS complement(50032..51078) product 3-deoxy-7-phosphoheptulonate synthase AroH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001082192.1 transl_table 11 codon_start 1 locus_tag LOCUS_14220 gene aroH CDS complement(51235..52077) product posphoenolpyruvate synthetase regulatory kinase/phosphorylase PpsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000370992.1 transl_table 11 codon_start 1 locus_tag LOCUS_14230 gene ppsR CDS 52403..54781 product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000069371.1 transl_table 11 codon_start 1 locus_tag LOCUS_14240 gene ppsA CDS complement(54816..55574) product type I 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000860178.1 transl_table 11 codon_start 1 locus_tag LOCUS_14250 gene aroD CDS 55945..57345 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096978.1 transl_table 11 codon_start 1 locus_tag LOCUS_14260 CDS 57349..59724 product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096977.1 transl_table 11 codon_start 1 locus_tag LOCUS_14270 CDS 60139..60327 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14280 CDS 60327..64802 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14290 CDS 64804..65232 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14300 CDS 65361..66011 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14310 CDS 66013..66183 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14320 CDS complement(66833..67945) product AI-2E family transporter YdiK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000248612.1 transl_table 11 codon_start 1 locus_tag LOCUS_14330 gene ydiK CDS 68160..71216 product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000612968.1 transl_table 11 codon_start 1 locus_tag LOCUS_14340 CDS 71213..71623 product 1,4-dihydroxy-2-naphthoyl-CoA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000637930.1 transl_table 11 codon_start 1 locus_tag LOCUS_14350 gene menI CDS 71723..71911 product YdiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638607.1 transl_table 11 codon_start 1 locus_tag LOCUS_14360 CDS 72441..72809 product Fe-S cluster assembly scaffold SufA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000418973.1 transl_table 11 codon_start 1 locus_tag LOCUS_14370 gene sufA CDS 72818..74305 product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000089364.1 transl_table 11 codon_start 1 locus_tag LOCUS_14380 gene sufB CDS 74315..75061 product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000948872.1 transl_table 11 codon_start 1 locus_tag LOCUS_14390 gene sufC CDS 75036..76307 product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096954.1 transl_table 11 codon_start 1 locus_tag LOCUS_14400 gene sufD CDS 76304..77524 product cysteine desulfurase SufS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000144556.1 transl_table 11 codon_start 1 locus_tag LOCUS_14410 gene sufS CDS 77537..77953 product cysteine desulfuration protein SufE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196530.1 transl_table 11 codon_start 1 locus_tag LOCUS_14420 gene sufE CDS 78077..79066 product L,D-transpeptidase LdtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000817107.1 transl_table 11 codon_start 1 locus_tag LOCUS_14430 gene ldtE CDS complement(79134..79370) product murein lipoprotein Lpp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001082307.1 transl_table 11 codon_start 1 locus_tag LOCUS_14440 gene lpp CDS 79501..79692 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14450 CDS complement(79680..81092) product pyruvate kinase PykF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000751448.1 transl_table 11 codon_start 1 locus_tag LOCUS_14460 gene pykF CDS 81277..81570 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14470 CDS 81617..82639 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096947.1 transl_table 11 codon_start 1 locus_tag LOCUS_14480 CDS 82632..83300 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096946.1 transl_table 11 codon_start 1 locus_tag LOCUS_14490 CDS 83321..84133 product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096945.1 transl_table 11 codon_start 1 locus_tag LOCUS_14500 CDS 84285..84494 product fumarate hydratase FumD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096944.1 transl_table 11 codon_start 1 locus_tag LOCUS_14510 gene fumD CDS 84977..85603 product ferredoxin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001070227.1 transl_table 11 codon_start 1 locus_tag LOCUS_14520 CDS 85624..87726 product aldehyde ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273527.1 transl_table 11 codon_start 1 locus_tag LOCUS_14530 CDS 87737..88384 product YdhW family putative oxidoreductase system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001571509.1 transl_table 11 codon_start 1 locus_tag LOCUS_14540 CDS 88435..89103 product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001412436.1 transl_table 11 codon_start 1 locus_tag LOCUS_14550 CDS 89100..89885 product thiosulfate reductase cytochrome B subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001070009.1 transl_table 11 codon_start 1 locus_tag LOCUS_14560 CDS 89866..90699 product protein YdhT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000587570.1 transl_table 11 codon_start 1 locus_tag LOCUS_14570 gene ydhT CDS complement(90704..91381) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704525.1 transl_table 11 codon_start 1 locus_tag LOCUS_14580 CDS complement(91371..91928) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14590 note possible pseudo, internal stop codon CDS complement(91992..92150) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14600 note possible pseudo, internal stop codon CDS complement(92150..92968) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704527.1 transl_table 11 codon_start 1 locus_tag LOCUS_14610 CDS complement(92970..93788) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_182015315.1 transl_table 11 codon_start 1 locus_tag LOCUS_14620 CDS complement(94014..94154) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705194.1 transl_table 11 codon_start 1 locus_tag LOCUS_14630 misc_feature complement(94237..>95864) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000716942.1:FAD-NAD(P)-binding protein locus_tag LOCUS_14640 sequence012 source 1..94415 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(65..2821) product two-component sensor histidine kinase BarA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000186405.1 transl_table 11 codon_start 1 locus_tag LOCUS_14650 gene barA CDS 2933..4177 product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000046780.1 transl_table 11 codon_start 1 locus_tag LOCUS_14660 gene rlmD CDS 4229..6463 product GTP diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000226841.1 transl_table 11 codon_start 1 locus_tag LOCUS_14670 gene relA CDS 6531..7322 product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098517.1 transl_table 11 codon_start 1 locus_tag LOCUS_14680 gene mazG CDS 7546..9183 product CTP synthase (glutamine hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000210863.1 transl_table 11 codon_start 1 locus_tag LOCUS_14690 gene pyrG CDS 9272..10570 product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000036734.1 transl_table 11 codon_start 1 locus_tag LOCUS_14700 gene eno repeat_region 10860..11864 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtgttccccgcgccagcggggataaaccg CDS 11928..12599 product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001199961.1 transl_table 11 codon_start 1 locus_tag LOCUS_14710 gene queE CDS complement(12635..14023) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705664.1 transl_table 11 codon_start 1 locus_tag LOCUS_14720 CDS complement(14050..15219) product M20 aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366269.1 transl_table 11 codon_start 1 locus_tag LOCUS_14730 CDS 15386..17716 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705665.1 transl_table 11 codon_start 1 locus_tag LOCUS_14740 CDS complement(17723..18088) product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000987944.1 transl_table 11 codon_start 1 locus_tag LOCUS_14750 gene queD CDS complement(18274..18480) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14760 CDS 18389..20188 product NADPH-dependent assimilatory sulfite reductase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211901.1 transl_table 11 codon_start 1 locus_tag LOCUS_14770 gene cysJ CDS 20188..21900 product assimilatory sulfite reductase (NADPH) hemoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001290706.1 transl_table 11 codon_start 1 locus_tag LOCUS_14780 gene cysI CDS 22000..22734 product phosphoadenosine phosphosulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000039862.1 transl_table 11 codon_start 1 locus_tag LOCUS_14790 gene cysH CDS 23096..25582 product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001233965.1 transl_table 11 codon_start 1 locus_tag LOCUS_14800 CDS 26078..27637 product type I-E CRISPR-associated protein Cse1/CasA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046083149.1 transl_table 11 codon_start 1 locus_tag LOCUS_14810 gene casA CDS 27634..28170 product type I-E CRISPR-associated protein Cse2/CasB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000029331.1 transl_table 11 codon_start 1 locus_tag LOCUS_14820 gene casB CDS 28184..29239 product type I-E CRISPR-associated protein Cas7/Cse4/CasC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000206445.1 transl_table 11 codon_start 1 locus_tag LOCUS_14830 gene cas7e CDS 29250..29996 product type I-E CRISPR-associated protein Cas5/CasD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000085058.1 transl_table 11 codon_start 1 locus_tag LOCUS_14840 gene cas5e CDS 29978..30628 product type I-E CRISPR-associated protein Cas6/Cse3/CasE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281463.1 transl_table 11 codon_start 1 locus_tag LOCUS_14850 gene cas6e CDS 30673..31548 product type I-E CRISPR-associated endonuclease Cas1e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000144847.1 transl_table 11 codon_start 1 locus_tag LOCUS_14860 gene cas1e CDS 31545..31829 product type I-E CRISPR-associated endoribonuclease Cas2e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000063176.1 transl_table 11 codon_start 1 locus_tag LOCUS_14870 gene cas2e repeat_region 31935..32389 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq aagttccccgcgcgagcggggatagaccg CDS 32916..33197 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14880 CDS complement(33287..34324) product alkaline phosphatase isozyme conversion aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000490413.1 transl_table 11 codon_start 1 locus_tag LOCUS_14890 gene iap CDS 34602..35510 product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000372392.1 transl_table 11 codon_start 1 locus_tag LOCUS_14900 gene cysD CDS 35520..36947 product sulfate adenylyltransferase subunit CysN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001090348.1 transl_table 11 codon_start 1 locus_tag LOCUS_14910 gene cysN CDS 36947..37552 product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173653.1 transl_table 11 codon_start 1 locus_tag LOCUS_14920 gene cysC CDS 37599..37922 product DUF3561 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001246103.1 transl_table 11 codon_start 1 locus_tag LOCUS_14930 CDS 38107..38418 product cell division protein FtsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000517476.1 transl_table 11 codon_start 1 locus_tag LOCUS_14940 gene ftsB CDS 38437..39132 product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000246155.1 transl_table 11 codon_start 1 locus_tag LOCUS_14950 gene ispD CDS 39260..39739 product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703296.1 transl_table 11 codon_start 1 locus_tag LOCUS_14960 gene ispF CDS 39736..40785 product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000134253.1 transl_table 11 codon_start 1 locus_tag LOCUS_14970 gene truD CDS 40766..41527 product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001221538.1 transl_table 11 codon_start 1 locus_tag LOCUS_14980 gene surE CDS 41521..42147 product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000253542.1 transl_table 11 codon_start 1 locus_tag LOCUS_14990 CDS 42276..43403 product murein hydrolase activator NlpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272624.1 transl_table 11 codon_start 1 locus_tag LOCUS_15000 gene nlpD CDS 43465..44457 product RNA polymerase sigma factor RpoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000081550.1 transl_table 11 codon_start 1 locus_tag LOCUS_15010 gene rpoS CDS complement(44583..44987) product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000423338.1 transl_table 11 codon_start 1 locus_tag LOCUS_15020 CDS 45157..45750 product non-oxidative hydroxyarylic acid decarboxylases subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001237176.1 transl_table 11 codon_start 1 locus_tag LOCUS_15030 CDS 45750..47177 product non-oxidative hydroxyarylic acid decarboxylases subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863165.1 transl_table 11 codon_start 1 locus_tag LOCUS_15040 CDS 47188..47424 product non-oxidative hydroxyarylic acid decarboxylases subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000562964.1 transl_table 11 codon_start 1 locus_tag LOCUS_15050 CDS 47578..48117 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15060 CDS complement(48222..50783) product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000103863.1 transl_table 11 codon_start 1 locus_tag LOCUS_15070 gene mutS CDS complement(50914..51780) product iron/manganese ABC transporter permease subunit SitD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000477918.1 transl_table 11 codon_start 1 locus_tag LOCUS_15080 gene sitD CDS complement(51771..52628) product iron/manganese ABC transporter permease subunit SitC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001104338.1 transl_table 11 codon_start 1 locus_tag LOCUS_15090 gene sitC CDS complement(52628..53443) product iron/manganese ABC transporter ATP-binding protein SitB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000083163.1 transl_table 11 codon_start 1 locus_tag LOCUS_15100 gene sitB CDS complement(53440..54357) product iron/manganese ABC transporter substrate-binding protein SitA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000182930.1 transl_table 11 codon_start 1 locus_tag LOCUS_15110 gene sitA CDS 54559..54903 product nitrous oxide-stimulated promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001117938.1 transl_table 11 codon_start 1 locus_tag LOCUS_15120 CDS complement(55002..57083) product formate hydrogenlyase transcriptional activator FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000122695.1 transl_table 11 codon_start 1 locus_tag LOCUS_15130 gene flhA CDS complement(57228..58238) product hydrogenase maturation carbamoyl dehydratase HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059931.1 transl_table 11 codon_start 1 locus_tag LOCUS_15140 gene hypE CDS complement(58235..59356) product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001212982.1 transl_table 11 codon_start 1 locus_tag LOCUS_15150 gene hypD CDS complement(59356..59628) product hydrogenase 3 maturation protein HypC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000334881.1 transl_table 11 codon_start 1 locus_tag LOCUS_15160 gene hypC CDS complement(59619..60491) product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000337682.1 transl_table 11 codon_start 1 locus_tag LOCUS_15170 gene hypB CDS complement(60550..60924) product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000544461.1 transl_table 11 codon_start 1 locus_tag LOCUS_15180 gene hypA CDS 61135..61596 product formate hydrogenlyase regulator HycA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000158056.1 transl_table 11 codon_start 1 locus_tag LOCUS_15190 gene hycA CDS 61730..62341 product formate hydrogenlyase subunit HycB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001079164.1 transl_table 11 codon_start 1 locus_tag LOCUS_15200 gene hycB CDS 62338..64164 product formate hydrogenlyase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000097032.1 transl_table 11 codon_start 1 locus_tag LOCUS_15210 gene hycC CDS 64167..65090 product respiratory chain complex I subunit 1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000110563.1 transl_table 11 codon_start 1 locus_tag LOCUS_15220 CDS 65108..66817 product formate hydrogenlyase subunit HycE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000461354.1 transl_table 11 codon_start 1 locus_tag LOCUS_15230 gene hycE CDS 66827..67369 product formate hydrogenlyase subunit HycF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000493767.1 transl_table 11 codon_start 1 locus_tag LOCUS_15240 gene hycF CDS 67369..68136 product formate hydrogenlyase subunit HycG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000067418.1 transl_table 11 codon_start 1 locus_tag LOCUS_15250 gene hycG CDS 68133..68543 product formate hydrogenlyase maturation HycH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003725.1 transl_table 11 codon_start 1 locus_tag LOCUS_15260 CDS 68536..69006 product hydrogenase maturation peptidase HycI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132980.1 transl_table 11 codon_start 1 locus_tag LOCUS_15270 gene hycI CDS 69093..69365 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069541.1 transl_table 11 codon_start 1 locus_tag LOCUS_15280 CDS 69365..69733 product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311244.1 transl_table 11 codon_start 1 locus_tag LOCUS_15290 CDS complement(69792..70028) product SymE family type I addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098482.1 transl_table 11 codon_start 1 locus_tag LOCUS_15300 CDS complement(70200..71624) product 6-phospho-beta-glucosidase AscB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000110378.1 transl_table 11 codon_start 1 locus_tag LOCUS_15310 gene ascB CDS complement(71647..73101) product PTS cellobiose/arbutin/salicin transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107885.1 transl_table 11 codon_start 1 locus_tag LOCUS_15320 gene ascF CDS 73375..74382 product DNA-binding transcriptional regulator AscG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001374632.1 transl_table 11 codon_start 1 locus_tag LOCUS_15330 gene ascG CDS 74525..75070 product electron transport protein HydN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078791.1 transl_table 11 codon_start 1 locus_tag LOCUS_15340 gene hydN CDS 75210..77453 product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000963417.1 transl_table 11 codon_start 1 locus_tag LOCUS_15350 gene hypF CDS complement(77705..78838) product NADH:flavorubredoxin reductase NorW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000086352.1 transl_table 11 codon_start 1 locus_tag LOCUS_15360 gene norW CDS complement(78835..80280) product anaerobic nitric oxide reductase flavorubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000025997.1 transl_table 11 codon_start 1 locus_tag LOCUS_15370 gene norV CDS 80468..81985 product nitric oxide reductase transcriptional regulator NorR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000010816.1 transl_table 11 codon_start 1 locus_tag LOCUS_15380 gene norR CDS complement(81982..82947) product arabinose-5-phosphate isomerase GutQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287415.1 transl_table 11 codon_start 1 locus_tag LOCUS_15390 gene gutQ CDS complement(82940..83713) product glucitol operon DNA-binding transcriptional repressor SrlR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000804546.1 transl_table 11 codon_start 1 locus_tag LOCUS_15400 gene srlR CDS complement(83782..84141) product transcriptional regulator GutM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000255198.1 transl_table 11 codon_start 1 locus_tag LOCUS_15410 gene gutM CDS complement(84239..85018) product sorbitol-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001077354.1 transl_table 11 codon_start 1 locus_tag LOCUS_15420 gene srlD CDS complement(85029..85391) product PTS glucitol/sorbitol transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000111554.1 transl_table 11 codon_start 1 locus_tag LOCUS_15430 gene srlB CDS complement(85403..86374) product PTS glucitol/sorbitol transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000199043.1 transl_table 11 codon_start 1 locus_tag LOCUS_15440 CDS complement(86371..86934) product PTS glucitol/sorbitol transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098444.1 transl_table 11 codon_start 1 locus_tag LOCUS_15450 gene srlA CDS 87197..88276 product lytic murein transglycosylase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000476820.1 transl_table 11 codon_start 1 locus_tag LOCUS_15460 gene mltB CDS 88489..88986 product nicotinamide-nucleotide amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132231.1 transl_table 11 codon_start 1 locus_tag LOCUS_15470 gene pncC CDS 89079..90140 product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000963150.1 transl_table 11 codon_start 1 locus_tag LOCUS_15480 gene recA CDS 90253..90753 product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140508.1 transl_table 11 codon_start 1 locus_tag LOCUS_15490 gene recX CDS 90961..93588 product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047238.1 transl_table 11 codon_start 1 locus_tag LOCUS_15500 gene alaS CDS 93827..94012 product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000906486.1 transl_table 11 codon_start 1 locus_tag LOCUS_15510 gene csrA tRNA 94322..94414 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00150 sequence013 source 1..94359 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 352..726 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15520 CDS 723..1196 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15530 CDS 1245..1700 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15540 CDS complement(2716..2958) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15550 CDS complement(2945..3280) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15560 note possible pseudo, internal stop codon, frameshifted CDS complement(3550..6759) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15570 note possible pseudo, frameshifted CDS complement(6731..8539) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15580 CDS 9478..9663 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15590 note possible pseudo, frameshifted CDS complement(9934..10131) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15600 note possible pseudo, frameshifted CDS complement(10283..10588) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15610 note possible pseudo, frameshifted CDS complement(10618..10776) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15620 note possible pseudo, frameshifted CDS 12147..12425 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001303943.1 transl_table 11 codon_start 1 locus_tag LOCUS_15630 CDS complement(12544..13122) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15640 CDS 13822..14391 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15650 CDS 14615..14935 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15660 CDS 17138..17584 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15670 CDS 18169..18582 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15680 note possible pseudo, internal stop codon CDS 19114..19362 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15690 CDS complement(19485..19844) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15700 CDS 20340..20912 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15710 CDS 20946..22166 product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074383.1 transl_table 11 codon_start 1 locus_tag LOCUS_15720 CDS 22168..24321 product peptidase domain-containing ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004545619.1 transl_table 11 codon_start 1 locus_tag LOCUS_15730 CDS 24467..24772 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15740 note possible pseudo, internal stop codon, frameshifted CDS 24792..25034 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15750 CDS 25193..25441 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15760 note possible pseudo, internal stop codon, frameshifted CDS 25489..25641 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15770 note possible pseudo, frameshifted CDS 25777..26085 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15780 CDS complement(26298..26516) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15790 CDS 26654..26974 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15800 CDS 27151..28344 product purine ribonucleoside efflux pump NepI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001004798.1 transl_table 11 codon_start 1 locus_tag LOCUS_15810 gene nepI CDS complement(28441..29817) product carbohydrate porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094819.1 transl_table 11 codon_start 1 locus_tag LOCUS_15820 CDS complement(30016..30318) product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008500136.1 transl_table 11 codon_start 1 locus_tag LOCUS_15830 CDS complement(30331..31713) product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001270464.1 transl_table 11 codon_start 1 locus_tag LOCUS_15840 CDS complement(31734..33065) product PTS cellobiose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094821.1 transl_table 11 codon_start 1 locus_tag LOCUS_15850 CDS complement(33080..33394) product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094822.1 transl_table 11 codon_start 1 locus_tag LOCUS_15860 CDS 33685..34641 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094823.1 transl_table 11 codon_start 1 locus_tag LOCUS_15870 CDS 34879..35295 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703859.1 transl_table 11 codon_start 1 locus_tag LOCUS_15880 CDS complement(35346..36248) product carboxylate/amino acid/amine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000535948.1 transl_table 11 codon_start 1 locus_tag LOCUS_15890 CDS 36440..36961 product anti-virulence regulator CigR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366928.1 transl_table 11 codon_start 1 locus_tag LOCUS_15900 CDS complement(37008..37526) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15910 CDS 37649..37876 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15920 CDS complement(38054..38722) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15930 CDS complement(39072..39773) product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097474.1 transl_table 11 codon_start 1 locus_tag LOCUS_15940 CDS complement(39766..42123) product fimbrial biogenesis outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703285.1 transl_table 11 codon_start 1 locus_tag LOCUS_15950 CDS complement(42189..42716) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15960 CDS 43176..46901 product serine protease autotransporter toxin Sat inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001034079.1 transl_table 11 codon_start 1 locus_tag LOCUS_15970 gene sat CDS 47110..47610 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15980 CDS 47823..48653 product aggregative adherence transcriptional regulator AggR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000769457.1 transl_table 11 codon_start 1 locus_tag LOCUS_15990 gene aggR CDS complement(48781..49368) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16000 CDS complement(49496..50284) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16010 CDS complement(50309..50926) product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211590.1 transl_table 11 codon_start 1 locus_tag LOCUS_16020 CDS complement(51689..52639) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16030 CDS 53089..53352 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16040 CDS 53613..54410 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16050 CDS complement(54592..54798) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16060 CDS 54847..55914 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16070 CDS 55938..57071 product CpaE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213784.1 transl_table 11 codon_start 1 locus_tag LOCUS_16080 CDS 57149..58408 product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213785.1 transl_table 11 codon_start 1 locus_tag LOCUS_16090 CDS 58408..59310 product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261283.1 transl_table 11 codon_start 1 locus_tag LOCUS_16100 CDS 59319..60170 product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817202.1 transl_table 11 codon_start 1 locus_tag LOCUS_16110 CDS 60155..61459 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16120 CDS 61483..61941 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16130 CDS 61984..62346 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003656109.1 transl_table 11 codon_start 1 locus_tag LOCUS_16140 CDS 62395..62757 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003656109.1 transl_table 11 codon_start 1 locus_tag LOCUS_16150 CDS 63057..63617 product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212573.1 transl_table 11 codon_start 1 locus_tag LOCUS_16160 CDS 63614..64069 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16170 CDS 64081..64629 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16180 CDS complement(64786..64944) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16190 CDS 65128..65640 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16200 CDS 65609..66220 product tight adherence pilus pseudopilin TadF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817205.1 transl_table 11 codon_start 1 locus_tag LOCUS_16210 gene tadF CDS 66267..68177 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16220 CDS 68197..69486 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16230 CDS 69562..70176 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16240 tRNA complement(70364..70458) product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00160 CDS 70748..72139 product glycoside-pentoside-hexuronide family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000834259.1 transl_table 11 codon_start 1 locus_tag LOCUS_16250 CDS 72142..74460 product alpha-xylosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000703001.1 transl_table 11 codon_start 1 locus_tag LOCUS_16260 gene yicI CDS complement(74560..76269) product AsmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000766661.1 transl_table 11 codon_start 1 locus_tag LOCUS_16270 CDS complement(76390..77781) product xanthine/proton symporter XanP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295238.1 transl_table 11 codon_start 1 locus_tag LOCUS_16280 gene xanP CDS 78003..79208 product sodium/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000468836.1 transl_table 11 codon_start 1 locus_tag LOCUS_16290 gene gltS CDS complement(79252..81333) product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000678419.1 transl_table 11 codon_start 1 locus_tag LOCUS_16300 gene recG CDS complement(81339..82028) product tRNA (guanosine(18)-2'-O)-methyltransferase TrmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001070193.1 transl_table 11 codon_start 1 locus_tag LOCUS_16310 gene trmH CDS complement(82033..84150) product bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000280473.1 transl_table 11 codon_start 1 locus_tag LOCUS_16320 gene spoT CDS complement(84169..84444) product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135058.1 transl_table 11 codon_start 1 locus_tag LOCUS_16330 gene rpoZ CDS complement(84499..85122) product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000046966.1 transl_table 11 codon_start 1 locus_tag LOCUS_16340 gene gmk CDS 85378..87060 product NAD-dependent DNA ligase LigB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000870036.1 transl_table 11 codon_start 1 locus_tag LOCUS_16350 gene ligB CDS complement(87192..87671) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16360 note possible pseudo, internal stop codon, frameshifted CDS complement(87922..88785) product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621352.1 transl_table 11 codon_start 1 locus_tag LOCUS_16370 CDS 88911..89627 product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001247078.1 transl_table 11 codon_start 1 locus_tag LOCUS_16380 gene rph CDS 89705..90346 product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703811.1 transl_table 11 codon_start 1 locus_tag LOCUS_16390 gene pyrE CDS complement(90429..91025) product nucleoid occlusion factor SlmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818603.1 transl_table 11 codon_start 1 locus_tag LOCUS_16400 gene slmA CDS complement(91135..91593) product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020077682.1 transl_table 11 codon_start 1 locus_tag LOCUS_16410 gene dut CDS complement(91571..92794) product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000050139.1 transl_table 11 codon_start 1 locus_tag LOCUS_16420 gene coaBC CDS 92965..93630 product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000380129.1 transl_table 11 codon_start 1 locus_tag LOCUS_16430 gene radC CDS 93897..94133 product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001519051.1 transl_table 11 codon_start 1 locus_tag LOCUS_16440 gene rpmB CDS 94156..94323 product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001051798.1 transl_table 11 codon_start 1 locus_tag LOCUS_16450 gene rpmG sequence014 source 1..93884 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1146 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013096268.1:bifunctional acetaldehyde-CoA/alcohol dehydrogenase locus_tag LOCUS_16460 CDS complement(1274..1981) product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000068066.1 transl_table 11 codon_start 1 locus_tag LOCUS_16470 gene tdk CDS complement(1978..2184) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16480 CDS 2503..2916 product DNA-binding transcriptional regulator H-NS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287383.1 transl_table 11 codon_start 1 locus_tag LOCUS_16490 gene hns CDS complement(3061..3969) product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729450.1 transl_table 11 codon_start 1 locus_tag LOCUS_16500 gene galU CDS complement(4170..5183) product two-component system response regulator RssB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000193432.1 transl_table 11 codon_start 1 locus_tag LOCUS_16510 gene rssB CDS complement(5275..6174) product patatin-like phospholipase RssA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190792.1 transl_table 11 codon_start 1 locus_tag LOCUS_16520 gene rssA CDS 6421..6753 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16530 CDS 6772..7647 product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705100.1 transl_table 11 codon_start 1 locus_tag LOCUS_16540 gene purU tRNA 7805..7889 product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00170 tRNA 8100..8184 product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00180 CDS complement(8202..8360) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16550 CDS complement(8755..9432) product respiratory nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545591.1 transl_table 11 codon_start 1 locus_tag LOCUS_16560 gene narI CDS complement(9432..10142) product nitrate reductase molybdenum cofactor assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000571671.1 transl_table 11 codon_start 1 locus_tag LOCUS_16570 gene narJ CDS complement(10139..11674) product nitrate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000702629.1 transl_table 11 codon_start 1 locus_tag LOCUS_16580 gene narH CDS complement(11671..15414) product nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000032878.1 transl_table 11 codon_start 1 locus_tag LOCUS_16590 CDS complement(15861..17252) product nitrate transporter NarK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019848.1 transl_table 11 codon_start 1 locus_tag LOCUS_16600 gene narK CDS 17593..19389 product nitrate/nitrite two-component system sensor histidine kinase NarX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000476239.1 transl_table 11 codon_start 1 locus_tag LOCUS_16610 gene narX CDS 19382..20032 product two-component system response regulator NarL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001064595.1 transl_table 11 codon_start 1 locus_tag LOCUS_16620 gene narL CDS complement(20033..21439) product inverse autotransporter invasin YchO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000086194.1 transl_table 11 codon_start 1 locus_tag LOCUS_16630 gene ychO CDS complement(21541..24123) product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705092.1 transl_table 11 codon_start 1 locus_tag LOCUS_16640 CDS complement(24120..28112) product nitrite reductase large subunit NirB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096251.1 transl_table 11 codon_start 1 locus_tag LOCUS_16650 gene nirB CDS complement(28123..28911) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096250.1 transl_table 11 codon_start 1 locus_tag LOCUS_16660 CDS complement(28921..29796) product nitrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096249.1 transl_table 11 codon_start 1 locus_tag LOCUS_16670 gene ntrB CDS complement(29798..31057) product CmpA/NrtA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029882726.1 transl_table 11 codon_start 1 locus_tag LOCUS_16680 CDS complement(31285..32472) product nitrate regulatory protein NasR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705088.1 transl_table 11 codon_start 1 locus_tag LOCUS_16690 gene nasR CDS 32547..32900 product DsrE/DsrF/TusD sulfur relay family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705087.1 transl_table 11 codon_start 1 locus_tag LOCUS_16700 CDS 33207..33407 product DUF1883 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705086.1 transl_table 11 codon_start 1 locus_tag LOCUS_16710 CDS complement(33461..34156) product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096242.1 transl_table 11 codon_start 1 locus_tag LOCUS_16720 CDS complement(34352..34582) product putative cation transport regulator ChaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096240.1 transl_table 11 codon_start 1 locus_tag LOCUS_16730 gene chaB CDS 34855..35955 product sodium-potassium/proton antiporter ChaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367104.1 transl_table 11 codon_start 1 locus_tag LOCUS_16740 gene chaA CDS complement(36060..36914) product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000811046.1 transl_table 11 codon_start 1 locus_tag LOCUS_16750 gene kdsA CDS complement(36950..37759) product invasion regulator SirB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001257065.1 transl_table 11 codon_start 1 locus_tag LOCUS_16760 gene sirB1 CDS complement(37763..38155) product invasion regulator SirB2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000150667.1 transl_table 11 codon_start 1 locus_tag LOCUS_16770 gene sirB2 CDS complement(38149..38985) product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000456466.1 transl_table 11 codon_start 1 locus_tag LOCUS_16780 gene prmC CDS complement(38985..40067) product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000804726.1 transl_table 11 codon_start 1 locus_tag LOCUS_16790 gene prfA CDS complement(40106..41362) product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000173208.1 transl_table 11 codon_start 1 locus_tag LOCUS_16800 gene hemA CDS 41564..42187 product lipoprotein insertase outer membrane protein LolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000174482.1 transl_table 11 codon_start 1 locus_tag LOCUS_16810 gene lolB CDS 42184..43035 product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001260323.1 transl_table 11 codon_start 1 locus_tag LOCUS_16820 gene ispE CDS 43223..44248 product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001119392.1 transl_table 11 codon_start 1 locus_tag LOCUS_16830 gene prs CDS 44661..46316 product C4-dicarboxylic acid transporter DauA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001037188.1 transl_table 11 codon_start 1 locus_tag LOCUS_16840 gene dauA CDS complement(46372..46650) product stress-induced protein YchH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000823874.1 transl_table 11 codon_start 1 locus_tag LOCUS_16850 gene ychH CDS 46926..47510 product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000985595.1 transl_table 11 codon_start 1 locus_tag LOCUS_16860 gene pth CDS 47627..48718 product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000505850.1 transl_table 11 codon_start 1 locus_tag LOCUS_16870 gene ychF CDS complement(48809..51379) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16880 CDS complement(51382..53937) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16890 CDS complement(54250..54897) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16900 CDS complement(54918..55433) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16910 CDS complement(55446..56051) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16920 CDS complement(56419..58866) product fimbrial biogenesis outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096967.1 transl_table 11 codon_start 1 locus_tag LOCUS_16930 CDS complement(58957..59589) product fimbria/pilus periplasmic chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096968.1 transl_table 11 codon_start 1 locus_tag LOCUS_16940 CDS complement(59684..60214) product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419182.1 transl_table 11 codon_start 1 locus_tag LOCUS_16950 CDS 60569..61231 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096970.1 transl_table 11 codon_start 1 locus_tag LOCUS_16960 CDS 61286..61918 product hydrogen peroxide resistance inhibitor IprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295817.1 transl_table 11 codon_start 1 locus_tag LOCUS_16970 gene iprA CDS 62240..63946 product alpha,alpha-trehalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000841714.1 transl_table 11 codon_start 1 locus_tag LOCUS_16980 gene treA CDS complement(63995..66109) product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419884.1 transl_table 11 codon_start 1 locus_tag LOCUS_16990 CDS complement(66229..66483) product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000511315.1 transl_table 11 codon_start 1 locus_tag LOCUS_17000 CDS 66686..67420 product flagellar brake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020142.1 transl_table 11 codon_start 1 locus_tag LOCUS_17010 CDS complement(67421..68032) product membrane-bound lytic murein transglycosylase EmtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776974.1 transl_table 11 codon_start 1 locus_tag LOCUS_17020 gene emtA CDS 68180..69094 product muramoyltetrapeptide carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000051575.1 transl_table 11 codon_start 1 locus_tag LOCUS_17030 gene ldcA CDS 69191..70927 product potassium/proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000338376.1 transl_table 11 codon_start 1 locus_tag LOCUS_17040 CDS complement(70980..72050) product catabolic alanine racemase DadX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000197840.1 transl_table 11 codon_start 1 locus_tag LOCUS_17050 gene dadX CDS complement(72063..73361) product D-amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001266908.1 transl_table 11 codon_start 1 locus_tag LOCUS_17060 gene dadA CDS 73684..75216 product SpoVR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190855.1 transl_table 11 codon_start 1 locus_tag LOCUS_17070 CDS complement(75345..76064) product fatty acid metabolism transcriptional regulator FadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000234823.1 transl_table 11 codon_start 1 locus_tag LOCUS_17080 gene fadR CDS 76291..77835 product Na(+)/H(+) antiporter NhaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000406446.1 transl_table 11 codon_start 1 locus_tag LOCUS_17090 gene nhaB CDS 78029..78508 product disulfide bond formation protein DsbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000943475.1 transl_table 11 codon_start 1 locus_tag LOCUS_17100 gene dsbB CDS 78619..78960 product DUF1971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000018971.1 transl_table 11 codon_start 1 locus_tag LOCUS_17110 CDS complement(78984..79445) product YcgN family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000785857.1 transl_table 11 codon_start 1 locus_tag LOCUS_17120 CDS complement(79523..80182) product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000284280.1 transl_table 11 codon_start 1 locus_tag LOCUS_17130 CDS complement(80251..80544) product YcgL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001125720.1 transl_table 11 codon_start 1 locus_tag LOCUS_17140 CDS 80671..81369 product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000072527.1 transl_table 11 codon_start 1 locus_tag LOCUS_17150 gene minC CDS 81393..82205 product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101048.1 transl_table 11 codon_start 1 locus_tag LOCUS_17160 gene minD CDS 82209..82475 product cell division topological specificity factor MinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001185666.1 transl_table 11 codon_start 1 locus_tag LOCUS_17170 gene minE CDS complement(82604..83521) product DNA-binding transcriptional regulator DmlR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001061578.1 transl_table 11 codon_start 1 locus_tag LOCUS_17180 gene dmlR CDS 83625..84716 product multifunctional D-malate/3-isopropylmalate/tartarate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000978494.1 transl_table 11 codon_start 1 locus_tag LOCUS_17190 gene dmlA CDS complement(84726..85847) product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001109156.1 transl_table 11 codon_start 1 locus_tag LOCUS_17200 gene rnd CDS complement(85929..87614) product long-chain-fatty-acid--CoA ligase FadD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705923.1 transl_table 11 codon_start 1 locus_tag LOCUS_17210 gene fadD CDS complement(87819..88400) product Slp family lipoprotein YeaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000290570.1 transl_table 11 codon_start 1 locus_tag LOCUS_17220 gene yeaY CDS complement(88474..89169) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001220995.1 transl_table 11 codon_start 1 locus_tag LOCUS_17230 gene tsaB CDS complement(89227..91137) product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000128807.1 transl_table 11 codon_start 1 locus_tag LOCUS_17240 CDS 91267..91611 product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295493.1 transl_table 11 codon_start 1 locus_tag LOCUS_17250 CDS complement(91619..91798) product YoaH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008500497.1 transl_table 11 codon_start 1 locus_tag LOCUS_17260 CDS 91872..93233 product aminodeoxychorismate synthase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000854972.1 transl_table 11 codon_start 1 locus_tag LOCUS_17270 gene pabB CDS 93237..93815 product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000456725.1 transl_table 11 codon_start 1 locus_tag LOCUS_17280 sequence015 source 1..93205 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(40..543) product DNA starvation/stationary phase protection protein Dps inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100805.1 transl_table 11 codon_start 1 locus_tag LOCUS_17290 gene dps CDS complement(854..1741) product threonine/homoserine exporter RhtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001119538.1 transl_table 11 codon_start 1 locus_tag LOCUS_17300 gene rhtA CDS 2146..2661 product outer membrane protein OmpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000716763.1 transl_table 11 codon_start 1 locus_tag LOCUS_17310 gene ompX CDS complement(2733..4313) product phosphoethanolamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001089326.1 transl_table 11 codon_start 1 locus_tag LOCUS_17320 CDS complement(4591..4719) product manganase accumulation protein MntS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001001761.1 transl_table 11 codon_start 1 locus_tag LOCUS_17330 gene mntS CDS 4905..5378 product manganese-binding transcriptional regulator MntR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000533542.1 transl_table 11 codon_start 1 locus_tag LOCUS_17340 gene mntR CDS 5375..6484 product anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000056477.1 transl_table 11 codon_start 1 locus_tag LOCUS_17350 CDS complement(6562..7482) product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001056404.1 transl_table 11 codon_start 1 locus_tag LOCUS_17360 gene ldtB CDS 7708..9300 product ABC-F family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367567.1 transl_table 11 codon_start 1 locus_tag LOCUS_17370 CDS 9536..10390 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17380 CDS complement(10446..11714) product DUF1479 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000168797.1 transl_table 11 codon_start 1 locus_tag LOCUS_17390 CDS 12026..13960 product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269327.1 transl_table 11 codon_start 1 locus_tag LOCUS_17400 CDS complement(14003..14818) product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000217910.1 transl_table 11 codon_start 1 locus_tag LOCUS_17410 CDS complement(14946..17378) product glycyl radical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000192654.1 transl_table 11 codon_start 1 locus_tag LOCUS_17420 CDS complement(17383..18282) product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000576948.1 transl_table 11 codon_start 1 locus_tag LOCUS_17430 CDS 18416..19078 product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001305948.1 transl_table 11 codon_start 1 locus_tag LOCUS_17440 gene fsa CDS 19280..20224 product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000749532.1 transl_table 11 codon_start 1 locus_tag LOCUS_17450 CDS complement(20267..21016) product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829250.1 transl_table 11 codon_start 1 locus_tag LOCUS_17460 gene moeB CDS complement(21016..22251) product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000397340.1 transl_table 11 codon_start 1 locus_tag LOCUS_17470 gene moeA CDS 22436..23401 product beta-aspartyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000513775.1 transl_table 11 codon_start 1 locus_tag LOCUS_17480 gene iaaA CDS 23388..25259 product glutathione ABC transporter ATP-binding protein GsiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001538498.1 transl_table 11 codon_start 1 locus_tag LOCUS_17490 gene gsiA CDS 25288..26826 product glutathione ABC transporter substrate-binding protein GsiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000191432.1 transl_table 11 codon_start 1 locus_tag LOCUS_17500 gene gsiB CDS 26844..27764 product glutathione ABC transporter permease GsiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000936043.1 transl_table 11 codon_start 1 locus_tag LOCUS_17510 gene gsiC CDS 27767..28678 product glutathione ABC transporter permease GsiD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001236024.1 transl_table 11 codon_start 1 locus_tag LOCUS_17520 gene gsiD CDS complement(28766..30100) product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000073304.1 transl_table 11 codon_start 1 locus_tag LOCUS_17530 gene rimO CDS 30367..30750 product biofilm formation regulator BssR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000259651.1 transl_table 11 codon_start 1 locus_tag LOCUS_17540 gene bssR CDS 30858..31973 product aldose sugar dehydrogenase YliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000555053.1 transl_table 11 codon_start 1 locus_tag LOCUS_17550 gene yliI CDS complement(31970..33256) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170166.1 transl_table 11 codon_start 1 locus_tag LOCUS_17560 CDS complement(33279..34370) product cellulase family glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095405.1 transl_table 11 codon_start 1 locus_tag LOCUS_17570 CDS 34514..35524 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095404.1 transl_table 11 codon_start 1 locus_tag LOCUS_17580 CDS complement(35571..36197) product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000631908.1 transl_table 11 codon_start 1 locus_tag LOCUS_17590 CDS 36519..37646 product serine-type D-Ala-D-Ala carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000195961.1 transl_table 11 codon_start 1 locus_tag LOCUS_17600 gene dacC CDS complement(37691..38449) product DNA-binding transcriptional repressor DeoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000450106.1 transl_table 11 codon_start 1 locus_tag LOCUS_17610 gene deoR CDS complement(38521..39129) product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001520197.1 transl_table 11 codon_start 1 locus_tag LOCUS_17620 gene ybjG CDS 39676..40656 product multidrug efflux MFS transporter MdfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001330495.1 transl_table 11 codon_start 1 locus_tag LOCUS_17630 gene mdfA note possible pseudo, frameshifted CDS complement(40712..41524) product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000023559.1 transl_table 11 codon_start 1 locus_tag LOCUS_17640 CDS complement(41525..42733) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000217859.1 transl_table 11 codon_start 1 locus_tag LOCUS_17650 CDS 42818..43399 product DNA-binding transcriptional regulator RcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005020071.1 transl_table 11 codon_start 1 locus_tag LOCUS_17660 gene rcdA CDS complement(43505..43834) product NIPSNAP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001261097.1 transl_table 11 codon_start 1 locus_tag LOCUS_17670 CDS complement(44156..45841) product aspartate:alanine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001024851.1 transl_table 11 codon_start 1 locus_tag LOCUS_17680 CDS complement(46536..46799) product GrxA family glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000495513.1 transl_table 11 codon_start 1 locus_tag LOCUS_17690 CDS 46987..47709 product nitroreductase NfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097374.1 transl_table 11 codon_start 1 locus_tag LOCUS_17700 gene nfsA CDS 47770..48672 product 30S ribosomal protein S6--L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684361.1 transl_table 11 codon_start 1 locus_tag LOCUS_17710 gene rimK CDS 48761..49237 product YbjN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000624817.1 transl_table 11 codon_start 1 locus_tag LOCUS_17720 CDS 49590..50702 product spermidine/putrescine ABC transporter substrate-binding protein PotF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000126075.1 transl_table 11 codon_start 1 locus_tag LOCUS_17730 gene potF CDS 50808..51941 product putrescine ABC transporter ATP-binding subunit PotG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000996007.1 transl_table 11 codon_start 1 locus_tag LOCUS_17740 gene potG CDS 51951..52904 product putrescine ABC transporter permease PotH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105436.1 transl_table 11 codon_start 1 locus_tag LOCUS_17750 gene potH CDS 52901..53746 product putrescine ABC transporter permease PotI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001061634.1 transl_table 11 codon_start 1 locus_tag LOCUS_17760 gene potI CDS 53806..54285 product YbjO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097368.1 transl_table 11 codon_start 1 locus_tag LOCUS_17770 CDS 54472..55515 product 23S rRNA (uracil(747)-C(5))-methyltransferase RlmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001149722.1 transl_table 11 codon_start 1 locus_tag LOCUS_17780 gene rlmC CDS 55828..57135 product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000399316.1 transl_table 11 codon_start 1 locus_tag LOCUS_17790 CDS 57165..57485 product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000655510.1 transl_table 11 codon_start 1 locus_tag LOCUS_17800 CDS 57495..58982 product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000644038.1 transl_table 11 codon_start 1 locus_tag LOCUS_17810 CDS complement(59016..59747) product ABC transporter substrate-binding protein ArtJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000737538.1 transl_table 11 codon_start 1 locus_tag LOCUS_17820 gene artJ CDS complement(59920..60588) product arginine ABC transporter permease ArtM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000895396.1 transl_table 11 codon_start 1 locus_tag LOCUS_17830 gene artM CDS complement(60588..61304) product arginine ABC transporter permease ArtQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001001687.1 transl_table 11 codon_start 1 locus_tag LOCUS_17840 gene artQ CDS complement(61311..62042) product arginine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000756586.1 transl_table 11 codon_start 1 locus_tag LOCUS_17850 gene artJ CDS complement(62060..62788) product arginine ABC transporter ATP-binding protein ArtP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027205.1 transl_table 11 codon_start 1 locus_tag LOCUS_17860 gene artP CDS complement(63065..63580) product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001270657.1 transl_table 11 codon_start 1 locus_tag LOCUS_17870 CDS 63784..64107 product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001160725.1 transl_table 11 codon_start 1 locus_tag LOCUS_17880 CDS 64104..64937 product N-acetylmuramoyl-L-alanine amidase AmiD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001252135.1 transl_table 11 codon_start 1 locus_tag LOCUS_17890 gene amiD CDS complement(64977..65990) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000866904.1 transl_table 11 codon_start 1 locus_tag LOCUS_17900 CDS complement(66082..67518) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000079004.1 transl_table 11 codon_start 1 locus_tag LOCUS_17910 CDS complement(67529..68530) product low-specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000566341.1 transl_table 11 codon_start 1 locus_tag LOCUS_17920 gene ltaE CDS complement(68569..70287) product ubiquinone-dependent pyruvate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000815366.1 transl_table 11 codon_start 1 locus_tag LOCUS_17930 gene poxB CDS complement(70458..71426) product NADH oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000178665.1 transl_table 11 codon_start 1 locus_tag LOCUS_17940 gene hcr CDS complement(71438..73090) product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000458773.1 transl_table 11 codon_start 1 locus_tag LOCUS_17950 gene hcp CDS complement(73234..74133) product lysine exporter LysO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000491116.1 transl_table 11 codon_start 1 locus_tag LOCUS_17960 CDS complement(74292..74987) product aquaporin Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097330.1 transl_table 11 codon_start 1 locus_tag LOCUS_17970 gene aqpZ CDS 75389..77050 product ATP-dependent endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000599771.1 transl_table 11 codon_start 1 locus_tag LOCUS_17980 CDS complement(77047..77997) product VirK/YbjX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001682088.1 transl_table 11 codon_start 1 locus_tag LOCUS_17990 CDS 78143..79261 product macrolide transporter subunit MacA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000746460.1 transl_table 11 codon_start 1 locus_tag LOCUS_18000 gene macA CDS 79258..81204 product macrolide ABC transporter ATP-binding protein/permease MacB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000188136.1 transl_table 11 codon_start 1 locus_tag LOCUS_18010 gene macB CDS complement(81330..81551) product cold shock-like protein CspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000447499.1 transl_table 11 codon_start 1 locus_tag LOCUS_18020 gene cspD CDS 81873..82193 product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000520781.1 transl_table 11 codon_start 1 locus_tag LOCUS_18030 gene clpS CDS 82224..84500 product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000934058.1 transl_table 11 codon_start 1 locus_tag LOCUS_18040 gene clpA CDS complement(84569..85753) product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096690.1 transl_table 11 codon_start 1 locus_tag LOCUS_18050 CDS complement(85753..87927) product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000739071.1 transl_table 11 codon_start 1 locus_tag LOCUS_18060 CDS complement(87930..89429) product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000533850.1 transl_table 11 codon_start 1 locus_tag LOCUS_18070 misc_feature complement(89495..>93205) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014207470.1:Ig-like domain-containing protein locus_tag LOCUS_18080 sequence016 source 1..84467 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(37..1239) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000189048.1 transl_table 11 codon_start 1 locus_tag LOCUS_18090 CDS 1238..1462 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18100 CDS complement(1471..2172) product autotransporter outer membrane beta-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000637074.1 transl_table 11 codon_start 1 locus_tag LOCUS_18110 CDS 2330..2725 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18120 note possible pseudo, frameshifted CDS 2641..2913 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18130 note possible pseudo, frameshifted CDS 2888..3328 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000619903.1 transl_table 11 codon_start 1 locus_tag LOCUS_18140 CDS complement(3297..5621) product molybdopterin guanine dinucleotide-containing S/N-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000148449.1 transl_table 11 codon_start 1 locus_tag LOCUS_18150 CDS 5776..6438 product OmpA family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094980.1 transl_table 11 codon_start 1 locus_tag LOCUS_18160 CDS 6685..7659 product glyoxylate/hydroxypyruvate reductase GhrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000805027.1 transl_table 11 codon_start 1 locus_tag LOCUS_18170 gene ghrB CDS complement(7734..8444) product DUF3053 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190524.1 transl_table 11 codon_start 1 locus_tag LOCUS_18180 CDS 8885..10255 product aromatic acid/H+ symport family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703774.1 transl_table 11 codon_start 1 locus_tag LOCUS_18190 CDS 10509..10799 product HTH-type transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000455798.1 transl_table 11 codon_start 1 locus_tag LOCUS_18200 CDS 11067..11279 product RNA chaperone/antiterminator CspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000014594.1 transl_table 11 codon_start 1 locus_tag LOCUS_18210 gene cspA CDS 11433..11969 product copper-binding periplasmic metallochaperone CueP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047148.1 transl_table 11 codon_start 1 locus_tag LOCUS_18220 gene cueP CDS complement(12582..14651) product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094970.1 transl_table 11 codon_start 1 locus_tag LOCUS_18230 gene glyS CDS complement(14661..15572) product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001168544.1 transl_table 11 codon_start 1 locus_tag LOCUS_18240 gene glyQ CDS complement(15667..15969) product YsaB family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000605592.1 transl_table 11 codon_start 1 locus_tag LOCUS_18250 CDS 16144..17139 product O-acetyltransferase WecH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001182653.1 transl_table 11 codon_start 1 locus_tag LOCUS_18260 gene wecH CDS complement(17257..17619) product inner membrane protein YiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296517.1 transl_table 11 codon_start 1 locus_tag LOCUS_18270 gene yiaB CDS complement(17788..19242) product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000275334.1 transl_table 11 codon_start 1 locus_tag LOCUS_18280 gene xylB CDS complement(19341..20663) product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001149568.1 transl_table 11 codon_start 1 locus_tag LOCUS_18290 gene xylA CDS 20993..22171 product XylR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000459824.1 transl_table 11 codon_start 1 locus_tag LOCUS_18300 CDS complement(22278..22850) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18310 CDS 23419..25449 product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000761268.1 transl_table 11 codon_start 1 locus_tag LOCUS_18320 gene malS CDS 25621..26874 product valine--pyruvate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000144384.1 transl_table 11 codon_start 1 locus_tag LOCUS_18330 gene avtA CDS complement(26893..27366) product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602576.1 transl_table 11 codon_start 1 locus_tag LOCUS_18340 CDS complement(27604..27918) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18350 CDS complement(28327..29142) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000891824.1 transl_table 11 codon_start 1 locus_tag LOCUS_18360 CDS 29376..30776 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000204802.1 transl_table 11 codon_start 1 locus_tag LOCUS_18370 CDS 30787..32742 product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001101526.1 transl_table 11 codon_start 1 locus_tag LOCUS_18380 CDS complement(32895..34433) product aldehyde dehydrogenase AldB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000183998.1 transl_table 11 codon_start 1 locus_tag LOCUS_18390 gene aldB CDS 34599..35480 product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001188270.1 transl_table 11 codon_start 1 locus_tag LOCUS_18400 CDS complement(35597..36748) product L-threonine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000741501.1 transl_table 11 codon_start 1 locus_tag LOCUS_18410 gene yiaY CDS complement(36936..38783) product selenocysteine-specific translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000582436.1 transl_table 11 codon_start 1 locus_tag LOCUS_18420 gene selB CDS complement(38780..40171) product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000206275.1 transl_table 11 codon_start 1 locus_tag LOCUS_18430 gene selA CDS complement(40271..40879) product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000766681.1 transl_table 11 codon_start 1 locus_tag LOCUS_18440 CDS complement(40952..42088) product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000364934.1 transl_table 11 codon_start 1 locus_tag LOCUS_18450 CDS complement(42091..42453) product DUF3302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000479618.1 transl_table 11 codon_start 1 locus_tag LOCUS_18460 CDS 42983..44890 product PTS mannitol transporter subunit IICBA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000093247.1 transl_table 11 codon_start 1 locus_tag LOCUS_18470 gene mtlA CDS 45027..46175 product mannitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000645390.1 transl_table 11 codon_start 1 locus_tag LOCUS_18480 gene mtlD CDS 46172..46762 product mannitol operon repressor MtlR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000193201.1 transl_table 11 codon_start 1 locus_tag LOCUS_18490 gene mtlR CDS complement(46775..46990) product protein YibT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000517097.1 transl_table 11 codon_start 1 locus_tag LOCUS_18500 gene yibT CDS 47272..47634 product YibL family ribosome-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000665687.1 transl_table 11 codon_start 1 locus_tag LOCUS_18510 CDS 47890..49545 product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001055299.1 transl_table 11 codon_start 1 locus_tag LOCUS_18520 gene lldP CDS 49542..50318 product transcriptional regulator LldR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000636695.1 transl_table 11 codon_start 1 locus_tag LOCUS_18530 gene lldR CDS 50315..51172 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18540 note possible pseudo, frameshifted CDS 51093..51440 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18550 note possible pseudo, frameshifted CDS 51479..51958 product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000932331.1 transl_table 11 codon_start 1 locus_tag LOCUS_18560 gene trmL CDS complement(51998..52933) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000981551.1 transl_table 11 codon_start 1 locus_tag LOCUS_18570 CDS 53321..54517 product L-talarate/galactarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001218254.1 transl_table 11 codon_start 1 locus_tag LOCUS_18580 CDS 54590..55900 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703312.1 transl_table 11 codon_start 1 locus_tag LOCUS_18590 CDS complement(55996..56817) product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094922.1 transl_table 11 codon_start 1 locus_tag LOCUS_18600 gene cysE CDS complement(56896..57915) product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001076194.1 transl_table 11 codon_start 1 locus_tag LOCUS_18610 gene gpsA CDS complement(57915..58382) product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003382.1 transl_table 11 codon_start 1 locus_tag LOCUS_18620 gene secB CDS complement(58511..58762) product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010426371.1 transl_table 11 codon_start 1 locus_tag LOCUS_18630 gene grxC CDS complement(58812..59243) product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001156179.1 transl_table 11 codon_start 1 locus_tag LOCUS_18640 CDS 59489..61033 product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116577.1 transl_table 11 codon_start 1 locus_tag LOCUS_18650 gene gpmM CDS complement(61097..61324) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18660 CDS 61226..62326 product murein hydrolase activator EnvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000196271.1 transl_table 11 codon_start 1 locus_tag LOCUS_18670 gene envC CDS 62330..63277 product divergent polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001135520.1 transl_table 11 codon_start 1 locus_tag LOCUS_18680 CDS complement(63264..64298) product UDP-glucuronate:LPS(HepIII) glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000982122.1 transl_table 11 codon_start 1 locus_tag LOCUS_18690 gene waaH CDS complement(64531..65556) product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000645995.1 transl_table 11 codon_start 1 locus_tag LOCUS_18700 gene tdh CDS complement(65566..66762) product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001213794.1 transl_table 11 codon_start 1 locus_tag LOCUS_18710 gene kbl CDS 66977..67957 product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000587764.1 transl_table 11 codon_start 1 locus_tag LOCUS_18720 gene rfaD CDS 68037..69083 product ADP-heptose--LPS heptosyltransferase RfaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000699228.1 transl_table 11 codon_start 1 locus_tag LOCUS_18730 gene rfaF CDS 69087..70043 product lipopolysaccharide heptosyltransferase RfaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264548.1 transl_table 11 codon_start 1 locus_tag LOCUS_18740 gene rfaC CDS 70079..71296 product O-antigen ligase RfaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000958453.1 transl_table 11 codon_start 1 locus_tag LOCUS_18750 gene rfaL CDS complement(71350..72498) product lipopolysaccharide N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000591814.1 transl_table 11 codon_start 1 locus_tag LOCUS_18760 CDS complement(72584..73393) product 3-deoxy-D-manno-oct-2-ulosonate III transferase WaaZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000790279.1 transl_table 11 codon_start 1 locus_tag LOCUS_18770 gene waaZ CDS complement(73494..74192) product lipopolysaccharide core heptose(II) kinase RfaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000615254.1 transl_table 11 codon_start 1 locus_tag LOCUS_18780 gene rfaY CDS complement(74208..75224) product lipopolysaccharide 1,2-glucosyltransferase RfaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000376841.1 transl_table 11 codon_start 1 locus_tag LOCUS_18790 gene rfaJ CDS complement(75260..76282) product lipopolysaccharide 3-alpha-galactosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001188013.1 transl_table 11 codon_start 1 locus_tag LOCUS_18800 gene waaO CDS complement(76282..77367) product lipopolysaccharide 1,6-galactosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000683964.1 transl_table 11 codon_start 1 locus_tag LOCUS_18810 gene waaB CDS complement(77406..78341) product LPS core biosynthesis protein RfaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000158225.1 transl_table 11 codon_start 1 locus_tag LOCUS_18820 gene rfaS CDS complement(78376..79173) product lipopolysaccharide core heptose(I) kinase RfaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001357918.1 transl_table 11 codon_start 1 locus_tag LOCUS_18830 gene rfaP CDS complement(79166..80290) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000634259.1 transl_table 11 codon_start 1 locus_tag LOCUS_18840 CDS complement(80287..81357) product lipopolysaccharide core heptosyltransferase RfaQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001268851.1 transl_table 11 codon_start 1 locus_tag LOCUS_18850 gene rfaQ CDS 81770..83047 product lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000891584.1 transl_table 11 codon_start 1 locus_tag LOCUS_18860 gene waaA CDS 83056..83535 product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001171888.1 transl_table 11 codon_start 1 locus_tag LOCUS_18870 gene coaD CDS complement(83589..84398) product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001114533.1 transl_table 11 codon_start 1 locus_tag LOCUS_18880 gene mutM sequence017 source 1..78947 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(395..2242) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18890 CDS complement(2368..3507) product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001294246.1 transl_table 11 codon_start 1 locus_tag LOCUS_18900 gene queG CDS 3506..5053 product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295189.1 transl_table 11 codon_start 1 locus_tag LOCUS_18910 gene nnr CDS 5025..5486 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000981977.1 transl_table 11 codon_start 1 locus_tag LOCUS_18920 gene tsaE CDS 5503..6831 product N-acetylmuramoyl-L-alanine amidase AmiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000640365.1 transl_table 11 codon_start 1 locus_tag LOCUS_18930 gene amiB CDS 6841..8706 product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001122547.1 transl_table 11 codon_start 1 locus_tag LOCUS_18940 gene mutL CDS 8699..9649 product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001280339.1 transl_table 11 codon_start 1 locus_tag LOCUS_18950 gene miaA CDS 9734..10042 product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095287.1 transl_table 11 codon_start 1 locus_tag LOCUS_18960 gene hfq CDS 10117..11397 product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460357.1 transl_table 11 codon_start 1 locus_tag LOCUS_18970 gene hflX CDS 11539..12795 product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000312504.1 transl_table 11 codon_start 1 locus_tag LOCUS_18980 gene hflK CDS 12798..13802 product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095290.1 transl_table 11 codon_start 1 locus_tag LOCUS_18990 gene hflC CDS 13871..14068 product DUF2065 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001089295.1 transl_table 11 codon_start 1 locus_tag LOCUS_19000 CDS 14171..15469 product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006178975.1 transl_table 11 codon_start 1 locus_tag LOCUS_19010 CDS 15675..16100 product nitric oxide-sensing transcriptional repressor NsrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001177639.1 transl_table 11 codon_start 1 locus_tag LOCUS_19020 gene nsrR CDS 16139..18592 product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076316.1 transl_table 11 codon_start 1 locus_tag LOCUS_19030 gene rnr CDS 18658..19389 product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001293282.1 transl_table 11 codon_start 1 locus_tag LOCUS_19040 gene rlmB CDS 19510..21138 product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000118984.1 transl_table 11 codon_start 1 locus_tag LOCUS_19050 CDS complement(21184..21459) product DUF1471 family protease activator YjfN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000441025.1 transl_table 11 codon_start 1 locus_tag LOCUS_19060 gene yjfN CDS complement(21608..21910) product biofilm peroxide resistance protein BsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071843255.1 transl_table 11 codon_start 1 locus_tag LOCUS_19070 gene bsmA CDS 22120..22869 product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000560304.1 transl_table 11 codon_start 1 locus_tag LOCUS_19080 gene yjfP CDS complement(22866..23621) product HTH-type transcriptional regulator UlaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000133631.1 transl_table 11 codon_start 1 locus_tag LOCUS_19090 gene ulaR CDS complement(23726..24790) product L-ascorbate 6-phosphate lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049161.1 transl_table 11 codon_start 1 locus_tag LOCUS_19100 gene ulaG CDS 24873..25052 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19110 CDS 25150..26547 product PTS ascorbate transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000404875.1 transl_table 11 codon_start 1 locus_tag LOCUS_19120 gene ulaA CDS 26563..26868 product PTS ascorbate transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000218360.1 transl_table 11 codon_start 1 locus_tag LOCUS_19130 gene ulaB CDS 26878..27342 product PTS ascorbate transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776521.1 transl_table 11 codon_start 1 locus_tag LOCUS_19140 gene ulaC CDS 27354..28007 product 3-keto-L-gulonate-6-phosphate decarboxylase UlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368613.1 transl_table 11 codon_start 1 locus_tag LOCUS_19150 gene ulaD CDS 28017..28871 product L-ribulose-5-phosphate 3-epimerase UlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000949539.1 transl_table 11 codon_start 1 locus_tag LOCUS_19160 gene ulaE CDS 28871..29557 product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001170772.1 transl_table 11 codon_start 1 locus_tag LOCUS_19170 CDS complement(29692..29967) product DUF1471 family protein YjfY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095308.1 transl_table 11 codon_start 1 locus_tag LOCUS_19180 gene yjfY CDS complement(30113..32236) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19190 CDS 32517..32912 product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001216673.1 transl_table 11 codon_start 1 locus_tag LOCUS_19200 gene rpsF CDS complement(32982..33197) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19210 CDS 33238..33465 product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135199.1 transl_table 11 codon_start 1 locus_tag LOCUS_19220 gene rpsR CDS 33507..33956 product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196065.1 transl_table 11 codon_start 1 locus_tag LOCUS_19230 gene rplI CDS 34101..35039 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000381071.1 transl_table 11 codon_start 1 locus_tag LOCUS_19240 CDS complement(35091..35726) product cell division protein YtfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001119478.1 transl_table 11 codon_start 1 locus_tag LOCUS_19250 gene ytfB CDS 35944..36564 product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001663320.1 transl_table 11 codon_start 1 locus_tag LOCUS_19260 gene fklB CDS 36885..38294 product D-serine/D-alanine/glycine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228366.1 transl_table 11 codon_start 1 locus_tag LOCUS_19270 gene cycA CDS complement(38521..39183) product iron-sulfur cluster repair protein YtfE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331457.1 transl_table 11 codon_start 1 locus_tag LOCUS_19280 gene ytfE CDS 39430..40983 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095313.1 transl_table 11 codon_start 1 locus_tag LOCUS_19290 CDS complement(41013..41978) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000623287.1 transl_table 11 codon_start 1 locus_tag LOCUS_19300 CDS complement(42093..42959) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704185.1 transl_table 11 codon_start 1 locus_tag LOCUS_19310 CDS 43048..43428 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084623.1 transl_table 11 codon_start 1 locus_tag LOCUS_19320 CDS complement(43468..45411) product bifunctional 2',3'-cyclic-nucleotide 2'-phosphodiesterase/3'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589381.1 transl_table 11 codon_start 1 locus_tag LOCUS_19330 CDS 45601..46341 product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000886884.1 transl_table 11 codon_start 1 locus_tag LOCUS_19340 gene cysQ CDS complement(46331..46888) product YtfJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000175289.1 transl_table 11 codon_start 1 locus_tag LOCUS_19350 CDS 47214..47420 product DUF1107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000689229.1 transl_table 11 codon_start 1 locus_tag LOCUS_19360 CDS complement(47493..48833) product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000935036.1 transl_table 11 codon_start 1 locus_tag LOCUS_19370 CDS complement(48977..50521) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095326.1 transl_table 11 codon_start 1 locus_tag LOCUS_19380 CDS complement(50600..51622) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095327.1 transl_table 11 codon_start 1 locus_tag LOCUS_19390 CDS complement(51633..52700) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095328.1 transl_table 11 codon_start 1 locus_tag LOCUS_19400 CDS complement(52697..53329) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19410 note possible pseudo, internal stop codon CDS complement(53366..53881) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19420 note possible pseudo, internal stop codon CDS complement(53897..55051) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095330.1 transl_table 11 codon_start 1 locus_tag LOCUS_19430 CDS 55242..56297 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029882373.1 transl_table 11 codon_start 1 locus_tag LOCUS_19440 CDS complement(56361..56999) product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295196.1 transl_table 11 codon_start 1 locus_tag LOCUS_19450 gene msrA CDS 57214..58947 product autotransporter assembly complex protein TamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001120231.1 transl_table 11 codon_start 1 locus_tag LOCUS_19460 gene tamA CDS 58944..62723 product autotransporter assembly complex protein TamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000060812.1 transl_table 11 codon_start 1 locus_tag LOCUS_19470 gene tamB CDS 62726..63070 product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028027890.1 transl_table 11 codon_start 1 locus_tag LOCUS_19480 CDS 63278..63529 product type II toxin-antitoxin system antitoxin ChpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001223208.1 transl_table 11 codon_start 1 locus_tag LOCUS_19490 gene chpS CDS 63523..63873 product endoribonuclease toxin ChpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000239579.1 transl_table 11 codon_start 1 locus_tag LOCUS_19500 gene chpB CDS complement(63972..64502) product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000055079.1 transl_table 11 codon_start 1 locus_tag LOCUS_19510 gene ppa CDS 64852..65766 product galactofuranose ABC transporter substrate-binding protein YtfQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000265933.1 transl_table 11 codon_start 1 locus_tag LOCUS_19520 gene ytfQ CDS 65923..67425 product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000205813.1 transl_table 11 codon_start 1 locus_tag LOCUS_19530 CDS 67439..68461 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010723275.1 transl_table 11 codon_start 1 locus_tag LOCUS_19540 CDS 68448..69458 product sugar ABC transporter permease YjfF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014830436.1 transl_table 11 codon_start 1 locus_tag LOCUS_19550 gene yjfF CDS 69531..70643 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19560 CDS complement(70721..71719) product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853753.1 transl_table 11 codon_start 1 locus_tag LOCUS_19570 gene fbp CDS 71895..73268 product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219848.1 transl_table 11 codon_start 1 locus_tag LOCUS_19580 gene mpl CDS complement(73382..73933) product ribosome biogenesis factor YjgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000166277.1 transl_table 11 codon_start 1 locus_tag LOCUS_19590 gene yjgA CDS 74041..75381 product metalloprotease PmbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000852994.1 transl_table 11 codon_start 1 locus_tag LOCUS_19600 gene pmbA CDS complement(75447..75734) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097683.1 transl_table 11 codon_start 1 locus_tag LOCUS_19610 CDS complement(75721..76044) product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214609.1 transl_table 11 codon_start 1 locus_tag LOCUS_19620 CDS 76492..76812 product glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028027887.1 transl_table 11 codon_start 1 locus_tag LOCUS_19630 CDS 76823..77185 product SFCGS family glycine-rich protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000435389.1 transl_table 11 codon_start 1 locus_tag LOCUS_19640 CDS 77188..77487 product DUF4312 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006810338.1 transl_table 11 codon_start 1 locus_tag LOCUS_19650 CDS 77510..78286 product DUF4311 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000478578.1 transl_table 11 codon_start 1 locus_tag LOCUS_19660 CDS 78298..78942 product DUF4310 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368573.1 transl_table 11 codon_start 1 locus_tag LOCUS_19670 sequence018 source 1..76948 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..507 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000440515.1:Rpn family recombination-promoting nuclease/putative transposase locus_tag LOCUS_19680 CDS complement(545..3817) product mechanosensitive channel MscK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000178244.1 transl_table 11 codon_start 1 locus_tag LOCUS_19690 gene mscK CDS complement(4010..4681) product multidrug efflux transporter transcriptional repressor AcrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101745.1 transl_table 11 codon_start 1 locus_tag LOCUS_19700 gene acrR CDS 4931..6016 product multidrug efflux RND transporter periplasmic adaptor subunit AcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001386618.1 transl_table 11 codon_start 1 locus_tag LOCUS_19710 gene acrA CDS 6039..9188 product efflux RND transporter permease AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001132507.1 transl_table 11 codon_start 1 locus_tag LOCUS_19720 gene acrB CDS 9682..10056 product Hha toxicity modulator TomB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000344807.1 transl_table 11 codon_start 1 locus_tag LOCUS_19730 gene tomB CDS 10084..10302 product HHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001280991.1 transl_table 11 codon_start 1 locus_tag LOCUS_19740 CDS 10480..11043 product maltose O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278793.1 transl_table 11 codon_start 1 locus_tag LOCUS_19750 gene maa CDS 11144..11614 product YlaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136183.1 transl_table 11 codon_start 1 locus_tag LOCUS_19760 CDS 11963..13513 product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000213129.1 transl_table 11 codon_start 1 locus_tag LOCUS_19770 CDS 13866..14177 product MGMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095875.1 transl_table 11 codon_start 1 locus_tag LOCUS_19780 CDS complement(14209..14778) product YbaY family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000779831.1 transl_table 11 codon_start 1 locus_tag LOCUS_19790 CDS 14993..15853 product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000075876.1 transl_table 11 codon_start 1 locus_tag LOCUS_19800 gene tesB CDS 16422..17291 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19810 CDS complement(17422..18693) product ammonium transporter AmtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000685029.1 transl_table 11 codon_start 1 locus_tag LOCUS_19820 gene amtB CDS complement(18740..19078) product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780338.1 transl_table 11 codon_start 1 locus_tag LOCUS_19830 gene glnK CDS complement(19298..21076) product SmdB family multidrug efflux ABC transporter permease/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001256201.1 transl_table 11 codon_start 1 locus_tag LOCUS_19840 CDS complement(21069..22841) product SmdA family multidrug ABC transporter permease/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001235611.1 transl_table 11 codon_start 1 locus_tag LOCUS_19850 CDS complement(22882..23340) product DNA-binding transcriptional regulator DecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884593.1 transl_table 11 codon_start 1 locus_tag LOCUS_19860 gene decR CDS 23456..24505 product PLP-dependent cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095867.1 transl_table 11 codon_start 1 locus_tag LOCUS_19870 CDS complement(24552..25370) product HMP-PP phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000113040.1 transl_table 11 codon_start 1 locus_tag LOCUS_19880 gene cof CDS 25546..27171 product SgrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001238179.1 transl_table 11 codon_start 1 locus_tag LOCUS_19890 CDS 27236..27931 product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000817227.1 transl_table 11 codon_start 1 locus_tag LOCUS_19900 gene queC CDS complement(28028..28429) product long-chain acyl-CoA thioesterase FadM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001194531.1 transl_table 11 codon_start 1 locus_tag LOCUS_19910 gene fadM CDS complement(28534..28908) product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000680294.1 transl_table 11 codon_start 1 locus_tag LOCUS_19920 CDS complement(29059..30933) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000969376.1 transl_table 11 codon_start 1 locus_tag LOCUS_19930 gene ppiD CDS complement(31121..31393) product DNA-binding protein HU-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043542.1 transl_table 11 codon_start 1 locus_tag LOCUS_19940 gene hupB CDS complement(31602..33956) product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001067728.1 transl_table 11 codon_start 1 locus_tag LOCUS_19950 gene lon CDS complement(34140..35414) product ATP-dependent protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130305.1 transl_table 11 codon_start 1 locus_tag LOCUS_19960 gene clpX CDS complement(35596..36219) product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000122257.1 transl_table 11 codon_start 1 locus_tag LOCUS_19970 gene clpP CDS complement(36464..37762) product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001198406.1 transl_table 11 codon_start 1 locus_tag LOCUS_19980 gene tig CDS complement(38104..38421) product transcriptional regulator BolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000973433.1 transl_table 11 codon_start 1 locus_tag LOCUS_19990 gene bolA CDS 38725..39303 product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001539323.1 transl_table 11 codon_start 1 locus_tag LOCUS_20000 CDS 39346..40824 product muropeptide MFS transporter AmpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098423.1 transl_table 11 codon_start 1 locus_tag LOCUS_20010 gene ampG CDS 41283..42239 product cytochrome o ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001239449.1 transl_table 11 codon_start 1 locus_tag LOCUS_20020 gene cyoA CDS 42251..44242 product cytochrome o ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000467158.1 transl_table 11 codon_start 1 locus_tag LOCUS_20030 gene cyoB CDS 44232..44846 product cytochrome o ubiquinol oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179831.1 transl_table 11 codon_start 1 locus_tag LOCUS_20040 CDS 44846..45175 product cytochrome o ubiquinol oxidase subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019869.1 transl_table 11 codon_start 1 locus_tag LOCUS_20050 CDS 45187..46077 product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000971336.1 transl_table 11 codon_start 1 locus_tag LOCUS_20060 gene cyoE CDS complement(46122..46880) product IclR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385634.1 transl_table 11 codon_start 1 locus_tag LOCUS_20070 CDS 47033..47854 product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253115.1 transl_table 11 codon_start 1 locus_tag LOCUS_20080 CDS 47851..49545 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085507.1 transl_table 11 codon_start 1 locus_tag LOCUS_20090 CDS 49542..49862 product NIPSNAP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973675.1 transl_table 11 codon_start 1 locus_tag LOCUS_20100 CDS 49873..51567 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113725.1 transl_table 11 codon_start 1 locus_tag LOCUS_20110 CDS 51643..52446 product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084082.1 transl_table 11 codon_start 1 locus_tag LOCUS_20120 CDS 52460..53824 product aromatic acid/H+ symport family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703774.1 transl_table 11 codon_start 1 locus_tag LOCUS_20130 CDS 54022..55386 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001000935.1 transl_table 11 codon_start 1 locus_tag LOCUS_20140 CDS complement(55449..55940) product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001138911.1 transl_table 11 codon_start 1 locus_tag LOCUS_20150 CDS 56065..56976 product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000705865.1 transl_table 11 codon_start 1 locus_tag LOCUS_20160 gene panE CDS 56939..57529 product protein deglycase YajL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001275809.1 transl_table 11 codon_start 1 locus_tag LOCUS_20170 gene yajL CDS complement(57627..59075) product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000668658.1 transl_table 11 codon_start 1 locus_tag LOCUS_20180 gene thiI CDS 59283..59525 product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001124935.1 transl_table 11 codon_start 1 locus_tag LOCUS_20190 gene xseB CDS 59526..60425 product (2E,6E)-farnesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000348078.1 transl_table 11 codon_start 1 locus_tag LOCUS_20200 gene ispA CDS 60449..62311 product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000006791.1 transl_table 11 codon_start 1 locus_tag LOCUS_20210 gene dxs CDS 62368..63342 product 1-deoxyxylulose-5-phosphate synthase YajO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001199800.1 transl_table 11 codon_start 1 locus_tag LOCUS_20220 gene yajO CDS complement(63532..64047) product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000154043.1 transl_table 11 codon_start 1 locus_tag LOCUS_20230 gene pgpA CDS complement(64025..65002) product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000742107.1 transl_table 11 codon_start 1 locus_tag LOCUS_20240 gene thiL CDS complement(65080..65499) product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000801120.1 transl_table 11 codon_start 1 locus_tag LOCUS_20250 gene nusB CDS complement(65519..65989) product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001021161.1 transl_table 11 codon_start 1 locus_tag LOCUS_20260 gene ribE CDS complement(66079..67182) product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001150434.1 transl_table 11 codon_start 1 locus_tag LOCUS_20270 gene ribD CDS complement(67186..67635) product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000543535.1 transl_table 11 codon_start 1 locus_tag LOCUS_20280 gene nrdR CDS 67788..68327 product DUF3251 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014830864.1 transl_table 11 codon_start 1 locus_tag LOCUS_20290 CDS 68625..69479 product nucleoside-specific channel-forming protein Tsx inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295827.1 transl_table 11 codon_start 1 locus_tag LOCUS_20300 gene tsx CDS complement(69537..70217) product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000198318.1 transl_table 11 codon_start 1 locus_tag LOCUS_20310 CDS complement(70233..70598) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095835.1 transl_table 11 codon_start 1 locus_tag LOCUS_20320 CDS complement(70750..71721) product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000046637.1 transl_table 11 codon_start 1 locus_tag LOCUS_20330 gene secF CDS complement(71732..73546) product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000934822.1 transl_table 11 codon_start 1 locus_tag LOCUS_20340 gene secD CDS complement(73607..73939) product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007630.1 transl_table 11 codon_start 1 locus_tag LOCUS_20350 gene yajC CDS complement(73962..75089) product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368001.1 transl_table 11 codon_start 1 locus_tag LOCUS_20360 gene tgt CDS complement(75142..76212) product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001266528.1 transl_table 11 codon_start 1 locus_tag LOCUS_20370 gene queA CDS 76305..76886 product ACP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001009858.1 transl_table 11 codon_start 1 locus_tag LOCUS_20380 gene acpH sequence019 source 1..73156 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(126..644) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20390 CDS 981..1865 product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005895559.1 transl_table 11 codon_start 1 locus_tag LOCUS_20400 CDS 1862..2236 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20410 CDS 2229..3584 product SPI-7-type island replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059486.1 transl_table 11 codon_start 1 locus_tag LOCUS_20420 gene dnaB-PI CDS 3581..4120 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20430 note possible pseudo, frameshifted CDS 4075..5055 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20440 note possible pseudo, frameshifted CDS 5039..5578 product DUF2857 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001013785.1 transl_table 11 codon_start 1 locus_tag LOCUS_20450 CDS 5597..6802 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20460 CDS complement(6768..7844) product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001104341.1 transl_table 11 codon_start 1 locus_tag LOCUS_20470 CDS complement(8263..8559) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001099275.1 transl_table 11 codon_start 1 locus_tag LOCUS_20480 CDS 9315..10634 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963673.1 transl_table 11 codon_start 1 locus_tag LOCUS_20490 CDS 10907..11605 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20500 CDS 11595..12089 product DUF3158 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005895541.1 transl_table 11 codon_start 1 locus_tag LOCUS_20510 CDS 12643..13059 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20520 CDS 13180..13644 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20530 CDS 13637..14245 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20540 CDS 14252..14902 product TIGR03759 family integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000734461.1 transl_table 11 codon_start 1 locus_tag LOCUS_20550 CDS 14878..15312 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20560 CDS 15278..15637 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20570 CDS 15993..17255 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20580 note possible pseudo, frameshifted CDS 17326..17484 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20590 CDS 17706..18164 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20600 CDS 18256..19017 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20610 CDS complement(19080..19766) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000043871.1 transl_table 11 codon_start 1 locus_tag LOCUS_20620 CDS 19998..20324 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20630 CDS 20321..20554 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20640 CDS 20572..20898 product TIGR03745 family integrating conjugative element membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003294215.1 transl_table 11 codon_start 1 locus_tag LOCUS_20650 CDS 20902..21255 product TIGR03750 family conjugal transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817086.1 transl_table 11 codon_start 1 locus_tag LOCUS_20660 CDS 21503..21910 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20670 note possible pseudo, frameshifted CDS 21907..22695 product TIGR03749 family integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000058700.1 transl_table 11 codon_start 1 locus_tag LOCUS_20680 CDS 22692..23144 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20690 note possible pseudo, frameshifted CDS 23116..24105 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20700 note possible pseudo, frameshifted CDS 24212..24415 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20710 CDS 24418..25299 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20720 note possible pseudo, internal stop codon, frameshifted CDS 25404..25784 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20730 note possible pseudo, internal stop codon, frameshifted CDS 25781..26038 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20740 CDS 26035..27513 product conjugal transfer protein TraG N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000213770.1 transl_table 11 codon_start 1 locus_tag LOCUS_20750 CDS 27749..29407 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20760 CDS complement(29580..31082) product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545613.1 transl_table 11 codon_start 1 locus_tag LOCUS_20770 CDS complement(31082..32005) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20780 CDS complement(32008..33654) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20790 CDS complement(33659..35275) product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083774549.1 transl_table 11 codon_start 1 locus_tag LOCUS_20800 CDS 35886..36179 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001143292.1 transl_table 11 codon_start 1 locus_tag LOCUS_20810 CDS 36265..37176 product zincin-like metallopeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_150388385.1 transl_table 11 codon_start 1 locus_tag LOCUS_20820 CDS complement(37648..37941) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20830 CDS 37882..39099 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20840 CDS 39089..39889 product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000142493.1 transl_table 11 codon_start 1 locus_tag LOCUS_20850 tRNA complement(40164..40248) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00190 CDS 40450..41469 product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098954.1 transl_table 11 codon_start 1 locus_tag LOCUS_20860 CDS 41605..43107 product DUF853 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001294573.1 transl_table 11 codon_start 1 locus_tag LOCUS_20870 CDS complement(43220..44302) product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001182241.1 transl_table 11 codon_start 1 locus_tag LOCUS_20880 gene lptG CDS complement(44302..45381) product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000584132.1 transl_table 11 codon_start 1 locus_tag LOCUS_20890 gene lptF CDS 45669..47180 product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000397157.1 transl_table 11 codon_start 1 locus_tag LOCUS_20900 gene pepA CDS 47301..47744 product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000786399.1 transl_table 11 codon_start 1 locus_tag LOCUS_20910 gene holC CDS 47744..50599 product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368547.1 transl_table 11 codon_start 1 locus_tag LOCUS_20920 CDS complement(50653..51852) product YjgN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001066967.1 transl_table 11 codon_start 1 locus_tag LOCUS_20930 CDS 52043..52540 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001519079.1 transl_table 11 codon_start 1 locus_tag LOCUS_20940 CDS complement(52584..53006) product ribonuclease E inhibitor RraB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000002940.1 transl_table 11 codon_start 1 locus_tag LOCUS_20950 gene rraB CDS 53170..54174 product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000012936.1 transl_table 11 codon_start 1 locus_tag LOCUS_20960 gene argF CDS complement(54224..54676) product toxin-antitoxin biofilm protein TabA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000583470.1 transl_table 11 codon_start 1 locus_tag LOCUS_20970 gene tabA CDS 54925..55404 product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000666047.1 transl_table 11 codon_start 1 locus_tag LOCUS_20980 CDS 55642..56577 product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000013055.1 transl_table 11 codon_start 1 locus_tag LOCUS_20990 gene pyrB CDS 56592..57053 product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095364.1 transl_table 11 codon_start 1 locus_tag LOCUS_21000 gene pyrI CDS 57135..57521 product 2-iminobutanoate/2-iminopropanoate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047544.1 transl_table 11 codon_start 1 locus_tag LOCUS_21010 gene ridA CDS complement(57570..60278) product magnesium-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001775586.1 transl_table 11 codon_start 1 locus_tag LOCUS_21020 gene mgtA CDS 60718..61653 product trehalose operon repressor TreR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181306.1 transl_table 11 codon_start 1 locus_tag LOCUS_21030 gene treR CDS 61796..63217 product PTS trehalose transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299664.1 transl_table 11 codon_start 1 locus_tag LOCUS_21040 gene treB CDS 63265..64920 product alpha,alpha-phosphotrehalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005016308.1 transl_table 11 codon_start 1 locus_tag LOCUS_21050 gene treC CDS 65329..67467 product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187820.1 transl_table 11 codon_start 1 locus_tag LOCUS_21060 gene nrdD CDS 67633..68097 product anaerobic ribonucleoside-triphosphate reductase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001106233.1 transl_table 11 codon_start 1 locus_tag LOCUS_21070 gene nrdG CDS complement(68160..70070) product BglG family transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989308.1 transl_table 11 codon_start 1 locus_tag LOCUS_21080 CDS complement(70089..70829) product KDGP aldolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368570.1 transl_table 11 codon_start 1 locus_tag LOCUS_21090 CDS complement(70826..71944) product DgaE family pyridoxal phosphate-dependent ammonia lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001139189.1 transl_table 11 codon_start 1 locus_tag LOCUS_21100 CDS complement(71928..73061) product amidohydrolase/deacetylase family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000459938.1 transl_table 11 codon_start 1 locus_tag LOCUS_21110 sequence020 source 1..71067 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1214..2212) product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098398.1 transl_table 11 codon_start 1 locus_tag LOCUS_21120 CDS complement(2212..3057) product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098399.1 transl_table 11 codon_start 1 locus_tag LOCUS_21130 CDS complement(3072..3821) product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098400.1 transl_table 11 codon_start 1 locus_tag LOCUS_21140 CDS complement(3872..5200) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098401.1 transl_table 11 codon_start 1 locus_tag LOCUS_21150 CDS 5521..6444 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098402.1 transl_table 11 codon_start 1 locus_tag LOCUS_21160 CDS 6504..7190 product DNA-binding transcriptional regulator CecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000340357.1 transl_table 11 codon_start 1 locus_tag LOCUS_21170 gene cecR CDS 7190..8185 product secretion protein HlyD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000743445.1 transl_table 11 codon_start 1 locus_tag LOCUS_21180 gene hlyD CDS 8178..9914 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001361293.1 transl_table 11 codon_start 1 locus_tag LOCUS_21190 CDS 9907..11040 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045765.1 transl_table 11 codon_start 1 locus_tag LOCUS_21200 CDS 11075..12181 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000469048.1 transl_table 11 codon_start 1 locus_tag LOCUS_21210 CDS complement(12143..12553) product YbhQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000871970.1 transl_table 11 codon_start 1 locus_tag LOCUS_21220 CDS 12685..13446 product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001113348.1 transl_table 11 codon_start 1 locus_tag LOCUS_21230 CDS 13443..14684 product cardiolipin synthase ClsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000649638.1 transl_table 11 codon_start 1 locus_tag LOCUS_21240 gene clsB CDS 14684..15646 product YbhN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001129824.1 transl_table 11 codon_start 1 locus_tag LOCUS_21250 CDS complement(15855..16559) product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001361291.1 transl_table 11 codon_start 1 locus_tag LOCUS_21260 CDS complement(16610..17062) product molybdopterin synthase catalytic subunit MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000852287.1 transl_table 11 codon_start 1 locus_tag LOCUS_21270 gene moaE CDS complement(17064..17309) product molybdopterin synthase sulfur carrier subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000598612.1 transl_table 11 codon_start 1 locus_tag LOCUS_21280 gene moaD CDS complement(17302..17787) product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000080893.1 transl_table 11 codon_start 1 locus_tag LOCUS_21290 gene moaC CDS complement(17790..18302) product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084639.1 transl_table 11 codon_start 1 locus_tag LOCUS_21300 gene moaB CDS complement(18321..19310) product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295301.1 transl_table 11 codon_start 1 locus_tag LOCUS_21310 gene moaA CDS 19707..20615 product uridine diphosphate-N-acetylglucosamine-binding protein YvcK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001246034.1 transl_table 11 codon_start 1 locus_tag LOCUS_21320 gene yvcK CDS complement(20839..22860) product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000042501.1 transl_table 11 codon_start 1 locus_tag LOCUS_21330 gene uvrB CDS complement(23425..24111) product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000044843.1 transl_table 11 codon_start 1 locus_tag LOCUS_21340 gene bioD CDS complement(24104..24859) product malonyl-ACP O-methyltransferase BioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000079913.1 transl_table 11 codon_start 1 locus_tag LOCUS_21350 gene bioC CDS complement(24843..26000) product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000118943.1 transl_table 11 codon_start 1 locus_tag LOCUS_21360 gene bioF CDS complement(25997..27037) product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000951213.1 transl_table 11 codon_start 1 locus_tag LOCUS_21370 gene bioB CDS 27114..28403 product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001362906.1 transl_table 11 codon_start 1 locus_tag LOCUS_21380 gene bioA CDS 28461..28937 product kinase inhibitor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767403.1 transl_table 11 codon_start 1 locus_tag LOCUS_21390 CDS complement(29043..30563) product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001095232.1 transl_table 11 codon_start 1 locus_tag LOCUS_21400 gene hutH CDS complement(30565..32250) product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367623.1 transl_table 11 codon_start 1 locus_tag LOCUS_21410 gene hutU CDS complement(32427..33104) product histidine utilization repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097507.1 transl_table 11 codon_start 1 locus_tag LOCUS_21420 CDS complement(33241..34182) product formimidoylglutamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000195673.1 transl_table 11 codon_start 1 locus_tag LOCUS_21430 gene hutG CDS complement(34179..35402) product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001249497.1 transl_table 11 codon_start 1 locus_tag LOCUS_21440 gene hutI CDS 35596..36909 product putative acyl-CoA thioester hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001094768.1 transl_table 11 codon_start 1 locus_tag LOCUS_21450 CDS complement(36997..39261) product hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000593905.1 transl_table 11 codon_start 1 locus_tag LOCUS_21460 CDS complement(39288..40721) product anion permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001036475.1 transl_table 11 codon_start 1 locus_tag LOCUS_21470 CDS complement(40804..41835) product 4-oxalomesaconate tautomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000723652.1 transl_table 11 codon_start 1 locus_tag LOCUS_21480 CDS 42034..42957 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001350493.1 transl_table 11 codon_start 1 locus_tag LOCUS_21490 CDS complement(43049..44044) product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000815470.1 transl_table 11 codon_start 1 locus_tag LOCUS_21500 gene pgl CDS 44187..45005 product pyridoxal phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989132.1 transl_table 11 codon_start 1 locus_tag LOCUS_21510 CDS complement(45006..46064) product molybdenum ABC transporter ATP-binding protein ModC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000891683.1 transl_table 11 codon_start 1 locus_tag LOCUS_21520 gene modC CDS complement(46067..46756) product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000604026.1 transl_table 11 codon_start 1 locus_tag LOCUS_21530 gene modB CDS complement(46753..47529) product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101987.1 transl_table 11 codon_start 1 locus_tag LOCUS_21540 gene modA CDS complement(47736..47885) product AcrZ family multidrug efflux pump-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045380498.1 transl_table 11 codon_start 1 locus_tag LOCUS_21550 CDS 48014..48802 product molybdenum-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001147416.1 transl_table 11 codon_start 1 locus_tag LOCUS_21560 gene modE CDS complement(48861..49070) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21570 CDS 49132..50604 product molybdate ABC transporter ATP-binding protein ModF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000096859.1 transl_table 11 codon_start 1 locus_tag LOCUS_21580 gene modF CDS 50808..51824 product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001265443.1 transl_table 11 codon_start 1 locus_tag LOCUS_21590 gene galE CDS 51834..52880 product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000191497.1 transl_table 11 codon_start 1 locus_tag LOCUS_21600 gene galT CDS 52883..54031 product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001049364.1 transl_table 11 codon_start 1 locus_tag LOCUS_21610 gene galK CDS 54025..55065 product galactose-1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000931394.1 transl_table 11 codon_start 1 locus_tag LOCUS_21620 gene galM CDS complement(55108..55866) product chitin disaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000440427.1 transl_table 11 codon_start 1 locus_tag LOCUS_21630 gene chbG CDS complement(55877..57235) product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097019.1 transl_table 11 codon_start 1 locus_tag LOCUS_21640 CDS complement(57300..58118) product transcriptional regulator ChbR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000983393.1 transl_table 11 codon_start 1 locus_tag LOCUS_21650 gene chbR CDS complement(58130..59488) product PTS N,N'-diacetylchitobiose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000073041.1 transl_table 11 codon_start 1 locus_tag LOCUS_21660 gene chbC CDS 59940..60692 product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000301554.1 transl_table 11 codon_start 1 locus_tag LOCUS_21670 gene gpmA CDS complement(60745..61548) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001253471.1 transl_table 11 codon_start 1 locus_tag LOCUS_21680 CDS complement(61548..62609) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000128344.1 transl_table 11 codon_start 1 locus_tag LOCUS_21690 CDS complement(62627..63610) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965288.1 transl_table 11 codon_start 1 locus_tag LOCUS_21700 CDS complement(63622..65760) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268707.1 transl_table 11 codon_start 1 locus_tag LOCUS_21710 CDS complement(65963..67015) product 3-deoxy-7-phosphoheptulonate synthase AroG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001109193.1 transl_table 11 codon_start 1 locus_tag LOCUS_21720 gene aroG CDS 67334..67738 product YbgS-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000784342.1 transl_table 11 codon_start 1 locus_tag LOCUS_21730 CDS 67859..68800 product CDF family zinc transporter ZitB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000951262.1 transl_table 11 codon_start 1 locus_tag LOCUS_21740 gene zitB CDS complement(68797..69516) product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000345402.1 transl_table 11 codon_start 1 locus_tag LOCUS_21750 gene pnuC CDS complement(69542..70588) product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097527.1 transl_table 11 codon_start 1 locus_tag LOCUS_21760 gene nadA tRNA complement(70948..71023) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00200 sequence021 source 1..65156 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1611..2150) product septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808672.1 transl_table 11 codon_start 1 locus_tag LOCUS_21770 CDS complement(2194..2937) product YciC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000028506.1 transl_table 11 codon_start 1 locus_tag LOCUS_21780 CDS 3278..3916 product outer membrane protein OmpW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000737245.1 transl_table 11 codon_start 1 locus_tag LOCUS_21790 gene ompW CDS complement(3991..4869) product manganese catalase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000488351.1 transl_table 11 codon_start 1 locus_tag LOCUS_21800 CDS complement(4890..5396) product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001109977.1 transl_table 11 codon_start 1 locus_tag LOCUS_21810 CDS complement(5463..5963) product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001056490.1 transl_table 11 codon_start 1 locus_tag LOCUS_21820 CDS complement(6047..6229) product general stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000807657.1 transl_table 11 codon_start 1 locus_tag LOCUS_21830 CDS 6709..6966 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21840 CDS complement(7013..7819) product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705746.1 transl_table 11 codon_start 1 locus_tag LOCUS_21850 gene trpA CDS complement(7819..9012) product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000209521.1 transl_table 11 codon_start 1 locus_tag LOCUS_21860 gene trpB CDS complement(9023..10384) product bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001195287.1 transl_table 11 codon_start 1 locus_tag LOCUS_21870 gene trpCF CDS complement(10385..11980) product bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000763483.1 transl_table 11 codon_start 1 locus_tag LOCUS_21880 gene trpD CDS complement(11980..13542) product anthranilate synthase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001194375.1 transl_table 11 codon_start 1 locus_tag LOCUS_21890 CDS 13818..14699 product RNase AM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001285661.1 transl_table 11 codon_start 1 locus_tag LOCUS_21900 gene rnm CDS 14696..15316 product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000536174.1 transl_table 11 codon_start 1 locus_tag LOCUS_21910 CDS 15417..16292 product 23S rRNA pseudouridine(2605) synthase RluB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291216.1 transl_table 11 codon_start 1 locus_tag LOCUS_21920 gene rluB CDS complement(16419..17009) product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278887.1 transl_table 11 codon_start 1 locus_tag LOCUS_21930 gene cobO CDS complement(17006..17767) product YciK family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000559310.1 transl_table 11 codon_start 1 locus_tag LOCUS_21940 CDS 17960..19027 product protease SohB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000422082.1 transl_table 11 codon_start 1 locus_tag LOCUS_21950 gene sohB CDS complement(19085..19336) product YciN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001031530.1 transl_table 11 codon_start 1 locus_tag LOCUS_21960 CDS 19732..22329 product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000513593.1 transl_table 11 codon_start 1 locus_tag LOCUS_21970 gene topA CDS 22631..23605 product HTH-type transcriptional regulator CysB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776231.1 transl_table 11 codon_start 1 locus_tag LOCUS_21980 gene cysB CDS 23942..24070 product YmiA family putative membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000908596.1 transl_table 11 codon_start 1 locus_tag LOCUS_21990 CDS 24073..24240 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22000 CDS 24701..27376 product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000099487.1 transl_table 11 codon_start 1 locus_tag LOCUS_22010 gene acnA CDS complement(27433..28029) product GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001176295.1 transl_table 11 codon_start 1 locus_tag LOCUS_22020 gene ribA CDS 28226..28990 product phosphatidylglycerophosphatase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420925.1 transl_table 11 codon_start 1 locus_tag LOCUS_22030 gene pgpB CDS 29141..29452 product lipopolysaccharide assembly protein LapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000876284.1 transl_table 11 codon_start 1 locus_tag LOCUS_22040 gene lapA CDS 29459..30628 product lipopolysaccharide assembly protein LapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000891378.1 transl_table 11 codon_start 1 locus_tag LOCUS_22050 gene lapB CDS 30723..31535 product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000881808.1 transl_table 11 codon_start 1 locus_tag LOCUS_22060 gene pyrF CDS 31536..31862 product stress response translation initiation inhibitor YciH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705734.1 transl_table 11 codon_start 1 locus_tag LOCUS_22070 gene yciH CDS complement(32005..32223) product osmotically-inducible lipoprotein OsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000498253.1 transl_table 11 codon_start 1 locus_tag LOCUS_22080 gene osmB CDS complement(32479..33228) product DNA-binding transcriptional regulator YciT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001088593.1 transl_table 11 codon_start 1 locus_tag LOCUS_22090 CDS complement(33322..33504) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096379.1 transl_table 11 codon_start 1 locus_tag LOCUS_22100 CDS complement(33674..35698) product cyclic di-GMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096381.1 transl_table 11 codon_start 1 locus_tag LOCUS_22110 gene pdeR CDS complement(35924..37858) product exoribonuclease II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096382.1 transl_table 11 codon_start 1 locus_tag LOCUS_22120 CDS complement(37948..39099) product CMD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005049719.1 transl_table 11 codon_start 1 locus_tag LOCUS_22130 CDS complement(39300..40088) product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000506494.1 transl_table 11 codon_start 1 locus_tag LOCUS_22140 gene fabI CDS complement(40210..41016) product peptide ABC transporter ATP-binding protein SapF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000573407.1 transl_table 11 codon_start 1 locus_tag LOCUS_22150 gene sapF CDS complement(41018..42010) product peptide ABC transporter ATP-binding protein SapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001128858.1 transl_table 11 codon_start 1 locus_tag LOCUS_22160 gene sapD CDS complement(42010..42900) product peptide ABC transporter permease SapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001146150.1 transl_table 11 codon_start 1 locus_tag LOCUS_22170 gene sapC CDS complement(42887..43852) product peptide ABC transporter permease SapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000583298.1 transl_table 11 codon_start 1 locus_tag LOCUS_22180 gene sapB CDS complement(43849..45492) product peptide ABC transporter substrate-binding protein SapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001241626.1 transl_table 11 codon_start 1 locus_tag LOCUS_22190 gene sapA CDS complement(45605..46582) product phage shock protein operon transcriptional activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000852835.1 transl_table 11 codon_start 1 locus_tag LOCUS_22200 gene pspF CDS 46751..47419 product phage shock protein PspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000511000.1 transl_table 11 codon_start 1 locus_tag LOCUS_22210 gene pspA CDS 47474..47698 product envelope stress response membrane protein PspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274953.1 transl_table 11 codon_start 1 locus_tag LOCUS_22220 gene pspB CDS 47698..48057 product envelope stress response membrane protein PspC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000014347.1 transl_table 11 codon_start 1 locus_tag LOCUS_22230 gene pspC CDS 48076..48300 product phage shock protein PspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001097607.1 transl_table 11 codon_start 1 locus_tag LOCUS_22240 gene pspD CDS 48471..50180 product glucosylglycerate phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602336.1 transl_table 11 codon_start 1 locus_tag LOCUS_22250 gene ycjM CDS 50194..51486 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000597478.1 transl_table 11 codon_start 1 locus_tag LOCUS_22260 CDS 51507..52388 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001080790.1 transl_table 11 codon_start 1 locus_tag LOCUS_22270 CDS 52375..53217 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224671.1 transl_table 11 codon_start 1 locus_tag LOCUS_22280 CDS 53245..54297 product zinc-binding alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000737347.1 transl_table 11 codon_start 1 locus_tag LOCUS_22290 CDS 54317..55105 product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001313788.1 transl_table 11 codon_start 1 locus_tag LOCUS_22300 CDS 55115..56170 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000833563.1 transl_table 11 codon_start 1 locus_tag LOCUS_22310 CDS 56167..58428 product kojibiose phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000197985.1 transl_table 11 codon_start 1 locus_tag LOCUS_22320 gene ycjT CDS 58425..59087 product beta-phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000775794.1 transl_table 11 codon_start 1 locus_tag LOCUS_22330 gene pgmB CDS 59098..59850 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22340 note possible pseudo, internal stop codon CDS 59854..60177 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22350 note possible pseudo, internal stop codon CDS 60249..61154 product monomeric porin OmpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000735246.1 transl_table 11 codon_start 1 locus_tag LOCUS_22360 gene ompG CDS complement(61274..62281) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000075383.1 transl_table 11 codon_start 1 locus_tag LOCUS_22370 CDS complement(62723..63067) product DUF1294 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281194.1 transl_table 11 codon_start 1 locus_tag LOCUS_22380 CDS complement(63140..63511) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816233.1 transl_table 11 codon_start 1 locus_tag LOCUS_22390 CDS 63643..63816 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170387.1 transl_table 11 codon_start 1 locus_tag LOCUS_22400 misc_feature complement(63903..>65156) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001358436.1:autotransporter outer membrane beta-barrel domain-containing protein locus_tag LOCUS_22410 sequence022 source 1..63973 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 352..705 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22420 CDS 718..984 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22430 CDS complement(1277..1531) product ferredoxin-like diferric-tyrosyl radical cofactor maintenance protein YfaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000533921.1 transl_table 11 codon_start 1 locus_tag LOCUS_22440 gene yfaE CDS complement(1531..2661) product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000332037.1 transl_table 11 codon_start 1 locus_tag LOCUS_22450 gene nrdB CDS complement(2776..5061) product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001075180.1 transl_table 11 codon_start 1 locus_tag LOCUS_22460 gene nrdA CDS complement(5442..6170) product bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000990765.1 transl_table 11 codon_start 1 locus_tag LOCUS_22470 CDS 6363..8999 product DNA topoisomerase (ATP-hydrolyzing) subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001281282.1 transl_table 11 codon_start 1 locus_tag LOCUS_22480 gene gyrA CDS 9129..11975 product two-component system sensor histidine kinase RcsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000876074.1 transl_table 11 codon_start 1 locus_tag LOCUS_22490 gene rcsC CDS complement(12324..12974) product response regulator transcription factor RcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001061910.1 transl_table 11 codon_start 1 locus_tag LOCUS_22500 gene rcsB CDS complement(12991..15660) product phosphotransferase RcsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000083209.1 transl_table 11 codon_start 1 locus_tag LOCUS_22510 gene rcsD CDS 16400..17518 product porin OmpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000865552.1 transl_table 11 codon_start 1 locus_tag LOCUS_22520 gene ompC CDS 17635..18690 product FAD:protein FMN transferase ApbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000406130.1 transl_table 11 codon_start 1 locus_tag LOCUS_22530 gene apbE CDS 18774..19838 product bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000786374.1 transl_table 11 codon_start 1 locus_tag LOCUS_22540 gene ada CDS 19838..20488 product DNA oxidative demethylase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884975.1 transl_table 11 codon_start 1 locus_tag LOCUS_22550 gene alkB CDS 20618..22207 product microcin J25 efflux ABC transporter YojI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000422211.1 transl_table 11 codon_start 1 locus_tag LOCUS_22560 gene yojI CDS 22356..23792 product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098001.1 transl_table 11 codon_start 1 locus_tag LOCUS_22570 gene mgtE CDS complement(23755..25002) product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098000.1 transl_table 11 codon_start 1 locus_tag LOCUS_22580 CDS 25279..26742 product malate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097999.1 transl_table 11 codon_start 1 locus_tag LOCUS_22590 gene mqo CDS complement(26786..27274) product serine protease inhibitor ecotin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000849216.1 transl_table 11 codon_start 1 locus_tag LOCUS_22600 gene eco CDS 27778..28269 product ferredoxin-type protein NapF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686721.1 transl_table 11 codon_start 1 locus_tag LOCUS_22610 gene napF CDS 28259..28522 product chaperone NapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001260058.1 transl_table 11 codon_start 1 locus_tag LOCUS_22620 gene napD CDS 28519..31005 product nitrate reductase catalytic subunit NapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000778090.1 transl_table 11 codon_start 1 locus_tag LOCUS_22630 gene napA CDS 31012..31707 product ferredoxin-type protein NapG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091679.1 transl_table 11 codon_start 1 locus_tag LOCUS_22640 gene napG CDS 31694..32557 product quinol dehydrogenase ferredoxin subunit NapH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000013515.1 transl_table 11 codon_start 1 locus_tag LOCUS_22650 gene napH CDS 32554..33003 product nitrate reductase cytochrome c-type subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000835177.1 transl_table 11 codon_start 1 locus_tag LOCUS_22660 gene napB CDS 33013..33615 product cytochrome c-type protein NapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000431773.1 transl_table 11 codon_start 1 locus_tag LOCUS_22670 gene napC CDS 33630..34259 product cytochrome c biogenesis heme-transporting ATPase CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000525587.1 transl_table 11 codon_start 1 locus_tag LOCUS_22680 gene ccmA CDS 34256..34915 product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000971730.1 transl_table 11 codon_start 1 locus_tag LOCUS_22690 gene ccmB CDS 34985..35722 product heme exporter protein CcmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295447.1 transl_table 11 codon_start 1 locus_tag LOCUS_22700 gene ccmC CDS 35719..35931 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22710 CDS 35928..36407 product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001026418.1 transl_table 11 codon_start 1 locus_tag LOCUS_22720 gene ccmE CDS 36404..38347 product cytochrome c-type biogenesis heme lyase CcmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000982439.1 transl_table 11 codon_start 1 locus_tag LOCUS_22730 gene ccmF CDS 38344..38901 product thiol:disulfide interchange protein DsbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000824439.1 transl_table 11 codon_start 1 locus_tag LOCUS_22740 gene dsbE CDS 38898..39950 product cytochrome c-type biogenesis thiol:disulfide oxidoreductase CcmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001211587.1 transl_table 11 codon_start 1 locus_tag LOCUS_22750 gene ccmH CDS complement(40019..40666) product nitrate/nitrite response regulator protein NarP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001115500.1 transl_table 11 codon_start 1 locus_tag LOCUS_22760 gene narP CDS complement(40807..41376) product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954195.1 transl_table 11 codon_start 1 locus_tag LOCUS_22770 CDS complement(41415..41759) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22780 tRNA complement(42571..42647) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00210 CDS complement(42721..44481) product LPS biosynthesis-modulating metalloenzyme YejM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000256203.1 transl_table 11 codon_start 1 locus_tag LOCUS_22790 gene yejM CDS complement(44512..44739) product YejL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001135667.1 transl_table 11 codon_start 1 locus_tag LOCUS_22800 CDS 44921..45928 product nucleoid-associated protein YejK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000050806.1 transl_table 11 codon_start 1 locus_tag LOCUS_22810 gene yejK CDS complement(45980..46264) product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000494192.1 transl_table 11 codon_start 1 locus_tag LOCUS_22820 gene rplY CDS complement(46389..48149) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000578079.1 transl_table 11 codon_start 1 locus_tag LOCUS_22830 CDS 48300..48995 product 16S rRNA pseudouridine(516) synthase RsuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001234850.1 transl_table 11 codon_start 1 locus_tag LOCUS_22840 gene rsuA CDS 49027..50217 product Bcr/CflA family multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000213351.1 transl_table 11 codon_start 1 locus_tag LOCUS_22850 CDS 50553..50897 product YejG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001094639.1 transl_table 11 codon_start 1 locus_tag LOCUS_22860 CDS complement(50901..52490) product microcin C ABC transporter ATP-binding protein YejF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000203612.1 transl_table 11 codon_start 1 locus_tag LOCUS_22870 gene yejF CDS complement(52492..53517) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000088916.1 transl_table 11 codon_start 1 locus_tag LOCUS_22880 CDS complement(53517..54611) product microcin C ABC transporter permease YejB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000501604.1 transl_table 11 codon_start 1 locus_tag LOCUS_22890 CDS complement(54612..56426) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301507.1 transl_table 11 codon_start 1 locus_tag LOCUS_22900 CDS complement(56530..58086) product cyclic di-GMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000957756.1 transl_table 11 codon_start 1 locus_tag LOCUS_22910 CDS complement(58271..58660) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22920 CDS complement(59247..59960) product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000178088.1 transl_table 11 codon_start 1 locus_tag LOCUS_22930 CDS complement(59998..60984) product zinc-binding GTPase YeiR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000198816.1 transl_table 11 codon_start 1 locus_tag LOCUS_22940 gene yeiR CDS complement(61101..62567) product mannitol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001091919.1 transl_table 11 codon_start 1 locus_tag LOCUS_22950 CDS 62771..63961 product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097978.1 transl_table 11 codon_start 1 locus_tag LOCUS_22960 gene uxuA sequence023 source 1..63782 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 187..339 product type I toxin-antitoxin system toxin HokE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000956465.1 transl_table 11 codon_start 1 locus_tag LOCUS_22970 gene hokE CDS complement(444..1229) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704697.1 transl_table 11 codon_start 1 locus_tag LOCUS_22980 CDS complement(1263..2060) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704698.1 transl_table 11 codon_start 1 locus_tag LOCUS_22990 CDS complement(2113..3180) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367789.1 transl_table 11 codon_start 1 locus_tag LOCUS_23000 CDS complement(3198..4742) product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704699.1 transl_table 11 codon_start 1 locus_tag LOCUS_23010 CDS complement(4744..5364) product DUF2291 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704700.1 transl_table 11 codon_start 1 locus_tag LOCUS_23020 CDS complement(5407..5640) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23030 note possible pseudo, frameshifted CDS complement(5661..6341) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23040 note possible pseudo, frameshifted CDS complement(6481..7860) product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704701.1 transl_table 11 codon_start 1 locus_tag LOCUS_23050 CDS complement(7879..8001) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23060 note possible pseudo, internal stop codon CDS complement(8345..9295) product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367784.1 transl_table 11 codon_start 1 locus_tag LOCUS_23070 CDS 9674..10504 product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704702.1 transl_table 11 codon_start 1 locus_tag LOCUS_23080 CDS 10497..11438 product transketolase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704703.1 transl_table 11 codon_start 1 locus_tag LOCUS_23090 CDS complement(11435..12058) product enterobactin synthase subunit EntD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001356526.1 transl_table 11 codon_start 1 locus_tag LOCUS_23100 gene entD CDS complement(12106..14367) product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001034967.1 transl_table 11 codon_start 1 locus_tag LOCUS_23110 CDS 14611..16062 product enterochelin esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125810.1 transl_table 11 codon_start 1 locus_tag LOCUS_23120 gene fes CDS 16059..19946 product enterobactin non-ribosomal peptide synthetase EntF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000077805.1 transl_table 11 codon_start 1 locus_tag LOCUS_23130 gene entF CDS complement(19996..20799) product iron-enterobactin ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140646.1 transl_table 11 codon_start 1 locus_tag LOCUS_23140 gene fepC CDS complement(20796..21788) product iron-enterobactin ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000480067.1 transl_table 11 codon_start 1 locus_tag LOCUS_23150 gene fepG CDS complement(21785..22789) product Fe(3+)-siderophore ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295314.1 transl_table 11 codon_start 1 locus_tag LOCUS_23160 gene fepD CDS 22940..24187 product enterobactin transporter EntS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001041787.1 transl_table 11 codon_start 1 locus_tag LOCUS_23170 gene entS CDS complement(24273..25220) product Fe2+-enterobactin ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001234319.1 transl_table 11 codon_start 1 locus_tag LOCUS_23180 gene fepB CDS 25402..26577 product isochorismate synthase EntC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000367601.1 transl_table 11 codon_start 1 locus_tag LOCUS_23190 gene entC CDS 26587..28194 product (2,3-dihydroxybenzoyl)adenylate synthase EntE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000026787.1 transl_table 11 codon_start 1 locus_tag LOCUS_23200 gene entE CDS 28208..29065 product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001007162.1 transl_table 11 codon_start 1 locus_tag LOCUS_23210 CDS 29065..29820 product 2,3-dihydro-2,3-dihydroxybenzoate dehydrogenase EntA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000347636.1 transl_table 11 codon_start 1 locus_tag LOCUS_23220 gene entA CDS 29820..30236 product proofreading thioesterase EntH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000637940.1 transl_table 11 codon_start 1 locus_tag LOCUS_23230 gene entH CDS complement(30274..31386) product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097629.1 transl_table 11 codon_start 1 locus_tag LOCUS_23240 CDS complement(31401..31865) product YjiG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005423470.1 transl_table 11 codon_start 1 locus_tag LOCUS_23250 CDS complement(31865..32584) product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000083620.1 transl_table 11 codon_start 1 locus_tag LOCUS_23260 CDS 32886..34991 product pyruvate/proton symporter CstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043160.1 transl_table 11 codon_start 1 locus_tag LOCUS_23270 gene cstA CDS 35045..35242 product YbdD/YjiX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460619.1 transl_table 11 codon_start 1 locus_tag LOCUS_23280 CDS complement(35324..35941) product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001164761.1 transl_table 11 codon_start 1 locus_tag LOCUS_23290 CDS complement(35926..37149) product phosphoadenosine phosphosulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000118148.1 transl_table 11 codon_start 1 locus_tag LOCUS_23300 CDS complement(37304..38206) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000002489.1 transl_table 11 codon_start 1 locus_tag LOCUS_23310 CDS complement(38411..39157) product thiol:disulfide interchange protein DsbG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301891.1 transl_table 11 codon_start 1 locus_tag LOCUS_23320 gene dsbG CDS 39533..40096 product alkyl hydroperoxide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000052802.1 transl_table 11 codon_start 1 locus_tag LOCUS_23330 gene ahpC CDS 40339..41904 product alkyl hydroperoxide reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000887629.1 transl_table 11 codon_start 1 locus_tag LOCUS_23340 gene ahpF CDS complement(41960..42295) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23350 CDS complement(42258..42500) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23360 CDS 42616..42858 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23370 CDS complement(42917..44014) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23380 CDS complement(44202..44636) product universal stress protein UspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001082294.1 transl_table 11 codon_start 1 locus_tag LOCUS_23390 gene uspF CDS complement(44997..45554) product universal stress protein UspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000278499.1 transl_table 11 codon_start 1 locus_tag LOCUS_23400 gene uspG CDS 45773..47011 product zinc-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000646142.1 transl_table 11 codon_start 1 locus_tag LOCUS_23410 CDS complement(47242..47652) product nucleoside diphosphate kinase regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000089748.1 transl_table 11 codon_start 1 locus_tag LOCUS_23420 gene rnk CDS 47927..48763 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021030.1 transl_table 11 codon_start 1 locus_tag LOCUS_23430 CDS complement(48844..49638) product ribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001331449.1 transl_table 11 codon_start 1 locus_tag LOCUS_23440 gene rna CDS complement(49752..51164) product citrate/succinate antiporter CitT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000050323.1 transl_table 11 codon_start 1 locus_tag LOCUS_23450 gene citT CDS complement(51240..52148) product triphosphoribosyl-dephospho-CoA synthase CitG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000982670.1 transl_table 11 codon_start 1 locus_tag LOCUS_23460 gene citG CDS complement(52120..52671) product citrate lyase holo-[acyl-carrier protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000550422.1 transl_table 11 codon_start 1 locus_tag LOCUS_23470 gene citX CDS complement(52675..54207) product citrate lyase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000192245.1 transl_table 11 codon_start 1 locus_tag LOCUS_23480 gene citF CDS complement(54218..55126) product citrate (pro-3S)-lyase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005052881.1 transl_table 11 codon_start 1 locus_tag LOCUS_23490 gene citE CDS complement(55123..55419) product citrate lyase acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000700701.1 transl_table 11 codon_start 1 locus_tag LOCUS_23500 gene citD CDS complement(55416..56492) product [citrate (pro-3S)-lyase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000467705.1 transl_table 11 codon_start 1 locus_tag LOCUS_23510 gene citC CDS 56882..58543 product sensor histidine kinase DpiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000121811.1 transl_table 11 codon_start 1 locus_tag LOCUS_23520 gene dpiB CDS 58551..59189 product two-component response regulator DpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138786.1 transl_table 11 codon_start 1 locus_tag LOCUS_23530 gene dpiA CDS complement(59289..60674) product anaerobic C4-dicarboxylate transporter DcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000958619.1 transl_table 11 codon_start 1 locus_tag LOCUS_23540 gene dcuC CDS 61118..61696 product lipid IV(A) palmitoyltransferase PagP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001784638.1 transl_table 11 codon_start 1 locus_tag LOCUS_23550 gene pagP CDS 61871..62080 product transcription antiterminator/RNA stability regulator CspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000034826.1 transl_table 11 codon_start 1 locus_tag LOCUS_23560 gene cspE CDS complement(62135..62458) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23570 CDS 62608..63396 product deaminated glutathione amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000959109.1 transl_table 11 codon_start 1 locus_tag LOCUS_23580 CDS 63524..63727 product twin-arginine translocase subunit TatE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000503938.1 transl_table 11 codon_start 1 locus_tag LOCUS_23590 gene tatE sequence024 source 1..63128 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 458..871 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23600 CDS complement(971..1879) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089308.1 transl_table 11 codon_start 1 locus_tag LOCUS_23610 CDS 2008..3045 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089309.1 transl_table 11 codon_start 1 locus_tag LOCUS_23620 CDS 3060..4148 product tartrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089310.1 transl_table 11 codon_start 1 locus_tag LOCUS_23630 CDS 4151..5410 product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035257427.1 transl_table 11 codon_start 1 locus_tag LOCUS_23640 CDS 5475..5666 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23650 CDS 6009..8846 product autotransporter outer membrane beta-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309459.1 transl_table 11 codon_start 1 locus_tag LOCUS_23660 CDS 9529..10203 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23670 CDS complement(10303..10491) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23680 CDS 10637..11824 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704179.1 transl_table 11 codon_start 1 locus_tag LOCUS_23690 CDS complement(12154..12975) product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000952736.1 transl_table 11 codon_start 1 locus_tag LOCUS_23700 gene cobB CDS complement(12992..13903) product N-acetylglucosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000291303.1 transl_table 11 codon_start 1 locus_tag LOCUS_23710 gene nagK CDS complement(13932..15176) product lipoprotein-releasing ABC transporter permease subunit LolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000168092.1 transl_table 11 codon_start 1 locus_tag LOCUS_23720 gene lolE CDS complement(15176..15877) product lipoprotein-releasing ABC transporter ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001033695.1 transl_table 11 codon_start 1 locus_tag LOCUS_23730 gene lolD CDS complement(15870..17069) product lipoprotein-releasing ABC transporter permease subunit LolC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272105.1 transl_table 11 codon_start 1 locus_tag LOCUS_23740 gene lolC CDS 17331..18404 product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000810242.1 transl_table 11 codon_start 1 locus_tag LOCUS_23750 CDS 18514..21960 product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001114340.1 transl_table 11 codon_start 1 locus_tag LOCUS_23760 gene mfd CDS 22180..23133 product L,D-transpeptidase LdtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001312748.1 transl_table 11 codon_start 1 locus_tag LOCUS_23770 gene ldtC CDS complement(23181..23741) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098960.1 transl_table 11 codon_start 1 locus_tag LOCUS_23780 CDS complement(23732..26146) product fimbrial biogenesis outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098961.1 transl_table 11 codon_start 1 locus_tag LOCUS_23790 CDS complement(26156..26866) product fimbria/pilus chaperone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098962.1 transl_table 11 codon_start 1 locus_tag LOCUS_23800 CDS complement(27220..27477) product multiple stress resistance protein BhsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097102.1 transl_table 11 codon_start 1 locus_tag LOCUS_23810 gene bhsA CDS 27718..28353 product TetR family copper-responsive transcriptional repressor ComR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000205980.1 transl_table 11 codon_start 1 locus_tag LOCUS_23820 gene comR CDS 28420..29079 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23830 CDS complement(29140..29679) product glycine zipper 2TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043459.1 transl_table 11 codon_start 1 locus_tag LOCUS_23840 CDS complement(29882..31186) product NADH-quinone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211053.1 transl_table 11 codon_start 1 locus_tag LOCUS_23850 gene ndh CDS complement(31433..31975) product alpha/beta hydrolase YcfP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000587943.1 transl_table 11 codon_start 1 locus_tag LOCUS_23860 gene ycfP CDS complement(31997..33022) product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000529284.1 transl_table 11 codon_start 1 locus_tag LOCUS_23870 gene nagZ CDS complement(33033..33857) product thiamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001257320.1 transl_table 11 codon_start 1 locus_tag LOCUS_23880 gene thiK CDS complement(33838..34470) product penicillin-binding protein activator LpoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000164439.1 transl_table 11 codon_start 1 locus_tag LOCUS_23890 gene lpoB CDS complement(34493..34867) product YcfL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589560.1 transl_table 11 codon_start 1 locus_tag LOCUS_23900 CDS complement(34870..35229) product purine nucleoside phosphoramidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001532068.1 transl_table 11 codon_start 1 locus_tag LOCUS_23910 gene hinT CDS 35576..37756 product ferric-rhodotorulic acid/ferric-coprogen receptor FhuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000953420.1 transl_table 11 codon_start 1 locus_tag LOCUS_23920 gene fhuE CDS complement(37836..39269) product PTS glucose transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000475735.1 transl_table 11 codon_start 1 locus_tag LOCUS_23930 gene ptsG CDS complement(39562..40359) product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000480245.1 transl_table 11 codon_start 1 locus_tag LOCUS_23940 CDS complement(40370..41374) product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000872450.1 transl_table 11 codon_start 1 locus_tag LOCUS_23950 gene holB CDS complement(41371..42012) product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001256997.1 transl_table 11 codon_start 1 locus_tag LOCUS_23960 gene tmk CDS complement(42002..43024) product cell division protein YceG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000756827.1 transl_table 11 codon_start 1 locus_tag LOCUS_23970 gene yceG CDS complement(43027..43836) product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000478660.1 transl_table 11 codon_start 1 locus_tag LOCUS_23980 gene pabC CDS complement(43955..45196) product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705037.1 transl_table 11 codon_start 1 locus_tag LOCUS_23990 gene fabF CDS complement(45283..45519) product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000103754.1 transl_table 11 codon_start 1 locus_tag LOCUS_24000 gene acpP CDS complement(45796..46530) product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367190.1 transl_table 11 codon_start 1 locus_tag LOCUS_24010 gene fabG CDS complement(46543..47472) product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000191372.1 transl_table 11 codon_start 1 locus_tag LOCUS_24020 gene fabD CDS complement(47488..48441) product beta-ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000288132.1 transl_table 11 codon_start 1 locus_tag LOCUS_24030 gene fabH CDS complement(48519..49595) product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000197578.1 transl_table 11 codon_start 1 locus_tag LOCUS_24040 gene plsX CDS complement(49676..49849) product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000290727.1 transl_table 11 codon_start 1 locus_tag LOCUS_24050 gene rpmF CDS complement(49866..50387) product 23S rRNA accumulation protein YceD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001174481.1 transl_table 11 codon_start 1 locus_tag LOCUS_24060 gene yceD CDS 50585..51169 product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001137608.1 transl_table 11 codon_start 1 locus_tag LOCUS_24070 CDS complement(51211..52206) product 23S rRNA pseudouridine(955/2504/2580) synthase RluC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000846342.1 transl_table 11 codon_start 1 locus_tag LOCUS_24080 gene rluC CDS 52738..55968 product ribonuclease E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000827427.1 transl_table 11 codon_start 1 locus_tag LOCUS_24090 gene rne CDS complement(56011..56946) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367198.1 transl_table 11 codon_start 1 locus_tag LOCUS_24100 CDS 57057..58250 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705033.1 transl_table 11 codon_start 1 locus_tag LOCUS_24110 CDS complement(58335..59288) product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001212764.1 transl_table 11 codon_start 1 locus_tag LOCUS_24120 gene flgL CDS complement(59303..60943) product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000096425.1 transl_table 11 codon_start 1 locus_tag LOCUS_24130 gene flgK CDS complement(61009..61353) product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097138.1 transl_table 11 codon_start 1 locus_tag LOCUS_24140 gene flgC CDS complement(61357..61773) product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000887042.1 transl_table 11 codon_start 1 locus_tag LOCUS_24150 gene flgB CDS 61930..62589 product flagellar basal body P-ring formation chaperone FlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001194076.1 transl_table 11 codon_start 1 locus_tag LOCUS_24160 gene flgA CDS 62682..62975 product flagellar biosynthesis anti-sigma factor FlgM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020892.1 transl_table 11 codon_start 1 locus_tag LOCUS_24170 gene flgM sequence025 source 1..62581 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 158..316 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24180 CDS 1320..1688 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24190 CDS 2703..3380 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24200 CDS 4365..4535 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24210 CDS 6017..7147 product dispersin export ABC transporter permease subunit AatP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000209219.1 transl_table 11 codon_start 1 locus_tag LOCUS_24220 gene aatP CDS 7144..8352 product dispersin export ABC transporter outer membrane protein AatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001216021.1 transl_table 11 codon_start 1 locus_tag LOCUS_24230 gene aatA CDS 8276..9088 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012904705.1 transl_table 11 codon_start 1 locus_tag LOCUS_24240 CDS 9081..9710 product dispersin export ABC transporter ATP-binding protein AatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621743.1 transl_table 11 codon_start 1 locus_tag LOCUS_24250 gene aatC CDS complement(10374..11714) product carbohydrate porin OprB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003116413.1 transl_table 11 codon_start 1 locus_tag LOCUS_24260 gene oprB CDS complement(11838..13235) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206005.1 transl_table 11 codon_start 1 locus_tag LOCUS_24270 CDS 13661..14692 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974645.1 transl_table 11 codon_start 1 locus_tag LOCUS_24280 CDS 14945..15874 product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000050879.1 transl_table 11 codon_start 1 locus_tag LOCUS_24290 CDS 16259..17548 product anaerobic C4-dicarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006590721.1 transl_table 11 codon_start 1 locus_tag LOCUS_24300 CDS complement(17677..19068) product putrescine/proton symporter PuuP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000996856.1 transl_table 11 codon_start 1 locus_tag LOCUS_24310 gene puuP CDS complement(19379..20797) product glutamate-putrescine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298814.1 transl_table 11 codon_start 1 locus_tag LOCUS_24320 gene puuA CDS 21022..21774 product gamma-glutamyl-gamma-aminobutyrate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001386777.1 transl_table 11 codon_start 1 locus_tag LOCUS_24330 gene puuD CDS 21792..22358 product HTH-type transcriptional regulator PuuR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278727.1 transl_table 11 codon_start 1 locus_tag LOCUS_24340 gene puuR CDS 22579..24066 product aldehyde dehydrogenase PuuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001009161.1 transl_table 11 codon_start 1 locus_tag LOCUS_24350 gene puuC CDS 24069..25349 product gamma-glutamylputrescine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000134843.1 transl_table 11 codon_start 1 locus_tag LOCUS_24360 gene puuB CDS complement(25534..28071) product autotransporter outer membrane beta-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103898.1 transl_table 11 codon_start 1 locus_tag LOCUS_24370 CDS 28183..28428 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24380 CDS complement(30315..31361) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24390 CDS complement(31382..33970) product fimbrial biogenesis outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210844.1 transl_table 11 codon_start 1 locus_tag LOCUS_24400 CDS complement(33987..34706) product fimbria/pilus periplasmic chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019080952.1 transl_table 11 codon_start 1 locus_tag LOCUS_24410 CDS complement(34925..35461) product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002113678.1 transl_table 11 codon_start 1 locus_tag LOCUS_24420 CDS complement(35555..35809) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24430 CDS complement(35830..36144) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24440 CDS complement(36358..38490) product peptidase domain-containing ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004545619.1 transl_table 11 codon_start 1 locus_tag LOCUS_24450 CDS complement(38509..39768) product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093492.1 transl_table 11 codon_start 1 locus_tag LOCUS_24460 CDS complement(39788..41113) product outer membrane channel protein TolC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000735329.1 transl_table 11 codon_start 1 locus_tag LOCUS_24470 gene tolC CDS complement(41118..41774) product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094834.1 transl_table 11 codon_start 1 locus_tag LOCUS_24480 CDS complement(42858..43343) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24490 CDS complement(43497..44459) product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209407.1 transl_table 11 codon_start 1 locus_tag LOCUS_24500 CDS complement(44659..46416) product dihydroxyacetone kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027218.1 transl_table 11 codon_start 1 locus_tag LOCUS_24510 CDS 46736..47203 product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209402.1 transl_table 11 codon_start 1 locus_tag LOCUS_24520 gene rpiB CDS 47404..48699 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051155748.1 transl_table 11 codon_start 1 locus_tag LOCUS_24530 CDS 48722..49768 product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113700.1 transl_table 11 codon_start 1 locus_tag LOCUS_24540 CDS 49765..50598 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24550 CDS 50817..51866 product NADPH-dependent aldehyde reductase YahK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000692761.1 transl_table 11 codon_start 1 locus_tag LOCUS_24560 gene yahK CDS complement(51878..52447) product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524160.1 transl_table 11 codon_start 1 locus_tag LOCUS_24570 CDS complement(52444..53379) product molybdenum cofactor insertion chaperone PaoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000121356.1 transl_table 11 codon_start 1 locus_tag LOCUS_24580 gene paoD CDS complement(53389..55587) product aldehyde oxidoreductase molybdenum-binding subunit PaoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000667026.1 transl_table 11 codon_start 1 locus_tag LOCUS_24590 gene paoC CDS complement(55591..56523) product aldehyde oxidoreductase FAD-binding subunit PaoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643333.1 transl_table 11 codon_start 1 locus_tag LOCUS_24600 gene paoB CDS complement(56520..57092) product aldehyde dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000070685.1 transl_table 11 codon_start 1 locus_tag LOCUS_24610 gene paoA CDS 57465..59018 product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369856.1 transl_table 11 codon_start 1 locus_tag LOCUS_24620 CDS 59422..62493 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24630 sequence026 source 1..62114 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(72..2426) product quinoprotein glucose dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309217.1 transl_table 11 codon_start 1 locus_tag LOCUS_24640 gene gcd CDS 2668..3204 product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000683335.1 transl_table 11 codon_start 1 locus_tag LOCUS_24650 gene hpt CDS complement(3264..3926) product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651585.1 transl_table 11 codon_start 1 locus_tag LOCUS_24660 gene can CDS 4035..4961 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000150637.1 transl_table 11 codon_start 1 locus_tag LOCUS_24670 CDS 4958..5728 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000983419.1 transl_table 11 codon_start 1 locus_tag LOCUS_24680 CDS 5834..6274 product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000901966.1 transl_table 11 codon_start 1 locus_tag LOCUS_24690 CDS 6363..7586 product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000277890.1 transl_table 11 codon_start 1 locus_tag LOCUS_24700 CDS complement(7590..7970) product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856284.1 transl_table 11 codon_start 1 locus_tag LOCUS_24710 gene panD CDS complement(8114..8968) product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000905353.1 transl_table 11 codon_start 1 locus_tag LOCUS_24720 gene panC CDS complement(9032..9823) product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000043003.1 transl_table 11 codon_start 1 locus_tag LOCUS_24730 gene panB CDS complement(9942..10421) product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704426.1 transl_table 11 codon_start 1 locus_tag LOCUS_24740 gene folK CDS complement(10418..11782) product polynucleotide adenylyltransferase PcnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204100700.1 transl_table 11 codon_start 1 locus_tag LOCUS_24750 gene pcnB CDS complement(11921..12817) product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000937424.1 transl_table 11 codon_start 1 locus_tag LOCUS_24760 gene gluQRS CDS complement(12890..13345) product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001155227.1 transl_table 11 codon_start 1 locus_tag LOCUS_24770 gene dksA CDS complement(13523..14227) product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000396050.1 transl_table 11 codon_start 1 locus_tag LOCUS_24780 gene sfsA CDS complement(14240..14770) product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001294700.1 transl_table 11 codon_start 1 locus_tag LOCUS_24790 gene thpR CDS 14844..17273 product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309224.1 transl_table 11 codon_start 1 locus_tag LOCUS_24800 gene hrpB CDS 17405..19939 product bifunctional glycosyl transferase/transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000918155.1 transl_table 11 codon_start 1 locus_tag LOCUS_24810 gene mrcB CDS 20324..22501 product ferrichrome porin FhuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124396.1 transl_table 11 codon_start 1 locus_tag LOCUS_24820 gene fhuA CDS 22549..23346 product Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001158929.1 transl_table 11 codon_start 1 locus_tag LOCUS_24830 gene fhuC CDS 23346..24236 product Fe(3+)-hydroxamate ABC transporter substrate-binding protein FhuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000015990.1 transl_table 11 codon_start 1 locus_tag LOCUS_24840 gene fhuD CDS 24233..26215 product Fe(3+)-hydroxamate ABC transporter permease FhuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000088086.1 transl_table 11 codon_start 1 locus_tag LOCUS_24850 gene fhuB CDS complement(26311..27591) product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045264.1 transl_table 11 codon_start 1 locus_tag LOCUS_24860 gene hemL CDS 27760..29181 product H(+)/Cl(-) exchange transporter ClcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000845433.1 transl_table 11 codon_start 1 locus_tag LOCUS_24870 gene clcA CDS 29263..29607 product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278668.1 transl_table 11 codon_start 1 locus_tag LOCUS_24880 gene erpA CDS complement(29728..30351) product TRIC cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000964234.1 transl_table 11 codon_start 1 locus_tag LOCUS_24890 CDS complement(30386..31186) product vitamin B12 ABC transporter substrate-binding protein BtuF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118833.1 transl_table 11 codon_start 1 locus_tag LOCUS_24900 gene btuF CDS complement(31179..31877) product 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000689844.1 transl_table 11 codon_start 1 locus_tag LOCUS_24910 gene mtnN CDS 31940..33475 product dGTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057067.1 transl_table 11 codon_start 1 locus_tag LOCUS_24920 gene dgt CDS 33605..35020 product serine endoprotease DegP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000753945.1 transl_table 11 codon_start 1 locus_tag LOCUS_24930 gene degP CDS 35170..36327 product DNA-binding transcriptional regulator CdaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000929458.1 transl_table 11 codon_start 1 locus_tag LOCUS_24940 gene cdaR CDS 36314..36610 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24950 CDS complement(36637..37023) product DUF3461 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000272193.1 transl_table 11 codon_start 1 locus_tag LOCUS_24960 CDS complement(37134..37958) product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095650.1 transl_table 11 codon_start 1 locus_tag LOCUS_24970 gene dapD CDS complement(37989..40661) product bifunctional uridylyltransferase/uridylyl-removing protein GlnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001094557.1 transl_table 11 codon_start 1 locus_tag LOCUS_24980 gene glnD CDS complement(40770..41564) product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018214.1 transl_table 11 codon_start 1 locus_tag LOCUS_24990 gene map CDS 42012..42737 product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000246886.1 transl_table 11 codon_start 1 locus_tag LOCUS_25000 gene rpsB CDS 42801..43724 product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808106.1 transl_table 11 codon_start 1 locus_tag LOCUS_25010 gene tsf CDS 43877..44602 product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856194.1 transl_table 11 codon_start 1 locus_tag LOCUS_25020 gene pyrH CDS 44903..45460 product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000622418.1 transl_table 11 codon_start 1 locus_tag LOCUS_25030 gene frr CDS 45568..46764 product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000811924.1 transl_table 11 codon_start 1 locus_tag LOCUS_25040 gene ispC CDS 47022..47711 product (2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000947409.1 transl_table 11 codon_start 1 locus_tag LOCUS_25050 gene ispU CDS 47724..48581 product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000922435.1 transl_table 11 codon_start 1 locus_tag LOCUS_25060 gene cdsA CDS 48593..49945 product sigma E protease regulator RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000949016.1 transl_table 11 codon_start 1 locus_tag LOCUS_25070 gene rseP CDS 49977..52406 product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001240896.1 transl_table 11 codon_start 1 locus_tag LOCUS_25080 gene bamA CDS 52529..53014 product molecular chaperone Skp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000758956.1 transl_table 11 codon_start 1 locus_tag LOCUS_25090 gene skp CDS 53018..54043 product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001139265.1 transl_table 11 codon_start 1 locus_tag LOCUS_25100 gene lpxD CDS 54147..54602 product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000210739.1 transl_table 11 codon_start 1 locus_tag LOCUS_25110 gene fabZ CDS 54606..55394 product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368155.1 transl_table 11 codon_start 1 locus_tag LOCUS_25120 gene lpxA CDS 55394..56542 product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000741216.1 transl_table 11 codon_start 1 locus_tag LOCUS_25130 gene lpxB CDS 56539..57135 product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569430.1 transl_table 11 codon_start 1 locus_tag LOCUS_25140 gene rnhB CDS 57160..60642 product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001294828.1 transl_table 11 codon_start 1 locus_tag LOCUS_25150 gene dnaE CDS 60655..61614 product acetyl-CoA carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000055753.1 transl_table 11 codon_start 1 locus_tag LOCUS_25160 gene accA sequence027 source 1..59487 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 280..603 product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095429.1 transl_table 11 codon_start 1 locus_tag LOCUS_25170 CDS 706..852 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25180 note possible pseudo, internal stop codon, frameshifted CDS complement(980..1852) product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000202281.1 transl_table 11 codon_start 1 locus_tag LOCUS_25190 CDS 2253..5468 product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705205.1 transl_table 11 codon_start 1 locus_tag LOCUS_25200 CDS 5481..5939 product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366918.1 transl_table 11 codon_start 1 locus_tag LOCUS_25210 CDS 6030..6596 product NTP transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705210.1 transl_table 11 codon_start 1 locus_tag LOCUS_25220 CDS complement(6623..8770) product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077681898.1 transl_table 11 codon_start 1 transl_except (pos:8351..8353,aa:Sec) note codon on position 140 is selenocysteine opal codon. locus_tag LOCUS_25230 gene fdhF CDS complement(8905..10377) product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366914.1 transl_table 11 codon_start 1 locus_tag LOCUS_25240 CDS 10869..12809 product formate-dependent uric acid utilization protein YgfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705207.1 transl_table 11 codon_start 1 locus_tag LOCUS_25250 gene ygfT CDS 12806..13282 product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366911.1 transl_table 11 codon_start 1 locus_tag LOCUS_25260 CDS complement(13343..14677) product putative aminohydrolase SsnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705208.1 transl_table 11 codon_start 1 locus_tag LOCUS_25270 gene ssnA CDS complement(14674..17778) product putative selenate reductase subunit YgfK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705209.1 transl_table 11 codon_start 1 locus_tag LOCUS_25280 gene ygfK CDS 18291..19148 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25290 CDS complement(19213..20145) product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366905.1 transl_table 11 codon_start 1 locus_tag LOCUS_25300 gene arcC CDS complement(20158..21564) product dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705212.1 transl_table 11 codon_start 1 locus_tag LOCUS_25310 gene hydA CDS complement(21615..22826) product YgeY family selenium metabolism-linked hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705213.1 transl_table 11 codon_start 1 locus_tag LOCUS_25320 CDS complement(22886..24085) product diaminopropionate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705214.1 transl_table 11 codon_start 1 locus_tag LOCUS_25330 gene dpaL CDS complement(24146..25333) product knotted carbamoyltransferase YgeW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366901.1 transl_table 11 codon_start 1 locus_tag LOCUS_25340 gene ygeW CDS 25817..27598 product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366900.1 transl_table 11 codon_start 1 locus_tag LOCUS_25350 CDS complement(27785..28531) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095760.1 transl_table 11 codon_start 1 locus_tag LOCUS_25360 CDS complement(28531..29421) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001681808.1 transl_table 11 codon_start 1 locus_tag LOCUS_25370 CDS complement(29432..29689) product YjhX family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095761.1 transl_table 11 codon_start 1 locus_tag LOCUS_25380 CDS 30068..30334 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25390 CDS 30454..30921 product Hsp20 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001518864.1 transl_table 11 codon_start 1 locus_tag LOCUS_25400 CDS complement(30976..31368) product DUF4280 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089513.1 transl_table 11 codon_start 1 locus_tag LOCUS_25410 CDS complement(31365..32285) product type VI secretion system protein TssA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115340.1 transl_table 11 codon_start 1 locus_tag LOCUS_25420 gene tssA CDS complement(32272..34062) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25430 CDS complement(34047..35831) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25440 CDS complement(35828..36574) product DotU family type IV/VI secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104706.1 transl_table 11 codon_start 1 locus_tag LOCUS_25450 CDS complement(36558..37892) product type VI secretion system baseplate subunit TssK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122697.1 transl_table 11 codon_start 1 locus_tag LOCUS_25460 gene tssK CDS complement(37894..38364) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104701.1 transl_table 11 codon_start 1 locus_tag LOCUS_25470 CDS 38731..39243 product type VI secretion system contractile sheath small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089493.1 transl_table 11 codon_start 1 locus_tag LOCUS_25480 gene tssB CDS 39262..40743 product type VI secretion system contractile sheath large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089494.1 transl_table 11 codon_start 1 locus_tag LOCUS_25490 gene tssC CDS 40759..41247 product Hcp family type VI secretion system effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000338756.1 transl_table 11 codon_start 1 locus_tag LOCUS_25500 CDS 41247..41627 product anti-adapter protein IraD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001304530.1 transl_table 11 codon_start 1 locus_tag LOCUS_25510 gene iraD CDS 41647..43368 product type VI secretion system baseplate subunit TssF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114518.1 transl_table 11 codon_start 1 locus_tag LOCUS_25520 gene tssF CDS 43332..44267 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25530 CDS 44258..46765 product type VI secretion system ATPase TssH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114516.1 transl_table 11 codon_start 1 locus_tag LOCUS_25540 gene tssH CDS 46970..48934 product type VI secretion system tip protein VgrG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114515.1 transl_table 11 codon_start 1 locus_tag LOCUS_25550 CDS 48945..49466 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25560 CDS complement(49488..49700) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25570 CDS 49690..52050 product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038162489.1 transl_table 11 codon_start 1 locus_tag LOCUS_25580 CDS 52050..53390 product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704239.1 transl_table 11 codon_start 1 locus_tag LOCUS_25590 CDS 53387..56629 product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704238.1 transl_table 11 codon_start 1 locus_tag LOCUS_25600 CDS 56742..57830 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25610 CDS 57823..58665 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25620 CDS 58772..59248 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25630 sequence028 source 1..58630 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 49..327 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25640 CDS 510..902 product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001294876.1 transl_table 11 codon_start 1 locus_tag LOCUS_25650 CDS 892..1188 product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096311.1 transl_table 11 codon_start 1 locus_tag LOCUS_25660 CDS 1172..1717 product putative peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166765.1 transl_table 11 codon_start 1 locus_tag LOCUS_25670 CDS 1714..1896 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25680 CDS 1917..2237 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25690 CDS 2237..2737 product DUF1804 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213715.1 transl_table 11 codon_start 1 locus_tag LOCUS_25700 CDS 2784..3524 product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038090.1 transl_table 11 codon_start 1 locus_tag LOCUS_25710 CDS 3526..5166 product phage terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003751157.1 transl_table 11 codon_start 1 locus_tag LOCUS_25720 gene terL CDS 5166..6761 product DUF935 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869229.1 transl_table 11 codon_start 1 locus_tag LOCUS_25730 CDS 6748..7914 product phage minor head protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939976.1 transl_table 11 codon_start 1 locus_tag LOCUS_25740 CDS 7911..8462 product phage virion morphogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939977.1 transl_table 11 codon_start 1 locus_tag LOCUS_25750 CDS 8618..9787 product phage protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939978.1 transl_table 11 codon_start 1 locus_tag LOCUS_25760 CDS 9788..10183 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25770 CDS 10194..11102 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25780 CDS 11106..11438 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25790 CDS 11442..11873 product DUF1320 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225240.1 transl_table 11 codon_start 1 locus_tag LOCUS_25800 CDS 11927..12523 product DUF1834 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225239.1 transl_table 11 codon_start 1 locus_tag LOCUS_25810 CDS 12504..12746 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25820 CDS 12739..14160 product phage tail sheath C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939984.1 transl_table 11 codon_start 1 locus_tag LOCUS_25830 CDS 14173..14547 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939987.1 transl_table 11 codon_start 1 locus_tag LOCUS_25840 CDS 14544..14927 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25850 CDS 14942..15100 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25860 CDS 15090..17372 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25870 CDS 17372..18721 product DNA circularization N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939990.1 transl_table 11 codon_start 1 locus_tag LOCUS_25880 CDS 18705..19916 product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089274228.1 transl_table 11 codon_start 1 locus_tag LOCUS_25890 CDS 19916..20566 product phage baseplate assembly protein V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217230.1 transl_table 11 codon_start 1 locus_tag LOCUS_25900 CDS 20620..20970 product phage GP46 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939994.1 transl_table 11 codon_start 1 locus_tag LOCUS_25910 CDS 20970..22049 product baseplate J/gp47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939995.1 transl_table 11 codon_start 1 locus_tag LOCUS_25920 CDS 22053..22625 product YmfQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222498.1 transl_table 11 codon_start 1 locus_tag LOCUS_25930 CDS 22625..23608 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25940 CDS 23608..24183 product tail fiber assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000885629.1 transl_table 11 codon_start 1 locus_tag LOCUS_25950 CDS 24229..25845 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25960 CDS 25845..26414 product DUF4376 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005061679.1 transl_table 11 codon_start 1 locus_tag LOCUS_25970 CDS complement(26469..27347) product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001293168.1 transl_table 11 codon_start 1 locus_tag LOCUS_25980 CDS complement(27325..28989) product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000993674.1 transl_table 11 codon_start 1 locus_tag LOCUS_25990 gene fliF CDS complement(28994..29350) product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000029087.1 transl_table 11 codon_start 1 locus_tag LOCUS_26000 CDS complement(29387..30373) product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292195.1 transl_table 11 codon_start 1 locus_tag LOCUS_26010 CDS 30983..31849 product FliM/FliN family flagellar motor switch protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000922504.1 transl_table 11 codon_start 1 locus_tag LOCUS_26020 CDS 31842..32213 product FliM/FliN family flagellar motor switch protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000043127.1 transl_table 11 codon_start 1 locus_tag LOCUS_26030 CDS 32210..32968 product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000830282.1 transl_table 11 codon_start 1 locus_tag LOCUS_26040 gene fliP CDS 32980..33252 product flagellar biosynthetic protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000958542.1 transl_table 11 codon_start 1 locus_tag LOCUS_26050 CDS 33254..34036 product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001260504.1 transl_table 11 codon_start 1 locus_tag LOCUS_26060 gene fliR CDS 34026..35165 product flagellar type III secretion system protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000785648.1 transl_table 11 codon_start 1 locus_tag LOCUS_26070 CDS 35149..37242 product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140817.1 transl_table 11 codon_start 1 locus_tag LOCUS_26080 gene flhA CDS 37349..37645 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26090 CDS complement(37642..38406) product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000056849.1 transl_table 11 codon_start 1 locus_tag LOCUS_26100 CDS 38742..39482 product peptidoglycan meso-diaminopimelic acid protein amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001225658.1 transl_table 11 codon_start 1 locus_tag LOCUS_26110 gene dpaA CDS complement(39453..40220) product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000333380.1 transl_table 11 codon_start 1 locus_tag LOCUS_26120 CDS complement(40320..40898) product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000284051.1 transl_table 11 codon_start 1 locus_tag LOCUS_26130 gene lpcA CDS 41137..43581 product acyl-CoA dehydrogenase FadE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000973055.1 transl_table 11 codon_start 1 locus_tag LOCUS_26140 gene fadE CDS 43690..44460 product 2-oxoglutaramate amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118056.1 transl_table 11 codon_start 1 locus_tag LOCUS_26150 gene yafV tRNA complement(45907..45983) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00220 CDS complement(46118..46849) product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297205.1 transl_table 11 codon_start 1 locus_tag LOCUS_26160 gene dnaQ CDS 46913..47380 product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000917872.1 transl_table 11 codon_start 1 locus_tag LOCUS_26170 gene rnhA CDS complement(47365..48099) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298887.1 transl_table 11 codon_start 1 locus_tag LOCUS_26180 CDS 48133..48888 product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001052715.1 transl_table 11 codon_start 1 locus_tag LOCUS_26190 gene gloB CDS 49173..50327 product murein transglycosylase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000644686.1 transl_table 11 codon_start 1 locus_tag LOCUS_26200 gene mltD CDS complement(50377..51147) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211713.1 transl_table 11 codon_start 1 locus_tag LOCUS_26210 CDS complement(51223..52035) product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001230983.1 transl_table 11 codon_start 1 locus_tag LOCUS_26220 CDS 52288..53205 product DNA-binding transcriptional regulator YafC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000648539.1 transl_table 11 codon_start 1 locus_tag LOCUS_26230 gene yafC CDS complement(53210..54013) product 2,5-didehydrogluconate reductase DkgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000154870.1 transl_table 11 codon_start 1 locus_tag LOCUS_26240 gene dkgB CDS complement(54913..55065) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26250 CDS 55109..57928 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26260 sequence029 source 1..58130 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 285..1325 product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000867129.1 transl_table 11 codon_start 1 locus_tag LOCUS_26270 gene pstS CDS 1472..2431 product phosphate ABC transporter permease PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000741630.1 transl_table 11 codon_start 1 locus_tag LOCUS_26280 gene pstC CDS 2431..3321 product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000212190.1 transl_table 11 codon_start 1 locus_tag LOCUS_26290 gene pstA CDS 3421..4194 product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000063125.1 transl_table 11 codon_start 1 locus_tag LOCUS_26300 gene pstB CDS 4238..4963 product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008500182.1 transl_table 11 codon_start 1 locus_tag LOCUS_26310 gene phoU CDS complement(5056..5721) product 6-phosphogluconate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099413.1 transl_table 11 codon_start 1 locus_tag LOCUS_26320 gene yieH CDS 5888..7225 product adenine permease AdeP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001214973.1 transl_table 11 codon_start 1 locus_tag LOCUS_26330 gene adeP CDS complement(7305..7871) product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369022.1 transl_table 11 codon_start 1 locus_tag LOCUS_26340 CDS complement(7882..8484) product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190678.1 transl_table 11 codon_start 1 locus_tag LOCUS_26350 CDS 8978..9511 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26360 CDS complement(9700..11064) product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703904.1 transl_table 11 codon_start 1 locus_tag LOCUS_26370 gene mnmE CDS complement(11171..12814) product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000378272.1 transl_table 11 codon_start 1 locus_tag LOCUS_26380 gene yidC CDS 13164..13361 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26390 CDS 14227..15564 product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000059095.1 transl_table 11 codon_start 1 locus_tag LOCUS_26400 gene dnaA CDS 15569..16669 product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000673464.1 transl_table 11 codon_start 1 locus_tag LOCUS_26410 gene dnaN CDS 16817..17890 product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000059373.1 transl_table 11 codon_start 1 locus_tag LOCUS_26420 gene recF CDS 17919..20333 product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000072047.1 transl_table 11 codon_start 1 locus_tag LOCUS_26430 gene gyrB CDS 20497..21309 product sugar-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000985571.1 transl_table 11 codon_start 1 locus_tag LOCUS_26440 gene yidA CDS 21600..22289 product D-galactonate utilization transcriptional regulator DgoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369039.1 transl_table 11 codon_start 1 locus_tag LOCUS_26450 gene dgoR CDS 22286..23164 product 2-dehydro-3-deoxygalactonokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094784.1 transl_table 11 codon_start 1 locus_tag LOCUS_26460 CDS 23148..23765 product 2-dehydro-3-deoxy-6-phosphogalactonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703895.1 transl_table 11 codon_start 1 locus_tag LOCUS_26470 CDS 23762..24910 product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094786.1 transl_table 11 codon_start 1 locus_tag LOCUS_26480 gene dgoD CDS 25136..26428 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032706561.1 transl_table 11 codon_start 1 locus_tag LOCUS_26490 CDS complement(26389..27531) product colicin M resistance lipid reductase CbrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001318137.1 transl_table 11 codon_start 1 locus_tag LOCUS_26500 gene cbrA CDS 27631..28857 product DUF3748 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809957.1 transl_table 11 codon_start 1 locus_tag LOCUS_26510 CDS complement(28858..29118) product YceK/YidQ family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001313407.1 transl_table 11 codon_start 1 locus_tag LOCUS_26520 CDS 29497..29910 product heat shock chaperone IbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001532742.1 transl_table 11 codon_start 1 locus_tag LOCUS_26530 gene ibpA CDS 30000..30428 product heat shock chaperone IbpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001766501.1 transl_table 11 codon_start 1 locus_tag LOCUS_26540 gene ibpB CDS 30555..32216 product putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001279784.1 transl_table 11 codon_start 1 locus_tag LOCUS_26550 CDS complement(32173..32931) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094792.1 transl_table 11 codon_start 1 locus_tag LOCUS_26560 CDS complement(32963..33658) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301657.1 transl_table 11 codon_start 1 locus_tag LOCUS_26570 CDS 33929..35536 product alpha-glucoside-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094793.1 transl_table 11 codon_start 1 locus_tag LOCUS_26580 CDS 35533..36855 product 6-phospho-alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094794.1 transl_table 11 codon_start 1 locus_tag LOCUS_26590 CDS complement(36852..37745) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001013540.1 transl_table 11 codon_start 1 locus_tag LOCUS_26600 CDS 37913..39628 product solute:sodium symporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001087114.1 transl_table 11 codon_start 1 locus_tag LOCUS_26610 CDS 39625..41118 product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000828527.1 transl_table 11 codon_start 1 locus_tag LOCUS_26620 CDS complement(41185..41634) product protein YidI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000511289.1 transl_table 11 codon_start 1 locus_tag LOCUS_26630 gene yidI CDS 41738..42085 product YidH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014640235.1 transl_table 11 codon_start 1 locus_tag LOCUS_26640 CDS 42075..42437 product DUF202 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001113457.1 transl_table 11 codon_start 1 locus_tag LOCUS_26650 CDS 42452..43546 product anaerobic sulfatase maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000971151.1 transl_table 11 codon_start 1 locus_tag LOCUS_26660 CDS complement(43600..44922) product D-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000427787.1 transl_table 11 codon_start 1 locus_tag LOCUS_26670 gene dsdA CDS complement(44940..46277) product D-serine transporter DsdX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000556035.1 transl_table 11 codon_start 1 locus_tag LOCUS_26680 gene dsdX CDS 46507..47436 product DNA-binding transcriptional regulator DsdC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989264.1 transl_table 11 codon_start 1 locus_tag LOCUS_26690 gene dsdC CDS complement(47454..48575) product multidrug efflux MFS transporter EmrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000828742.1 transl_table 11 codon_start 1 locus_tag LOCUS_26700 gene emrD CDS complement(49008..49841) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703884.1 transl_table 11 codon_start 1 locus_tag LOCUS_26710 CDS 50779..52473 product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000168480.1 transl_table 11 codon_start 1 locus_tag LOCUS_26720 gene ilvB CDS 52477..52767 product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001171826.1 transl_table 11 codon_start 1 locus_tag LOCUS_26730 gene ilvN CDS 52853..53446 product transcriptional regulator UhpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000633668.1 transl_table 11 codon_start 1 locus_tag LOCUS_26740 gene uhpA CDS 53443..54945 product signal transduction histidine-protein kinase/phosphatase UhpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001091255.1 transl_table 11 codon_start 1 locus_tag LOCUS_26750 gene uhpB CDS 54954..56282 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000948180.1 transl_table 11 codon_start 1 locus_tag LOCUS_26760 CDS 56423..57814 product hexose-6-phosphate:phosphate antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000879212.1 transl_table 11 codon_start 1 locus_tag LOCUS_26770 gene uhpT sequence030 source 1..57903 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(44..1543) product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582800.1 transl_table 11 codon_start 1 locus_tag LOCUS_26780 gene gguA CDS 2010..3785 product L-fucose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001033899.1 transl_table 11 codon_start 1 locus_tag LOCUS_26790 gene fucI CDS 3812..5206 product L-fuculokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001763972.1 transl_table 11 codon_start 1 locus_tag LOCUS_26800 gene fucK CDS 5220..5642 product L-fucose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000920848.1 transl_table 11 codon_start 1 locus_tag LOCUS_26810 gene fucU CDS 5683..6393 product L-fucose operon activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642345.1 transl_table 11 codon_start 1 locus_tag LOCUS_26820 gene fucR CDS complement(6436..7536) product 23S rRNA (cytidine(2498)-2'-O)-methyltransferase RlmM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001045494.1 transl_table 11 codon_start 1 locus_tag LOCUS_26830 gene rlmM CDS complement(7529..7924) product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862756.1 transl_table 11 codon_start 1 locus_tag LOCUS_26840 CDS complement(7943..8767) product glycine cleavage system transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000044401.1 transl_table 11 codon_start 1 locus_tag LOCUS_26850 gene gcvA CDS complement(9210..9437) product YgdI/YgdR family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000750393.1 transl_table 11 codon_start 1 locus_tag LOCUS_26860 CDS 9629..10837 product cysteine desulfurase CsdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300698.1 transl_table 11 codon_start 1 locus_tag LOCUS_26870 gene csdA CDS 10834..11283 product cysteine desulfurase sulfur acceptor subunit CsdE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000184198.1 transl_table 11 codon_start 1 locus_tag LOCUS_26880 gene csdE CDS complement(11329..12135) product tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000117716.1 transl_table 11 codon_start 1 locus_tag LOCUS_26890 gene tcdA CDS complement(12293..13360) product murein transglycosylase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000678646.1 transl_table 11 codon_start 1 locus_tag LOCUS_26900 gene mltA tRNA 13598..13674 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00230 tRNA 13719..13795 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00240 tRNA 13839..13915 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00250 CDS complement(14052..15305) product N-acetylmuramoyl-L-alanine amidase AmiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000016907.1 transl_table 11 codon_start 1 locus_tag LOCUS_26910 gene amiC CDS 15538..16869 product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000237947.1 transl_table 11 codon_start 1 locus_tag LOCUS_26920 gene argA CDS complement(16891..18726) product exodeoxyribonuclease V subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000775991.1 transl_table 11 codon_start 1 locus_tag LOCUS_26930 gene recD CDS complement(18723..22271) product exodeoxyribonuclease V subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001322794.1 transl_table 11 codon_start 1 locus_tag LOCUS_26940 gene recB CDS complement(22264..25152) product pitrilysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001138213.1 transl_table 11 codon_start 1 locus_tag LOCUS_26950 gene ptrA CDS complement(25263..28634) product exodeoxyribonuclease V subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000946849.1 transl_table 11 codon_start 1 locus_tag LOCUS_26960 gene recC CDS complement(28650..28970) product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001276460.1 transl_table 11 codon_start 1 locus_tag LOCUS_26970 CDS complement(28955..29362) product DUF2509 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078399.1 transl_table 11 codon_start 1 locus_tag LOCUS_26980 CDS complement(29359..29922) product prepilin peptidase-dependent protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000029148.1 transl_table 11 codon_start 1 locus_tag LOCUS_26990 CDS complement(29913..30383) product prepilin peptidase-dependent protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857051.1 transl_table 11 codon_start 1 locus_tag LOCUS_27000 CDS complement(30567..31361) product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000816222.1 transl_table 11 codon_start 1 locus_tag LOCUS_27010 gene thyA CDS complement(31368..32243) product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000204658.1 transl_table 11 codon_start 1 locus_tag LOCUS_27020 gene lgt CDS complement(32445..34691) product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000957883.1 transl_table 11 codon_start 1 locus_tag LOCUS_27030 gene ptsP CDS complement(34704..35234) product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000564481.1 transl_table 11 codon_start 1 locus_tag LOCUS_27040 gene rppH CDS 35919..36614 product DNA mismatch repair endonuclease MutH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274935.1 transl_table 11 codon_start 1 locus_tag LOCUS_27050 gene mutH CDS 36677..37390 product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000895635.1 transl_table 11 codon_start 1 locus_tag LOCUS_27060 CDS 37526..37744 product lipoprotein YgdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000758655.1 transl_table 11 codon_start 1 locus_tag LOCUS_27070 gene ygdR CDS 37852..38892 product NADP(H)-dependent aldo-keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001199299.1 transl_table 11 codon_start 1 locus_tag LOCUS_27080 CDS complement(38996..40192) product lysophospholipid transporter LplT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004609.1 transl_table 11 codon_start 1 locus_tag LOCUS_27090 gene lplT CDS complement(40185..42344) product bifunctional acyl-ACP--phospholipid O-acyltransferase/long-chain-fatty-acid--ACP ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000899069.1 transl_table 11 codon_start 1 locus_tag LOCUS_27100 gene aas CDS 42933..43961 product HTH-type transcriptional regulator GalR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000201063.1 transl_table 11 codon_start 1 locus_tag LOCUS_27110 gene galR CDS complement(44054..45316) product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001120711.1 transl_table 11 codon_start 1 locus_tag LOCUS_27120 gene lysA CDS 45436..46371 product DNA-binding transcriptional regulator LysR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000741816.1 transl_table 11 codon_start 1 locus_tag LOCUS_27130 gene lysR CDS complement(46358..47050) product aspartate/glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703334.1 transl_table 11 codon_start 1 locus_tag LOCUS_27140 CDS 47158..47517 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098568.1 transl_table 11 codon_start 1 locus_tag LOCUS_27150 CDS 48096..48986 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098570.1 transl_table 11 codon_start 1 locus_tag LOCUS_27160 CDS 48979..49881 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098571.1 transl_table 11 codon_start 1 locus_tag LOCUS_27170 CDS 49894..51021 product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098572.1 transl_table 11 codon_start 1 locus_tag LOCUS_27180 gene ugpC CDS 51036..52322 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098573.1 transl_table 11 codon_start 1 locus_tag LOCUS_27190 CDS complement(52447..53865) product arabinose-proton symporter AraE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000256438.1 transl_table 11 codon_start 1 locus_tag LOCUS_27200 gene araE CDS complement(54179..54940) product 2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000603502.1 transl_table 11 codon_start 1 locus_tag LOCUS_27210 gene kduD CDS complement(54998..55834) product 5-dehydro-4-deoxy-D-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000383248.1 transl_table 11 codon_start 1 locus_tag LOCUS_27220 gene kduI CDS 56281..57456 product oligogalacturonate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098577.1 transl_table 11 codon_start 1 locus_tag LOCUS_27230 sequence031 source 1..57342 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(459..1181) product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000719088.1 transl_table 11 codon_start 1 locus_tag LOCUS_27240 CDS complement(1355..2335) product NADH-dependent methylglyoxal reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000723719.1 transl_table 11 codon_start 1 locus_tag LOCUS_27250 gene ydjG CDS complement(2345..3292) product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309545.1 transl_table 11 codon_start 1 locus_tag LOCUS_27260 CDS complement(3297..4133) product ketose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000878903.1 transl_table 11 codon_start 1 locus_tag LOCUS_27270 CDS complement(4153..5196) product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000798110.1 transl_table 11 codon_start 1 locus_tag LOCUS_27280 CDS complement(5207..6586) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000435315.1 transl_table 11 codon_start 1 locus_tag LOCUS_27290 CDS complement(6613..7689) product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000645203.1 transl_table 11 codon_start 1 locus_tag LOCUS_27300 CDS 7981..9234 product glycoside hydrolase family 18 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097050.1 transl_table 11 codon_start 1 locus_tag LOCUS_27310 CDS 9353..9697 product HNH nuclease YajD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000974818.1 transl_table 11 codon_start 1 locus_tag LOCUS_27320 gene yajD CDS complement(9757..10032) product YeaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046790.1 transl_table 11 codon_start 1 locus_tag LOCUS_27330 CDS complement(10074..10487) product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001284618.1 transl_table 11 codon_start 1 locus_tag LOCUS_27340 gene msrB CDS 10821..11825 product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004203784.1 transl_table 11 codon_start 1 locus_tag LOCUS_27350 gene gapA CDS 11909..12793 product D-hexose-6-phosphate mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366147.1 transl_table 11 codon_start 1 locus_tag LOCUS_27360 CDS complement(12880..13734) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843742.1 transl_table 11 codon_start 1 locus_tag LOCUS_27370 CDS complement(13825..14571) product MipA/OmpV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000163762.1 transl_table 11 codon_start 1 locus_tag LOCUS_27380 CDS 15013..16947 product protein kinase YeaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019882.1 transl_table 11 codon_start 1 locus_tag LOCUS_27390 gene yeaG CDS 17071..18354 product YeaH/YhbH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000219687.1 transl_table 11 codon_start 1 locus_tag LOCUS_27400 CDS 18491..19981 product diguanylate cyclase DgcJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000766132.1 transl_table 11 codon_start 1 locus_tag LOCUS_27410 gene dgcJ CDS 20023..20526 product YbaK/prolyl-tRNA synthetase associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989016.1 transl_table 11 codon_start 1 locus_tag LOCUS_27420 CDS 20803..21249 product DUF441 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460707.1 transl_table 11 codon_start 1 locus_tag LOCUS_27430 CDS complement(21367..22074) product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097066.1 transl_table 11 codon_start 1 locus_tag LOCUS_27440 CDS 22229..22738 product DUF523 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705161.1 transl_table 11 codon_start 1 locus_tag LOCUS_27450 CDS 22722..23069 product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000678599.1 transl_table 11 codon_start 1 locus_tag LOCUS_27460 CDS complement(23055..23366) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000487129.1 transl_table 11 codon_start 1 locus_tag LOCUS_27470 CDS complement(23441..23599) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27480 CDS complement(24118..24366) product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000512149.1 transl_table 11 codon_start 1 locus_tag LOCUS_27490 CDS complement(24752..25435) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000762776.1 transl_table 11 codon_start 1 locus_tag LOCUS_27500 CDS complement(25598..25780) product DUF1869 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000513737.1 transl_table 11 codon_start 1 locus_tag LOCUS_27510 CDS complement(25783..26145) product DUF1971 domain-containing protein YeaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001248993.1 transl_table 11 codon_start 1 locus_tag LOCUS_27520 gene yeaR CDS complement(26311..26949) product leucine efflux protein LeuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000457190.1 transl_table 11 codon_start 1 locus_tag LOCUS_27530 gene leuE CDS complement(27153..27317) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27540 CDS 27353..28618 product Y-family DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366112.1 transl_table 11 codon_start 1 locus_tag LOCUS_27550 CDS 28747..29634 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037382345.1 transl_table 11 codon_start 1 locus_tag LOCUS_27560 CDS complement(29679..31016) product CitMHS family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038452.1 transl_table 11 codon_start 1 locus_tag LOCUS_27570 CDS complement(31092..31835) product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193701.1 transl_table 11 codon_start 1 locus_tag LOCUS_27580 CDS 32136..33236 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27590 CDS complement(33267..34190) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807817.1 transl_table 11 codon_start 1 locus_tag LOCUS_27600 CDS complement(34205..36853) product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259000.1 transl_table 11 codon_start 1 locus_tag LOCUS_27610 gene acnA CDS complement(36978..37655) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815414.1 transl_table 11 codon_start 1 locus_tag LOCUS_27620 CDS complement(37642..39024) product glucarate transporter GudP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234818.1 transl_table 11 codon_start 1 locus_tag LOCUS_27630 gene gudP CDS complement(39048..39926) product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153441905.1 transl_table 11 codon_start 1 locus_tag LOCUS_27640 CDS complement(39959..40612) product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085692.1 transl_table 11 codon_start 1 locus_tag LOCUS_27650 CDS complement(40664..41734) product isocitrate/isopropylmalate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139076345.1 transl_table 11 codon_start 1 locus_tag LOCUS_27660 CDS 42057..43319 product four-carbon acid sugar kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298110.1 transl_table 11 codon_start 1 locus_tag LOCUS_27670 CDS 43312..43950 product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170138703.1 transl_table 11 codon_start 1 locus_tag LOCUS_27680 CDS 44029..45330 product CitMHS family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003313973.1 transl_table 11 codon_start 1 locus_tag LOCUS_27690 CDS complement(45412..45828) product translesion error-prone DNA polymerase V autoproteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000897380.1 transl_table 11 codon_start 1 locus_tag LOCUS_27700 CDS complement(46041..46688) product metal-binding protein ZinT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000234684.1 transl_table 11 codon_start 1 locus_tag LOCUS_27710 gene zinT CDS complement(46827..47153) product four-helix bundle copper-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001183698.1 transl_table 11 codon_start 1 locus_tag LOCUS_27720 CDS 47503..48390 product extended-spectrum class A beta-lactamase CTX-M-15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000239590.1 transl_table 11 codon_start 1 locus_tag LOCUS_27730 gene blaCTX-M CDS 48477..48815 product DUF1471 family virulence protein SrfN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000745961.1 transl_table 11 codon_start 1 locus_tag LOCUS_27740 gene srfN tRNA complement(48910..48984) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00260 CDS 49225..49422 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096722.1 transl_table 11 codon_start 1 locus_tag LOCUS_27750 CDS 49424..50185 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096723.1 transl_table 11 codon_start 1 locus_tag LOCUS_27760 CDS 50443..51000 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27770 CDS complement(51161..51364) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27780 CDS complement(51571..52821) product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444506.1 transl_table 11 codon_start 1 locus_tag LOCUS_27790 gene icd CDS 53143..53649 product 23S rRNA pseudouridine(2457) synthase RluE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001248659.1 transl_table 11 codon_start 1 locus_tag LOCUS_27800 gene rluE CDS 53660..54121 product phosphatase NudJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000476089.1 transl_table 11 codon_start 1 locus_tag LOCUS_27810 gene nudJ CDS 54131..55282 product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301861.1 transl_table 11 codon_start 1 locus_tag LOCUS_27820 gene mnmA CDS 55311..55958 product high frequency lysogenization protein HflD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297479.1 transl_table 11 codon_start 1 locus_tag LOCUS_27830 gene hflD CDS 55962..57332 product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000423729.1 transl_table 11 codon_start 1 locus_tag LOCUS_27840 gene purB sequence032 source 1..56512 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..6193 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001237656.1:Ig-like domain repeat protein locus_tag LOCUS_27850 CDS 6276..7682 product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098387.1 transl_table 11 codon_start 1 locus_tag LOCUS_27860 CDS 7679..9445 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27870 CDS 9426..10616 product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989217.1 transl_table 11 codon_start 1 locus_tag LOCUS_27880 tmRNA 10688..11052 product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_tm00010 CDS 11322..11567 product DinI-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001261928.1 transl_table 11 codon_start 1 locus_tag LOCUS_27890 CDS 11670..11849 product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674407.1 transl_table 11 codon_start 1 locus_tag LOCUS_27900 CDS 11873..12283 product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552310.1 transl_table 11 codon_start 1 locus_tag LOCUS_27910 CDS 12311..12862 product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954203.1 transl_table 11 codon_start 1 locus_tag LOCUS_27920 CDS complement(12878..13456) product tail fiber assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000885629.1 transl_table 11 codon_start 1 locus_tag LOCUS_27930 CDS complement(13456..14304) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27940 CDS complement(14358..14963) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27950 CDS complement(14960..16117) product baseplate J/gp47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208847.1 transl_table 11 codon_start 1 locus_tag LOCUS_27960 CDS complement(16107..16559) product phage GP46 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208848.1 transl_table 11 codon_start 1 locus_tag LOCUS_27970 CDS complement(16556..17140) product phage baseplate assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215460.1 transl_table 11 codon_start 1 locus_tag LOCUS_27980 CDS complement(17137..18216) product contractile injection system protein, VgrG/Pvc8 family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208850.1 transl_table 11 codon_start 1 locus_tag LOCUS_27990 CDS complement(18213..19613) product DNA circularization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208852.1 transl_table 11 codon_start 1 locus_tag LOCUS_28000 CDS complement(19650..21563) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28010 CDS complement(21556..21747) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28020 CDS complement(21705..21983) product phage tail assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208854.1 transl_table 11 codon_start 1 locus_tag LOCUS_28030 CDS complement(21986..22357) product phage tail tube protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208855.1 transl_table 11 codon_start 1 locus_tag LOCUS_28040 CDS complement(22361..23863) product phage tail sheath subtilisin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208856.1 transl_table 11 codon_start 1 locus_tag LOCUS_28050 CDS complement(23860..24024) product DUF2635 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208857.1 transl_table 11 codon_start 1 locus_tag LOCUS_28060 CDS complement(24027..24572) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208858.1 transl_table 11 codon_start 1 locus_tag LOCUS_28070 CDS complement(24569..24919) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28080 CDS complement(24922..25227) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28090 CDS complement(25229..26278) product major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939445.1 transl_table 11 codon_start 1 locus_tag LOCUS_28100 CDS complement(26372..26779) product head decoration protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975798.1 transl_table 11 codon_start 1 locus_tag LOCUS_28110 CDS complement(26779..27381) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28120 CDS complement(27383..28249) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28130 CDS complement(28249..29892) product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975801.1 transl_table 11 codon_start 1 locus_tag LOCUS_28140 CDS complement(29892..30155) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28150 CDS complement(30164..32143) product phage terminase large subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001390573.1 transl_table 11 codon_start 1 locus_tag LOCUS_28160 CDS complement(32109..32714) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28170 CDS complement(32885..33526) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28180 CDS complement(33537..34202) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28190 CDS complement(34192..34812) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28200 CDS complement(35632..35829) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072625.1 transl_table 11 codon_start 1 locus_tag LOCUS_28210 CDS complement(35801..36355) product DUF2514 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001050879.1 transl_table 11 codon_start 1 locus_tag LOCUS_28220 CDS complement(36359..36766) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939016.1 transl_table 11 codon_start 1 locus_tag LOCUS_28230 CDS complement(36763..37095) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28240 CDS complement(37273..38325) product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000578748.1 transl_table 11 codon_start 1 locus_tag LOCUS_28250 CDS complement(38475..38666) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000917750.1 transl_table 11 codon_start 1 locus_tag LOCUS_28260 CDS complement(38865..39560) product bacteriophage antitermination protein Q inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095969.1 transl_table 11 codon_start 1 locus_tag LOCUS_28270 CDS complement(39582..40649) product DUF968 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001393597.1 transl_table 11 codon_start 1 locus_tag LOCUS_28280 CDS complement(40646..42373) product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816510.1 transl_table 11 codon_start 1 locus_tag LOCUS_28290 CDS complement(42366..43247) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28300 CDS complement(43244..44116) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28310 CDS complement(44294..44998) product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115765672.1 transl_table 11 codon_start 1 locus_tag LOCUS_28320 CDS complement(44979..45176) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28330 CDS complement(45173..45730) product protein YmfL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000515848.1 transl_table 11 codon_start 1 locus_tag LOCUS_28340 gene ymfL CDS complement(45723..45986) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001191669.1 transl_table 11 codon_start 1 locus_tag LOCUS_28350 CDS 46085..46780 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001353346.1 transl_table 11 codon_start 1 locus_tag LOCUS_28360 CDS 47773..48144 product protein YfdP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135680.1 transl_table 11 codon_start 1 locus_tag LOCUS_28370 gene yfdP CDS 48201..49028 product DUF2303 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000081252.1 transl_table 11 codon_start 1 locus_tag LOCUS_28380 CDS 49167..49709 product 5'-deoxynucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001603282.1 transl_table 11 codon_start 1 locus_tag LOCUS_28390 gene yfdR CDS 49694..49894 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28400 CDS 49891..50217 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28410 CDS 50214..50945 product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989482.1 transl_table 11 codon_start 1 locus_tag LOCUS_28420 CDS 50942..51139 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28430 CDS 51139..51612 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28440 note possible pseudo, frameshifted CDS 51749..51955 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28450 CDS 51916..53082 product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926852.1 transl_table 11 codon_start 1 locus_tag LOCUS_28460 CDS 53086..54873 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28470 CDS 54953..55834 product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206252.1 transl_table 11 codon_start 1 locus_tag LOCUS_28480 sequence033 source 1..52843 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(547..960) product regulatory protein GemA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939964.1 transl_table 11 codon_start 1 locus_tag LOCUS_28490 CDS complement(932..1264) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28500 CDS complement(1291..1554) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28510 CDS complement(1679..2089) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28520 CDS complement(2456..2644) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28530 CDS complement(2641..2931) product DUF4752 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020909.1 transl_table 11 codon_start 1 locus_tag LOCUS_28540 CDS complement(2921..3151) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28550 CDS complement(3148..3375) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28560 CDS complement(3378..4088) product DUF2786 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072609.1 transl_table 11 codon_start 1 locus_tag LOCUS_28570 CDS complement(4365..4910) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28580 CDS complement(4992..5183) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28590 CDS complement(5164..5397) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28600 CDS complement(5399..6043) product DUF3164 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072605.1 transl_table 11 codon_start 1 locus_tag LOCUS_28610 CDS complement(6073..6288) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28620 CDS complement(6278..6469) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28630 CDS complement(6485..6709) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28640 CDS complement(6751..7083) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28650 CDS complement(7098..7991) product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003751204.1 transl_table 11 codon_start 1 locus_tag LOCUS_28660 CDS complement(8009..10051) product Mu transposase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000289290.1 transl_table 11 codon_start 1 locus_tag LOCUS_28670 CDS complement(10051..10287) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000433427.1 transl_table 11 codon_start 1 locus_tag LOCUS_28680 CDS 10470..11117 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28690 CDS 11441..12685 product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001279402.1 transl_table 11 codon_start 1 locus_tag LOCUS_28700 gene fliI CDS 12688..13131 product flagellar export protein FliJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001248917.1 transl_table 11 codon_start 1 locus_tag LOCUS_28710 gene fliJ CDS 13128..13526 product adenylyltransferase/cytidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000859527.1 transl_table 11 codon_start 1 locus_tag LOCUS_28720 CDS complement(13507..14280) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28730 CDS complement(14328..15908) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28740 note possible pseudo, internal stop codon CDS complement(16017..16886) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28750 note possible pseudo, internal stop codon CDS complement(16935..17873) product lysine-N-methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191775953.1 transl_table 11 codon_start 1 locus_tag LOCUS_28760 CDS complement(18016..18444) product flagellar protein FlgN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027804.1 transl_table 11 codon_start 1 locus_tag LOCUS_28770 CDS complement(18460..18747) product flagellar biosynthesis anti-sigma factor FlgM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000705404.1 transl_table 11 codon_start 1 locus_tag LOCUS_28780 gene flgM CDS complement(18843..19571) product flagellar basal body P-ring formation chaperone FlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309268.1 transl_table 11 codon_start 1 locus_tag LOCUS_28790 gene flgA CDS 19696..20043 product flagellar biosynthesis protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000512950.1 transl_table 11 codon_start 1 locus_tag LOCUS_28800 CDS 20046..20477 product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000010941.1 transl_table 11 codon_start 1 locus_tag LOCUS_28810 gene flgC CDS 20477..21289 product flagellar hook capping FlgD N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001093678.1 transl_table 11 codon_start 1 locus_tag LOCUS_28820 CDS 21315..22517 product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000119538.1 transl_table 11 codon_start 1 locus_tag LOCUS_28830 gene flgE CDS 22529..23056 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28840 note possible pseudo, internal stop codon CDS 23060..23266 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28850 note possible pseudo, internal stop codon CDS 23297..24082 product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000990540.1 transl_table 11 codon_start 1 locus_tag LOCUS_28860 gene flgG CDS 24139..24804 product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000800864.1 transl_table 11 codon_start 1 locus_tag LOCUS_28870 gene flgH CDS 24819..25940 product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_059224973.1 transl_table 11 codon_start 1 locus_tag LOCUS_28880 CDS 25940..26254 product rod-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000867281.1 transl_table 11 codon_start 1 locus_tag LOCUS_28890 CDS 26354..27721 product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000367245.1 transl_table 11 codon_start 1 locus_tag LOCUS_28900 gene flgK CDS 27736..28665 product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001266799.1 transl_table 11 codon_start 1 locus_tag LOCUS_28910 gene flgL CDS 28734..29735 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001195938.1 transl_table 11 codon_start 1 locus_tag LOCUS_28920 CDS complement(29732..30205) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28930 CDS complement(30183..31160) product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181672479.1 transl_table 11 codon_start 1 locus_tag LOCUS_28940 CDS 31731..32636 product lateral flagellin LafA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000949083.1 transl_table 11 codon_start 1 locus_tag LOCUS_28950 gene lafA CDS 32841..34160 product flagellar filament capping protein FliD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000609678.1 transl_table 11 codon_start 1 locus_tag LOCUS_28960 gene fliD CDS 34194..34586 product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000285322.1 transl_table 11 codon_start 1 locus_tag LOCUS_28970 gene fliS CDS 34591..34908 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415004.1 transl_table 11 codon_start 1 locus_tag LOCUS_28980 CDS 34905..36056 product flagellar hook-length control protein FliK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001067489.1 transl_table 11 codon_start 1 locus_tag LOCUS_28990 CDS 36079..36528 product flagellar basal body-associated FliL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000725259.1 transl_table 11 codon_start 1 locus_tag LOCUS_29000 CDS 36549..37265 product FliA/WhiG family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000938726.1 transl_table 11 codon_start 1 locus_tag LOCUS_29010 CDS 37294..38157 product flagellar motor stator protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001169518.1 transl_table 11 codon_start 1 locus_tag LOCUS_29020 gene motA CDS 38160..39155 product putative lateral flagellar export/assembly protein LafU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001232550.1 transl_table 11 codon_start 1 locus_tag LOCUS_29030 gene lafU CDS 39207..39848 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29040 CDS 39930..40985 product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226164.1 transl_table 11 codon_start 1 locus_tag LOCUS_29050 gene dinB CDS complement(41079..42536) product cytosol nonspecific dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001293009.1 transl_table 11 codon_start 1 locus_tag LOCUS_29060 gene pepD CDS 42801..43259 product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291990.1 transl_table 11 codon_start 1 locus_tag LOCUS_29070 gene gpt CDS 43359..44603 product esterase FrsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000189584.1 transl_table 11 codon_start 1 locus_tag LOCUS_29080 gene frsA CDS 44661..45062 product sigma factor-binding protein Crl inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000174682.1 transl_table 11 codon_start 1 locus_tag LOCUS_29090 gene crl CDS complement(45113..46165) product phosphoporin PhoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095744.1 transl_table 11 codon_start 1 locus_tag LOCUS_29100 gene phoE CDS 46451..47554 product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001285275.1 transl_table 11 codon_start 1 locus_tag LOCUS_29110 gene proB CDS 47565..48815 product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000893213.1 transl_table 11 codon_start 1 locus_tag LOCUS_29120 gene proA tRNA 48929..49004 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00270 CDS complement(49607..50482) product type III secretion system effector OspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463140.1 transl_table 11 codon_start 1 locus_tag LOCUS_29130 gene ospB CDS complement(50826..52118) product type III secretion system effector NleA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001025672.1 transl_table 11 codon_start 1 locus_tag LOCUS_29140 gene nleA sequence034 source 1..52811 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(86..2233) product formate dehydrogenase N subunit alpha, selenocysteine-containing inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989279.1 transl_table 11 codon_start 1 transl_except (pos:1814..1816,aa:Sec) note codon on position 140 is selenocysteine opal codon. locus_tag LOCUS_29150 CDS complement(2430..3335) product allose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001171687.1 transl_table 11 codon_start 1 locus_tag LOCUS_29160 gene alsK CDS complement(3319..4014) product D-allulose-6-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001314355.1 transl_table 11 codon_start 1 locus_tag LOCUS_29170 gene alsE CDS complement(4025..5005) product D-allose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000507105.1 transl_table 11 codon_start 1 locus_tag LOCUS_29180 gene alsC CDS complement(4984..6516) product D-allose ABC transporter ATP-binding protein AlsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000235240.1 transl_table 11 codon_start 1 locus_tag LOCUS_29190 gene alsA CDS complement(6615..7550) product D-allose transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001361478.1 transl_table 11 codon_start 1 locus_tag LOCUS_29200 gene alsB CDS complement(7609..8499) product als operon DNA-binding transcriptional repressor AlsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000083216.1 transl_table 11 codon_start 1 locus_tag LOCUS_29210 gene alsR CDS 8847..9290 product bifunctional allose-6-phosphate isomerase/ribose-5-phosphate isomerase RpiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000716792.1 transl_table 11 codon_start 1 locus_tag LOCUS_29220 gene rpiB CDS 9365..9694 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29230 CDS 9843..10721 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29240 CDS 10852..11673 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29250 CDS complement(11708..12043) product zinc ribbon domain-containing protein YjdM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000056482.1 transl_table 11 codon_start 1 locus_tag LOCUS_29260 CDS complement(12254..13258) product 2-keto-3-deoxygluconate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095118.1 transl_table 11 codon_start 1 locus_tag LOCUS_29270 gene kdgT CDS 13955..15457 product glycine betaine/L-proline transporter ProP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000919708.1 transl_table 11 codon_start 1 locus_tag LOCUS_29280 gene proP CDS complement(15759..16838) product two-component system sensor histidine kinase PmrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001212189.1 transl_table 11 codon_start 1 locus_tag LOCUS_29290 gene pmrB CDS complement(16839..17513) product two-component system response regulator BasR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000697907.1 transl_table 11 codon_start 1 locus_tag LOCUS_29300 gene basR CDS complement(17510..19168) product phosphoethanolamine transferase EptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000919286.1 transl_table 11 codon_start 1 locus_tag LOCUS_29310 gene eptA CDS complement(19251..20897) product class I fumarate hydratase FumA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037190.1 transl_table 11 codon_start 1 locus_tag LOCUS_29320 gene fumA CDS complement(20974..22314) product anaerobic C4-dicarboxylate transporter DcuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000899522.1 transl_table 11 codon_start 1 locus_tag LOCUS_29330 gene dcuB CDS complement(22947..23666) product two-component system response regulator DcuR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000611288.1 transl_table 11 codon_start 1 locus_tag LOCUS_29340 gene dcuR CDS complement(23663..25252) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001216477.1 transl_table 11 codon_start 1 locus_tag LOCUS_29350 CDS complement(25415..26368) product nickel/cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038418498.1 transl_table 11 codon_start 1 locus_tag LOCUS_29360 CDS 26319..26480 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29370 CDS 26572..28701 product DmsA/YnfE/YnfF family dimethyl sulfoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211602.1 transl_table 11 codon_start 1 locus_tag LOCUS_29380 CDS 28701..29003 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29390 note possible pseudo, frameshifted CDS 29017..29643 product dimethylsulfoxide reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211603.1 transl_table 11 codon_start 1 locus_tag LOCUS_29400 gene dmsB CDS 29636..30406 product dimethyl sulfoxide reductase anchor subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000544919.1 transl_table 11 codon_start 1 locus_tag LOCUS_29410 CDS 30552..31148 product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001112218.1 transl_table 11 codon_start 1 locus_tag LOCUS_29420 CDS 31145..31690 product ferredoxin-type protein NapF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006996351.1 transl_table 11 codon_start 1 locus_tag LOCUS_29430 gene napF CDS 32102..32632 product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095121.1 transl_table 11 codon_start 1 locus_tag LOCUS_29440 CDS complement(32623..32820) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29450 CDS 32804..33253 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29460 CDS 33317..35791 product fimbria/pilus outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_120159885.1 transl_table 11 codon_start 1 locus_tag LOCUS_29470 CDS 35835..36578 product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095123.1 transl_table 11 codon_start 1 locus_tag LOCUS_29480 CDS 36597..37220 product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703381.1 transl_table 11 codon_start 1 locus_tag LOCUS_29490 CDS 37220..38278 product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095124.1 transl_table 11 codon_start 1 locus_tag LOCUS_29500 CDS 38288..38836 product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095125.1 transl_table 11 codon_start 1 locus_tag LOCUS_29510 CDS 38859..39521 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095126.1 transl_table 11 codon_start 1 locus_tag LOCUS_29520 CDS 39609..39806 product DUF4762 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095127.1 transl_table 11 codon_start 1 locus_tag LOCUS_29530 CDS 39869..40540 product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_120159870.1 transl_table 11 codon_start 1 locus_tag LOCUS_29540 CDS 40545..41495 product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_120159871.1 transl_table 11 codon_start 1 locus_tag LOCUS_29550 CDS 41504..43612 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095130.1 transl_table 11 codon_start 1 locus_tag LOCUS_29560 CDS 43609..44760 product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095131.1 transl_table 11 codon_start 1 locus_tag LOCUS_29570 CDS 44764..46695 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095132.1 transl_table 11 codon_start 1 locus_tag LOCUS_29580 CDS 46692..48119 product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200832808.1 transl_table 11 codon_start 1 locus_tag LOCUS_29590 CDS 48106..49359 product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095134.1 transl_table 11 codon_start 1 locus_tag LOCUS_29600 CDS 49356..50150 product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095135.1 transl_table 11 codon_start 1 locus_tag LOCUS_29610 CDS 50147..50398 product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095136.1 transl_table 11 codon_start 1 locus_tag LOCUS_29620 CDS 50415..51137 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200832809.1 transl_table 11 codon_start 1 locus_tag LOCUS_29630 CDS complement(51174..52295) product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095138.1 transl_table 11 codon_start 1 locus_tag LOCUS_29640 sequence035 source 1..51805 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 144..308 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29650 note possible pseudo, frameshifted CDS 247..513 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29660 note possible pseudo, frameshifted CDS complement(724..1302) product T3SS effector guanine nucleotide exchange factor EspM2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001132157.1 transl_table 11 codon_start 1 locus_tag LOCUS_29670 gene espM2 CDS 1604..1879 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29680 note possible pseudo, internal stop codon, frameshifted CDS complement(3053..3436) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29690 note possible pseudo, internal stop codon, frameshifted CDS complement(3732..3968) product phage tail fiber C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001024006.1 transl_table 11 codon_start 1 locus_tag LOCUS_29700 CDS complement(3990..4490) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29710 note possible pseudo, internal stop codon CDS complement(4500..4658) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29720 CDS 4757..5266 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29730 note possible pseudo, frameshifted CDS complement(5876..6457) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29740 CDS complement(8460..9335) product DUF1932 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162494215.1 transl_table 11 codon_start 1 locus_tag LOCUS_29750 CDS complement(9335..10417) product 4-oxalomesaconate tautomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969456.1 transl_table 11 codon_start 1 locus_tag LOCUS_29760 CDS complement(10419..11132) product 4-carboxy-4-hydroxy-2-oxoadipate aldolase/oxaloacetate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208962.1 transl_table 11 codon_start 1 locus_tag LOCUS_29770 CDS complement(11129..11869) product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208961.1 transl_table 11 codon_start 1 locus_tag LOCUS_29780 CDS 11959..13224 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208960.1 transl_table 11 codon_start 1 locus_tag LOCUS_29790 CDS complement(13221..14483) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29800 CDS complement(14497..15867) product aromatic acid/H+ symport family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703774.1 transl_table 11 codon_start 1 locus_tag LOCUS_29810 CDS 16040..16234 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29820 CDS complement(16193..16462) product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621026.1 transl_table 11 codon_start 1 locus_tag LOCUS_29830 CDS complement(16472..17332) product class II aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001131788.1 transl_table 11 codon_start 1 locus_tag LOCUS_29840 CDS complement(17397..18881) product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001113563.1 transl_table 11 codon_start 1 locus_tag LOCUS_29850 CDS complement(18874..20232) product PTS galactitol transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000997823.1 transl_table 11 codon_start 1 locus_tag LOCUS_29860 CDS complement(20310..20597) product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000041396.1 transl_table 11 codon_start 1 locus_tag LOCUS_29870 CDS complement(20594..21067) product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001161554.1 transl_table 11 codon_start 1 locus_tag LOCUS_29880 CDS complement(21078..21827) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000854956.1 transl_table 11 codon_start 1 locus_tag LOCUS_29890 CDS 23475..23831 product anti-adapter protein IraM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704054.1 transl_table 11 codon_start 1 locus_tag LOCUS_29900 gene iraM CDS 24144..24500 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098385.1 transl_table 11 codon_start 1 locus_tag LOCUS_29910 CDS complement(24617..26029) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000872343.1 transl_table 11 codon_start 1 locus_tag LOCUS_29920 CDS complement(26016..26690) product transcriptional regulator TctD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001237936.1 transl_table 11 codon_start 1 locus_tag LOCUS_29930 gene tctD CDS 26769..27557 product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098088.1 transl_table 11 codon_start 1 locus_tag LOCUS_29940 CDS 27572..28003 product tripartite tricarboxylate transporter TctB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001283754.1 transl_table 11 codon_start 1 locus_tag LOCUS_29950 CDS 28012..29526 product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706152.1 transl_table 11 codon_start 1 locus_tag LOCUS_29960 CDS complement(29523..31016) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186277841.1 transl_table 11 codon_start 1 locus_tag LOCUS_29970 CDS complement(31284..31733) product potassium binding protein Kbp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000522413.1 transl_table 11 codon_start 1 locus_tag LOCUS_29980 gene kbp CDS complement(31867..32025) product YqaE/Pmp3 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705362.1 transl_table 11 codon_start 1 locus_tag LOCUS_29990 CDS 32209..32508 product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000137280.1 transl_table 11 codon_start 1 locus_tag LOCUS_30000 CDS 32518..33042 product thiosulfate sulfurtransferase YgaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001229442.1 transl_table 11 codon_start 1 locus_tag LOCUS_30010 gene ygaP CDS complement(33090..33491) product DNA-binding protein StpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000115379.1 transl_table 11 codon_start 1 locus_tag LOCUS_30020 gene stpA CDS 33979..34428 product L-alanine exporter AlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000492656.1 transl_table 11 codon_start 1 locus_tag LOCUS_30030 gene alaE CDS complement(34462..34806) product DUF2002 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281320.1 transl_table 11 codon_start 1 locus_tag LOCUS_30040 CDS 34969..35295 product DUF883 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001519557.1 transl_table 11 codon_start 1 locus_tag LOCUS_30050 CDS 35558..35803 product glutaredoxin-like protein NrdH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000028873.1 transl_table 11 codon_start 1 locus_tag LOCUS_30060 gene nrdH CDS 35800..36210 product class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000080944.1 transl_table 11 codon_start 1 locus_tag LOCUS_30070 gene nrdI CDS 36183..38327 product class 1b ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000246553.1 transl_table 11 codon_start 1 locus_tag LOCUS_30080 gene nrdE CDS 38338..39297 product class 1b ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000777898.1 transl_table 11 codon_start 1 locus_tag LOCUS_30090 gene nrdF CDS 39652..40854 product glycine betaine/L-proline ABC transporter ATP-binding protein ProV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000985494.1 transl_table 11 codon_start 1 locus_tag LOCUS_30100 gene proV CDS 40847..41908 product glycine betaine/L-proline ABC transporter permease ProW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000774978.1 transl_table 11 codon_start 1 locus_tag LOCUS_30110 gene proW CDS 41983..42978 product glycine betaine/L-proline ABC transporter substrate-binding protein ProX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001216613.1 transl_table 11 codon_start 1 locus_tag LOCUS_30120 gene proX CDS 43128..44222 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000165770.1 transl_table 11 codon_start 1 locus_tag LOCUS_30130 CDS 44834..45364 product transcriptional repressor MprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098427.1 transl_table 11 codon_start 1 locus_tag LOCUS_30140 gene mprA CDS 45488..46660 product multidrug efflux MFS transporter periplasmic adaptor subunit EmrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001275597.1 transl_table 11 codon_start 1 locus_tag LOCUS_30150 gene emrA CDS 46677..48215 product multidrug efflux MFS transporter permease subunit EmrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295176.1 transl_table 11 codon_start 1 locus_tag LOCUS_30160 gene emrB CDS complement(48271..48786) product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001130208.1 transl_table 11 codon_start 1 locus_tag LOCUS_30170 gene luxS CDS complement(48935..50491) product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000611827.1 transl_table 11 codon_start 1 locus_tag LOCUS_30180 gene gshA CDS complement(50568..50996) product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287454.1 transl_table 11 codon_start 1 locus_tag LOCUS_30190 CDS complement(50993..51559) product fructose-1-phosphate/6-phosphogluconate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000273309.1 transl_table 11 codon_start 1 locus_tag LOCUS_30200 gene yqaB sequence036 source 1..50583 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(87..584) product TIGR00645 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000439331.1 transl_table 11 codon_start 1 locus_tag LOCUS_30210 CDS complement(653..1147) product RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000433046.1 transl_table 11 codon_start 1 locus_tag LOCUS_30220 CDS 1252..1662 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000936453.1 transl_table 11 codon_start 1 locus_tag LOCUS_30230 CDS 1655..2092 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098710.1 transl_table 11 codon_start 1 locus_tag LOCUS_30240 CDS 2169..3053 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019040.1 transl_table 11 codon_start 1 locus_tag LOCUS_30250 CDS complement(3197..3622) product TonB system transport protein ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001240712.1 transl_table 11 codon_start 1 locus_tag LOCUS_30260 gene exbD CDS complement(3629..4363) product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000527859.1 transl_table 11 codon_start 1 locus_tag LOCUS_30270 gene exbB CDS 4613..5800 product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130268.1 transl_table 11 codon_start 1 locus_tag LOCUS_30280 gene metC CDS 5940..6599 product DedA family general envelope maintenance protein YghB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000268419.1 transl_table 11 codon_start 1 locus_tag LOCUS_30290 gene yghB CDS complement(6625..6876) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30300 note possible pseudo, internal stop codon CDS complement(6895..7527) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30310 note possible pseudo, internal stop codon CDS 7721..8884 product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001058802.1 transl_table 11 codon_start 1 locus_tag LOCUS_30320 gene yqhD CDS 8989..9816 product 2,5-didehydrogluconate reductase DkgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098717.1 transl_table 11 codon_start 1 locus_tag LOCUS_30330 gene dkgA CDS complement(9850..10266) product carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212066.1 transl_table 11 codon_start 1 locus_tag LOCUS_30340 CDS complement(10383..12548) product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274469.1 transl_table 11 codon_start 1 locus_tag LOCUS_30350 CDS complement(12658..14070) product cell division protein FtsP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000010658.1 transl_table 11 codon_start 1 locus_tag LOCUS_30360 gene ftsP CDS complement(14147..14884) product 1-acylglycerol-3-phosphate O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000965730.1 transl_table 11 codon_start 1 locus_tag LOCUS_30370 gene plsC CDS complement(15132..17390) product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001281905.1 transl_table 11 codon_start 1 locus_tag LOCUS_30380 gene parC CDS complement(17521..17946) product YgiW/YdeI family stress tolerance OB fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000731552.1 transl_table 11 codon_start 1 locus_tag LOCUS_30390 CDS 18065..18724 product quorum sensing response regulator transcription factor QseB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001221574.1 transl_table 11 codon_start 1 locus_tag LOCUS_30400 gene qseB CDS 18727..20073 product quorum sensing histidine kinase QseC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000779337.1 transl_table 11 codon_start 1 locus_tag LOCUS_30410 gene qseC CDS 20179..20760 product NADPH:quinone oxidoreductase MdaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000065430.1 transl_table 11 codon_start 1 locus_tag LOCUS_30420 gene mdaB CDS 20791..21105 product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000958587.1 transl_table 11 codon_start 1 locus_tag LOCUS_30430 CDS complement(21157..22341) product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703496.1 transl_table 11 codon_start 1 locus_tag LOCUS_30440 CDS complement(22517..23707) product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098730.1 transl_table 11 codon_start 1 locus_tag LOCUS_30450 CDS complement(23731..24117) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30460 note possible pseudo, frameshifted CDS complement(24120..24998) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30470 note possible pseudo, frameshifted CDS complement(25032..26852) product DUF2264 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098732.1 transl_table 11 codon_start 1 locus_tag LOCUS_30480 CDS 27017..27868 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098733.1 transl_table 11 codon_start 1 locus_tag LOCUS_30490 CDS complement(28042..29934) product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000195318.1 transl_table 11 codon_start 1 locus_tag LOCUS_30500 gene parE CDS complement(29963..30544) product esterase YqiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105725.1 transl_table 11 codon_start 1 locus_tag LOCUS_30510 gene yqiA CDS complement(30544..31371) product 3',5'-cyclic-AMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444734.1 transl_table 11 codon_start 1 locus_tag LOCUS_30520 gene cpdA CDS complement(31396..31818) product DUF1249 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000833403.1 transl_table 11 codon_start 1 locus_tag LOCUS_30530 CDS complement(31815..32447) product ADP-ribose diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001231952.1 transl_table 11 codon_start 1 locus_tag LOCUS_30540 gene nudF CDS 32656..34137 product outer membrane channel protein TolC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000735278.1 transl_table 11 codon_start 1 locus_tag LOCUS_30550 gene tolC CDS 34335..35006 product DUF1190 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000831528.1 transl_table 11 codon_start 1 locus_tag LOCUS_30560 CDS 35012..36172 product glutathionylspermidine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000442860.1 transl_table 11 codon_start 1 locus_tag LOCUS_30570 CDS complement(36204..37001) product 4,5-DOPA dioxygenase extradiol inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000245226.1 transl_table 11 codon_start 1 locus_tag LOCUS_30580 gene ygiD CDS 37133..37906 product zinc transporter ZupT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000115874.1 transl_table 11 codon_start 1 locus_tag LOCUS_30590 gene zupT CDS complement(37935..38111) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000469259.1 transl_table 11 codon_start 1 locus_tag LOCUS_30600 CDS 38514..40310 product aryl-sulfate sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460261.1 transl_table 11 codon_start 1 locus_tag LOCUS_30610 CDS 40338..41006 product thiol:disulfide interchange protein DsbA/DsbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000096232.1 transl_table 11 codon_start 1 locus_tag LOCUS_30620 CDS 41021..41698 product protein-disulfide oxidoreductase DsbI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000345576.1 transl_table 11 codon_start 1 locus_tag LOCUS_30630 gene dsbI CDS complement(41797..42450) product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001076997.1 transl_table 11 codon_start 1 locus_tag LOCUS_30640 gene ribB CDS 42838..43140 product accessory factor UbiK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001537605.1 transl_table 11 codon_start 1 locus_tag LOCUS_30650 CDS complement(43174..43380) product cell surface composition regulator GlgS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000928927.1 transl_table 11 codon_start 1 locus_tag LOCUS_30660 gene glgS CDS 43643..44272 product DUF1449 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000599947.1 transl_table 11 codon_start 1 locus_tag LOCUS_30670 CDS 44296..45975 product flotillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000342894.1 transl_table 11 codon_start 1 locus_tag LOCUS_30680 CDS complement(46025..47458) product bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869178.1 transl_table 11 codon_start 1 locus_tag LOCUS_30690 gene hldE CDS complement(47506..50337) product bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001315860.1 transl_table 11 codon_start 1 locus_tag LOCUS_30700 gene glnE sequence037 source 1..50217 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 79..258 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30710 CDS complement(259..498) product septal ring assembly protein ZapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099316.1 transl_table 11 codon_start 1 locus_tag LOCUS_30720 gene zapB CDS 904..1749 product glycerol uptake facilitator protein GlpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084268.1 transl_table 11 codon_start 1 locus_tag LOCUS_30730 gene glpF CDS 1771..3279 product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136788.1 transl_table 11 codon_start 1 locus_tag LOCUS_30740 gene glpK CDS 3422..4432 product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001250625.1 transl_table 11 codon_start 1 locus_tag LOCUS_30750 gene glpX CDS 4565..5311 product ferredoxin--NADP(+) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000796310.1 transl_table 11 codon_start 1 locus_tag LOCUS_30760 gene fpr CDS 5358..5663 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30770 CDS complement(5707..6132) product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000155257.1 transl_table 11 codon_start 1 locus_tag LOCUS_30780 CDS 6233..6829 product YiiQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000802241.1 transl_table 11 codon_start 1 locus_tag LOCUS_30790 CDS 6941..7708 product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001216342.1 transl_table 11 codon_start 1 locus_tag LOCUS_30800 gene tpiA CDS complement(7776..9080) product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703817.1 transl_table 11 codon_start 1 locus_tag LOCUS_30810 CDS complement(9167..11395) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30820 CDS complement(11397..12428) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30830 CDS complement(12538..13287) product CDP-diacylglycerol diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000750765.1 transl_table 11 codon_start 1 locus_tag LOCUS_30840 CDS complement(13390..14379) product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000758715.1 transl_table 11 codon_start 1 locus_tag LOCUS_30850 CDS complement(14583..15545) product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000591793.1 transl_table 11 codon_start 1 locus_tag LOCUS_30860 gene pfkA CDS complement(15730..16632) product CDF family cation-efflux transporter FieF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001076742.1 transl_table 11 codon_start 1 locus_tag LOCUS_30870 gene fieF CDS 16982..17440 product DUF3757 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102937.1 transl_table 11 codon_start 1 locus_tag LOCUS_30880 CDS complement(17559..18059) product cell-envelope stress modulator CpxP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001223800.1 transl_table 11 codon_start 1 locus_tag LOCUS_30890 gene cpxP CDS 18210..18908 product envelope stress response regulator transcription factor CpxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001033727.1 transl_table 11 codon_start 1 locus_tag LOCUS_30900 gene cpxR CDS 18905..20278 product envelope stress sensor histidine kinase CpxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000580417.1 transl_table 11 codon_start 1 locus_tag LOCUS_30910 gene cpxA CDS 20397..20756 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30920 CDS complement(20732..21403) product 6-hydroxyaminopurine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001270249.1 transl_table 11 codon_start 1 locus_tag LOCUS_30930 gene yiiM CDS 21556..22446 product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004117946.1 transl_table 11 codon_start 1 locus_tag LOCUS_30940 CDS complement(22524..23144) product superoxide dismutase [Mn] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000122632.1 transl_table 11 codon_start 1 locus_tag LOCUS_30950 gene sodA CDS 23432..24466 product L-rhamnose/proton symporter RhaT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000063537.1 transl_table 11 codon_start 1 locus_tag LOCUS_30960 gene rhaT CDS complement(24463..25314) product HTH-type transcriptional activator RhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000013291.1 transl_table 11 codon_start 1 locus_tag LOCUS_30970 gene rhaR CDS complement(25437..26273) product HTH-type transcriptional activator RhaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000217112.1 transl_table 11 codon_start 1 locus_tag LOCUS_30980 gene rhaS CDS 26576..28045 product rhamnulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000143961.1 transl_table 11 codon_start 1 locus_tag LOCUS_30990 gene rhaB CDS 28042..29301 product L-rhamnose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001311268.1 transl_table 11 codon_start 1 locus_tag LOCUS_31000 gene rhaA CDS 29411..30238 product rhamnulose-1-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099339.1 transl_table 11 codon_start 1 locus_tag LOCUS_31010 gene rhaD CDS 30452..31600 product lactaldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000009255.1 transl_table 11 codon_start 1 locus_tag LOCUS_31020 gene fucO CDS 31597..31911 product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000619478.1 transl_table 11 codon_start 1 locus_tag LOCUS_31030 gene rhaM CDS complement(32025..33416) product carbohydrate porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000749934.1 transl_table 11 codon_start 1 locus_tag LOCUS_31040 CDS complement(33764..34312) product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989088.1 transl_table 11 codon_start 1 locus_tag LOCUS_31050 CDS 34413..35072 product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000683586.1 transl_table 11 codon_start 1 locus_tag LOCUS_31060 CDS 35072..35395 product AzlD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368956.1 transl_table 11 codon_start 1 locus_tag LOCUS_31070 CDS 35649..38156 product transcriptional regulator DagR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063446280.1 transl_table 11 codon_start 1 locus_tag LOCUS_31080 gene dagR CDS 38329..38811 product PTS mannose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287112.1 transl_table 11 codon_start 1 locus_tag LOCUS_31090 CDS 38808..39986 product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703474.1 transl_table 11 codon_start 1 locus_tag LOCUS_31100 CDS 39999..40496 product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354800.1 transl_table 11 codon_start 1 locus_tag LOCUS_31110 CDS 40508..41308 product PTS mannose/fructose/sorbose/N-acetylgalactosamine transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002365419.1 transl_table 11 codon_start 1 locus_tag LOCUS_31120 CDS 41301..42143 product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287022.1 transl_table 11 codon_start 1 locus_tag LOCUS_31130 CDS complement(42223..42435) product DUF1471 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099352.1 transl_table 11 codon_start 1 locus_tag LOCUS_31140 CDS complement(42564..43367) product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000753620.1 transl_table 11 codon_start 1 locus_tag LOCUS_31150 gene fdhD CDS 43592..46642 product formate dehydrogenase-N subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989259.1 transl_table 11 codon_start 1 transl_except (pos:44177..44179,aa:Sec) note codon on position 196 is selenocysteine opal codon. locus_tag LOCUS_31160 gene fdnG CDS 46655..47557 product formate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099356.1 transl_table 11 codon_start 1 locus_tag LOCUS_31170 gene fdxH CDS 47554..48189 product formate dehydrogenase cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099357.1 transl_table 11 codon_start 1 locus_tag LOCUS_31180 gene fdoI CDS 48450..49379 product formate dehydrogenase accessory protein FdhE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027727.1 transl_table 11 codon_start 1 locus_tag LOCUS_31190 gene fdhE CDS complement(49417..49791) product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000238494.1 transl_table 11 codon_start 1 locus_tag LOCUS_31200 CDS complement(49791..50039) product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001523745.1 transl_table 11 codon_start 1 locus_tag LOCUS_31210 sequence038 source 1..48863 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..833 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001302355.1:cystathionine beta-lyase locus_tag LOCUS_31220 CDS complement(883..2124) product multidrug efflux MFS transporter MdtM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001136983.1 transl_table 11 codon_start 1 locus_tag LOCUS_31230 gene mdtM CDS complement(2423..3085) product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095436.1 transl_table 11 codon_start 1 locus_tag LOCUS_31240 CDS complement(3134..3949) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095437.1 transl_table 11 codon_start 1 locus_tag LOCUS_31250 CDS 4180..5121 product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000749985.1 transl_table 11 codon_start 1 locus_tag LOCUS_31260 CDS complement(5350..7074) product nuclease-related domain-containing DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263035.1 transl_table 11 codon_start 1 locus_tag LOCUS_31270 CDS complement(7385..8341) product GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297640.1 transl_table 11 codon_start 1 locus_tag LOCUS_31280 gene yjiA CDS complement(8354..8557) product YbdD/YjiX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002887451.1 transl_table 11 codon_start 1 locus_tag LOCUS_31290 CDS complement(8652..10802) product pyruvate/proton symporter BtsT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000379928.1 transl_table 11 codon_start 1 locus_tag LOCUS_31300 gene btsT CDS 11098..12105 product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704302.1 transl_table 11 codon_start 1 locus_tag LOCUS_31310 CDS complement(12143..13363) product amino acid deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704303.1 transl_table 11 codon_start 1 locus_tag LOCUS_31320 CDS 13565..15016 product D-aminoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704304.1 transl_table 11 codon_start 1 locus_tag LOCUS_31330 CDS 15019..15411 product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368415.1 transl_table 11 codon_start 1 locus_tag LOCUS_31340 CDS 15508..16983 product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704305.1 transl_table 11 codon_start 1 locus_tag LOCUS_31350 CDS 16980..17855 product 2-dehydro-3-deoxygalactonokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704306.1 transl_table 11 codon_start 1 locus_tag LOCUS_31360 CDS 17845..18450 product 2-dehydro-3-deoxy-6-phosphogalactonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704307.1 transl_table 11 codon_start 1 locus_tag LOCUS_31370 CDS complement(18447..19310) product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704308.1 transl_table 11 codon_start 1 locus_tag LOCUS_31380 CDS 19457..21121 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000919571.1 transl_table 11 codon_start 1 locus_tag LOCUS_31390 gene tsr CDS complement(21180..22559) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000410144.1 transl_table 11 codon_start 1 locus_tag LOCUS_31400 CDS complement(22760..23674) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091570.1 transl_table 11 codon_start 1 locus_tag LOCUS_31410 CDS 23815..24837 product L-galactonate oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000106033.1 transl_table 11 codon_start 1 locus_tag LOCUS_31420 gene lgoD CDS 24998..27763 product sigma-54-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287111.1 transl_table 11 codon_start 1 locus_tag LOCUS_31430 CDS 27865..28287 product PTS mannose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287112.1 transl_table 11 codon_start 1 locus_tag LOCUS_31440 CDS 28302..28763 product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287114.1 transl_table 11 codon_start 1 locus_tag LOCUS_31450 CDS 28789..29568 product PTS mannose/fructose/sorbose/N-acetylgalactosamine transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357107.1 transl_table 11 codon_start 1 locus_tag LOCUS_31460 CDS 29546..30238 product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287116.1 transl_table 11 codon_start 1 locus_tag LOCUS_31470 note possible pseudo, internal stop codon CDS 30263..30394 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31480 note possible pseudo, internal stop codon CDS 30407..31468 product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016539.1 transl_table 11 codon_start 1 locus_tag LOCUS_31490 CDS 31487..32497 product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236585662.1 transl_table 11 codon_start 1 locus_tag LOCUS_31500 CDS complement(32555..34846) product phosphatidylglycerol--membrane-oligosaccharide glycerophosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292715.1 transl_table 11 codon_start 1 locus_tag LOCUS_31510 gene opgB CDS complement(35121..35612) product DUF2501 domain-containing protein YjjA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001305619.1 transl_table 11 codon_start 1 locus_tag LOCUS_31520 gene yjjA CDS complement(35710..36447) product DNA replication protein DnaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799923.1 transl_table 11 codon_start 1 locus_tag LOCUS_31530 gene dnaC CDS complement(36450..36989) product primosomal protein DnaT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298056.1 transl_table 11 codon_start 1 locus_tag LOCUS_31540 gene dnaT CDS complement(37089..37562) product threonine/serine exporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000511327.1 transl_table 11 codon_start 1 locus_tag LOCUS_31550 CDS complement(37553..38329) product threonine/serine exporter ThrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989102.1 transl_table 11 codon_start 1 locus_tag LOCUS_31560 CDS 38626..39810 product 4-hydroxybenzoate 3-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704313.1 transl_table 11 codon_start 1 locus_tag LOCUS_31570 gene pobA CDS 39826..40710 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704314.1 transl_table 11 codon_start 1 locus_tag LOCUS_31580 CDS 40973..41695 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000936635.1 transl_table 11 codon_start 1 locus_tag LOCUS_31590 CDS 41707..42288 product DNA-binding transcriptional activator BglJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000431550.1 transl_table 11 codon_start 1 locus_tag LOCUS_31600 gene bglJ CDS complement(42505..43293) product siderophore-iron reductase FhuF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331596.1 transl_table 11 codon_start 1 locus_tag LOCUS_31610 gene fhuF CDS complement(43406..44470) product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211217.1 transl_table 11 codon_start 1 locus_tag LOCUS_31620 CDS 44720..44956 product DUF1435 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000941878.1 transl_table 11 codon_start 1 locus_tag LOCUS_31630 tRNA complement(44996..45082) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00280 tRNA complement(45115..45201) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00290 tRNA complement(45230..45316) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00300 CDS complement(45523..46551) product 16S rRNA (guanine(1207)-N(2))-methyltransferase RsmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272330.1 transl_table 11 codon_start 1 locus_tag LOCUS_31640 gene rsmC CDS 46765..47178 product DNA polymerase III subunit psi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000204018.1 transl_table 11 codon_start 1 locus_tag LOCUS_31650 gene holD CDS 47090..47593 product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001092461.1 transl_table 11 codon_start 1 locus_tag LOCUS_31660 gene rimI CDS 47608..48285 product pyrimidine 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000870720.1 transl_table 11 codon_start 1 locus_tag LOCUS_31670 gene yjjG sequence039 source 1..44632 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(275..733) product DUF4761 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000739029.1 transl_table 11 codon_start 1 locus_tag LOCUS_31680 CDS complement(745..951) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31690 CDS complement(958..1245) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31700 CDS 1361..1681 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31710 CDS 1778..2782 product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815648.1 transl_table 11 codon_start 1 locus_tag LOCUS_31720 CDS complement(2962..3210) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31730 CDS 3496..4011 product zinc uptake transcriptional repressor Zur inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295691.1 transl_table 11 codon_start 1 locus_tag LOCUS_31740 gene zur CDS complement(4088..4300) product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000981150.1 transl_table 11 codon_start 1 locus_tag LOCUS_31750 CDS complement(4427..5752) product MATE family efflux transporter DinF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001128149.1 transl_table 11 codon_start 1 locus_tag LOCUS_31760 gene dinF CDS complement(5890..6498) product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000646078.1 transl_table 11 codon_start 1 locus_tag LOCUS_31770 gene lexA CDS complement(6622..6990) product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000002902.1 transl_table 11 codon_start 1 locus_tag LOCUS_31780 CDS 7161..9581 product glycerol-3-phosphate 1-O-acyltransferase PlsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000017354.1 transl_table 11 codon_start 1 locus_tag LOCUS_31790 gene plsB CDS complement(9779..10651) product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000455227.1 transl_table 11 codon_start 1 locus_tag LOCUS_31800 gene ubiA CDS complement(10664..11161) product chorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001305723.1 transl_table 11 codon_start 1 locus_tag LOCUS_31810 gene ubiC CDS complement(11342..12280) product maltose operon protein MalM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000782497.1 transl_table 11 codon_start 1 locus_tag LOCUS_31820 gene malM CDS complement(12430..13779) product maltoporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000973678.1 transl_table 11 codon_start 1 locus_tag LOCUS_31830 CDS complement(13883..14992) product maltose/maltodextrin ABC transporter ATP-binding protein MalK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179177.1 transl_table 11 codon_start 1 locus_tag LOCUS_31840 gene malK CDS 15363..16553 product maltose/maltodextrin ABC transporter substrate-binding protein MalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095045.1 transl_table 11 codon_start 1 locus_tag LOCUS_31850 gene malE CDS 16670..18214 product maltose ABC transporter permease MalF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095044.1 transl_table 11 codon_start 1 locus_tag LOCUS_31860 gene malF CDS 18370..19260 product maltose ABC transporter permease MalG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001252081.1 transl_table 11 codon_start 1 locus_tag LOCUS_31870 gene malG CDS 19597..21072 product D-xylose transporter XylE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001097274.1 transl_table 11 codon_start 1 locus_tag LOCUS_31880 gene xylE CDS complement(21127..21831) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095042.1 transl_table 11 codon_start 1 locus_tag LOCUS_31890 CDS complement(21871..22734) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095041.1 transl_table 11 codon_start 1 locus_tag LOCUS_31900 CDS complement(22731..23777) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095040.1 transl_table 11 codon_start 1 locus_tag LOCUS_31910 CDS complement(23774..25474) product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095039.1 transl_table 11 codon_start 1 locus_tag LOCUS_31920 CDS complement(25499..25819) product PTS N,N'-diacetylchitobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366185.1 transl_table 11 codon_start 1 locus_tag LOCUS_31930 gene chbA CDS complement(25960..26370) product phosphate-starvation-inducible protein PsiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000202902.1 transl_table 11 codon_start 1 locus_tag LOCUS_31940 gene psiE CDS complement(26533..28629) product YjbH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000745771.1 transl_table 11 codon_start 1 locus_tag LOCUS_31950 CDS complement(28629..29366) product capsule biosynthesis GfcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000595535.1 transl_table 11 codon_start 1 locus_tag LOCUS_31960 CDS complement(29363..29998) product YjbF family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296632.1 transl_table 11 codon_start 1 locus_tag LOCUS_31970 CDS 30077..30268 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31980 CDS complement(30735..32384) product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095033.1 transl_table 11 codon_start 1 locus_tag LOCUS_31990 gene pgi CDS complement(32326..32565) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32000 CDS 32699..34048 product lysine-sensitive aspartokinase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001290322.1 transl_table 11 codon_start 1 locus_tag LOCUS_32010 gene lysC CDS complement(34100..34885) product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001130548.1 transl_table 11 codon_start 1 locus_tag LOCUS_32020 CDS complement(34890..36116) product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704030.1 transl_table 11 codon_start 1 locus_tag LOCUS_32030 CDS 36310..37887 product RNA repair transcriptional activator RtcR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704028.1 transl_table 11 codon_start 1 locus_tag LOCUS_32040 gene rtcR CDS 38020..38946 product ketopantoate/pantoate/pantothenate transporter PanS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095031.1 transl_table 11 codon_start 1 locus_tag LOCUS_32050 gene panS CDS 39094..39366 product DUF3811 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001207628.1 transl_table 11 codon_start 1 locus_tag LOCUS_32060 CDS complement(39363..40238) product 23S rRNA pseudouridine(2604) synthase RluF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954615.1 transl_table 11 codon_start 1 locus_tag LOCUS_32070 gene rluF CDS complement(40397..41356) product DUF523 and DUF1722 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038418304.1 transl_table 11 codon_start 1 locus_tag LOCUS_32080 CDS 41544..41996 product lipocalin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094859.1 transl_table 11 codon_start 1 locus_tag LOCUS_32090 note possible pseudo, frameshifted CDS 42187..42876 product dipeptidase PepE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000421772.1 transl_table 11 codon_start 1 locus_tag LOCUS_32100 gene pepE CDS complement(42931..44562) product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000956807.1 transl_table 11 codon_start 1 locus_tag LOCUS_32110 sequence040 source 1..43483 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(234..779) product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295188.1 transl_table 11 codon_start 1 locus_tag LOCUS_32120 gene orn CDS 886..1938 product small ribosomal subunit biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000041970.1 transl_table 11 codon_start 1 locus_tag LOCUS_32130 gene rsgA CDS 2035..3006 product archaetidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000934920.1 transl_table 11 codon_start 1 locus_tag LOCUS_32140 gene asd CDS 3074..6400 product miniconductance mechanosensitive channel MscM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001236847.1 transl_table 11 codon_start 1 locus_tag LOCUS_32150 gene mscM CDS complement(6487..7989) product glutamate/gamma-aminobutyrate family transporter YjeM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000149876.1 transl_table 11 codon_start 1 locus_tag LOCUS_32160 gene yjeM CDS complement(8201..9178) product elongation factor P--(R)-beta-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004789.1 transl_table 11 codon_start 1 locus_tag LOCUS_32170 gene epmA CDS 9502..11286 product fumarate reductase (quinol) flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095275.1 transl_table 11 codon_start 1 locus_tag LOCUS_32180 gene frdA CDS 11286..12020 product fumarate reductase iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829507.1 transl_table 11 codon_start 1 locus_tag LOCUS_32190 gene frdB CDS 12031..12426 product fumarate reductase subunit FrdC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000208749.1 transl_table 11 codon_start 1 locus_tag LOCUS_32200 gene frdC CDS 12437..12796 product fumarate reductase subunit FrdD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299198.1 transl_table 11 codon_start 1 locus_tag LOCUS_32210 gene frdD CDS 12906..13478 product lipocalin Blc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001238378.1 transl_table 11 codon_start 1 locus_tag LOCUS_32220 gene blc CDS complement(13434..13751) product quaternary ammonium compound efflux SMR transporter SugE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000118482.1 transl_table 11 codon_start 1 locus_tag LOCUS_32230 gene sugE CDS 14006..14593 product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001763937.1 transl_table 11 codon_start 1 locus_tag LOCUS_32240 CDS complement(14627..14773) product lipoprotein toxin entericidin B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000239598.1 transl_table 11 codon_start 1 locus_tag LOCUS_32250 gene ecnB CDS 14914..15159 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32260 CDS complement(15096..15662) product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257282.1 transl_table 11 codon_start 1 locus_tag LOCUS_32270 gene efp CDS 15800..16732 product EF-P beta-lysylation protein EpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940500.1 transl_table 11 codon_start 1 locus_tag LOCUS_32280 gene epmB CDS 16893..17756 product YjeJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001008025.1 transl_table 11 codon_start 1 locus_tag LOCUS_32290 CDS complement(17877..18230) product DUF4156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000605289.1 transl_table 11 codon_start 1 locus_tag LOCUS_32300 CDS complement(18493..20205) product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235893157.1 transl_table 11 codon_start 1 locus_tag LOCUS_32310 gene ltrA CDS complement(21297..22943) product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729126.1 transl_table 11 codon_start 1 locus_tag LOCUS_32320 gene groL CDS complement(22987..23280) product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027827.1 transl_table 11 codon_start 1 locus_tag LOCUS_32330 CDS 23554..24810 product L-methionine/branched-chain amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000015852.1 transl_table 11 codon_start 1 locus_tag LOCUS_32340 gene yjeH CDS complement(24853..25329) product membrane protein FxsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001267291.1 transl_table 11 codon_start 1 locus_tag LOCUS_32350 gene fxsA CDS 25669..27105 product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000069440.1 transl_table 11 codon_start 1 locus_tag LOCUS_32360 gene aspA CDS 27220..28521 product anaerobic C4-dicarboxylate transporter DcuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000637594.1 transl_table 11 codon_start 1 locus_tag LOCUS_32370 gene dcuA CDS 28641..28988 product divalent cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000887832.1 transl_table 11 codon_start 1 locus_tag LOCUS_32380 gene cutA CDS 28964..30673 product protein-disulfide reductase DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000068922.1 transl_table 11 codon_start 1 locus_tag LOCUS_32390 gene dsbD CDS 30710..31285 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001188520.1 transl_table 11 codon_start 1 locus_tag LOCUS_32400 CDS 31353..33377 product DUF1176 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704142.1 transl_table 11 codon_start 1 locus_tag LOCUS_32410 tRNA 33493..33568 product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00310 CDS 33728..33937 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32420 note possible pseudo, frameshifted CDS 33855..34469 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32430 note possible pseudo, internal stop codon, frameshifted CDS 34554..34982 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32440 note possible pseudo, internal stop codon CDS complement(35781..36053) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32450 note possible pseudo, frameshifted CDS complement(36127..36669) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32460 note possible pseudo, frameshifted CDS 37001..37198 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32470 CDS complement(37517..37735) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000193665.1 transl_table 11 codon_start 1 locus_tag LOCUS_32480 CDS complement(37732..38193) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000201267.1 transl_table 11 codon_start 1 locus_tag LOCUS_32490 CDS 38800..39366 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32500 CDS 39363..41336 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189214254.1 transl_table 11 codon_start 1 locus_tag LOCUS_32510 CDS 41346..43271 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32520 CDS complement(43332..43481) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32530 sequence041 source 1..43441 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 340..1704 product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000624289.1 transl_table 11 codon_start 1 locus_tag LOCUS_32540 gene sdaA CDS 1852..3450 product cyclic diguanylate phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192512.1 transl_table 11 codon_start 1 locus_tag LOCUS_32550 CDS complement(3456..5015) product CNNM family cation transport protein YoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000394983.1 transl_table 11 codon_start 1 locus_tag LOCUS_32560 gene yoaE CDS 5458..6426 product PTS mannose transporter subunit IIAB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096132.1 transl_table 11 codon_start 1 locus_tag LOCUS_32570 gene manX CDS 6484..7284 product PTS mannose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000406918.1 transl_table 11 codon_start 1 locus_tag LOCUS_32580 gene manY CDS 7297..8148 product PTS mannose transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366038.1 transl_table 11 codon_start 1 locus_tag LOCUS_32590 CDS 8207..8665 product DUF986 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000156273.1 transl_table 11 codon_start 1 locus_tag LOCUS_32600 CDS 9080..9646 product manganese efflux pump MntP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296134.1 transl_table 11 codon_start 1 locus_tag LOCUS_32610 gene mntP CDS complement(9643..10452) product 23S rRNA (guanine(745)-N(1))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000010115.1 transl_table 11 codon_start 1 locus_tag LOCUS_32620 gene rlmA CDS complement(10516..12219) product peptidoglycan glycosyltransferase FtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000730322.1 transl_table 11 codon_start 1 locus_tag LOCUS_32630 gene ftsI CDS complement(12483..12692) product transcription antiterminator/RNA stability regulator CspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001062678.1 transl_table 11 codon_start 1 locus_tag LOCUS_32640 gene cspE CDS complement(13504..13791) product YebO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001000660.1 transl_table 11 codon_start 1 locus_tag LOCUS_32650 CDS 14170..14409 product YobH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705933.1 transl_table 11 codon_start 1 locus_tag LOCUS_32660 CDS complement(14477..15268) product DNA-binding transcriptional regulator KdgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001262197.1 transl_table 11 codon_start 1 locus_tag LOCUS_32670 gene kdgR CDS 15445..16818 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309553.1 transl_table 11 codon_start 1 locus_tag LOCUS_32680 CDS complement(16907..17788) product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000984498.1 transl_table 11 codon_start 1 locus_tag LOCUS_32690 gene htpX CDS complement(17979..20027) product carboxy terminal-processing peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001091235.1 transl_table 11 codon_start 1 locus_tag LOCUS_32700 gene prc CDS complement(20047..20733) product RNA chaperone ProQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000431401.1 transl_table 11 codon_start 1 locus_tag LOCUS_32710 gene proQ CDS complement(20831..21328) product L-methionine (R)-S-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043882.1 transl_table 11 codon_start 1 locus_tag LOCUS_32720 gene msrC CDS 21457..22740 product membrane integrity lipid transport subunit YebS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001207300.1 transl_table 11 codon_start 1 locus_tag LOCUS_32730 gene yebS CDS 22709..25342 product lipid-binding membrane homeostasis protein YebT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297532.1 transl_table 11 codon_start 1 locus_tag LOCUS_32740 gene yebT CDS 25421..26860 product 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309555.1 transl_table 11 codon_start 1 locus_tag LOCUS_32750 gene rsmF CDS 26972..27211 product YebV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000978523.1 transl_table 11 codon_start 1 locus_tag LOCUS_32760 CDS 27314..27505 product DUF1482 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000457838.1 transl_table 11 codon_start 1 locus_tag LOCUS_32770 CDS complement(27973..28311) product YebY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976476.1 transl_table 11 codon_start 1 locus_tag LOCUS_32780 CDS complement(28328..29200) product copper homeostasis membrane protein CopD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000979693.1 transl_table 11 codon_start 1 locus_tag LOCUS_32790 gene copD CDS complement(29203..29526) product CopC domain-containing protein YobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000168393.1 transl_table 11 codon_start 1 locus_tag LOCUS_32800 gene yobA CDS 29714..29944 product DNA polymerase III subunit theta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000856224.1 transl_table 11 codon_start 1 locus_tag LOCUS_32810 CDS 30053..30709 product carbon-nitrogen hydrolase family protein YobB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000011664.1 transl_table 11 codon_start 1 locus_tag LOCUS_32820 gene yobB CDS 30732..31394 product exodeoxyribonuclease X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000944256.1 transl_table 11 codon_start 1 locus_tag LOCUS_32830 gene exoX CDS complement(31376..33451) product oligopeptidase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000936997.1 transl_table 11 codon_start 1 locus_tag LOCUS_32840 gene ptrB CDS complement(33536..34195) product tellurite resistance TerB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000024713.1 transl_table 11 codon_start 1 locus_tag LOCUS_32850 CDS complement(34291..34644) product protein YebF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001042123.1 transl_table 11 codon_start 1 locus_tag LOCUS_32860 gene yebF CDS complement(34712..34993) product DNA damage-inducible protein YebG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257738.1 transl_table 11 codon_start 1 locus_tag LOCUS_32870 gene yebG CDS 35125..36303 product formate-dependent phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000173461.1 transl_table 11 codon_start 1 locus_tag LOCUS_32880 gene purT CDS complement(36360..37001) product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000800493.1 transl_table 11 codon_start 1 locus_tag LOCUS_32890 gene kdgA CDS complement(37037..38848) product phosphogluconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001069125.1 transl_table 11 codon_start 1 locus_tag LOCUS_32900 gene edd CDS complement(39083..40558) product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000301712.1 transl_table 11 codon_start 1 locus_tag LOCUS_32910 gene zwf CDS 40904..41785 product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001056719.1 transl_table 11 codon_start 1 locus_tag LOCUS_32920 CDS 41897..43339 product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091158.1 transl_table 11 codon_start 1 locus_tag LOCUS_32930 gene pyk sequence042 source 1..41936 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(107..304) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32940 note possible pseudo, internal stop codon, frameshifted CDS complement(884..2530) product type III secretion system effector EspL2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001121626.1 transl_table 11 codon_start 1 locus_tag LOCUS_32950 gene espL2 CDS complement(3164..3331) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32960 CDS complement(4061..4849) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32970 note possible pseudo, frameshifted CDS complement(5355..6626) product iron uptake transporter deferrochelatase/peroxidase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001199155.1 transl_table 11 codon_start 1 locus_tag LOCUS_32980 gene efeB CDS complement(6632..7765) product iron uptake system protein EfeO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000154396.1 transl_table 11 codon_start 1 locus_tag LOCUS_32990 gene efeO CDS complement(7816..8649) product FTR1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000497942.1 transl_table 11 codon_start 1 locus_tag LOCUS_33000 CDS complement(8891..10399) product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018479.1 transl_table 11 codon_start 1 locus_tag LOCUS_33010 gene putP CDS 10795..14757 product trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000537509.1 transl_table 11 codon_start 1 locus_tag LOCUS_33020 gene putA CDS 14859..15254 product lysozyme inhibitor LprI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000821059.1 transl_table 11 codon_start 1 locus_tag LOCUS_33030 CDS complement(15251..15901) product HTH-type transcriptional regulator RutR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001302258.1 transl_table 11 codon_start 1 locus_tag LOCUS_33040 gene rutR CDS complement(16089..16262) product general stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097201.1 transl_table 11 codon_start 1 locus_tag LOCUS_33050 CDS 16648..17244 product NAD(P)H:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001062894.1 transl_table 11 codon_start 1 locus_tag LOCUS_33060 gene wrbA CDS 17265..17492 product YccJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001143120.1 transl_table 11 codon_start 1 locus_tag LOCUS_33070 CDS complement(17526..18767) product bifunctional glucose-1-phosphatase/inositol phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012132910.1 transl_table 11 codon_start 1 locus_tag LOCUS_33080 gene agp CDS 19024..19944 product curved DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000420603.1 transl_table 11 codon_start 1 locus_tag LOCUS_33090 gene cbpA CDS 19944..20249 product chaperone modulator CbpM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001284251.1 transl_table 11 codon_start 1 locus_tag LOCUS_33100 gene cbpM CDS 20367..21446 product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818458.1 transl_table 11 codon_start 1 locus_tag LOCUS_33110 CDS complement(21488..22600) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095768.1 transl_table 11 codon_start 1 locus_tag LOCUS_33120 CDS 23000..23725 product gluconate 2-dehydrogenase subunit 3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110746.1 transl_table 11 codon_start 1 locus_tag LOCUS_33130 CDS 23728..25470 product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110747.1 transl_table 11 codon_start 1 locus_tag LOCUS_33140 CDS 25483..26763 product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113742.1 transl_table 11 codon_start 1 locus_tag LOCUS_33150 CDS complement(26996..27712) product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000532923.1 transl_table 11 codon_start 1 locus_tag LOCUS_33160 CDS complement(28303..32763) product ECSE_1600 family autotransporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602787.1 transl_table 11 codon_start 1 locus_tag LOCUS_33170 note possible pseudo, frameshifted CDS complement(32756..33211) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33180 note possible pseudo, frameshifted CDS complement(33217..33429) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33190 CDS complement(34801..35301) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107442.1 transl_table 11 codon_start 1 locus_tag LOCUS_33200 CDS complement(35312..36232) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433843.1 transl_table 11 codon_start 1 locus_tag LOCUS_33210 CDS complement(36300..36920) product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897384.1 transl_table 11 codon_start 1 locus_tag LOCUS_33220 CDS 37321..37587 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33230 CDS complement(37968..38342) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33240 CDS complement(38339..38878) product lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274722.1 transl_table 11 codon_start 1 locus_tag LOCUS_33250 CDS complement(40294..40965) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33260 CDS complement(40865..41920) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33270 sequence043 source 1..40361 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(186..947) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000078338.1 transl_table 11 codon_start 1 locus_tag LOCUS_33280 CDS complement(955..1926) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298587.1 transl_table 11 codon_start 1 locus_tag LOCUS_33290 CDS complement(2071..3252) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099003.1 transl_table 11 codon_start 1 locus_tag LOCUS_33300 CDS complement(3322..4347) product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000738579.1 transl_table 11 codon_start 1 locus_tag LOCUS_33310 CDS complement(4802..5023) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000825639.1 transl_table 11 codon_start 1 locus_tag LOCUS_33320 CDS complement(5250..8363) product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703631.1 transl_table 11 codon_start 1 locus_tag LOCUS_33330 CDS complement(8375..9538) product multidrug efflux RND transporter periplasmic adaptor subunit AcrE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000160334.1 transl_table 11 codon_start 1 locus_tag LOCUS_33340 gene acrE CDS 9948..10610 product multidrug efflux transporter transcriptional repressor AcrS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001129529.1 transl_table 11 codon_start 1 locus_tag LOCUS_33350 gene acrS CDS complement(10636..10800) product DUF2556 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000620015.1 transl_table 11 codon_start 1 locus_tag LOCUS_33360 CDS complement(10883..11758) product adenine-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642611.1 transl_table 11 codon_start 1 locus_tag LOCUS_33370 gene yhdJ CDS complement(11844..12140) product DNA-binding transcriptional regulator Fis inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000462905.1 transl_table 11 codon_start 1 locus_tag LOCUS_33380 gene fis CDS complement(12164..13129) product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219652.1 transl_table 11 codon_start 1 locus_tag LOCUS_33390 gene dusB CDS complement(13550..14431) product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001145849.1 transl_table 11 codon_start 1 locus_tag LOCUS_33400 gene prmA CDS complement(14443..15894) product sodium/pantothenate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001175728.1 transl_table 11 codon_start 1 locus_tag LOCUS_33410 gene panF CDS complement(15884..16126) product YhdT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000381175.1 transl_table 11 codon_start 1 locus_tag LOCUS_33420 CDS complement(16277..17626) product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884627.1 transl_table 11 codon_start 1 locus_tag LOCUS_33430 gene accC CDS complement(17637..18098) product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098992.1 transl_table 11 codon_start 1 locus_tag LOCUS_33440 gene accB CDS complement(18485..19084) product protein-methionine-sulfoxide reductase heme-binding subunit MsrQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001241496.1 transl_table 11 codon_start 1 locus_tag LOCUS_33450 gene msrQ CDS complement(19085..20089) product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000740111.1 transl_table 11 codon_start 1 locus_tag LOCUS_33460 gene msrP CDS complement(20195..21169) product MDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001148479.1 transl_table 11 codon_start 1 locus_tag LOCUS_33470 CDS 21376..23316 product RNase E specificity factor CsrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001241469.1 transl_table 11 codon_start 1 locus_tag LOCUS_33480 gene csrD CDS 23623..24666 product rod shape-determining protein MreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000913396.1 transl_table 11 codon_start 1 locus_tag LOCUS_33490 gene mreB CDS 24730..25767 product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000802540.1 transl_table 11 codon_start 1 locus_tag LOCUS_33500 gene mreC CDS 25767..26255 product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000226619.1 transl_table 11 codon_start 1 locus_tag LOCUS_33510 gene mreD CDS 26264..26857 product nucleoside triphosphate pyrophosphatase YhdE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000203096.1 transl_table 11 codon_start 1 locus_tag LOCUS_33520 gene yhdE CDS 26847..28316 product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000123188.1 transl_table 11 codon_start 1 locus_tag LOCUS_33530 gene rng CDS 28410..32210 product AsmA2 domain-containing protein YhdP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001253498.1 transl_table 11 codon_start 1 locus_tag LOCUS_33540 gene yhdP CDS 32350..33795 product metalloprotease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000055913.1 transl_table 11 codon_start 1 locus_tag LOCUS_33550 gene tldD CDS complement(34000..34911) product HTH-type transcriptional activator AaeR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000440300.1 transl_table 11 codon_start 1 locus_tag LOCUS_33560 gene aaeR CDS 35073..35312 product p-hydroxybenzoic acid efflux pump operon protein AaeX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001116614.1 transl_table 11 codon_start 1 locus_tag LOCUS_33570 gene aaeX CDS 35320..36252 product p-hydroxybenzoic acid efflux pump subunit AaeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000855134.1 transl_table 11 codon_start 1 locus_tag LOCUS_33580 gene aaeA CDS 36258..38225 product p-hydroxybenzoic acid efflux pump subunit AaeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000510962.1 transl_table 11 codon_start 1 locus_tag LOCUS_33590 gene aaeB CDS 38313..39761 product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098976.1 transl_table 11 codon_start 1 locus_tag LOCUS_33600 CDS 39789..40061 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001103887.1 transl_table 11 codon_start 1 locus_tag LOCUS_33610 sequence044 source 1..40202 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1827 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011987103.1:glycosyl hydrolase family 18 protein locus_tag LOCUS_33620 CDS 1967..2161 product bacterioferritin-associated ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000289082.1 transl_table 11 codon_start 1 locus_tag LOCUS_33630 gene bfd CDS 2233..2709 product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000675515.1 transl_table 11 codon_start 1 locus_tag LOCUS_33640 gene bfr CDS complement(2743..3516) product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174847886.1 transl_table 11 codon_start 1 locus_tag LOCUS_33650 CDS complement(3503..3991) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33660 CDS complement(3984..5108) product type II secretion system protein GspL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001335091.1 transl_table 11 codon_start 1 locus_tag LOCUS_33670 gene gspL CDS complement(5120..6085) product type II secretion system minor pseudopilin GspK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001058522.1 transl_table 11 codon_start 1 locus_tag LOCUS_33680 gene gspK CDS complement(6075..6662) product type II secretion system minor pseudopilin GspJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000610632.1 transl_table 11 codon_start 1 locus_tag LOCUS_33690 gene gspJ CDS complement(6659..7012) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33700 CDS complement(7009..7509) product type II secretion system minor pseudopilin GspH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001076035.1 transl_table 11 codon_start 1 locus_tag LOCUS_33710 gene gspH CDS complement(7512..7955) product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001202874.1 transl_table 11 codon_start 1 locus_tag LOCUS_33720 gene gspG CDS complement(7964..9163) product type II secretion system inner membrane protein GspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001109573.1 transl_table 11 codon_start 1 locus_tag LOCUS_33730 gene gspF CDS complement(9160..10629) product type II secretion system ATPase GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219894.1 transl_table 11 codon_start 1 locus_tag LOCUS_33740 gene gspE CDS complement(10626..12623) product type II secretion system secretin GspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001326512.1 transl_table 11 codon_start 1 locus_tag LOCUS_33750 gene gspD CDS complement(12624..13364) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33760 CDS 13573..15033 product type II secretion system protein GspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000107576.1 transl_table 11 codon_start 1 locus_tag LOCUS_33770 gene gspA CDS 15030..15431 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33780 CDS 15683..15994 product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181005.1 transl_table 11 codon_start 1 locus_tag LOCUS_33790 gene rpsJ CDS 16027..16656 product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000579833.1 transl_table 11 codon_start 1 locus_tag LOCUS_33800 gene rplC CDS 16667..17272 product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000424395.1 transl_table 11 codon_start 1 locus_tag LOCUS_33810 gene rplD CDS 17269..17571 product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000617546.1 transl_table 11 codon_start 1 locus_tag LOCUS_33820 gene rplW CDS 17589..18410 product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000301864.1 transl_table 11 codon_start 1 locus_tag LOCUS_33830 gene rplB CDS 18427..18705 product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001138117.1 transl_table 11 codon_start 1 locus_tag LOCUS_33840 gene rpsS CDS 18720..19052 product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000447529.1 transl_table 11 codon_start 1 locus_tag LOCUS_33850 gene rplV CDS 19070..19771 product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000529945.1 transl_table 11 codon_start 1 locus_tag LOCUS_33860 gene rpsC CDS 19784..20194 product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000941208.1 transl_table 11 codon_start 1 locus_tag LOCUS_33870 gene rplP CDS 20194..20385 product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000644742.1 transl_table 11 codon_start 1 locus_tag LOCUS_33880 gene rpmC CDS 20385..20639 product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002438707.1 transl_table 11 codon_start 1 locus_tag LOCUS_33890 gene rpsQ CDS 20802..21173 product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000613954.1 transl_table 11 codon_start 1 locus_tag LOCUS_33900 gene rplN CDS 21184..21498 product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729185.1 transl_table 11 codon_start 1 locus_tag LOCUS_33910 gene rplX CDS 21513..22052 product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096206.1 transl_table 11 codon_start 1 locus_tag LOCUS_33920 gene rplE CDS 22067..22372 product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099026.1 transl_table 11 codon_start 1 locus_tag LOCUS_33930 gene rpsN CDS 22406..22798 product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062611.1 transl_table 11 codon_start 1 locus_tag LOCUS_33940 gene rpsH CDS 22811..23344 product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091939.1 transl_table 11 codon_start 1 locus_tag LOCUS_33950 gene rplF CDS 23354..23707 product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000358956.1 transl_table 11 codon_start 1 locus_tag LOCUS_33960 gene rplR CDS 23722..24225 product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940121.1 transl_table 11 codon_start 1 locus_tag LOCUS_33970 gene rpsE CDS 24229..24408 product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140434.1 transl_table 11 codon_start 1 locus_tag LOCUS_33980 gene rpmD CDS 24412..24846 product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001238917.1 transl_table 11 codon_start 1 locus_tag LOCUS_33990 gene rplO CDS 24854..26185 product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118861.1 transl_table 11 codon_start 1 locus_tag LOCUS_34000 gene secY CDS 26480..26836 product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099021.1 transl_table 11 codon_start 1 locus_tag LOCUS_34010 gene rpsM CDS 26853..27242 product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001029684.1 transl_table 11 codon_start 1 locus_tag LOCUS_34020 gene rpsK CDS 27276..27896 product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135224.1 transl_table 11 codon_start 1 locus_tag LOCUS_34030 gene rpsD CDS 27922..28911 product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001162094.1 transl_table 11 codon_start 1 locus_tag LOCUS_34040 gene rpoA CDS 28952..29338 product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001216372.1 transl_table 11 codon_start 1 locus_tag LOCUS_34050 gene rplQ CDS 29446..29823 product DUF1992 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000266513.1 transl_table 11 codon_start 1 locus_tag LOCUS_34060 CDS 29825..30250 product Zn(2+)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000285607.1 transl_table 11 codon_start 1 locus_tag LOCUS_34070 gene zntR CDS 30306..30524 product alternative ribosome-rescue factor ArfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000092696.1 transl_table 11 codon_start 1 locus_tag LOCUS_34080 gene arfA CDS complement(30521..30934) product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000008119.1 transl_table 11 codon_start 1 locus_tag LOCUS_34090 gene mscL CDS complement(31073..32449) product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000691374.1 transl_table 11 codon_start 1 locus_tag LOCUS_34100 gene trkA CDS complement(32471..33760) product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001329571.1 transl_table 11 codon_start 1 locus_tag LOCUS_34110 gene rsmB CDS complement(33813..34760) product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001285161.1 transl_table 11 codon_start 1 locus_tag LOCUS_34120 gene fmt CDS complement(34775..35284) product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000114992.1 transl_table 11 codon_start 1 locus_tag LOCUS_34130 gene def CDS 35414..36538 product DNA-protecting protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228517.1 transl_table 11 codon_start 1 locus_tag LOCUS_34140 gene dprA CDS 36510..36983 product DUF494 family protein Smg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460672.1 transl_table 11 codon_start 1 locus_tag LOCUS_34150 gene smg CDS complement(37073..37462) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34160 CDS 37557..38129 product L-threonylcarbamoyladenylate synthase type 1 TsaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001063622.1 transl_table 11 codon_start 1 locus_tag LOCUS_34170 gene tsaC CDS 38134..38952 product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000451226.1 transl_table 11 codon_start 1 locus_tag LOCUS_34180 gene aroE CDS 38949..39206 product DUF1488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001070570.1 transl_table 11 codon_start 1 locus_tag LOCUS_34190 CDS complement(39182..39736) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34200 note possible pseudo, frameshifted CDS 39763..39987 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34210 sequence045 source 1..39261 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(117..2066) product PTS N-acetyl glucosamine transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001023093.1 transl_table 11 codon_start 1 locus_tag LOCUS_34220 gene nagE CDS 2406..3206 product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001237064.1 transl_table 11 codon_start 1 locus_tag LOCUS_34230 gene nagB CDS 3206..4414 product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000271187.1 transl_table 11 codon_start 1 locus_tag LOCUS_34240 gene nagA CDS 4423..5643 product DNA-binding transcriptional regulator NagC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187594.1 transl_table 11 codon_start 1 locus_tag LOCUS_34250 gene nagC CDS 5689..6441 product ribonucleotide monophosphatase NagD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153143.1 transl_table 11 codon_start 1 locus_tag LOCUS_34260 gene nagD CDS 6695..8359 product asparagine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097572.1 transl_table 11 codon_start 1 locus_tag LOCUS_34270 gene asnB tRNA 8581..8657 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00320 tRNA 8666..8750 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00330 tRNA 8805..8879 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00340 tRNA 8914..8988 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00350 tRNA 9004..9080 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00360 tRNA 9196..9270 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00370 tRNA 9369..9443 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00380 CDS complement(9566..10741) product 3-demethoxyubiquinol 3-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000184541.1 transl_table 11 codon_start 1 locus_tag LOCUS_34280 gene ubiF CDS 10887..12311 product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000162740.1 transl_table 11 codon_start 1 locus_tag LOCUS_34290 gene miaB CDS 12664..13710 product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018040.1 transl_table 11 codon_start 1 locus_tag LOCUS_34300 CDS 13707..14174 product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858677.1 transl_table 11 codon_start 1 locus_tag LOCUS_34310 gene ybeY CDS 14334..15212 product CNNM family magnesium/cobalt transport protein CorC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278605.1 transl_table 11 codon_start 1 locus_tag LOCUS_34320 gene corC CDS 15235..16773 product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097577.1 transl_table 11 codon_start 1 locus_tag LOCUS_34330 gene lnt CDS 17158..18066 product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000588823.1 transl_table 11 codon_start 1 locus_tag LOCUS_34340 CDS 18229..18969 product glutamate/aspartate ABC transporter permease GltJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020930.1 transl_table 11 codon_start 1 locus_tag LOCUS_34350 gene gltJ CDS 18969..19643 product glutamate/aspartate ABC transporter permease GltK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000272799.1 transl_table 11 codon_start 1 locus_tag LOCUS_34360 gene gltK CDS 19643..20368 product glutamate/aspartate ABC transporter ATP-binding protein GltL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000631384.1 transl_table 11 codon_start 1 locus_tag LOCUS_34370 gene gltL CDS 20486..21226 product pyrimidine-specific ribonucleoside hydrolase RihA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001207503.1 transl_table 11 codon_start 1 locus_tag LOCUS_34380 gene rihA note possible pseudo, internal stop codon CDS 21302..21421 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34390 note possible pseudo, internal stop codon CDS complement(21574..22056) product zinc ribbon-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044880.1 transl_table 11 codon_start 1 locus_tag LOCUS_34400 CDS 22292..24874 product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011378592.1 transl_table 11 codon_start 1 locus_tag LOCUS_34410 gene leuS CDS 24889..25488 product LPS assembly lipoprotein LptE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001269669.1 transl_table 11 codon_start 1 locus_tag LOCUS_34420 gene lptE CDS 25488..26519 product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000620535.1 transl_table 11 codon_start 1 locus_tag LOCUS_34430 gene holA CDS 26521..27162 product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989126.1 transl_table 11 codon_start 1 locus_tag LOCUS_34440 gene nadD CDS complement(27137..28222) product threonine-phosphate decarboxylase CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173241.1 transl_table 11 codon_start 1 locus_tag LOCUS_34450 gene cobD CDS 28319..28930 product adenosylcobalamin/alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001241920.1 transl_table 11 codon_start 1 locus_tag LOCUS_34460 CDS 29190..29507 product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001161664.1 transl_table 11 codon_start 1 locus_tag LOCUS_34470 gene rsfS CDS 29511..29978 product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776104.1 transl_table 11 codon_start 1 locus_tag LOCUS_34480 gene rlmH CDS 30008..31909 product peptidoglycan DD-transpeptidase MrdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000828701.1 transl_table 11 codon_start 1 locus_tag LOCUS_34490 gene mrdA CDS 31912..33024 product peptidoglycan glycosyltransferase MrdB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000131713.1 transl_table 11 codon_start 1 locus_tag LOCUS_34500 gene mrdB CDS 33077..34138 product endolytic peptidoglycan transglycosylase RlpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000549517.1 transl_table 11 codon_start 1 locus_tag LOCUS_34510 gene rlpA CDS 34289..35500 product D-alanyl-D-alanine carboxypeptidase DacA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000858714.1 transl_table 11 codon_start 1 locus_tag LOCUS_34520 gene dacA CDS 35608..35871 product DUF493 family protein YbeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000850547.1 transl_table 11 codon_start 1 locus_tag LOCUS_34530 gene ybeD CDS 35972..36613 product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000284040.1 transl_table 11 codon_start 1 locus_tag LOCUS_34540 gene lipB CDS 36907..37860 product YbeF family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001282817.1 transl_table 11 codon_start 1 locus_tag LOCUS_34550 CDS 38069..39034 product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000042632.1 transl_table 11 codon_start 1 locus_tag LOCUS_34560 gene lipA sequence046 source 1..38911 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(17..92) product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00390 tRNA complement(149..225) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00400 CDS complement(328..1713) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818378.1 transl_table 11 codon_start 1 locus_tag LOCUS_34570 CDS complement(1916..2656) product lipopolysaccharide N-acetylmannosaminouronosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000183613.1 transl_table 11 codon_start 1 locus_tag LOCUS_34580 gene wecG CDS complement(2659..4011) product ECA oligosaccharide polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000055119.1 transl_table 11 codon_start 1 locus_tag LOCUS_34590 gene wzyE CDS complement(4008..5087) product TDP-N-acetylfucosamine:lipid II N-acetylfucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000217257.1 transl_table 11 codon_start 1 locus_tag LOCUS_34600 gene rffT CDS complement(5084..6334) product lipid III flippase WzxE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000050302.1 transl_table 11 codon_start 1 locus_tag LOCUS_34610 gene wzxE CDS complement(6336..7466) product dTDP-4-amino-4,6-dideoxygalactose transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000612044.1 transl_table 11 codon_start 1 locus_tag LOCUS_34620 gene rffA CDS complement(7471..8148) product dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001145170.1 transl_table 11 codon_start 1 locus_tag LOCUS_34630 gene rffC CDS complement(8126..9007) product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000676056.1 transl_table 11 codon_start 1 locus_tag LOCUS_34640 gene rfbA CDS complement(9040..10107) product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226625.1 transl_table 11 codon_start 1 locus_tag LOCUS_34650 gene rffG CDS complement(10107..11369) product UDP-N-acetyl-D-mannosamine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000011236.1 transl_table 11 codon_start 1 locus_tag LOCUS_34660 gene wecC CDS complement(11366..12496) product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000866686.1 transl_table 11 codon_start 1 locus_tag LOCUS_34670 gene wecB CDS complement(12552..13598) product ECA polysaccharide chain length modulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000193415.1 transl_table 11 codon_start 1 locus_tag LOCUS_34680 gene wzzE CDS complement(13611..14714) product UDP-N-acetylglucosamine--undecaprenyl-phosphate N-acetylglucosaminephosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001050960.1 transl_table 11 codon_start 1 locus_tag LOCUS_34690 gene wecA CDS complement(14955..16214) product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002883293.1 transl_table 11 codon_start 1 locus_tag LOCUS_34700 gene rho CDS complement(16554..16883) product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001305383.1 transl_table 11 codon_start 1 locus_tag LOCUS_34710 gene trxA CDS 17014..18279 product ATP-dependent RNA helicase RhlB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047509.1 transl_table 11 codon_start 1 locus_tag LOCUS_34720 gene rhlB CDS 18285..19778 product guanosine-5'-triphosphate,3'-diphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309088.1 transl_table 11 codon_start 1 locus_tag LOCUS_34730 gene gppA CDS complement(19805..21838) product DNA helicase Rep inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001238841.1 transl_table 11 codon_start 1 locus_tag LOCUS_34740 gene rep CDS 22231..23370 product sugar diacid recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209535.1 transl_table 11 codon_start 1 locus_tag LOCUS_34750 CDS 23490..24758 product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000200863.1 transl_table 11 codon_start 1 locus_tag LOCUS_34760 CDS 24814..25911 product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000706383.1 transl_table 11 codon_start 1 locus_tag LOCUS_34770 CDS 26012..26293 product peptidylprolyl isomerase PpiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140251.1 transl_table 11 codon_start 1 locus_tag LOCUS_34780 gene ppiC CDS complement(26405..27880) product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099283.1 transl_table 11 codon_start 1 locus_tag LOCUS_34790 gene ilvC CDS 28045..28935 product HTH-type transcriptional activator IlvY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365790.1 transl_table 11 codon_start 1 locus_tag LOCUS_34800 gene ilvY CDS complement(28978..30546) product threonine ammonia-lyase, biosynthetic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014833732.1 transl_table 11 codon_start 1 locus_tag LOCUS_34810 gene ilvA CDS complement(30546..32396) product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703963.1 transl_table 11 codon_start 1 locus_tag LOCUS_34820 gene ilvD CDS complement(32459..33388) product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099287.1 transl_table 11 codon_start 1 locus_tag LOCUS_34830 gene ilvE CDS complement(33407..33670) product acetolactate synthase 2 small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860184.1 transl_table 11 codon_start 1 locus_tag LOCUS_34840 gene ilvM CDS complement(33667..35313) product acetolactate synthase 2 catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012560.1 transl_table 11 codon_start 1 locus_tag LOCUS_34850 gene ilvG CDS 35902..37362 product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000058957.1 transl_table 11 codon_start 1 locus_tag LOCUS_34860 CDS complement(37448..37786) product macrodomain Ori organization protein MaoP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000841001.1 transl_table 11 codon_start 1 locus_tag LOCUS_34870 gene maoP CDS 37905..38738 product HTH-type transcriptional regulator HdfR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001541181.1 transl_table 11 codon_start 1 locus_tag LOCUS_34880 gene hdfR tRNA complement(38830..38905) product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00410 sequence047 source 1..38151 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(7..345) product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000717694.1 transl_table 11 codon_start 1 locus_tag LOCUS_34890 gene glnB CDS complement(411..1748) product two-component system response regulator GlrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295369.1 transl_table 11 codon_start 1 locus_tag LOCUS_34900 gene glrR CDS complement(1745..2461) product two-component system QseEF-associated lipoprotein QseG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001215898.1 transl_table 11 codon_start 1 locus_tag LOCUS_34910 gene qseG CDS complement(2504..3889) product two component system sensor histidine kinase QseE/GlrK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001538042.1 transl_table 11 codon_start 1 locus_tag LOCUS_34920 gene qseE CDS complement(4465..8352) product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000970165.1 transl_table 11 codon_start 1 locus_tag LOCUS_34930 gene purL CDS 8610..10157 product membrane-bound lytic murein transglycosylase MltF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000734194.1 transl_table 11 codon_start 1 locus_tag LOCUS_34940 gene mltF CDS 10203..10427 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34950 CDS complement(10431..10901) product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297409.1 transl_table 11 codon_start 1 locus_tag LOCUS_34960 gene tadA CDS complement(10991..11626) product phosphatidylglycerophosphatase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190651.1 transl_table 11 codon_start 1 locus_tag LOCUS_34970 gene yfhb CDS complement(11630..12994) product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000361665.1 transl_table 11 codon_start 1 locus_tag LOCUS_34980 CDS complement(13006..13899) product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001048539.1 transl_table 11 codon_start 1 locus_tag LOCUS_34990 gene murQ CDS 14017..14865 product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000995694.1 transl_table 11 codon_start 1 locus_tag LOCUS_35000 CDS 14921..15181 product YfhL family 4Fe-4S dicluster ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196291.1 transl_table 11 codon_start 1 locus_tag LOCUS_35010 CDS complement(15229..15609) product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000986043.1 transl_table 11 codon_start 1 locus_tag LOCUS_35020 gene acpS CDS complement(15609..16340) product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297412.1 transl_table 11 codon_start 1 locus_tag LOCUS_35030 gene pdxJ CDS complement(16357..17067) product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370291.1 transl_table 11 codon_start 1 locus_tag LOCUS_35040 gene recO CDS complement(17079..17984) product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020737.1 transl_table 11 codon_start 1 locus_tag LOCUS_35050 gene era CDS complement(17981..18595) product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860711.1 transl_table 11 codon_start 1 locus_tag LOCUS_35060 gene rnc CDS complement(18936..19910) product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000002542.1 transl_table 11 codon_start 1 locus_tag LOCUS_35070 gene lepB CDS complement(19927..21726) product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000790169.1 transl_table 11 codon_start 1 locus_tag LOCUS_35080 gene lepA CDS complement(21985..22878) product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098830.1 transl_table 11 codon_start 1 locus_tag LOCUS_35090 CDS complement(23007..23486) product SoxR-reducing system protein RseC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589049.1 transl_table 11 codon_start 1 locus_tag LOCUS_35100 gene rseC CDS complement(23483..24439) product sigma-E factor regulatory protein RseB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000812041.1 transl_table 11 codon_start 1 locus_tag LOCUS_35110 gene rseB CDS complement(24439..25089) product anti-sigma-E factor RseA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001168466.1 transl_table 11 codon_start 1 locus_tag LOCUS_35120 gene rseA CDS complement(25121..25747) product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003307.1 transl_table 11 codon_start 1 locus_tag LOCUS_35130 gene rpoE CDS 26121..27743 product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001094491.1 transl_table 11 codon_start 1 locus_tag LOCUS_35140 gene nadB CDS complement(27728..28465) product tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297411.1 transl_table 11 codon_start 1 locus_tag LOCUS_35150 gene trmN CDS 28596..29930 product ATP-dependent RNA helicase SrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000219176.1 transl_table 11 codon_start 1 locus_tag LOCUS_35160 gene srmB CDS complement(30048..30431) product autonomous glycyl radical cofactor GrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000627804.1 transl_table 11 codon_start 1 locus_tag LOCUS_35170 gene grcA CDS 30719..31438 product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179978.1 transl_table 11 codon_start 1 locus_tag LOCUS_35180 gene ung CDS complement(31537..32574) product tRNA/rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000997368.1 transl_table 11 codon_start 1 locus_tag LOCUS_35190 CDS 32781..33200 product thioredoxin TrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001098726.1 transl_table 11 codon_start 1 locus_tag LOCUS_35200 gene trxC CDS 33373..33969 product tRNA-uridine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000183640.1 transl_table 11 codon_start 1 locus_tag LOCUS_35210 gene tapT CDS 34005..36665 product protein lysine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000082964.1 transl_table 11 codon_start 1 locus_tag LOCUS_35220 gene pat CDS 36776..38134 product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000949265.1 transl_table 11 codon_start 1 locus_tag LOCUS_35230 gene pssA sequence048 source 1..37526 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(168..1703) product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001050683.1 transl_table 11 codon_start 1 locus_tag LOCUS_35240 gene murJ CDS complement(1816..2061) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35250 note possible pseudo, frameshifted CDS complement(2039..2737) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35260 note possible pseudo, frameshifted CDS complement(2730..3386) product YceH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000873047.1 transl_table 11 codon_start 1 locus_tag LOCUS_35270 CDS complement(3397..3981) product ribosomal protein S5-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367203.1 transl_table 11 codon_start 1 locus_tag LOCUS_35280 gene rimJ CDS 4243..4998 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35290 note possible pseudo, frameshifted CDS 4907..5452 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35300 note possible pseudo, frameshifted CDS 5516..6163 product glutaredoxin 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780912.1 transl_table 11 codon_start 1 locus_tag LOCUS_35310 gene grxB CDS 6291..6851 product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295443.1 transl_table 11 codon_start 1 locus_tag LOCUS_35320 CDS 7026..8000 product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000126556.1 transl_table 11 codon_start 1 locus_tag LOCUS_35330 gene pyrC CDS 8076..8321 product DNA damage-inducible protein I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001217754.1 transl_table 11 codon_start 1 locus_tag LOCUS_35340 gene dinI CDS 8637..8891 product biofilm formation regulator BssS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000414441.1 transl_table 11 codon_start 1 locus_tag LOCUS_35350 gene bssS CDS 9006..10127 product N-methyl-L-tryptophan oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000872833.1 transl_table 11 codon_start 1 locus_tag LOCUS_35360 gene solA CDS 10551..11123 product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000011118.1 transl_table 11 codon_start 1 locus_tag LOCUS_35370 CDS 11120..11695 product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000749261.1 transl_table 11 codon_start 1 locus_tag LOCUS_35380 CDS complement(11782..12834) product rhodanese-related sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001144616.1 transl_table 11 codon_start 1 locus_tag LOCUS_35390 CDS 13060..13980 product kdo(2)-lipid IV(A) lauroyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005062003.1 transl_table 11 codon_start 1 locus_tag LOCUS_35400 gene lpxL CDS 14136..15356 product multidrug efflux MFS transporter MdtG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000075040.1 transl_table 11 codon_start 1 locus_tag LOCUS_35410 gene mdtG CDS 15438..15812 product MysB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000180050.1 transl_table 11 codon_start 1 locus_tag LOCUS_35420 CDS complement(15813..16040) product YceK/YidQ family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001237205.1 transl_table 11 codon_start 1 locus_tag LOCUS_35430 CDS complement(16142..18670) product glucans biosynthesis glucosyltransferase MdoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044602.1 transl_table 11 codon_start 1 locus_tag LOCUS_35440 gene mdoH CDS complement(18663..20189) product glucans biosynthesis protein MdoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001562609.1 transl_table 11 codon_start 1 locus_tag LOCUS_35450 gene mdoG CDS 20476..21636 product glucans biosynthesis protein MdoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100054.1 transl_table 11 codon_start 1 locus_tag LOCUS_35460 gene mdoC CDS complement(21642..23132) product phospholipase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976323.1 transl_table 11 codon_start 1 locus_tag LOCUS_35470 CDS complement(23065..23598) product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857399.1 transl_table 11 codon_start 1 locus_tag LOCUS_35480 gene ymdB CDS complement(23688..24011) product type 1 fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000111254.1 transl_table 11 codon_start 1 locus_tag LOCUS_35490 CDS 24344..24523 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35500 CDS complement(24531..24986) product curli major subunit CsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000771416.1 transl_table 11 codon_start 1 locus_tag LOCUS_35510 gene csgA CDS complement(25027..25482) product curli minor subunit CsgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001360656.1 transl_table 11 codon_start 1 locus_tag LOCUS_35520 gene csgB CDS 26226..26876 product biofilm master transcriptional regulator CsgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000481500.1 transl_table 11 codon_start 1 locus_tag LOCUS_35530 gene csgD CDS 26881..27270 product curli production assembly/transport protein CsgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000833288.1 transl_table 11 codon_start 1 locus_tag LOCUS_35540 gene csgE CDS 27297..27713 product curli production assembly/transport protein CsgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264073.1 transl_table 11 codon_start 1 locus_tag LOCUS_35550 gene csgF CDS 27739..28572 product curli production assembly/transport protein CsgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001137620.1 transl_table 11 codon_start 1 locus_tag LOCUS_35560 gene csgG CDS complement(28632..29123) product DUF1097 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000337814.1 transl_table 11 codon_start 1 locus_tag LOCUS_35570 CDS complement(29214..29792) product molecular chaperone YcdY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001001909.1 transl_table 11 codon_start 1 locus_tag LOCUS_35580 gene ycdY CDS complement(29792..30529) product zinc-binding phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000283664.1 transl_table 11 codon_start 1 locus_tag LOCUS_35590 gene ycdX CDS complement(30662..31600) product glyoxylate/hydroxypyruvate reductase GhrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000402555.1 transl_table 11 codon_start 1 locus_tag LOCUS_35600 gene ghrA tRNA 31834..31921 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00420 CDS complement(32071..32472) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35610 note possible pseudo, frameshifted CDS complement(32405..32668) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35620 note possible pseudo, frameshifted CDS complement(32676..32915) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35630 note possible pseudo, frameshifted CDS complement(33000..33176) product DUF957 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000772032.1 transl_table 11 codon_start 1 locus_tag LOCUS_35640 CDS 33426..33611 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35650 CDS 33595..33852 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35660 CDS complement(34474..35166) product type III secretion system effector cysteine methyltransferase NleE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000609742.1 transl_table 11 codon_start 1 locus_tag LOCUS_35670 gene nleE CDS complement(35209..36198) product type III secretion system effector arginine glycosyltransferase NleB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000953022.1 transl_table 11 codon_start 1 locus_tag LOCUS_35680 gene nleB CDS complement(36442..36852) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35690 note possible pseudo, frameshifted CDS complement(37180..37524) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35700 sequence049 source 1..37228 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 131..820 product Sel1 family TPR-like repeat protein YjcO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000719886.1 transl_table 11 codon_start 1 locus_tag LOCUS_35710 gene yjcO CDS complement(923..2233) product glutamate/aspartate:proton symporter GltP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000793283.1 transl_table 11 codon_start 1 locus_tag LOCUS_35720 gene gltP CDS complement(2577..3185) product heme lyase NrfEFG subunit NrfG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000083247.1 transl_table 11 codon_start 1 locus_tag LOCUS_35730 gene nrfG CDS complement(3172..3666) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35740 note possible pseudo, frameshifted CDS complement(3659..5392) product heme lyase NrfEFG subunit NrfEF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000551709.1 transl_table 11 codon_start 1 locus_tag LOCUS_35750 gene nrfEF note possible pseudo, frameshifted CDS complement(5385..6341) product cytochrome c nitrite reductase subunit NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000199631.1 transl_table 11 codon_start 1 locus_tag LOCUS_35760 gene nrfD CDS complement(6338..7009) product cytochrome c nitrite reductase Fe-S protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278023.1 transl_table 11 codon_start 1 locus_tag LOCUS_35770 gene nrfC CDS complement(7006..7569) product cytochrome c nitrite reductase pentaheme subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295391.1 transl_table 11 codon_start 1 locus_tag LOCUS_35780 gene nrfB CDS complement(7682..9118) product ammonia-forming nitrite reductase cytochrome c552 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101783.1 transl_table 11 codon_start 1 locus_tag LOCUS_35790 gene nrfA CDS 9549..11507 product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000078206.1 transl_table 11 codon_start 1 locus_tag LOCUS_35800 gene acs CDS 11726..12040 product DUF485 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001014565.1 transl_table 11 codon_start 1 locus_tag LOCUS_35810 CDS 12037..13686 product cation/acetate symporter ActP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000832531.1 transl_table 11 codon_start 1 locus_tag LOCUS_35820 gene actP CDS complement(13767..14720) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35830 CDS 14961..16250 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167274874.1 transl_table 11 codon_start 1 locus_tag LOCUS_35840 CDS 16386..17276 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000354962.1 transl_table 11 codon_start 1 locus_tag LOCUS_35850 CDS complement(17526..19172) product Na+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000402207.1 transl_table 11 codon_start 1 locus_tag LOCUS_35860 CDS complement(19324..20673) product guanine/hypoxanthine transporter GhxP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000106903.1 transl_table 11 codon_start 1 locus_tag LOCUS_35870 gene ghxP CDS complement(20990..21658) product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000958574.1 transl_table 11 codon_start 1 locus_tag LOCUS_35880 CDS complement(22057..22515) product redox-sensitive transcriptional activator SoxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000412424.1 transl_table 11 codon_start 1 locus_tag LOCUS_35890 gene soxR CDS 22601..22924 product superoxide response transcriptional regulator SoxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019484.1 transl_table 11 codon_start 1 locus_tag LOCUS_35900 gene soxS CDS complement(22927..24465) product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000083646.1 transl_table 11 codon_start 1 locus_tag LOCUS_35910 CDS 24733..24969 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35920 CDS 25110..25391 product YjcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000719058.1 transl_table 11 codon_start 1 locus_tag LOCUS_35930 CDS complement(25424..26299) product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098280.1 transl_table 11 codon_start 1 locus_tag LOCUS_35940 CDS complement(26299..27087) product dimethyl sulfoxide reductase anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098281.1 transl_table 11 codon_start 1 locus_tag LOCUS_35950 CDS complement(27080..27709) product dimethylsulfoxide reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000077439.1 transl_table 11 codon_start 1 locus_tag LOCUS_35960 gene dmsB CDS complement(27706..30090) product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098283.1 transl_table 11 codon_start 1 locus_tag LOCUS_35970 CDS 30545..30928 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35980 CDS 30925..31236 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35990 CDS 31451..33766 product Fe(3+) dicitrate transport protein FecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000188246.1 transl_table 11 codon_start 1 locus_tag LOCUS_36000 gene fecA CDS 34508..37150 product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097676.1 transl_table 11 codon_start 1 locus_tag LOCUS_36010 sequence050 source 1..37107 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(3124..3651) product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001518569.1 transl_table 11 codon_start 1 locus_tag LOCUS_36020 gene smpB CDS 3777..4214 product type II toxin-antitoxin system toxin RatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000600189.1 transl_table 11 codon_start 1 locus_tag LOCUS_36030 gene ratA CDS 4204..4494 product RnfH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001112990.1 transl_table 11 codon_start 1 locus_tag LOCUS_36040 CDS complement(4618..4920) product outer membrane protein assembly factor BamE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001203437.1 transl_table 11 codon_start 1 locus_tag LOCUS_36050 gene bamE CDS complement(5112..6773) product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000880973.1 transl_table 11 codon_start 1 locus_tag LOCUS_36060 gene recN CDS complement(6859..7737) product NAD(+) kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059176.1 transl_table 11 codon_start 1 locus_tag LOCUS_36070 gene nadK CDS 7752..8453 product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296310.1 transl_table 11 codon_start 1 locus_tag LOCUS_36080 gene grpE CDS complement(8510..9796) product HlyC/CorC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010723175.1 transl_table 11 codon_start 1 locus_tag LOCUS_36090 CDS complement(9888..10679) product inner membrane protein YpjD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001537507.1 transl_table 11 codon_start 1 locus_tag LOCUS_36100 CDS 10845..12206 product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460052.1 transl_table 11 codon_start 1 locus_tag LOCUS_36110 gene ffh CDS 12477..12725 product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000256453.1 transl_table 11 codon_start 1 locus_tag LOCUS_36120 gene rpsP CDS 12744..13292 product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000043335.1 transl_table 11 codon_start 1 locus_tag LOCUS_36130 gene rimM CDS 13336..14082 product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000264777.1 transl_table 11 codon_start 1 locus_tag LOCUS_36140 gene trmD CDS 14142..14489 product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000065253.1 transl_table 11 codon_start 1 locus_tag LOCUS_36150 gene rplS CDS complement(14618..15100) product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589793.1 transl_table 11 codon_start 1 locus_tag LOCUS_36160 CDS complement(15121..16344) product diguanylate cyclase DgcN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001030993.1 transl_table 11 codon_start 1 locus_tag LOCUS_36170 gene dgcN CDS complement(16337..16855) product YfiR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001212391.1 transl_table 11 codon_start 1 locus_tag LOCUS_36180 CDS 17233..18303 product 3-deoxy-7-phosphoheptulonate synthase AroF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001168045.1 transl_table 11 codon_start 1 locus_tag LOCUS_36190 gene aroF CDS 18314..19435 product bifunctional chorismate mutase/prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000225204.1 transl_table 11 codon_start 1 locus_tag LOCUS_36200 gene tyrA CDS complement(19480..21087) product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704301.1 transl_table 11 codon_start 1 locus_tag LOCUS_36210 CDS complement(21093..22724) product aldehyde dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704300.1 transl_table 11 codon_start 1 locus_tag LOCUS_36220 CDS complement(22739..23659) product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008807565.1 transl_table 11 codon_start 1 locus_tag LOCUS_36230 CDS complement(23798..24613) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368421.1 transl_table 11 codon_start 1 locus_tag LOCUS_36240 CDS 24920..25861 product 4-hydroxyproline epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704299.1 transl_table 11 codon_start 1 locus_tag LOCUS_36250 CDS 25858..26961 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704298.1 transl_table 11 codon_start 1 locus_tag LOCUS_36260 CDS 26958..27212 product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368424.1 transl_table 11 codon_start 1 locus_tag LOCUS_36270 CDS 27199..28455 product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704297.1 transl_table 11 codon_start 1 locus_tag LOCUS_36280 CDS 28577..29449 product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098341.1 transl_table 11 codon_start 1 locus_tag LOCUS_36290 CDS complement(29446..30606) product bifunctional chorismate mutase/prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000200116.1 transl_table 11 codon_start 1 locus_tag LOCUS_36300 gene pheA CDS complement(30856..31194) product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000178449.1 transl_table 11 codon_start 1 locus_tag LOCUS_36310 gene raiA CDS complement(31466..32203) product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000197686.1 transl_table 11 codon_start 1 locus_tag LOCUS_36320 gene bamD CDS 32336..33316 product 23S rRNA pseudouridine(1911/1915/1917) synthase RluD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000079097.1 transl_table 11 codon_start 1 locus_tag LOCUS_36330 gene rluD CDS 33313..34044 product purine nucleoside phosphorylase YfiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000992642.1 transl_table 11 codon_start 1 locus_tag LOCUS_36340 gene yfiH CDS 34174..36747 product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001235094.1 transl_table 11 codon_start 1 locus_tag LOCUS_36350 gene clpB sequence051 source 1..37042 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(311..808) product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095527.1 transl_table 11 codon_start 1 locus_tag LOCUS_36360 gene lspA CDS complement(808..3624) product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001286898.1 transl_table 11 codon_start 1 locus_tag LOCUS_36370 gene ileS CDS complement(3662..4600) product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767311.1 transl_table 11 codon_start 1 locus_tag LOCUS_36380 gene ribF CDS 4929..5192 product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274021.1 transl_table 11 codon_start 1 locus_tag LOCUS_36390 gene rpsT CDS 5623..6996 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989104.1 transl_table 11 codon_start 1 locus_tag LOCUS_36400 CDS 7035..9074 product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001116444.1 transl_table 11 codon_start 1 locus_tag LOCUS_36410 CDS complement(9109..10005) product transcriptional activator NhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062880.1 transl_table 11 codon_start 1 locus_tag LOCUS_36420 gene nhaR CDS complement(10065..11231) product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000681337.1 transl_table 11 codon_start 1 locus_tag LOCUS_36430 gene nhaA CDS complement(11832..13907) product glycosyl hydrolase family 18 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704340.1 transl_table 11 codon_start 1 locus_tag LOCUS_36440 CDS 14292..14705 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000860681.1 transl_table 11 codon_start 1 locus_tag LOCUS_36450 CDS 14739..15272 product glycoside hydrolase family 108 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368347.1 transl_table 11 codon_start 1 locus_tag LOCUS_36460 CDS complement(15356..15706) product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704339.1 transl_table 11 codon_start 1 locus_tag LOCUS_36470 CDS complement(15822..16754) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704338.1 transl_table 11 codon_start 1 locus_tag LOCUS_36480 CDS complement(17070..18200) product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118464.1 transl_table 11 codon_start 1 locus_tag LOCUS_36490 gene dnaJ CDS complement(18287..20203) product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000516126.1 transl_table 11 codon_start 1 locus_tag LOCUS_36500 gene dnaK CDS 20559..21125 product acetate uptake transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000528527.1 transl_table 11 codon_start 1 locus_tag LOCUS_36510 gene satP CDS complement(21160..22422) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704337.1 transl_table 11 codon_start 1 locus_tag LOCUS_36520 CDS complement(22589..23176) product molybdopterin adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295414.1 transl_table 11 codon_start 1 locus_tag LOCUS_36530 gene mog CDS complement(23290..24243) product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130175.1 transl_table 11 codon_start 1 locus_tag LOCUS_36540 gene tal CDS 24514..25944 product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001112565.1 transl_table 11 codon_start 1 locus_tag LOCUS_36550 CDS 26014..26787 product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000906171.1 transl_table 11 codon_start 1 locus_tag LOCUS_36560 gene yaaA CDS complement(26937..28223) product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000781103.1 transl_table 11 codon_start 1 locus_tag LOCUS_36570 gene thrC CDS complement(28227..29156) product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000241660.1 transl_table 11 codon_start 1 locus_tag LOCUS_36580 gene thrB CDS complement(29159..31621) product bifunctional aspartate kinase/homoserine dehydrogenase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264731.1 transl_table 11 codon_start 1 locus_tag LOCUS_36590 gene thrA CDS complement(31981..32592) product tRNA/rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001223177.1 transl_table 11 codon_start 1 locus_tag LOCUS_36600 CDS 33289..34005 product two-component system response regulator ArcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001194359.1 transl_table 11 codon_start 1 locus_tag LOCUS_36610 gene arcA CDS complement(34070..35455) product cell envelope integrity protein CreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000920380.1 transl_table 11 codon_start 1 locus_tag LOCUS_36620 gene creD CDS complement(35514..36938) product two-component system sensor histidine kinase CreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219577.1 transl_table 11 codon_start 1 locus_tag LOCUS_36630 gene creC sequence052 source 1..36973 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 575..1333 product metalloprotease LoiP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000701841.1 transl_table 11 codon_start 1 locus_tag LOCUS_36640 gene loiP CDS complement(1463..2383) product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002434404.1 transl_table 11 codon_start 1 locus_tag LOCUS_36650 gene speB CDS complement(2528..4426) product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278580.1 transl_table 11 codon_start 1 locus_tag LOCUS_36660 gene speA CDS 5364..6518 product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001062128.1 transl_table 11 codon_start 1 locus_tag LOCUS_36670 gene metK CDS 6942..8336 product galactose/proton symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001113171.1 transl_table 11 codon_start 1 locus_tag LOCUS_36680 gene galP CDS complement(8388..8798) product hydroxyisourate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000833187.1 transl_table 11 codon_start 1 locus_tag LOCUS_36690 gene hiuH CDS 8933..9613 product response regulator transcription factor HprR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014343829.1 transl_table 11 codon_start 1 locus_tag LOCUS_36700 gene hprR CDS 9618..10955 product heavy metal sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000240036.1 transl_table 11 codon_start 1 locus_tag LOCUS_36710 CDS 11042..11500 product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000856775.1 transl_table 11 codon_start 1 locus_tag LOCUS_36720 CDS 11592..12299 product deoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000286500.1 transl_table 11 codon_start 1 locus_tag LOCUS_36730 gene endA CDS 12373..13104 product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001222509.1 transl_table 11 codon_start 1 locus_tag LOCUS_36740 gene rsmE CDS 13117..14064 product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000593260.1 transl_table 11 codon_start 1 locus_tag LOCUS_36750 gene gshB CDS 14254..14817 product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001053167.1 transl_table 11 codon_start 1 locus_tag LOCUS_36760 CDS 14817..15233 product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000017110.1 transl_table 11 codon_start 1 locus_tag LOCUS_36770 gene ruvX CDS complement(15269..16249) product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001349546.1 transl_table 11 codon_start 1 locus_tag LOCUS_36780 CDS 16357..16971 product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000997790.1 transl_table 11 codon_start 1 locus_tag LOCUS_36790 CDS 16990..17556 product osmotic shock tolerance protein YggT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001094831.1 transl_table 11 codon_start 1 locus_tag LOCUS_36800 gene yggT CDS 17553..17843 product DUF167 family protein YggU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001277205.1 transl_table 11 codon_start 1 locus_tag LOCUS_36810 gene yggU CDS 17851..18444 product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369727.1 transl_table 11 codon_start 1 locus_tag LOCUS_36820 CDS 18437..19573 product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096530.1 transl_table 11 codon_start 1 locus_tag LOCUS_36830 gene hemW CDS complement(19684..20730) product L-asparaginase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000394189.1 transl_table 11 codon_start 1 locus_tag LOCUS_36840 gene ansB CDS complement(20920..21639) product DUF2884 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000984827.1 transl_table 11 codon_start 1 locus_tag LOCUS_36850 CDS complement(21689..22015) product YggL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107565.1 transl_table 11 codon_start 1 locus_tag LOCUS_36860 CDS complement(22015..22734) product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000786887.1 transl_table 11 codon_start 1 locus_tag LOCUS_36870 gene trmB CDS 22879..23979 product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004972828.1 transl_table 11 codon_start 1 locus_tag LOCUS_36880 gene mutY CDS 23976..24248 product oxidative damage protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091700.1 transl_table 11 codon_start 1 locus_tag LOCUS_36890 CDS 24348..25433 product membrane-bound lytic murein transglycosylase MltC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298916.1 transl_table 11 codon_start 1 locus_tag LOCUS_36900 gene mltC CDS 25645..26901 product nucleoside permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001049802.1 transl_table 11 codon_start 1 locus_tag LOCUS_36910 CDS complement(27066..29192) product ornithine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000839815.1 transl_table 11 codon_start 1 locus_tag LOCUS_36920 gene speC CDS 29627..30334 product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000234466.1 transl_table 11 codon_start 1 locus_tag LOCUS_36930 tRNA 30440..30515 product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00430 CDS 30713..31975 product integrase arm-type DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001218809.1 transl_table 11 codon_start 1 locus_tag LOCUS_36940 CDS 32139..32324 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36950 CDS 32550..32762 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36960 CDS 33160..33558 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36970 CDS 33693..35021 product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039059.1 transl_table 11 codon_start 1 locus_tag LOCUS_36980 CDS 35029..35580 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36990 CDS 35691..36341 product IS66-like element accessory protein TnpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001339397.1 transl_table 11 codon_start 1 locus_tag LOCUS_37000 gene tnpA CDS 36341..36688 product IS66 family insertion sequence element accessory protein TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000624622.1 transl_table 11 codon_start 1 locus_tag LOCUS_37010 gene tnpB sequence053 source 1..35925 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 77..649 product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000904930.1 transl_table 11 codon_start 1 locus_tag LOCUS_37020 CDS 735..2786 product SASA family carbohydrate esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000023170.1 transl_table 11 codon_start 1 locus_tag LOCUS_37030 CDS 2921..3103 product DUF1378 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000144787.1 transl_table 11 codon_start 1 locus_tag LOCUS_37040 CDS 3139..3396 product DUF826 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001114104.1 transl_table 11 codon_start 1 locus_tag LOCUS_37050 CDS complement(5025..5480) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37060 CDS complement(5524..6897) product PTS galactitol transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000490608.1 transl_table 11 codon_start 1 locus_tag LOCUS_37070 CDS complement(6902..7186) product PTS galactitol transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000824293.1 transl_table 11 codon_start 1 locus_tag LOCUS_37080 gene gatB CDS complement(7216..7680) product PTS galactitol transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000080443.1 transl_table 11 codon_start 1 locus_tag LOCUS_37090 gene gatA CDS complement(7695..8966) product tagatose-bisphosphate aldolase subunit GatZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853830.1 transl_table 11 codon_start 1 locus_tag LOCUS_37100 gene gatZ CDS complement(9018..9872) product tagatose bisphosphate family class II aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000469985.1 transl_table 11 codon_start 1 locus_tag LOCUS_37110 CDS complement(10053..11624) product galactarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273776.1 transl_table 11 codon_start 1 locus_tag LOCUS_37120 gene garD CDS 12137..12907 product 2-dehydro-3-deoxyglucarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098883.1 transl_table 11 codon_start 1 locus_tag LOCUS_37130 gene garL CDS 12938..13828 product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001303675.1 transl_table 11 codon_start 1 locus_tag LOCUS_37140 gene garR CDS 13929..15074 product glycerate 2-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703577.1 transl_table 11 codon_start 1 locus_tag LOCUS_37150 gene garK CDS 16093..17256 product NapC/NirT family cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006798114.1 transl_table 11 codon_start 1 locus_tag LOCUS_37160 CDS 17266..19785 product trimethylamine-N-oxide reductase TorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047040642.1 transl_table 11 codon_start 1 locus_tag LOCUS_37170 gene torA CDS 20494..21432 product transcriptional regulator TdcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000104210.1 transl_table 11 codon_start 1 locus_tag LOCUS_37180 gene tdcA CDS 21531..22520 product bifunctional threonine ammonia-lyase/L-serine ammonia-lyase TdcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000548373.1 transl_table 11 codon_start 1 locus_tag LOCUS_37190 gene tdcB CDS 22555..23886 product threonine/serine transporter TdcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020078491.1 transl_table 11 codon_start 1 locus_tag LOCUS_37200 gene tdcC CDS 23918..25126 product propionate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298325.1 transl_table 11 codon_start 1 locus_tag LOCUS_37210 gene tdcD CDS 25158..27452 product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000867312.1 transl_table 11 codon_start 1 locus_tag LOCUS_37220 gene pflB CDS 27540..28904 product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000622070.1 transl_table 11 codon_start 1 locus_tag LOCUS_37230 gene tdcG CDS 29216..30547 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000401598.1 transl_table 11 codon_start 1 locus_tag LOCUS_37240 CDS 30569..31879 product serine dehydratase subunit alpha family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000463069.1 transl_table 11 codon_start 1 locus_tag LOCUS_37250 CDS complement(31958..32119) product protein YhaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005050939.1 transl_table 11 codon_start 1 locus_tag LOCUS_37260 gene yhaL CDS complement(32139..32840) product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000633552.1 transl_table 11 codon_start 1 locus_tag LOCUS_37270 CDS 32945..33841 product DNA-binding transcriptional regulator YhaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001041009.1 transl_table 11 codon_start 1 locus_tag LOCUS_37280 gene yhaJ CDS complement(33892..34251) product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001198807.1 transl_table 11 codon_start 1 locus_tag LOCUS_37290 CDS complement(34475..34840) product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000384145.1 transl_table 11 codon_start 1 locus_tag LOCUS_37300 CDS complement(34970..35512) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37310 sequence054 source 1..35285 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(23..388) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37320 CDS complement(535..882) product anti-adapter protein IraM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309448.1 transl_table 11 codon_start 1 locus_tag LOCUS_37330 gene iraM CDS 1316..1981 product UPF0149 family protein YecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000847902.1 transl_table 11 codon_start 1 locus_tag LOCUS_37340 gene yecA CDS complement(2034..3212) product tyrosine transporter TyrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000797566.1 transl_table 11 codon_start 1 locus_tag LOCUS_37350 gene tyrP CDS 3441..3680 product YecH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000377238.1 transl_table 11 codon_start 1 locus_tag LOCUS_37360 CDS complement(3713..4210) product non-heme ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000920615.1 transl_table 11 codon_start 1 locus_tag LOCUS_37370 gene ftnA CDS complement(4381..4716) product YecR-like lipofamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000803230.1 transl_table 11 codon_start 1 locus_tag LOCUS_37380 CDS 4978..5616 product RpiB/LacA/LacB family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705970.1 transl_table 11 codon_start 1 locus_tag LOCUS_37390 CDS complement(5646..7076) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705969.1 transl_table 11 codon_start 1 locus_tag LOCUS_37400 CDS 7493..7744 product DUF2766 family protein YecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000082127.1 transl_table 11 codon_start 1 locus_tag LOCUS_37410 gene yecJ CDS complement(7873..8337) product non-heme ferritin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000741707.1 transl_table 11 codon_start 1 locus_tag LOCUS_37420 CDS 8299..8451 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37430 CDS 8892..9449 product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000754799.1 transl_table 11 codon_start 1 locus_tag LOCUS_37440 CDS 9767..10756 product arabinose ABC transporter substrate-binding protein AraF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000548675.1 transl_table 11 codon_start 1 locus_tag LOCUS_37450 gene araF CDS 10892..11881 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37460 note possible pseudo, frameshifted CDS 11878..12396 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37470 note possible pseudo, frameshifted CDS 12411..13397 product arabinose ABC transporter permease AraH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000987903.1 transl_table 11 codon_start 1 locus_tag LOCUS_37480 gene araH CDS 13565..14365 product trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309561.1 transl_table 11 codon_start 1 locus_tag LOCUS_37490 gene otsB CDS 14340..15761 product alpha,alpha-trehalose-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309560.1 transl_table 11 codon_start 1 locus_tag LOCUS_37500 gene otsA CDS complement(15779..16207) product universal stress protein UspC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000122416.1 transl_table 11 codon_start 1 locus_tag LOCUS_37510 gene uspC CDS 16712..16900 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37520 CDS 16997..17347 product flagellar transcriptional regulator FlhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295647.1 transl_table 11 codon_start 1 locus_tag LOCUS_37530 gene flhD CDS 17347..17928 product flagellar transcriptional regulator FlhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096051.1 transl_table 11 codon_start 1 locus_tag LOCUS_37540 gene flhC CDS 18054..18938 product flagellar motor stator protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000906317.1 transl_table 11 codon_start 1 locus_tag LOCUS_37550 gene motA CDS 18935..19864 product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000795656.1 transl_table 11 codon_start 1 locus_tag LOCUS_37560 gene motB CDS 19875..21890 product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000061308.1 transl_table 11 codon_start 1 locus_tag LOCUS_37570 gene cheA CDS 21910..22413 product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096054.1 transl_table 11 codon_start 1 locus_tag LOCUS_37580 gene cheW CDS complement(22484..23752) product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096055.1 transl_table 11 codon_start 1 locus_tag LOCUS_37590 CDS 24177..24746 product spore coat protein U domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096056.1 transl_table 11 codon_start 1 locus_tag LOCUS_37600 CDS 24907..25302 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37610 CDS 25319..26071 product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096058.1 transl_table 11 codon_start 1 locus_tag LOCUS_37620 CDS 26047..28437 product fimbria/pilus outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096059.1 transl_table 11 codon_start 1 locus_tag LOCUS_37630 CDS 28434..29399 product spore coat U domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096060.1 transl_table 11 codon_start 1 locus_tag LOCUS_37640 CDS 29481..31142 product methyl-accepting chemotaxis protein II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000483273.1 transl_table 11 codon_start 1 locus_tag LOCUS_37650 gene tar CDS 31230..32096 product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008500429.1 transl_table 11 codon_start 1 locus_tag LOCUS_37660 gene cheR CDS 32093..33142 product protein-glutamate methylesterase/protein glutamine deamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000036391.1 transl_table 11 codon_start 1 locus_tag LOCUS_37670 gene cheB CDS 33160..33549 product chemotaxis response regulator CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000763861.1 transl_table 11 codon_start 1 locus_tag LOCUS_37680 gene cheY CDS 33560..34204 product protein phosphatase CheZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000983587.1 transl_table 11 codon_start 1 locus_tag LOCUS_37690 gene cheZ CDS complement(34259..34816) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37700 sequence055 source 1..33442 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(711..905) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37710 CDS complement(1182..1667) product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000603920.1 transl_table 11 codon_start 1 locus_tag LOCUS_37720 CDS complement(1809..2093) product YqjK-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000096086.1 transl_table 11 codon_start 1 locus_tag LOCUS_37730 CDS complement(2083..2487) product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000785722.1 transl_table 11 codon_start 1 locus_tag LOCUS_37740 CDS complement(2490..2795) product YqjD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000031219.1 transl_table 11 codon_start 1 locus_tag LOCUS_37750 CDS complement(2830..3198) product DUF1090 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000877297.1 transl_table 11 codon_start 1 locus_tag LOCUS_37760 CDS complement(3347..3730) product EnvZ/OmpR regulon moderator MzrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001166761.1 transl_table 11 codon_start 1 locus_tag LOCUS_37770 gene mzrA CDS complement(3734..4396) product DedA family general envelope maintenance protein YqjA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000422149.1 transl_table 11 codon_start 1 locus_tag LOCUS_37780 gene yqjA CDS complement(4741..5517) product transcriptional regulator ExuR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000406487.1 transl_table 11 codon_start 1 locus_tag LOCUS_37790 gene exuR CDS complement(5724..7025) product hexuronate transporter ExuT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703568.1 transl_table 11 codon_start 1 locus_tag LOCUS_37800 gene exuT CDS 7502..8914 product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187442.1 transl_table 11 codon_start 1 locus_tag LOCUS_37810 gene uxaC CDS 8929..10416 product altronate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001199383.1 transl_table 11 codon_start 1 locus_tag LOCUS_37820 gene uxaA CDS 10581..11138 product YgjV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000128143.1 transl_table 11 codon_start 1 locus_tag LOCUS_37830 CDS complement(11155..12399) product serine/threonine transporter SstT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000235369.1 transl_table 11 codon_start 1 locus_tag LOCUS_37840 gene sstT CDS complement(12634..13599) product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001098834.1 transl_table 11 codon_start 1 locus_tag LOCUS_37850 CDS complement(13872..14870) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098856.1 transl_table 11 codon_start 1 locus_tag LOCUS_37860 CDS complement(14941..15444) product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295542.1 transl_table 11 codon_start 1 locus_tag LOCUS_37870 CDS 15528..16664 product 23S rRNA (guanine(1835)-N(2))-methyltransferase RlmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098854.1 transl_table 11 codon_start 1 locus_tag LOCUS_37880 gene rlmG CDS complement(16801..18819) product NADPH-dependent 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000121433.1 transl_table 11 codon_start 1 locus_tag LOCUS_37890 gene fadH CDS complement(19045..20334) product putrescine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098827.1 transl_table 11 codon_start 1 locus_tag LOCUS_37900 gene ygjG CDS 20854..22374 product PAS domain-containing methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000094656.1 transl_table 11 codon_start 1 locus_tag LOCUS_37910 CDS 22642..24207 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000478457.1 transl_table 11 codon_start 1 locus_tag LOCUS_37920 CDS complement(24204..24734) product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098824.1 transl_table 11 codon_start 1 locus_tag LOCUS_37930 CDS 24958..25725 product NADPH-dependent ferric chelate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001066494.1 transl_table 11 codon_start 1 locus_tag LOCUS_37940 gene nfeF CDS 26091..26582 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37950 CDS 26807..27226 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37960 CDS 27871..29181 product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096692.1 transl_table 11 codon_start 1 locus_tag LOCUS_37970 sequence056 source 1..33315 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(51..126) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00440 CDS complement(290..1081) product cell division protein CpoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097528.1 transl_table 11 codon_start 1 locus_tag LOCUS_37980 gene cpoB CDS complement(1091..1612) product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295883.1 transl_table 11 codon_start 1 locus_tag LOCUS_37990 gene pal CDS complement(1647..2942) product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295307.1 transl_table 11 codon_start 1 locus_tag LOCUS_38000 gene tolB CDS complement(3072..4316) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38010 CDS complement(4379..4807) product colicin uptake protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858589.1 transl_table 11 codon_start 1 locus_tag LOCUS_38020 gene tolR CDS complement(4811..5503) product Tol-Pal system protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097532.1 transl_table 11 codon_start 1 locus_tag LOCUS_38030 gene tolQ CDS complement(5500..5904) product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001098384.1 transl_table 11 codon_start 1 locus_tag LOCUS_38040 gene ybgC CDS complement(6179..6472) product cyd operon protein YbgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367664.1 transl_table 11 codon_start 1 locus_tag LOCUS_38050 gene ybgE CDS complement(6601..7740) product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000568258.1 transl_table 11 codon_start 1 locus_tag LOCUS_38060 gene cydB CDS complement(7756..9324) product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884372.1 transl_table 11 codon_start 1 locus_tag LOCUS_38070 gene cydA CDS 9555..9749 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38080 CDS complement(10216..11085) product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367669.1 transl_table 11 codon_start 1 locus_tag LOCUS_38090 gene sucD CDS complement(11085..12251) product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367670.1 transl_table 11 codon_start 1 locus_tag LOCUS_38100 gene sucC CDS complement(12392..13612) product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000099858.1 transl_table 11 codon_start 1 locus_tag LOCUS_38110 gene odhB CDS complement(13627..16434) product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023622290.1 transl_table 11 codon_start 1 locus_tag LOCUS_38120 gene sucA CDS complement(16713..17429) product succinate dehydrogenase iron-sulfur subunit SdhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001235263.1 transl_table 11 codon_start 1 locus_tag LOCUS_38130 gene sdhB CDS complement(17445..19154) product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000775540.1 transl_table 11 codon_start 1 locus_tag LOCUS_38140 gene sdhA CDS complement(19211..19558) product succinate dehydrogenase membrane anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000254356.1 transl_table 11 codon_start 1 locus_tag LOCUS_38150 gene sdhD CDS complement(19552..19956) product succinate dehydrogenase cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000263355.1 transl_table 11 codon_start 1 locus_tag LOCUS_38160 gene sdhC CDS 20775..22058 product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097545.1 transl_table 11 codon_start 1 locus_tag LOCUS_38170 CDS 22195..23241 product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001122050.1 transl_table 11 codon_start 1 locus_tag LOCUS_38180 CDS complement(23285..23695) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38190 CDS complement(23625..23954) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38200 CDS complement(23964..24959) product DUF979 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704764.1 transl_table 11 codon_start 1 locus_tag LOCUS_38210 CDS complement(24956..25684) product DUF969 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704763.1 transl_table 11 codon_start 1 locus_tag LOCUS_38220 CDS complement(25759..26493) product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000687142.1 transl_table 11 codon_start 1 locus_tag LOCUS_38230 gene pxpA CDS complement(26483..27415) product 5-oxoprolinase subunit PxpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000912700.1 transl_table 11 codon_start 1 locus_tag LOCUS_38240 gene pxpC CDS complement(27409..28065) product 5-oxoprolinase subunit PxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001188364.1 transl_table 11 codon_start 1 locus_tag LOCUS_38250 gene pxpB CDS complement(28131..28874) product radiation resistance protein YbgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000798871.1 transl_table 11 codon_start 1 locus_tag LOCUS_38260 gene ybgI CDS 29141..30622 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001041123.1 transl_table 11 codon_start 1 locus_tag LOCUS_38270 CDS complement(30675..31616) product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000235943.1 transl_table 11 codon_start 1 locus_tag LOCUS_38280 CDS complement(31807..33225) product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000207142.1 transl_table 11 codon_start 1 locus_tag LOCUS_38290 gene phrB sequence057 source 1..32282 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 395..1285 product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007509.1 transl_table 11 codon_start 1 locus_tag LOCUS_38300 gene metF CDS 1451..3631 product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000108110.1 transl_table 11 codon_start 1 locus_tag LOCUS_38310 gene katG CDS complement(3742..4845) product glycerol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000374033.1 transl_table 11 codon_start 1 locus_tag LOCUS_38320 CDS complement(4858..5520) product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000424865.1 transl_table 11 codon_start 1 locus_tag LOCUS_38330 gene fsa CDS complement(5534..8035) product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001174077.1 transl_table 11 codon_start 1 locus_tag LOCUS_38340 gene ptsP CDS 8343..9422 product PTS fructose transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001004442.1 transl_table 11 codon_start 1 locus_tag LOCUS_38350 CDS 9437..9757 product PTS fructose-like transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000161265.1 transl_table 11 codon_start 1 locus_tag LOCUS_38360 CDS 9929..12226 product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000184828.1 transl_table 11 codon_start 1 locus_tag LOCUS_38370 CDS 12192..13070 product [formate-C-acetyltransferase]-activating enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000204105.1 transl_table 11 codon_start 1 locus_tag LOCUS_38380 CDS 13072..13428 product PTS fructose-like transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323849.1 transl_table 11 codon_start 1 locus_tag LOCUS_38390 CDS complement(13415..13696) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38400 note possible pseudo, internal stop codon CDS complement(13697..14266) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38410 note possible pseudo, internal stop codon CDS complement(14372..16105) product phosphoethanolamine transferase CptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192092.1 transl_table 11 codon_start 1 locus_tag LOCUS_38420 CDS complement(16310..19081) product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001005544.1 transl_table 11 codon_start 1 locus_tag LOCUS_38430 gene ppc CDS complement(19270..20421) product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099301.1 transl_table 11 codon_start 1 locus_tag LOCUS_38440 gene argE CDS 20510..21514 product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000935332.1 transl_table 11 codon_start 1 locus_tag LOCUS_38450 gene argC CDS 21525..22298 product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020686923.1 transl_table 11 codon_start 1 locus_tag LOCUS_38460 gene argB CDS 22439..23812 product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001230079.1 transl_table 11 codon_start 1 locus_tag LOCUS_38470 gene argH CDS 24099..25016 product DNA-binding transcriptional regulator OxyR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001025939.1 transl_table 11 codon_start 1 locus_tag LOCUS_38480 gene oxyR CDS complement(24999..26333) product Si-specific NAD(P)(+) transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001120789.1 transl_table 11 codon_start 1 locus_tag LOCUS_38490 gene sthA CDS 26601..27248 product HTH-type transcriptional repressor FabR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300495.1 transl_table 11 codon_start 1 locus_tag LOCUS_38500 gene fabR CDS 27248..27607 product YijD family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000813838.1 transl_table 11 codon_start 1 locus_tag LOCUS_38510 CDS complement(27865..28965) product tRNA (uridine(54)-C5)-methyltransferase TrmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187022.1 transl_table 11 codon_start 1 locus_tag LOCUS_38520 gene trmA CDS 29339..31177 product TonB-dependent vitamin B12 receptor BtuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815316.1 transl_table 11 codon_start 1 locus_tag LOCUS_38530 gene btuB CDS 31122..31973 product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000201804.1 transl_table 11 codon_start 1 locus_tag LOCUS_38540 gene murI sequence058 source 1..32192 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(285..830) product menaquinone-dependent protoporphyrinogen IX dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853959.1 transl_table 11 codon_start 1 locus_tag LOCUS_38550 gene hemG CDS complement(842..2293) product Trk system potassium transporter TrkH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099227.1 transl_table 11 codon_start 1 locus_tag LOCUS_38560 gene trkH CDS complement(2331..2945) product IMPACT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295262.1 transl_table 11 codon_start 1 locus_tag LOCUS_38570 CDS complement(2945..4276) product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444529.1 transl_table 11 codon_start 1 locus_tag LOCUS_38580 gene pepQ CDS 4464..6653 product fatty acid oxidation complex subunit alpha FadB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000965965.1 transl_table 11 codon_start 1 locus_tag LOCUS_38590 gene fadB CDS 6663..7826 product acetyl-CoA C-acyltransferase FadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000438747.1 transl_table 11 codon_start 1 locus_tag LOCUS_38600 gene fadA CDS complement(8027..8728) product NAD(P)H-flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001306785.1 transl_table 11 codon_start 1 locus_tag LOCUS_38610 gene fre CDS complement(8769..10262) product 4-hydroxy-3-polyprenylbenzoate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000339792.1 transl_table 11 codon_start 1 locus_tag LOCUS_38620 gene ubiD CDS 10442..10930 product transcription/translation regulatory transformer protein RfaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192407.1 transl_table 11 codon_start 1 locus_tag LOCUS_38630 gene rfaH CDS complement(10960..11751) product 3'-5' ssDNA/RNA exonuclease TatD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000459642.1 transl_table 11 codon_start 1 locus_tag LOCUS_38640 gene tatD CDS complement(11793..12578) product Sec-independent protein translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000109942.1 transl_table 11 codon_start 1 locus_tag LOCUS_38650 gene tatC CDS complement(12581..13129) product Sec-independent protein translocase protein TatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000459611.1 transl_table 11 codon_start 1 locus_tag LOCUS_38660 gene tatB CDS complement(13133..13387) product Sec-independent protein translocase subunit TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099238.1 transl_table 11 codon_start 1 locus_tag LOCUS_38670 gene tatA CDS complement(13466..15106) product ubiquinone biosynthesis regulatory protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187530.1 transl_table 11 codon_start 1 locus_tag LOCUS_38680 gene ubiB CDS complement(15103..15708) product ubiquinone biosynthesis protein UbiJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295259.1 transl_table 11 codon_start 1 locus_tag LOCUS_38690 gene ubiJ CDS complement(15721..16476) product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000227958.1 transl_table 11 codon_start 1 locus_tag LOCUS_38700 gene ubiE CDS complement(16571..17998) product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000347717.1 transl_table 11 codon_start 1 locus_tag LOCUS_38710 gene rmuC CDS complement(18138..18899) product uridine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860792.1 transl_table 11 codon_start 1 locus_tag LOCUS_38720 gene udp CDS 19161..19970 product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000562775.1 transl_table 11 codon_start 1 locus_tag LOCUS_38730 CDS complement(20046..22307) product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153917.1 transl_table 11 codon_start 1 locus_tag LOCUS_38740 gene metE CDS 22540..23493 product HTH-type transcriptional regulator MetR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569786.1 transl_table 11 codon_start 1 locus_tag LOCUS_38750 gene metR CDS complement(23381..24301) product biotin transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196238.1 transl_table 11 codon_start 1 locus_tag LOCUS_38760 gene bioP CDS complement(24360..25160) product sugar/pyridoxal phosphate phosphatase YigL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000285338.1 transl_table 11 codon_start 1 locus_tag LOCUS_38770 gene yigL CDS complement(25169..26191) product lysophospholipase L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000487654.1 transl_table 11 codon_start 1 locus_tag LOCUS_38780 gene pldB CDS 26302..26922 product homoserine/homoserine lactone efflux protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099249.1 transl_table 11 codon_start 1 locus_tag LOCUS_38790 gene rhtB CDS complement(27067..27687) product threonine export protein RhtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000928824.1 transl_table 11 codon_start 1 locus_tag LOCUS_38800 gene rhtC CDS complement(27754..29589) product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001533487.1 transl_table 11 codon_start 1 locus_tag LOCUS_38810 gene recQ CDS complement(29660..30529) product phospholipase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001201692.1 transl_table 11 codon_start 1 locus_tag LOCUS_38820 gene pldA CDS 30694..31161 product acyl-CoA thioesterase YigI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001277136.1 transl_table 11 codon_start 1 locus_tag LOCUS_38830 gene yigI CDS 31205..32101 product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099254.1 transl_table 11 codon_start 1 locus_tag LOCUS_38840 gene rarD sequence059 source 1..31919 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(143..532) product Mor transcription activator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001281695.1 transl_table 11 codon_start 1 locus_tag LOCUS_38850 CDS complement(529..954) product regulatory protein GemA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001170114.1 transl_table 11 codon_start 1 locus_tag LOCUS_38860 CDS complement(1152..1847) product DUF2786 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132039.1 transl_table 11 codon_start 1 locus_tag LOCUS_38870 CDS complement(1834..2130) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000197790.1 transl_table 11 codon_start 1 locus_tag LOCUS_38880 CDS complement(2145..2417) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000632580.1 transl_table 11 codon_start 1 locus_tag LOCUS_38890 CDS complement(2414..2602) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38900 CDS complement(2681..3292) product DUF3164 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070973.1 transl_table 11 codon_start 1 locus_tag LOCUS_38910 CDS complement(3310..3579) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38920 CDS complement(3582..4739) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000960673.1 transl_table 11 codon_start 1 locus_tag LOCUS_38930 CDS complement(4750..6519) product DDE-type integrase/transposase/recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000990532.1 transl_table 11 codon_start 1 locus_tag LOCUS_38940 CDS complement(6523..7437) product DUF3102 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000533821.1 transl_table 11 codon_start 1 locus_tag LOCUS_38950 CDS complement(7447..7752) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049025.1 transl_table 11 codon_start 1 locus_tag LOCUS_38960 CDS complement(7749..7973) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38970 CDS 8063..8473 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_217885674.1 transl_table 11 codon_start 1 locus_tag LOCUS_38980 CDS 8515..9042 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38990 CDS complement(9097..9867) product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071010.1 transl_table 11 codon_start 1 locus_tag LOCUS_39000 CDS 10117..10467 product putative holin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000793143.1 transl_table 11 codon_start 1 locus_tag LOCUS_39010 CDS 10467..11204 product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001104439.1 transl_table 11 codon_start 1 locus_tag LOCUS_39020 CDS 11194..11847 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000264661.1 transl_table 11 codon_start 1 locus_tag LOCUS_39030 CDS 11844..12176 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000175097.1 transl_table 11 codon_start 1 locus_tag LOCUS_39040 CDS 12169..12480 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000227700.1 transl_table 11 codon_start 1 locus_tag LOCUS_39050 CDS 12480..13025 product DUF3486 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124060.1 transl_table 11 codon_start 1 locus_tag LOCUS_39060 CDS 13022..14545 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169542415.1 transl_table 11 codon_start 1 locus_tag LOCUS_39070 CDS 14545..16041 product DUF935 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090679.1 transl_table 11 codon_start 1 locus_tag LOCUS_39080 CDS 16022..16843 product phage minor head protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000117548.1 transl_table 11 codon_start 1 locus_tag LOCUS_39090 CDS 16846..17304 product phage virion morphogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135514.1 transl_table 11 codon_start 1 locus_tag LOCUS_39100 CDS 17510..18610 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273072.1 transl_table 11 codon_start 1 locus_tag LOCUS_39110 CDS 18624..19577 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001286905.1 transl_table 11 codon_start 1 locus_tag LOCUS_39120 CDS 19584..19946 product DUF2190 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000537457.1 transl_table 11 codon_start 1 locus_tag LOCUS_39130 CDS 19948..20394 product DUF1320 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000271668.1 transl_table 11 codon_start 1 locus_tag LOCUS_39140 CDS 20394..20858 product Gp37 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001101804.1 transl_table 11 codon_start 1 locus_tag LOCUS_39150 CDS 20858..21109 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000666499.1 transl_table 11 codon_start 1 locus_tag LOCUS_39160 CDS 21099..22526 product phage tail sheath subtilisin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729859.1 transl_table 11 codon_start 1 locus_tag LOCUS_39170 CDS 22526..23047 product phage major tail tube protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000034292.1 transl_table 11 codon_start 1 locus_tag LOCUS_39180 CDS 23050..23343 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39190 CDS 23333..23614 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000110118.1 transl_table 11 codon_start 1 locus_tag LOCUS_39200 CDS 23711..24052 product phage tail assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084228.1 transl_table 11 codon_start 1 locus_tag LOCUS_39210 CDS 24204..26672 product phage tail tape measure protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135574.1 transl_table 11 codon_start 1 locus_tag LOCUS_39220 CDS 26672..27556 product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000458383.1 transl_table 11 codon_start 1 locus_tag LOCUS_39230 CDS 27556..27768 product tail protein X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000478224.1 transl_table 11 codon_start 1 locus_tag LOCUS_39240 CDS 27756..28925 product contractile injection system protein, VgrG/Pvc8 family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808005.1 transl_table 11 codon_start 1 locus_tag LOCUS_39250 CDS 28925..29455 product phage baseplate assembly protein V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000148263.1 transl_table 11 codon_start 1 locus_tag LOCUS_39260 CDS 29511..29858 product GPW/gp25 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000859114.1 transl_table 11 codon_start 1 locus_tag LOCUS_39270 CDS 29849..30952 product baseplate J/gp47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219102.1 transl_table 11 codon_start 1 locus_tag LOCUS_39280 CDS 30945..31523 product phage tail protein I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000852584.1 transl_table 11 codon_start 1 locus_tag LOCUS_39290 sequence060 source 1..31618 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(20..1153) product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000152873.1 transl_table 11 codon_start 1 locus_tag LOCUS_39300 CDS complement(1333..3747) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000561824.1 transl_table 11 codon_start 1 locus_tag LOCUS_39310 CDS complement(3744..4430) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001110598.1 transl_table 11 codon_start 1 locus_tag LOCUS_39320 CDS 4368..5024 product multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297298.1 transl_table 11 codon_start 1 locus_tag LOCUS_39330 gene tesA CDS 5053..5823 product NADP(+)-dependent aldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000148959.1 transl_table 11 codon_start 1 locus_tag LOCUS_39340 gene ybbO CDS 5882..6736 product chaperedoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116065.1 transl_table 11 codon_start 1 locus_tag LOCUS_39350 gene cnoX CDS complement(6811..7590) product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001002130.1 transl_table 11 codon_start 1 locus_tag LOCUS_39360 gene fetB CDS complement(7577..8257) product iron ABC transporter ATP-binding protein FetA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000166987.1 transl_table 11 codon_start 1 locus_tag LOCUS_39370 gene fetA CDS 8398..9312 product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000904497.1 transl_table 11 codon_start 1 locus_tag LOCUS_39380 CDS 9312..9773 product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000561177.1 transl_table 11 codon_start 1 locus_tag LOCUS_39390 CDS complement(9774..10187) product Cu(I)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001026762.1 transl_table 11 codon_start 1 locus_tag LOCUS_39400 gene cueR CDS 10296..12797 product copper-exporting P-type ATPase CopA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000083983.1 transl_table 11 codon_start 1 locus_tag LOCUS_39410 gene copA CDS 12943..13737 product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365154.1 transl_table 11 codon_start 1 locus_tag LOCUS_39420 CDS 13939..14418 product Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase YbaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000186633.1 transl_table 11 codon_start 1 locus_tag LOCUS_39430 gene ybaK CDS complement(14652..16295) product bifunctional UDP-sugar hydrolase/5'-nucleotidase UshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095904.1 transl_table 11 codon_start 1 locus_tag LOCUS_39440 gene ushA CDS 16457..17677 product fosmidomycin MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001251634.1 transl_table 11 codon_start 1 locus_tag LOCUS_39450 gene fsr CDS 17893..19569 product YbaL family putative K(+) efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000546202.1 transl_table 11 codon_start 1 locus_tag LOCUS_39460 gene ybaL CDS complement(19630..20934) product inosine/guanosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000671574.1 transl_table 11 codon_start 1 locus_tag LOCUS_39470 gene gsk CDS 21075..22034 product acetyl esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000801813.1 transl_table 11 codon_start 1 locus_tag LOCUS_39480 gene aes CDS complement(22031..22993) product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001250076.1 transl_table 11 codon_start 1 locus_tag LOCUS_39490 gene hemH CDS complement(23173..23817) product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001220237.1 transl_table 11 codon_start 1 locus_tag LOCUS_39500 gene adk CDS complement(24236..26110) product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001682145.1 transl_table 11 codon_start 1 locus_tag LOCUS_39510 gene htpG CDS complement(26221..26826) product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001195026.1 transl_table 11 codon_start 1 locus_tag LOCUS_39520 gene recR CDS complement(26826..27155) product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000467098.1 transl_table 11 codon_start 1 locus_tag LOCUS_39530 CDS complement(27209..29140) product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000122015.1 transl_table 11 codon_start 1 locus_tag LOCUS_39540 gene dnaX CDS complement(29229..29780) product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000127359.1 transl_table 11 codon_start 1 locus_tag LOCUS_39550 gene apt CDS complement(29985..30380) product DUF454 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095896.1 transl_table 11 codon_start 1 locus_tag LOCUS_39560 CDS complement(30390..30665) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39570 CDS 30624..30959 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39580 CDS 30974..31141 product pleiotropic regulatory protein RsmS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000051161.1 transl_table 11 codon_start 1 locus_tag LOCUS_39590 gene rsmS sequence061 source 1..31185 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 8..364 product DUF4156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000722977.1 transl_table 11 codon_start 1 locus_tag LOCUS_39600 CDS 460..1095 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095717.1 transl_table 11 codon_start 1 locus_tag LOCUS_39610 CDS complement(1162..2592) product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097891.1 transl_table 11 codon_start 1 locus_tag LOCUS_39620 CDS complement(2969..3631) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097894.1 transl_table 11 codon_start 1 locus_tag LOCUS_39630 CDS complement(3667..5283) product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097895.1 transl_table 11 codon_start 1 locus_tag LOCUS_39640 CDS complement(5287..7773) product TcfC E-set like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097896.1 transl_table 11 codon_start 1 locus_tag LOCUS_39650 CDS complement(7837..8514) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097897.1 transl_table 11 codon_start 1 locus_tag LOCUS_39660 CDS complement(8570..9163) product common pilus major fimbrillin subunit EcpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097898.1 transl_table 11 codon_start 1 locus_tag LOCUS_39670 CDS complement(9668..11038) product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063447002.1 transl_table 11 codon_start 1 locus_tag LOCUS_39680 CDS complement(11109..12011) product type 1 fimbria D-mannose specific adhesin FimH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000832236.1 transl_table 11 codon_start 1 locus_tag LOCUS_39690 gene fimH CDS complement(12025..12525) product type 1 fimbria minor subunit FimG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000872432.1 transl_table 11 codon_start 1 locus_tag LOCUS_39700 gene fimG CDS complement(12538..13065) product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170926280.1 transl_table 11 codon_start 1 locus_tag LOCUS_39710 CDS complement(13076..15712) product fimbrial biogenesis usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703360.1 transl_table 11 codon_start 1 locus_tag LOCUS_39720 CDS complement(15786..16490) product type 1 fimbria chaperone FimC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000066560.1 transl_table 11 codon_start 1 locus_tag LOCUS_39730 gene fimC CDS complement(16547..17077) product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020078010.1 transl_table 11 codon_start 1 locus_tag LOCUS_39740 CDS complement(17155..17703) product type 1 fimbrial major subunit FimA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369870.1 transl_table 11 codon_start 1 locus_tag LOCUS_39750 gene fimA CDS complement(18198..18794) product type 1 fimbria switch DNA invertase FimE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703357.1 transl_table 11 codon_start 1 locus_tag LOCUS_39760 gene fimE CDS complement(19261..19866) product tyrosine-type DNA invertase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369873.1 transl_table 11 codon_start 1 locus_tag LOCUS_39770 CDS complement(20814..21437) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704506.1 transl_table 11 codon_start 1 locus_tag LOCUS_39780 CDS 21687..22271 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39790 CDS complement(22309..22791) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001521985.1 transl_table 11 codon_start 1 locus_tag LOCUS_39800 CDS complement(22784..23626) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301664.1 transl_table 11 codon_start 1 locus_tag LOCUS_39810 CDS 24214..24444 product 4Fe-4S mono-cluster protein YjdI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369861.1 transl_table 11 codon_start 1 locus_tag LOCUS_39820 gene yjdI CDS 24456..24728 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098585.1 transl_table 11 codon_start 1 locus_tag LOCUS_39830 CDS complement(24772..25635) product nickel/cobalt efflux protein RcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000134629.1 transl_table 11 codon_start 1 locus_tag LOCUS_39840 gene rcnA CDS 25747..26019 product Ni(II)/Co(II)-binding transcriptional repressor RcnR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019953.1 transl_table 11 codon_start 1 locus_tag LOCUS_39850 gene rcnR CDS complement(26047..26328) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39860 CDS complement(26367..26954) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001305805.1 transl_table 11 codon_start 1 locus_tag LOCUS_39870 CDS complement(27715..28944) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000036836.1 transl_table 11 codon_start 1 locus_tag LOCUS_39880 CDS 29169..30347 product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000656042.1 transl_table 11 codon_start 1 locus_tag LOCUS_39890 sequence062 source 1..30826 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 550..2139 product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095020.1 transl_table 11 codon_start 1 locus_tag LOCUS_39900 gene purH CDS 2151..3440 product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000866828.1 transl_table 11 codon_start 1 locus_tag LOCUS_39910 gene purD CDS complement(3437..4762) product sigma-54-dependent response regulator transcription factor ZraR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000148522.1 transl_table 11 codon_start 1 locus_tag LOCUS_39920 gene zraR CDS complement(4759..6162) product two-component system sensor histidine kinase ZraS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001211892.1 transl_table 11 codon_start 1 locus_tag LOCUS_39930 gene zraS CDS 6418..6855 product zinc resistance sensor/chaperone ZraP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000828133.1 transl_table 11 codon_start 1 locus_tag LOCUS_39940 gene zraP tRNA complement(6962..7038) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00450 CDS complement(7651..7923) product DNA-binding protein HU-alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044509.1 transl_table 11 codon_start 1 locus_tag LOCUS_39950 gene hupA CDS complement(8110..8700) product YjaG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940092.1 transl_table 11 codon_start 1 locus_tag LOCUS_39960 CDS complement(8742..9413) product deoxyribonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000362359.1 transl_table 11 codon_start 1 locus_tag LOCUS_39970 gene nfi CDS complement(9423..10487) product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000137619.1 transl_table 11 codon_start 1 locus_tag LOCUS_39980 gene hemE CDS complement(10528..11301) product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000373940.1 transl_table 11 codon_start 1 locus_tag LOCUS_39990 gene nudC CDS 11398..11886 product sigma D regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000934311.1 transl_table 11 codon_start 1 locus_tag LOCUS_40000 gene rsd CDS 12177..14072 product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001276897.1 transl_table 11 codon_start 1 locus_tag LOCUS_40010 gene thiC CDS 14072..14713 product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000284626.1 transl_table 11 codon_start 1 locus_tag LOCUS_40020 gene thiE CDS 14700..15455 product HesA/MoeB/ThiF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000999774.1 transl_table 11 codon_start 1 locus_tag LOCUS_40030 CDS 15439..15639 product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095009.1 transl_table 11 codon_start 1 locus_tag LOCUS_40040 gene thiS CDS 15641..16411 product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000944065.1 transl_table 11 codon_start 1 locus_tag LOCUS_40050 gene thiG CDS 16408..17541 product 2-iminoacetate synthase ThiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000847432.1 transl_table 11 codon_start 1 locus_tag LOCUS_40060 gene thiH CDS complement(17855..22078) product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000653965.1 transl_table 11 codon_start 1 locus_tag LOCUS_40070 gene rpoC CDS complement(22155..26183) product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000263103.1 transl_table 11 codon_start 1 locus_tag LOCUS_40080 gene rpoB CDS complement(26503..26868) product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000028882.1 transl_table 11 codon_start 1 locus_tag LOCUS_40090 gene rplL CDS complement(26935..27432) product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001207203.1 transl_table 11 codon_start 1 locus_tag LOCUS_40100 gene rplJ CDS complement(27847..28551) product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096684.1 transl_table 11 codon_start 1 locus_tag LOCUS_40110 gene rplA CDS complement(28555..29025) product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085926.1 transl_table 11 codon_start 1 locus_tag LOCUS_40120 gene rplK CDS complement(29261..29806) product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862341.1 transl_table 11 codon_start 1 locus_tag LOCUS_40130 gene nusG CDS complement(29808..30191) product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001275702.1 transl_table 11 codon_start 1 locus_tag LOCUS_40140 gene secE sequence063 source 1..30122 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(20..1873) product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000334086.1 transl_table 11 codon_start 1 locus_tag LOCUS_40150 gene glmS CDS complement(2149..3519) product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000934853.1 transl_table 11 codon_start 1 locus_tag LOCUS_40160 gene glmU CDS complement(3831..4250) product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001251971.1 transl_table 11 codon_start 1 locus_tag LOCUS_40170 CDS complement(4271..5653) product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190499.1 transl_table 11 codon_start 1 locus_tag LOCUS_40180 gene atpD CDS complement(5680..6543) product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369007.1 transl_table 11 codon_start 1 locus_tag LOCUS_40190 gene atpG CDS complement(6594..8135) product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001176745.1 transl_table 11 codon_start 1 locus_tag LOCUS_40200 gene atpA CDS complement(8148..8681) product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001288957.1 transl_table 11 codon_start 1 locus_tag LOCUS_40210 gene atpH CDS complement(8696..9166) product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001052212.1 transl_table 11 codon_start 1 locus_tag LOCUS_40220 gene atpF CDS complement(9226..9465) product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000429386.1 transl_table 11 codon_start 1 locus_tag LOCUS_40230 gene atpE CDS complement(9512..10327) product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135618.1 transl_table 11 codon_start 1 locus_tag LOCUS_40240 gene atpB CDS complement(10336..10716) product F0F1 ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001145371.1 transl_table 11 codon_start 1 locus_tag LOCUS_40250 gene atpI CDS complement(11333..11956) product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000932839.1 transl_table 11 codon_start 1 locus_tag LOCUS_40260 gene rsmG CDS complement(12095..13984) product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000499882.1 transl_table 11 codon_start 1 locus_tag LOCUS_40270 gene mnmG CDS complement(14363..14806) product FMN-binding protein MioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000763722.1 transl_table 11 codon_start 1 locus_tag LOCUS_40280 gene mioC CDS complement(14897..15355) product transcriptional regulator AsnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000433016.1 transl_table 11 codon_start 1 locus_tag LOCUS_40290 gene asnC CDS 15507..16499 product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000845133.1 transl_table 11 codon_start 1 locus_tag LOCUS_40300 gene asnA CDS complement(16505..17956) product ATPase RavA stimulator ViaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000956591.1 transl_table 11 codon_start 1 locus_tag LOCUS_40310 gene viaA CDS complement(17950..19446) product ATPase RavA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940993.1 transl_table 11 codon_start 1 locus_tag LOCUS_40320 gene ravA CDS 19667..21535 product low affinity potassium transporter Kup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000102337.1 transl_table 11 codon_start 1 locus_tag LOCUS_40330 gene kup CDS 21749..22168 product D-ribose pyranase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099397.1 transl_table 11 codon_start 1 locus_tag LOCUS_40340 gene rbsD CDS 22176..23681 product ribose ABC transporter ATP-binding protein RbsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000387770.1 transl_table 11 codon_start 1 locus_tag LOCUS_40350 gene rbsA CDS 23687..24652 product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099395.1 transl_table 11 codon_start 1 locus_tag LOCUS_40360 gene rbsC CDS 24677..25567 product ribose ABC transporter substrate-binding protein RbsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001056273.1 transl_table 11 codon_start 1 locus_tag LOCUS_40370 gene rbsB CDS 25665..26609 product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000354235.1 transl_table 11 codon_start 1 locus_tag LOCUS_40380 gene rbsK CDS 26613..27611 product ribose operon transcriptional repressor RbsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224487.1 transl_table 11 codon_start 1 locus_tag LOCUS_40390 gene rbsR CDS complement(27577..29004) product multidrug transporter subunit MdtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099391.1 transl_table 11 codon_start 1 locus_tag LOCUS_40400 gene mdtD CDS complement(29016..29720) product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001131144.1 transl_table 11 codon_start 1 locus_tag LOCUS_40410 sequence064 source 1..29007 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1729..2664 product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001157407.1 transl_table 11 codon_start 1 locus_tag LOCUS_40420 gene ttcA CDS complement(2705..4003) product ATP-dependent RNA helicase DbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096453.1 transl_table 11 codon_start 1 locus_tag LOCUS_40430 gene dbpA CDS complement(4570..5553) product zinc transporter ZntB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000387372.1 transl_table 11 codon_start 1 locus_tag LOCUS_40440 gene zntB CDS 5807..7012 product diguanylate cyclase DgcM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001307164.1 transl_table 11 codon_start 1 locus_tag LOCUS_40450 gene dgcM CDS complement(7060..7449) product 4-carboxymuconolactone decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705266.1 transl_table 11 codon_start 1 locus_tag LOCUS_40460 gene pcaC CDS complement(7439..8203) product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705265.1 transl_table 11 codon_start 1 locus_tag LOCUS_40470 gene pcaD CDS complement(8181..9545) product 3-carboxy-cis,cis-muconate cycloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705264.1 transl_table 11 codon_start 1 locus_tag LOCUS_40480 CDS complement(9555..10757) product 3-oxoadipyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705263.1 transl_table 11 codon_start 1 locus_tag LOCUS_40490 gene pcaF CDS complement(10767..11423) product 3-oxoacid CoA-transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705262.1 transl_table 11 codon_start 1 locus_tag LOCUS_40500 CDS complement(11434..12123) product 3-oxoacid CoA-transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705261.1 transl_table 11 codon_start 1 locus_tag LOCUS_40510 CDS 12294..13100 product IclR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366809.1 transl_table 11 codon_start 1 locus_tag LOCUS_40520 CDS complement(13097..13660) product DNA endonuclease SmrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046824.1 transl_table 11 codon_start 1 locus_tag LOCUS_40530 gene smrA CDS 13938..14453 product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000945013.1 transl_table 11 codon_start 1 locus_tag LOCUS_40540 gene ogt CDS 14648..15400 product fumarate/nitrate reduction transcriptional regulator Fnr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000611911.1 transl_table 11 codon_start 1 locus_tag LOCUS_40550 gene fnr CDS 15552..16499 product universal stress protein UspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001262143.1 transl_table 11 codon_start 1 locus_tag LOCUS_40560 gene uspE CDS complement(16545..16805) product DUF2534 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000605645.1 transl_table 11 codon_start 1 locus_tag LOCUS_40570 CDS complement(16897..18510) product murein tripeptide ABC transporter substrate-binding protein MppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000683008.1 transl_table 11 codon_start 1 locus_tag LOCUS_40580 gene mppA CDS 18694..19422 product murein tripeptide amidase MpaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000219122.1 transl_table 11 codon_start 1 locus_tag LOCUS_40590 gene mpaA CDS complement(19397..20362) product L-Ala-D/L-Glu epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602338.1 transl_table 11 codon_start 1 locus_tag LOCUS_40600 gene ycjG CDS 20484..20990 product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084375.1 transl_table 11 codon_start 1 locus_tag LOCUS_40610 gene tpx CDS complement(21183..22724) product transcriptional regulator TyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001235493.1 transl_table 11 codon_start 1 locus_tag LOCUS_40620 gene tyrR CDS complement(22873..23934) product YcjF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138717.1 transl_table 11 codon_start 1 locus_tag LOCUS_40630 CDS complement(23931..25334) product YcjX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000825801.1 transl_table 11 codon_start 1 locus_tag LOCUS_40640 CDS complement(25448..25789) product DHCW motif cupin fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064307.1 transl_table 11 codon_start 1 locus_tag LOCUS_40650 CDS complement(26062..26613) product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385417.1 transl_table 11 codon_start 1 locus_tag LOCUS_40660 sequence065 source 1..28769 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(18..989) product lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000448401.1 transl_table 11 codon_start 1 locus_tag LOCUS_40670 gene lpxM CDS complement(1109..2431) product murein DD-endopeptidase MepM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001184045.1 transl_table 11 codon_start 1 locus_tag LOCUS_40680 gene mepM CDS complement(2447..3406) product zinc ABC transporter substrate-binding protein ZnuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625584.1 transl_table 11 codon_start 1 locus_tag LOCUS_40690 gene znuA CDS 3470..4228 product zinc ABC transporter ATP-binding protein ZnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000203015.1 transl_table 11 codon_start 1 locus_tag LOCUS_40700 gene znuC CDS 4221..5009 product zinc ABC transporter permease subunit ZnuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000571518.1 transl_table 11 codon_start 1 locus_tag LOCUS_40710 gene znuB CDS complement(5153..5605) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40720 CDS complement(5772..6782) product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000568508.1 transl_table 11 codon_start 1 locus_tag LOCUS_40730 gene ruvB CDS complement(6791..7402) product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000580323.1 transl_table 11 codon_start 1 locus_tag LOCUS_40740 gene ruvA CDS complement(7482..8003) product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000022509.1 transl_table 11 codon_start 1 locus_tag LOCUS_40750 gene ruvC CDS complement(8038..8781) product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000907234.1 transl_table 11 codon_start 1 locus_tag LOCUS_40760 CDS complement(8809..9252) product dihydroneopterin triphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323632.1 transl_table 11 codon_start 1 locus_tag LOCUS_40770 gene nudB CDS complement(9254..11026) product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096080.1 transl_table 11 codon_start 1 locus_tag LOCUS_40780 gene aspS CDS 11268..11837 product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096079.1 transl_table 11 codon_start 1 locus_tag LOCUS_40790 CDS 11834..12001 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40800 CDS complement(11998..12330) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40810 CDS complement(12216..12545) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40820 note possible pseudo, frameshifted CDS complement(12569..12988) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40830 note possible pseudo, frameshifted CDS 13436..14644 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012906143.1 transl_table 11 codon_start 1 locus_tag LOCUS_40840 CDS 14822..15139 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40850 note possible pseudo, frameshifted CDS 15759..15956 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40860 note possible pseudo, frameshifted CDS 15950..16345 product MAPEG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000252980.1 transl_table 11 codon_start 1 locus_tag LOCUS_40870 CDS 16386..17129 product carboxy-S-adenosyl-L-methionine synthase CmoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019588.1 transl_table 11 codon_start 1 locus_tag LOCUS_40880 gene cmoA CDS 17126..18094 product tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569029.1 transl_table 11 codon_start 1 locus_tag LOCUS_40890 gene cmoB CDS complement(18270..19016) product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001185741.1 transl_table 11 codon_start 1 locus_tag LOCUS_40900 gene cutC CDS complement(19019..19585) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096073.1 transl_table 11 codon_start 1 locus_tag LOCUS_40910 CDS 19823..21556 product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705961.1 transl_table 11 codon_start 1 locus_tag LOCUS_40920 gene argS CDS complement(21741..22880) product glycoside hydrolase family 105 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000989908.1 transl_table 11 codon_start 1 locus_tag LOCUS_40930 CDS complement(22885..24468) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096070.1 transl_table 11 codon_start 1 locus_tag LOCUS_40940 CDS complement(24732..25124) product flagellar protein FlhE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001233619.1 transl_table 11 codon_start 1 locus_tag LOCUS_40950 gene flhe CDS complement(25124..27202) product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000002392.1 transl_table 11 codon_start 1 locus_tag LOCUS_40960 gene flhA CDS complement(27195..28343) product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000797087.1 transl_table 11 codon_start 1 locus_tag LOCUS_40970 gene flhB sequence066 source 1..26853 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(208..564) product addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000127482.1 transl_table 11 codon_start 1 locus_tag LOCUS_40980 CDS complement(582..863) product type II toxin-antitoxin system mRNA interferase RelE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323025.1 transl_table 11 codon_start 1 locus_tag LOCUS_40990 gene relE CDS complement(853..1104) product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000213183.1 transl_table 11 codon_start 1 locus_tag LOCUS_41000 CDS 2469..3476 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41010 CDS 3542..3946 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41020 CDS 4082..4609 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41030 CDS complement(4672..4893) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41040 CDS complement(5181..5432) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000905710.1 transl_table 11 codon_start 1 locus_tag LOCUS_41050 CDS complement(5469..5771) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001062963.1 transl_table 11 codon_start 1 locus_tag LOCUS_41060 CDS complement(5937..6596) product division plane positioning ATPase MipZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000516230.1 transl_table 11 codon_start 1 locus_tag LOCUS_41070 CDS complement(6701..7525) product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012908952.1 transl_table 11 codon_start 1 locus_tag LOCUS_41080 CDS 7871..8350 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41090 CDS complement(8425..8619) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41100 CDS 8789..9580 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41110 CDS complement(9884..10540) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001478769.1 transl_table 11 codon_start 1 locus_tag LOCUS_41120 CDS complement(10644..11108) product H-NS family nucleoid-associated regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001293140.1 transl_table 11 codon_start 1 locus_tag LOCUS_41130 CDS complement(11327..13480) product type IA DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001235749.1 transl_table 11 codon_start 1 locus_tag LOCUS_41140 CDS complement(13485..14060) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41150 CDS complement(14071..14400) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41160 CDS complement(14421..15173) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41170 CDS complement(15191..15439) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41180 CDS complement(15452..15964) product thermonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001218000.1 transl_table 11 codon_start 1 locus_tag LOCUS_41190 CDS complement(15961..16395) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000981209.1 transl_table 11 codon_start 1 locus_tag LOCUS_41200 CDS complement(16467..16718) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41210 CDS complement(16814..17041) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41220 CDS complement(17070..18485) product YadA-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869132.1 transl_table 11 codon_start 1 locus_tag LOCUS_41230 CDS complement(18586..18891) product TrbM/KikA/MpfK family conjugal transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000820911.1 transl_table 11 codon_start 1 locus_tag LOCUS_41240 CDS complement(18875..19294) product cag pathogenicity island Cag12 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000722607.1 transl_table 11 codon_start 1 locus_tag LOCUS_41250 CDS complement(19306..21168) product type IV secretory system conjugative DNA transfer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032309849.1 transl_table 11 codon_start 1 locus_tag LOCUS_41260 CDS complement(21155..22183) product P-type DNA transfer ATPase VirB11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125557.1 transl_table 11 codon_start 1 locus_tag LOCUS_41270 gene virB11 CDS complement(22185..23303) product VirB10/TraB/TrbI family type IV secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039326147.1 transl_table 11 codon_start 1 locus_tag LOCUS_41280 gene virB10 CDS complement(23296..24201) product P-type conjugative transfer protein VirB9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976329.1 transl_table 11 codon_start 1 locus_tag LOCUS_41290 gene virB9 CDS complement(24201..24887) product type IV secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001005327.1 transl_table 11 codon_start 1 locus_tag LOCUS_41300 CDS complement(25402..26481) product type IV secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000513454.1 transl_table 11 codon_start 1 locus_tag LOCUS_41310 CDS complement(26492..26818) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41320 sequence067 source 1..26689 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(146..1150) product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000368546.1 transl_table 11 codon_start 1 locus_tag LOCUS_41330 CDS complement(1214..1684) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41340 note possible pseudo, internal stop codon CDS complement(1799..2131) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41350 note possible pseudo, internal stop codon CDS 2197..2658 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000574091.1 transl_table 11 codon_start 1 locus_tag LOCUS_41360 CDS 2713..3018 product stress response protein ElaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001242981.1 transl_table 11 codon_start 1 locus_tag LOCUS_41370 gene elaB CDS 3116..4414 product isochorismate synthase MenF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000555672.1 transl_table 11 codon_start 1 locus_tag LOCUS_41380 gene menF CDS 4499..6169 product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116387.1 transl_table 11 codon_start 1 locus_tag LOCUS_41390 gene menD CDS 6166..6924 product 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000979148.1 transl_table 11 codon_start 1 locus_tag LOCUS_41400 gene menH CDS 6939..7796 product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000640013.1 transl_table 11 codon_start 1 locus_tag LOCUS_41410 gene menB CDS 7796..8758 product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001255562.1 transl_table 11 codon_start 1 locus_tag LOCUS_41420 gene menC CDS 8755..10125 product o-succinylbenzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000577547.1 transl_table 11 codon_start 1 locus_tag LOCUS_41430 gene menE CDS 10366..11022 product lipopolysaccharide core heptose(II)-phosphate phosphatase PmrG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000879245.1 transl_table 11 codon_start 1 locus_tag LOCUS_41440 gene pmrG CDS complement(11049..11474) product nucleoside triphosphatase NudI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001303598.1 transl_table 11 codon_start 1 locus_tag LOCUS_41450 gene nudI CDS 11786..12328 product YfaZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001574701.1 transl_table 11 codon_start 1 locus_tag LOCUS_41460 note possible pseudo, frameshifted CDS 12435..13631 product nicotinamide mononucleotide deamidase-related protein YfaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000921621.1 transl_table 11 codon_start 1 locus_tag LOCUS_41470 CDS 13932..14714 product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000894172.1 transl_table 11 codon_start 1 locus_tag LOCUS_41480 CDS 14727..15932 product L-rhamnonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000427822.1 transl_table 11 codon_start 1 locus_tag LOCUS_41490 gene rhmD CDS 15987..17276 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000028931.1 transl_table 11 codon_start 1 locus_tag LOCUS_41500 CDS 17302..18105 product 2-keto-3-deoxy-L-rhamnonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000992948.1 transl_table 11 codon_start 1 locus_tag LOCUS_41510 gene yfaU CDS complement(18155..19105) product ISNCY family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140529.1 transl_table 11 codon_start 1 locus_tag LOCUS_41520 CDS complement(19323..20513) product anaerobic glycerol-3-phosphate dehydrogenase subunit GlpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001285727.1 transl_table 11 codon_start 1 locus_tag LOCUS_41530 gene glpC CDS complement(20510..21769) product glycerol-3-phosphate dehydrogenase subunit GlpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000667159.1 transl_table 11 codon_start 1 locus_tag LOCUS_41540 gene glpB CDS complement(21759..23387) product anaerobic glycerol-3-phosphate dehydrogenase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857213.1 transl_table 11 codon_start 1 locus_tag LOCUS_41550 gene glpA CDS 23662..25020 product glycerol-3-phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000948703.1 transl_table 11 codon_start 1 locus_tag LOCUS_41560 gene glpT CDS 25025..26101 product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000858949.1 transl_table 11 codon_start 1 locus_tag LOCUS_41570 gene glpQ sequence068 source 1..25578 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(576..1049) product protein CreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000875811.1 transl_table 11 codon_start 1 locus_tag LOCUS_41580 gene creA CDS 1261..2130 product MDR efflux pump AcrAB transcriptional activator RobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000371679.1 transl_table 11 codon_start 1 locus_tag LOCUS_41590 gene robA CDS complement(2127..2774) product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase GpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000942344.1 transl_table 11 codon_start 1 locus_tag LOCUS_41600 gene gpmB CDS 2845..3357 product inosine/xanthosine triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001341279.1 transl_table 11 codon_start 1 locus_tag LOCUS_41610 gene yjjX CDS complement(3420..3746) product trp operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095502.1 transl_table 11 codon_start 1 locus_tag LOCUS_41620 gene trpR CDS complement(3803..5740) product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000409451.1 transl_table 11 codon_start 1 locus_tag LOCUS_41630 gene sltY CDS 6056..7723 product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000046749.1 transl_table 11 codon_start 1 locus_tag LOCUS_41640 gene ettA CDS complement(7855..8598) product oxidative stress defense protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000669854.1 transl_table 11 codon_start 1 locus_tag LOCUS_41650 CDS complement(8691..9326) product arginine exporter ArgO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098632.1 transl_table 11 codon_start 1 locus_tag LOCUS_41660 gene argO CDS complement(9516..10376) product small-conductance mechanosensitive channel MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000389833.1 transl_table 11 codon_start 1 locus_tag LOCUS_41670 CDS complement(10499..11437) product HTH-type transcriptional activator AllS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460148.1 transl_table 11 codon_start 1 locus_tag LOCUS_41680 gene allS CDS complement(11394..12221) product DUF2877 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000152513.1 transl_table 11 codon_start 1 locus_tag LOCUS_41690 CDS complement(12282..13544) product DUF1116 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000495330.1 transl_table 11 codon_start 1 locus_tag LOCUS_41700 CDS complement(13561..15222) product acyl-CoA synthetase FdrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000580880.1 transl_table 11 codon_start 1 locus_tag LOCUS_41710 CDS complement(15235..16458) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355251.1 transl_table 11 codon_start 1 locus_tag LOCUS_41720 CDS 16763..17668 product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000855388.1 transl_table 11 codon_start 1 locus_tag LOCUS_41730 CDS complement(17776..18855) product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000034386.1 transl_table 11 codon_start 1 locus_tag LOCUS_41740 gene fbaA CDS complement(18952..20115) product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000111274.1 transl_table 11 codon_start 1 locus_tag LOCUS_41750 gene pgk CDS complement(20167..20415) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41760 note possible pseudo, frameshifted CDS complement(20366..21187) product erythrose-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000218338.1 transl_table 11 codon_start 1 locus_tag LOCUS_41770 gene epd note possible pseudo, internal stop codon, frameshifted misc_feature complement(21522..>25578) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_126621964.1:hemagglutinin repeat-containing protein locus_tag LOCUS_41780 sequence069 source 1..25523 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(41..1267) product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000359446.1 transl_table 11 codon_start 1 locus_tag LOCUS_41790 gene pepT CDS 1496..2632 product spermidine/putrescine ABC transporter ATP-binding protein PotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000531581.1 transl_table 11 codon_start 1 locus_tag LOCUS_41800 gene potA CDS 2616..3479 product spermidine/putrescine ABC transporter permease PotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799385.1 transl_table 11 codon_start 1 locus_tag LOCUS_41810 gene potB CDS 3842..5203 product type III secretion system effector EspK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000938118.1 transl_table 11 codon_start 1 locus_tag LOCUS_41820 gene espK CDS complement(5583..5798) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41830 note possible pseudo, internal stop codon CDS complement(5802..6920) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41840 note possible pseudo, internal stop codon, frameshifted CDS complement(6887..7423) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41850 note possible pseudo, frameshifted CDS complement(7434..8981) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41860 note possible pseudo, frameshifted CDS complement(9573..11921) product type III secretion system effector E3 ubiquitin ligase NleL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301673.1 transl_table 11 codon_start 1 locus_tag LOCUS_41870 gene nleL CDS complement(12148..12456) product phage tail fiber C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001023396.1 transl_table 11 codon_start 1 locus_tag LOCUS_41880 CDS complement(12419..12988) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41890 note possible pseudo, frameshifted CDS complement(13021..13542) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41900 note possible pseudo, internal stop codon, frameshifted CDS 14013..14804 product spermidine/putrescine ABC transporter permease PotC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000580303.1 transl_table 11 codon_start 1 locus_tag LOCUS_41910 gene potC CDS 14856..15902 product spermidine/putrescine ABC transporter substrate-binding protein PotD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000759329.1 transl_table 11 codon_start 1 locus_tag LOCUS_41920 gene potD CDS 16156..17094 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105356.1 transl_table 11 codon_start 1 locus_tag LOCUS_41930 CDS complement(17091..18158) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206772.1 transl_table 11 codon_start 1 locus_tag LOCUS_41940 CDS 18381..19949 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106694.1 transl_table 11 codon_start 1 locus_tag LOCUS_41950 CDS 19946..20689 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112653.1 transl_table 11 codon_start 1 locus_tag LOCUS_41960 CDS 20711..22510 product aryl-sulfate sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810317.1 transl_table 11 codon_start 1 locus_tag LOCUS_41970 sequence070 source 1..25113 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 166..615 product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004655.1 transl_table 11 codon_start 1 locus_tag LOCUS_41980 gene fkpB CDS 617..1567 product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001166426.1 transl_table 11 codon_start 1 locus_tag LOCUS_41990 gene ispH CDS 1808..2590 product glucose-6-phosphate isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020865.1 transl_table 11 codon_start 1 locus_tag LOCUS_42000 CDS complement(2642..3460) product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706181.1 transl_table 11 codon_start 1 locus_tag LOCUS_42010 CDS complement(3460..4263) product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706182.1 transl_table 11 codon_start 1 locus_tag LOCUS_42020 CDS complement(4274..4768) product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706183.1 transl_table 11 codon_start 1 locus_tag LOCUS_42030 CDS complement(4780..5208) product PTS fructose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706184.1 transl_table 11 codon_start 1 locus_tag LOCUS_42040 CDS complement(5213..6958) product class I mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706185.1 transl_table 11 codon_start 1 locus_tag LOCUS_42050 CDS 7144..8151 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819931.1 transl_table 11 codon_start 1 locus_tag LOCUS_42060 CDS 8285..9106 product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000543582.1 transl_table 11 codon_start 1 locus_tag LOCUS_42070 gene dapB CDS 9560..10708 product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704367.1 transl_table 11 codon_start 1 locus_tag LOCUS_42080 gene carA CDS 10727..13951 product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001126321.1 transl_table 11 codon_start 1 locus_tag LOCUS_42090 gene carB CDS 14198..14587 product carnitine metabolism transcriptional regulator CaiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000333324.1 transl_table 11 codon_start 1 locus_tag LOCUS_42100 gene caiF CDS complement(14814..15599) product crotonobetainyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004377.1 transl_table 11 codon_start 1 locus_tag LOCUS_42110 gene caiD CDS complement(15652..17205) product crotonobetaine/carnitine-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301863.1 transl_table 11 codon_start 1 locus_tag LOCUS_42120 gene caiC CDS complement(17262..18479) product L-carnitine CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001016209.1 transl_table 11 codon_start 1 locus_tag LOCUS_42130 gene caiB CDS complement(18583..19725) product crotonobetainyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000347135.1 transl_table 11 codon_start 1 locus_tag LOCUS_42140 gene caiA CDS complement(19759..21276) product L-carnitine/gamma-butyrobetaine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000787109.1 transl_table 11 codon_start 1 locus_tag LOCUS_42150 gene caiT CDS 21733..22506 product electron transfer flavoprotein FixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001331240.1 transl_table 11 codon_start 1 locus_tag LOCUS_42160 CDS 22518..23459 product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001032189.1 transl_table 11 codon_start 1 locus_tag LOCUS_42170 CDS 23481..24767 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287774.1 transl_table 11 codon_start 1 locus_tag LOCUS_42180 CDS 24764..25051 product ferredoxin-like protein FixX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000203741.1 transl_table 11 codon_start 1 locus_tag LOCUS_42190 gene fixX sequence071 source 1..25025 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 137..2413 product sensor domain-containing phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001112949.1 transl_table 11 codon_start 1 locus_tag LOCUS_42200 CDS complement(2480..3682) product nucleoside permease NupC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000376337.1 transl_table 11 codon_start 1 locus_tag LOCUS_42210 gene nupC CDS 4089..5264 product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000186369.1 transl_table 11 codon_start 1 locus_tag LOCUS_42220 CDS complement(5319..5651) product DUF2502 domain-containing protein YpeC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000490091.1 transl_table 11 codon_start 1 locus_tag LOCUS_42230 gene ypeC CDS complement(5779..6777) product L-glyceraldehyde 3-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000640297.1 transl_table 11 codon_start 1 locus_tag LOCUS_42240 gene mgrA CDS 6960..8615 product alpha-keto acid decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001180878.1 transl_table 11 codon_start 1 locus_tag LOCUS_42250 CDS complement(8616..9851) product ion channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000468932.1 transl_table 11 codon_start 1 locus_tag LOCUS_42260 CDS 10057..11022 product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000170343.1 transl_table 11 codon_start 1 locus_tag LOCUS_42270 gene glk CDS 11232..11558 product PTS fructose transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000038456.1 transl_table 11 codon_start 1 locus_tag LOCUS_42280 CDS 11579..12826 product PTS fructose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000985322.1 transl_table 11 codon_start 1 locus_tag LOCUS_42290 CDS 12843..13925 product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000173288.1 transl_table 11 codon_start 1 locus_tag LOCUS_42300 gene ypdF CDS 13925..14965 product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000366033.1 transl_table 11 codon_start 1 locus_tag LOCUS_42310 gene ypdE CDS 14989..17484 product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000955825.1 transl_table 11 codon_start 1 locus_tag LOCUS_42320 gene ptsP CDS complement(17609..18166) product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815863.1 transl_table 11 codon_start 1 locus_tag LOCUS_42330 CDS 18434..18973 product DUF2058 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096724.1 transl_table 11 codon_start 1 locus_tag LOCUS_42340 CDS 19053..19535 product cold shock domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705072.1 transl_table 11 codon_start 1 locus_tag LOCUS_42350 CDS complement(19544..20398) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000646835.1 transl_table 11 codon_start 1 locus_tag LOCUS_42360 CDS complement(20409..21143) product two-component system response regulator YpdB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295458.1 transl_table 11 codon_start 1 locus_tag LOCUS_42370 gene ypdB CDS complement(21158..22852) product two-component system sensor histidine kinase YpdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000544379.1 transl_table 11 codon_start 1 locus_tag LOCUS_42380 gene ypdA CDS 23240..24511 product alanine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000785931.1 transl_table 11 codon_start 1 locus_tag LOCUS_42390 gene alaC sequence072 source 1..24857 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 322..693 product type III secretion system LEE master regulator Ler inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001055728.1 transl_table 11 codon_start 1 locus_tag LOCUS_42400 gene ler CDS 708..926 product YscE family type III secretion system co-chaperone EscE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000628731.1 transl_table 11 codon_start 1 locus_tag LOCUS_42410 gene escE CDS 932..1246 product type III secretion system LEE chaperone CesAB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000029559.1 transl_table 11 codon_start 1 locus_tag LOCUS_42420 gene cesAB CDS 1243..1842 product type III secretion system domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000151812.1 transl_table 11 codon_start 1 locus_tag LOCUS_42430 CDS 1829..2485 product type III secretion system LEE stator protein EspL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780681.1 transl_table 11 codon_start 1 locus_tag LOCUS_42440 gene espL CDS 2490..3143 product type III secretion system LEE export apparatus protein EscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299599.1 transl_table 11 codon_start 1 locus_tag LOCUS_42450 gene escR CDS 3143..3412 product type III secretion system LEE export apparatus protein EscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000379425.1 transl_table 11 codon_start 1 locus_tag LOCUS_42460 gene escS CDS complement(3360..3563) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42470 CDS complement(3609..3821) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42480 CDS 4181..5218 product type III secretion system LEE export apparatus switch protein EscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291694.1 transl_table 11 codon_start 1 locus_tag LOCUS_42490 gene escU CDS complement(5215..5676) product type III secretion system LEE muramidase EtgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000720639.1 transl_table 11 codon_start 1 locus_tag LOCUS_42500 gene etgA CDS 5868..6206 product type III secretion system LEE GrlA-binding negative regulator GrlR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000605370.1 transl_table 11 codon_start 1 locus_tag LOCUS_42510 gene grlR CDS 6274..6681 product type III secretion system LEE transcriptional regulator GrlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444180.1 transl_table 11 codon_start 1 locus_tag LOCUS_42520 gene grlA CDS 7090..7404 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42530 note possible pseudo, internal stop codon, frameshifted CDS 7463..7714 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42540 note possible pseudo, internal stop codon, frameshifted CDS complement(8145..8600) product SycD/LcrH family type III secretion system chaperone CesD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000087467.1 transl_table 11 codon_start 1 locus_tag LOCUS_42550 gene cesD CDS complement(8614..10152) product type III secretion system LEE outer membrane ring protein EscC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000723942.1 transl_table 11 codon_start 1 locus_tag LOCUS_42560 gene escC CDS complement(10152..10607) product type III secretion system LEE switch protein SepD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001063681.1 transl_table 11 codon_start 1 locus_tag LOCUS_42570 gene sepD CDS complement(10613..11185) product type III secretion system LEE inner membrane ring protein EscJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000716189.1 transl_table 11 codon_start 1 locus_tag LOCUS_42580 gene escJ CDS complement(11188..11556) product type III secretion system inner rod subunit SctI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001302733.1 transl_table 11 codon_start 1 locus_tag LOCUS_42590 gene sctI CDS complement(11648..11950) product type III secretion system LEE cytoprotective effector EspZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000386949.1 transl_table 11 codon_start 1 locus_tag LOCUS_42600 gene espZ CDS 12137..12490 product type III secretion system LEE chaperone CesL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001050992.1 transl_table 11 codon_start 1 locus_tag LOCUS_42610 gene cesL CDS 12487..14514 product type III secretion system LEE export apparatus protein EscV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001037814.1 transl_table 11 codon_start 1 locus_tag LOCUS_42620 gene escV CDS 14498..15838 product type III secretion system LEE ATPase EscN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000622545.1 transl_table 11 codon_start 1 locus_tag LOCUS_42630 gene escN CDS 15898..16218 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001062956.1 transl_table 11 codon_start 1 locus_tag LOCUS_42640 CDS 16211..16627 product type III secretion system LEE needle length regulator EscP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001303723.1 transl_table 11 codon_start 1 locus_tag LOCUS_42650 gene escP CDS 16590..17507 product type III secretion system LEE ring protein EscQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000803687.1 transl_table 11 codon_start 1 locus_tag LOCUS_42660 gene escQ CDS 17537..18052 product type III secretion system LEE effector EspH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001302249.1 transl_table 11 codon_start 1 locus_tag LOCUS_42670 gene espH CDS complement(18156..18518) product type III secretion system LEE chaperone CesF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001003065.1 transl_table 11 codon_start 1 locus_tag LOCUS_42680 gene cesF CDS 18787..19398 product type III secretion system LEE effector Map (Rho guanine exchange factor) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000492638.1 transl_table 11 codon_start 1 locus_tag LOCUS_42690 gene map CDS 19740..21383 product type III secretion system LEE translocated intimin receptor Tir inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301454.1 transl_table 11 codon_start 1 locus_tag LOCUS_42700 gene tir CDS 21504..21974 product type III secretion system LEE chaperone CesT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098793.1 transl_table 11 codon_start 1 locus_tag LOCUS_42710 gene cesT CDS 22035..24845 product intimin type gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000627885.1 transl_table 11 codon_start 1 locus_tag LOCUS_42720 gene eae sequence073 source 1..23971 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(30..569) product Ail/Lom family outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000830239.1 transl_table 11 codon_start 1 locus_tag LOCUS_42730 CDS complement(806..1294) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545416.1 transl_table 11 codon_start 1 locus_tag LOCUS_42740 CDS complement(1267..2007) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000081360.1 transl_table 11 codon_start 1 locus_tag LOCUS_42750 CDS complement(2023..3540) product cyclic diguanylate phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868284.1 transl_table 11 codon_start 1 locus_tag LOCUS_42760 CDS complement(3745..4095) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42770 CDS complement(4224..4973) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001005856.1 transl_table 11 codon_start 1 locus_tag LOCUS_42780 CDS 5443..5655 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42790 note possible pseudo, internal stop codon CDS 5686..5979 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42800 note possible pseudo, internal stop codon CDS 6037..6798 product fimbrial biogenesis chaperone StbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000781490.1 transl_table 11 codon_start 1 locus_tag LOCUS_42810 gene stbB CDS 6779..9337 product fimbrial outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000075318.1 transl_table 11 codon_start 1 locus_tag LOCUS_42820 CDS 9341..20857 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42830 CDS 20832..21119 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42840 CDS complement(21108..21284) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42850 note possible pseudo, frameshifted CDS 21479..21814 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42860 CDS 22080..22835 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704130.1 transl_table 11 codon_start 1 locus_tag LOCUS_42870 CDS 22840..23214 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704129.1 transl_table 11 codon_start 1 locus_tag LOCUS_42880 sequence074 source 1..23775 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..839 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000345437.1:sulfite exporter TauE/SafE family protein locus_tag LOCUS_42890 CDS 936..2972 product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001087028.1 transl_table 11 codon_start 1 locus_tag LOCUS_42900 CDS 3019..4404 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084241.1 transl_table 11 codon_start 1 locus_tag LOCUS_42910 CDS 4414..5874 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001279692.1 transl_table 11 codon_start 1 locus_tag LOCUS_42920 CDS complement(5990..7813) product ribosome-dependent GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099375.1 transl_table 11 codon_start 1 locus_tag LOCUS_42930 gene typA CDS 8190..9599 product glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001271717.1 transl_table 11 codon_start 1 locus_tag LOCUS_42940 gene glnA CDS 9918..10967 product nitrogen regulation protein NR(II) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190577.1 transl_table 11 codon_start 1 locus_tag LOCUS_42950 gene glnL CDS 10978..12387 product nitrogen regulation protein NR(I) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001334023.1 transl_table 11 codon_start 1 locus_tag LOCUS_42960 gene glnG CDS complement(12689..14062) product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116090.1 transl_table 11 codon_start 1 locus_tag LOCUS_42970 gene hemN CDS complement(14250..14759) product Der GTPase-activating protein YihI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005015593.1 transl_table 11 codon_start 1 locus_tag LOCUS_42980 gene yihI CDS 15338..15970 product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000183327.1 transl_table 11 codon_start 1 locus_tag LOCUS_42990 gene yihA CDS complement(16291..19077) product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000249956.1 transl_table 11 codon_start 1 locus_tag LOCUS_43000 gene polA CDS 19498..20376 product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099384.1 transl_table 11 codon_start 1 locus_tag LOCUS_43010 CDS complement(20388..21011) product thiol:disulfide interchange protein DsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000725369.1 transl_table 11 codon_start 1 locus_tag LOCUS_43020 gene dsbA CDS complement(21026..22012) product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000999265.1 transl_table 11 codon_start 1 locus_tag LOCUS_43030 CDS complement(22089..22358) product YihD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295263.1 transl_table 11 codon_start 1 locus_tag LOCUS_43040 CDS 22428..23012 product molybdenum cofactor guanylyltransferase MobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001052181.1 transl_table 11 codon_start 1 locus_tag LOCUS_43050 gene mobA CDS 22994..23518 product molybdopterin-guanine dinucleotide biosynthesis protein MobB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989262.1 transl_table 11 codon_start 1 locus_tag LOCUS_43060 gene mobB sequence075 source 1..22939 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(21..1322) product inorganic triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000046314.1 transl_table 11 codon_start 1 locus_tag LOCUS_43070 gene ygiF CDS 1563..2177 product TIGR04211 family SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001125344.1 transl_table 11 codon_start 1 locus_tag LOCUS_43080 CDS 2243..3475 product fused tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/phosphatase Cca inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000708487.1 transl_table 11 codon_start 1 locus_tag LOCUS_43090 gene cca CDS complement(3598..5169) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43100 CDS complement(5452..6273) product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001281933.1 transl_table 11 codon_start 1 locus_tag LOCUS_43110 gene bacA CDS complement(6373..6738) product bifunctional dihydroneopterin aldolase/7,8-dihydroneopterin epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001540933.1 transl_table 11 codon_start 1 locus_tag LOCUS_43120 gene folB CDS 6845..7462 product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272784.1 transl_table 11 codon_start 1 locus_tag LOCUS_43130 gene plsY CDS complement(7508..8473) product DNA-binding transcriptional activator TtdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000935202.1 transl_table 11 codon_start 1 locus_tag LOCUS_43140 gene ttdR CDS 8654..9565 product L(+)-tartrate dehydratase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000986803.1 transl_table 11 codon_start 1 locus_tag LOCUS_43150 gene ttdA CDS 9562..10167 product L(+)-tartrate dehydratase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000722957.1 transl_table 11 codon_start 1 locus_tag LOCUS_43160 gene ttdB CDS 10216..11679 product L-tartrate/succinate antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000804928.1 transl_table 11 codon_start 1 locus_tag LOCUS_43170 gene ttdT CDS 11766..12629 product urease accessory protein UreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098766.1 transl_table 11 codon_start 1 locus_tag LOCUS_43180 CDS 12640..12942 product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000424145.1 transl_table 11 codon_start 1 locus_tag LOCUS_43190 CDS 12952..13272 product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098767.1 transl_table 11 codon_start 1 locus_tag LOCUS_43200 CDS 13265..14968 product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098768.1 transl_table 11 codon_start 1 locus_tag LOCUS_43210 gene ureC CDS 14978..15436 product urease accessory protein UreE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098769.1 transl_table 11 codon_start 1 locus_tag LOCUS_43220 gene ureE CDS 15436..16110 product urease accessory protein UreF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098771.1 transl_table 11 codon_start 1 locus_tag LOCUS_43230 CDS 16120..16737 product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098772.1 transl_table 11 codon_start 1 locus_tag LOCUS_43240 gene ureG CDS complement(16777..17790) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264365.1 transl_table 11 codon_start 1 locus_tag LOCUS_43250 gene tsaD CDS 18019..18234 product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001144069.1 transl_table 11 codon_start 1 locus_tag LOCUS_43260 gene rpsU CDS 18348..20096 product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703524.1 transl_table 11 codon_start 1 locus_tag LOCUS_43270 gene dnaG CDS 20247..22091 product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098777.1 transl_table 11 codon_start 1 locus_tag LOCUS_43280 gene rpoD CDS complement(22196..22702) product G/U mismatch-specific DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228937.1 transl_table 11 codon_start 1 locus_tag LOCUS_43290 gene mug tRNA 22828..22903 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00460 sequence076 source 1..22429 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 57..479 product Mor transcription activator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000852377.1 transl_table 11 codon_start 1 locus_tag LOCUS_43300 CDS 551..1051 product lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001125304.1 transl_table 11 codon_start 1 locus_tag LOCUS_43310 CDS 1164..1514 product exotoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816483.1 transl_table 11 codon_start 1 locus_tag LOCUS_43320 CDS 1444..1716 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43330 CDS 1727..1954 product TraR/DksA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000342746.1 transl_table 11 codon_start 1 locus_tag LOCUS_43340 CDS 1935..2246 product DUF2730 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000270159.1 transl_table 11 codon_start 1 locus_tag LOCUS_43350 CDS 2239..2529 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001279084.1 transl_table 11 codon_start 1 locus_tag LOCUS_43360 CDS 2532..3113 product DUF3486 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000360581.1 transl_table 11 codon_start 1 locus_tag LOCUS_43370 CDS 3113..4777 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001057672.1 transl_table 11 codon_start 1 locus_tag LOCUS_43380 CDS 4768..6366 product DUF935 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000532593.1 transl_table 11 codon_start 1 locus_tag LOCUS_43390 CDS 6350..7681 product phage head morphogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000046893.1 transl_table 11 codon_start 1 locus_tag LOCUS_43400 CDS 7803..8276 product phage virion morphogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000094804.1 transl_table 11 codon_start 1 locus_tag LOCUS_43410 CDS 8453..9577 product phage protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000850811.1 transl_table 11 codon_start 1 locus_tag LOCUS_43420 CDS 9577..10524 product Mu-like prophage major head subunit gpT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001142982.1 transl_table 11 codon_start 1 locus_tag LOCUS_43430 CDS 10568..10987 product HI1506-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001002057.1 transl_table 11 codon_start 1 locus_tag LOCUS_43440 CDS 10984..11403 product gp436 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001104956.1 transl_table 11 codon_start 1 locus_tag LOCUS_43450 CDS 11400..11963 product DUF1834 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000627431.1 transl_table 11 codon_start 1 locus_tag LOCUS_43460 CDS 11967..12245 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43470 CDS 12245..13726 product phage tail sheath subtilisin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000606747.1 transl_table 11 codon_start 1 locus_tag LOCUS_43480 CDS 13735..14100 product phage tail tube protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000015473.1 transl_table 11 codon_start 1 locus_tag LOCUS_43490 CDS 14115..14594 product phage tail assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000213225.1 transl_table 11 codon_start 1 locus_tag LOCUS_43500 CDS 14572..14718 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43510 CDS 14722..16779 product tape measure protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000113525.1 transl_table 11 codon_start 1 locus_tag LOCUS_43520 CDS 16766..18124 product DNA circularization N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000146116.1 transl_table 11 codon_start 1 locus_tag LOCUS_43530 CDS 18108..19235 product tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098807.1 transl_table 11 codon_start 1 locus_tag LOCUS_43540 CDS 19228..19839 product phage baseplate assembly protein V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000980532.1 transl_table 11 codon_start 1 locus_tag LOCUS_43550 CDS 19832..20269 product phage GP46 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000763330.1 transl_table 11 codon_start 1 locus_tag LOCUS_43560 CDS 20269..21351 product baseplate J/gp47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001146835.1 transl_table 11 codon_start 1 locus_tag LOCUS_43570 CDS 21342..21902 product YmfQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000301577.1 transl_table 11 codon_start 1 locus_tag LOCUS_43580 sequence077 source 1..22144 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 588..1988 product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000393706.1 transl_table 11 codon_start 1 locus_tag LOCUS_43590 CDS 1988..2998 product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000151052.1 transl_table 11 codon_start 1 locus_tag LOCUS_43600 gene cydB CDS 2998..3129 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43610 CDS complement(3183..5837) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43620 CDS complement(6343..7938) product propionate catabolism operon regulatory protein PrpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000205290.1 transl_table 11 codon_start 1 locus_tag LOCUS_43630 gene prpR CDS 8185..9069 product methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000052221.1 transl_table 11 codon_start 1 locus_tag LOCUS_43640 gene prpB CDS 9152..10321 product 2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001285908.1 transl_table 11 codon_start 1 locus_tag LOCUS_43650 gene prpC CDS 10358..11809 product bifunctional 2-methylcitrate dehydratase/aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272709.1 transl_table 11 codon_start 1 locus_tag LOCUS_43660 CDS 11828..13714 product propionate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000010226.1 transl_table 11 codon_start 1 locus_tag LOCUS_43670 gene prpE CDS complement(13986..15239) product lactose permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000291541.1 transl_table 11 codon_start 1 locus_tag LOCUS_43680 gene lacY CDS complement(15291..18374) product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000177906.1 transl_table 11 codon_start 1 locus_tag LOCUS_43690 gene lacZ CDS complement(18496..19578) product DNA-binding transcriptional repressor LacI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000805889.1 transl_table 11 codon_start 1 locus_tag LOCUS_43700 gene lacI CDS complement(19612..20568) product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001247696.1 transl_table 11 codon_start 1 locus_tag LOCUS_43710 CDS complement(20580..21356) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000705454.1 transl_table 11 codon_start 1 locus_tag LOCUS_43720 sequence078 source 1..21383 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..7113 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001111655.1:Ig-like domain-containing protein note possible pseudo, internal stop codon locus_tag LOCUS_43730 CDS 7207..7401 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43740 note possible pseudo, internal stop codon CDS 7519..9774 product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096691.1 transl_table 11 codon_start 1 locus_tag LOCUS_43750 CDS 9776..10951 product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096690.1 transl_table 11 codon_start 1 locus_tag LOCUS_43760 CDS complement(10953..12146) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001089435.1 transl_table 11 codon_start 1 locus_tag LOCUS_43770 CDS complement(12222..13091) product YjiK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000746206.1 transl_table 11 codon_start 1 locus_tag LOCUS_43780 CDS 13271..14944 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703156.1 transl_table 11 codon_start 1 locus_tag LOCUS_43790 CDS 15173..16213 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43800 CDS 16200..17273 product glycoside hydrolase family 105 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973962.1 transl_table 11 codon_start 1 locus_tag LOCUS_43810 CDS complement(17319..18590) product DUF445 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001033044.1 transl_table 11 codon_start 1 locus_tag LOCUS_43820 CDS complement(18635..19561) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209056.1 transl_table 11 codon_start 1 locus_tag LOCUS_43830 CDS 19788..21020 product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000649362.1 transl_table 11 codon_start 1 locus_tag LOCUS_43840 sequence079 source 1..21137 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(35..1081) product ferric ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000078833.1 transl_table 11 codon_start 1 locus_tag LOCUS_43850 gene fbpC CDS complement(1093..3171) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095788.1 transl_table 11 codon_start 1 locus_tag LOCUS_43860 CDS complement(3249..4280) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000784324.1 transl_table 11 codon_start 1 locus_tag LOCUS_43870 CDS complement(4277..5581) product MFS transporter family glucose-6-phosphate receptor UhpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000543352.1 transl_table 11 codon_start 1 locus_tag LOCUS_43880 gene uhpC CDS complement(5666..7213) product MASE1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000089287.1 transl_table 11 codon_start 1 locus_tag LOCUS_43890 CDS complement(7213..7842) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621918.1 transl_table 11 codon_start 1 locus_tag LOCUS_43900 CDS 8096..9058 product taurine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018416.1 transl_table 11 codon_start 1 locus_tag LOCUS_43910 gene tauA CDS 9069..9836 product taurine ABC transporter ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939385.1 transl_table 11 codon_start 1 locus_tag LOCUS_43920 gene tauB CDS 9833..10666 product taurine ABC transporter permease TauC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000114619.1 transl_table 11 codon_start 1 locus_tag LOCUS_43930 gene tauC CDS 10663..11514 product taurine dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004074.1 transl_table 11 codon_start 1 locus_tag LOCUS_43940 gene tauD CDS complement(11584..12558) product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130724.1 transl_table 11 codon_start 1 locus_tag LOCUS_43950 gene hemB CDS 12850..15771 product autotransporter adhesin EhaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000556469.1 transl_table 11 codon_start 1 locus_tag LOCUS_43960 gene ehaB CDS 15818..16486 product hydrogen peroxide resistance inhibitor IprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295335.1 transl_table 11 codon_start 1 locus_tag LOCUS_43970 gene iprA CDS complement(16487..17644) product D-alanyl-D-alanine-carboxypeptidase/endopeptidase AmpH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000830774.1 transl_table 11 codon_start 1 locus_tag LOCUS_43980 gene ampH CDS 17986..19206 product peptide antibiotic transporter SbmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001304845.1 transl_table 11 codon_start 1 locus_tag LOCUS_43990 gene sbmA CDS 19221..20315 product surface-exposed outer membrane lipoprotein YaiW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001271423.1 transl_table 11 codon_start 1 locus_tag LOCUS_44000 gene yaiW CDS complement(20355..20663) product YaiY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000763139.1 transl_table 11 codon_start 1 locus_tag LOCUS_44010 CDS 20921..21136 product DUF2754 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295334.1 transl_table 11 codon_start 1 locus_tag LOCUS_44020 sequence080 source 1..20777 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(111..542) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366755.1 transl_table 11 codon_start 1 locus_tag LOCUS_44030 CDS complement(906..2699) product reverse transcriptase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461915.1 transl_table 11 codon_start 1 locus_tag LOCUS_44040 CDS complement(3401..3931) product single-stranded DNA-binding protein SSB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000168322.1 transl_table 11 codon_start 1 locus_tag LOCUS_44050 gene ssb1 CDS 4185..7007 product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000357724.1 transl_table 11 codon_start 1 locus_tag LOCUS_44060 gene uvrA CDS 7162..7608 product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000432193.1 transl_table 11 codon_start 1 locus_tag LOCUS_44070 CDS 7595..7924 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000146604.1 transl_table 11 codon_start 1 locus_tag LOCUS_44080 tRNA 8053..8129 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00470 CDS complement(8276..8692) product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000270375.1 transl_table 11 codon_start 1 locus_tag LOCUS_44090 CDS complement(8799..9512) product acid phosphatase AphA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000724436.1 transl_table 11 codon_start 1 locus_tag LOCUS_44100 gene aphA CDS complement(9713..10906) product aromatic amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000486998.1 transl_table 11 codon_start 1 locus_tag LOCUS_44110 gene tyrB CDS complement(11205..12284) product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001147328.1 transl_table 11 codon_start 1 locus_tag LOCUS_44120 gene alr CDS complement(12436..13851) product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368755.1 transl_table 11 codon_start 1 locus_tag LOCUS_44130 gene dnaB CDS 13916..14899 product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000235562.1 transl_table 11 codon_start 1 locus_tag LOCUS_44140 CDS complement(15079..15321) product envelope stress response protein PspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000891414.1 transl_table 11 codon_start 1 locus_tag LOCUS_44150 gene pspG CDS complement(15455..16492) product tRNA dihydrouridine(20/20a) synthase DusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298868.1 transl_table 11 codon_start 1 locus_tag LOCUS_44160 gene dusA CDS 16549..16710 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44170 CDS 16788..17183 product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014497752.1 transl_table 11 codon_start 1 locus_tag LOCUS_44180 CDS 17185..17502 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44190 CDS complement(17639..18649) product conjugal transfer protein TraF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001039344.1 transl_table 11 codon_start 1 locus_tag LOCUS_44200 CDS complement(18871..19764) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44210 CDS complement(19769..20101) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44220 CDS complement(20366..20506) product Hok/Gef family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000078916.1 transl_table 11 codon_start 1 locus_tag LOCUS_44230 sequence081 source 1..18773 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(79..780) product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704607.1 transl_table 11 codon_start 1 locus_tag LOCUS_44240 CDS 921..2036 product YbdK family carboxylate-amine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001130659.1 transl_table 11 codon_start 1 locus_tag LOCUS_44250 CDS 2107..2355 product DUF1158 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000682500.1 transl_table 11 codon_start 1 locus_tag LOCUS_44260 CDS complement(2372..2713) product RamA family antibiotic efflux transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014830972.1 transl_table 11 codon_start 1 locus_tag LOCUS_44270 CDS 2975..3556 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000113603.1 transl_table 11 codon_start 1 locus_tag LOCUS_44280 CDS 3556..3924 product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367809.1 transl_table 11 codon_start 1 locus_tag LOCUS_44290 CDS 4023..4676 product oxygen-insensitive NAD(P)H nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097682.1 transl_table 11 codon_start 1 locus_tag LOCUS_44300 gene nfsB CDS 4769..6016 product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001156971.1 transl_table 11 codon_start 1 locus_tag LOCUS_44310 CDS complement(6071..6637) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44320 note possible pseudo, internal stop codon CDS complement(6638..7459) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44330 note possible pseudo, internal stop codon CDS 7753..8928 product DNA repair ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816311.1 transl_table 11 codon_start 1 locus_tag LOCUS_44340 CDS 10113..10658 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44350 tRNA complement(10737..10813) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00480 CDS 11055..11921 product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729160.1 transl_table 11 codon_start 1 locus_tag LOCUS_44360 gene folD CDS 11923..12135 product ribosome-associated protein YbcJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001310620.1 transl_table 11 codon_start 1 locus_tag LOCUS_44370 gene ybcJ CDS 12258..12812 product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095925.1 transl_table 11 codon_start 1 locus_tag LOCUS_44380 CDS complement(12858..14243) product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000912352.1 transl_table 11 codon_start 1 locus_tag LOCUS_44390 gene cysS CDS 14418..14912 product peptidylprolyl isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000255991.1 transl_table 11 codon_start 1 locus_tag LOCUS_44400 gene ppiB CDS 14915..15637 product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000212237.1 transl_table 11 codon_start 1 locus_tag LOCUS_44410 gene lpxH CDS 15834..16343 product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295318.1 transl_table 11 codon_start 1 locus_tag LOCUS_44420 gene purE CDS 16340..17407 product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000815551.1 transl_table 11 codon_start 1 locus_tag LOCUS_44430 gene purK CDS 17504..18574 product tRNA 2-selenouridine(34) synthase MnmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704627.1 transl_table 11 codon_start 1 locus_tag LOCUS_44440 gene mnmH sequence082 source 1..18021 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1135..1665) product phage tail protein I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000071739.1 transl_table 11 codon_start 1 locus_tag LOCUS_44450 CDS complement(1658..2554) product baseplate J/gp47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001111965.1 transl_table 11 codon_start 1 locus_tag LOCUS_44460 CDS complement(2558..2908) product GPW/gp25 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000213447.1 transl_table 11 codon_start 1 locus_tag LOCUS_44470 CDS complement(2905..3486) product phage baseplate assembly protein V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077826354.1 transl_table 11 codon_start 1 locus_tag LOCUS_44480 CDS complement(3483..4127) product phage virion morphogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000356347.1 transl_table 11 codon_start 1 locus_tag LOCUS_44490 CDS complement(4111..4578) product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000921128.1 transl_table 11 codon_start 1 locus_tag LOCUS_44500 CDS complement(4716..5123) product DUF2570 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780558.1 transl_table 11 codon_start 1 locus_tag LOCUS_44510 CDS complement(5120..5665) product putative peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166765.1 transl_table 11 codon_start 1 locus_tag LOCUS_44520 CDS complement(5720..6043) product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000104350.1 transl_table 11 codon_start 1 locus_tag LOCUS_44530 CDS complement(6046..6246) product tail protein X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000864897.1 transl_table 11 codon_start 1 locus_tag LOCUS_44540 CDS complement(6246..6740) product head completion/stabilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000063103.1 transl_table 11 codon_start 1 locus_tag LOCUS_44550 CDS complement(6843..7643) product phage terminase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000632318.1 transl_table 11 codon_start 1 locus_tag LOCUS_44560 gene gpM CDS complement(7689..8741) product phage major capsid protein, P2 family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001055094.1 transl_table 11 codon_start 1 locus_tag LOCUS_44570 CDS complement(8765..9601) product GPO family capsid scaffolding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001262665.1 transl_table 11 codon_start 1 locus_tag LOCUS_44580 CDS 9756..11507 product terminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000613796.1 transl_table 11 codon_start 1 locus_tag LOCUS_44590 CDS 11507..12553 product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000087812.1 transl_table 11 codon_start 1 locus_tag LOCUS_44600 CDS 13260..13763 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44610 CDS complement(13854..14165) product plasmid partitioning/stability family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211280.1 transl_table 11 codon_start 1 locus_tag LOCUS_44620 CDS complement(14170..15129) product plasmid segregation protein ParM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686540.1 transl_table 11 codon_start 1 locus_tag LOCUS_44630 misc_feature complement(15206..>18021) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000123463.1:replication endonuclease locus_tag LOCUS_44640 sequence083 source 1..16805 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 288..890 product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095829.1 transl_table 11 codon_start 1 locus_tag LOCUS_44650 CDS complement(940..2331) product DUF3999 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114469.1 transl_table 11 codon_start 1 locus_tag LOCUS_44660 CDS complement(2328..4967) product DUF2339 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105345.1 transl_table 11 codon_start 1 locus_tag LOCUS_44670 CDS complement(5074..6891) product maltodextrin glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001361950.1 transl_table 11 codon_start 1 locus_tag LOCUS_44680 gene malZ CDS complement(7068..8435) product proline-specific permease ProY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445555.1 transl_table 11 codon_start 1 locus_tag LOCUS_44690 gene proY CDS complement(8514..9833) product branched-chain amino acid transporter carrier protein BrnQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000149625.1 transl_table 11 codon_start 1 locus_tag LOCUS_44700 gene brnQ CDS complement(10228..11505) product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000893648.1 transl_table 11 codon_start 1 locus_tag LOCUS_44710 gene phoR CDS complement(11587..12276) product phosphate response regulator transcription factor PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010428026.1 transl_table 11 codon_start 1 locus_tag LOCUS_44720 gene phoB CDS 12466..13668 product exonuclease subunit SbcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001221246.1 transl_table 11 codon_start 1 locus_tag LOCUS_44730 gene sbcD sequence084 source 1..16603 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2..448 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44740 CDS 445..1515 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202689.1 transl_table 11 codon_start 1 locus_tag LOCUS_44750 CDS 1623..3029 product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000043528.1 transl_table 11 codon_start 1 locus_tag LOCUS_44760 gene gndA CDS 3266..4432 product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000704865.1 transl_table 11 codon_start 1 locus_tag LOCUS_44770 gene ugd CDS 4581..5567 product LPS O-antigen chain length determinant protein WzzB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001553141.1 transl_table 11 codon_start 1 locus_tag LOCUS_44780 gene wzzB CDS complement(5650..6261) product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954872.1 transl_table 11 codon_start 1 locus_tag LOCUS_44790 gene hisIE CDS complement(6255..7031) product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000880182.1 transl_table 11 codon_start 1 locus_tag LOCUS_44800 gene hisF CDS complement(7013..7750) product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000586456.1 transl_table 11 codon_start 1 locus_tag LOCUS_44810 gene hisA CDS complement(7750..8340) product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001103560.1 transl_table 11 codon_start 1 locus_tag LOCUS_44820 gene hisH CDS complement(8340..9407) product bifunctional histidinol-phosphatase/imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000080040.1 transl_table 11 codon_start 1 locus_tag LOCUS_44830 gene hisB CDS complement(9404..10483) product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000108967.1 transl_table 11 codon_start 1 locus_tag LOCUS_44840 gene hisC CDS complement(10480..11784) product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001350335.1 transl_table 11 codon_start 1 locus_tag LOCUS_44850 gene hisD CDS complement(11873..12772) product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000886604.1 transl_table 11 codon_start 1 locus_tag LOCUS_44860 gene hisG CDS 13130..13954 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000754712.1 transl_table 11 codon_start 1 locus_tag LOCUS_44870 CDS 14001..14930 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000803363.1 transl_table 11 codon_start 1 locus_tag LOCUS_44880 CDS 15199..16557 product putrescine/proton symporter PlaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000178807.1 transl_table 11 codon_start 1 locus_tag LOCUS_44890 gene plaP sequence085 source 1..16446 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(70..1539) product lysine-specific permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000534995.1 transl_table 11 codon_start 1 locus_tag LOCUS_44900 gene lysP CDS complement(1733..2596) product DNA-binding transcriptional regulator YeiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000548316.1 transl_table 11 codon_start 1 locus_tag LOCUS_44910 gene yieE CDS 2695..3744 product YeiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000137966.1 transl_table 11 codon_start 1 locus_tag LOCUS_44920 CDS 3962..4546 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44930 CDS 4610..5473 product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000873880.1 transl_table 11 codon_start 1 locus_tag LOCUS_44940 gene nfo CDS 5470..6561 product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000999819.1 transl_table 11 codon_start 1 locus_tag LOCUS_44950 CDS complement(6619..7848) product NupC/NupG family nucleoside CNT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000353878.1 transl_table 11 codon_start 1 locus_tag LOCUS_44960 CDS complement(7955..8890) product pseudouridine-5'-phosphate glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001290195.1 transl_table 11 codon_start 1 locus_tag LOCUS_44970 CDS complement(8878..9819) product pseudouridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042318072.1 transl_table 11 codon_start 1 locus_tag LOCUS_44980 CDS complement(10105..11796) product PTS fructose transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000854441.1 transl_table 11 codon_start 1 locus_tag LOCUS_44990 gene fruA CDS complement(11813..12751) product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091249.1 transl_table 11 codon_start 1 locus_tag LOCUS_45000 gene fruK CDS complement(12751..13881) product fused PTS fructose transporter subunit IIA/HPr protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000487294.1 transl_table 11 codon_start 1 locus_tag LOCUS_45010 gene fruB CDS 14250..15431 product sugar efflux transporter SetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000551934.1 transl_table 11 codon_start 1 locus_tag LOCUS_45020 gene setB CDS complement(15428..15616) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45030 CDS 15848..16420 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45040 note possible pseudo, internal stop codon, frameshifted sequence086 source 1..15425 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(69..1019) product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000947139.1 transl_table 11 codon_start 1 locus_tag LOCUS_45050 gene corA CDS complement(1519..3681) product DNA helicase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000383444.1 transl_table 11 codon_start 1 locus_tag LOCUS_45060 gene uvrD CDS complement(3818..4534) product 5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001213567.1 transl_table 11 codon_start 1 locus_tag LOCUS_45070 gene yigB CDS complement(4534..5430) product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000141123.1 transl_table 11 codon_start 1 locus_tag LOCUS_45080 gene xerC CDS complement(5427..6098) product DUF484 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000812770.1 transl_table 11 codon_start 1 locus_tag LOCUS_45090 CDS complement(6131..6955) product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001160671.1 transl_table 11 codon_start 1 locus_tag LOCUS_45100 gene dapF CDS complement(6992..7195) product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799903.1 transl_table 11 codon_start 1 locus_tag LOCUS_45110 CDS 7335..7655 product iron donor protein CyaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000999925.1 transl_table 11 codon_start 1 locus_tag LOCUS_45120 gene cyaY CDS complement(7716..10262) product class I adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281718.1 transl_table 11 codon_start 1 locus_tag LOCUS_45130 gene cyaA CDS 10651..11592 product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001521319.1 transl_table 11 codon_start 1 locus_tag LOCUS_45140 gene hemC CDS 11589..12329 product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000025500.1 transl_table 11 codon_start 1 locus_tag LOCUS_45150 gene hemD CDS 12351..13547 product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138976.1 transl_table 11 codon_start 1 locus_tag LOCUS_45160 gene hemX CDS 13547..14746 product protoheme IX biogenesis protein HemY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000921791.1 transl_table 11 codon_start 1 locus_tag LOCUS_45170 gene hemY tRNA complement(15308..15384) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00490 sequence087 source 1..14809 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(148..1188) product L-glyceraldehyde 3-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000262193.1 transl_table 11 codon_start 1 locus_tag LOCUS_45180 gene gpr CDS 1594..2040 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45190 note possible pseudo, frameshifted CDS 2015..2281 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45200 note possible pseudo, frameshifted CDS 2644..3678 product hydrogenase 2 small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000145429.1 transl_table 11 codon_start 1 locus_tag LOCUS_45210 gene hybO CDS 3681..4667 product hydrogenase 2 operon protein HybA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001081721.1 transl_table 11 codon_start 1 locus_tag LOCUS_45220 gene hybA CDS 4657..5835 product Ni/Fe-hydrogenase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000017676.1 transl_table 11 codon_start 1 locus_tag LOCUS_45230 gene hybB CDS 5832..7535 product hydrogenase 2 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000083050.1 transl_table 11 codon_start 1 locus_tag LOCUS_45240 gene hybC CDS 7535..8029 product HyaD/HybD family hydrogenase maturation endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001221940.1 transl_table 11 codon_start 1 locus_tag LOCUS_45250 CDS 8022..8510 product hydrogenase-2 assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000134017.1 transl_table 11 codon_start 1 locus_tag LOCUS_45260 gene hybE CDS 8503..8844 product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000544945.1 transl_table 11 codon_start 1 locus_tag LOCUS_45270 gene hypA CDS 8863..9111 product hydrogenase maturation factor HybG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000334887.1 transl_table 11 codon_start 1 locus_tag LOCUS_45280 gene hybG CDS complement(9219..9431) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45290 CDS complement(9409..9780) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45300 CDS 9973..11832 product bifunctional glutathionylspermidine amidase/synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000033690.1 transl_table 11 codon_start 1 locus_tag LOCUS_45310 gene gss CDS complement(11952..12719) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45320 CDS complement(13163..13930) product DUF1911 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000943014.1 transl_table 11 codon_start 1 locus_tag LOCUS_45330 CDS complement(13982..14377) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45340 note possible pseudo, frameshifted sequence088 source 1..14463 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(109..2541) product bifunctional aspartate kinase/homoserine dehydrogenase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000110772.1 transl_table 11 codon_start 1 locus_tag LOCUS_45350 gene metL CDS complement(2544..3704) product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295694.1 transl_table 11 codon_start 1 locus_tag LOCUS_45360 gene metB CDS 3980..4297 product met regulon transcriptional regulator MetJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004107547.1 transl_table 11 codon_start 1 locus_tag LOCUS_45370 gene metJ CDS 4636..5085 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704509.1 transl_table 11 codon_start 1 locus_tag LOCUS_45380 CDS 5079..5405 product DUF1493 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_059386398.1 transl_table 11 codon_start 1 locus_tag LOCUS_45390 CDS 5421..5906 product type VI secretion system tube protein TssD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138096472.1 transl_table 11 codon_start 1 locus_tag LOCUS_45400 gene tssD CDS complement(5975..6187) product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368925.1 transl_table 11 codon_start 1 locus_tag LOCUS_45410 gene rpmE CDS 6443..8641 product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301269.1 transl_table 11 codon_start 1 locus_tag LOCUS_45420 gene priA CDS 8863..9888 product DNA-binding transcriptional regulator CytR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000841337.1 transl_table 11 codon_start 1 locus_tag LOCUS_45430 gene cytR CDS 10080..10907 product cell division protein FtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000068837.1 transl_table 11 codon_start 1 locus_tag LOCUS_45440 gene ftsN CDS 10999..11529 product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000208240.1 transl_table 11 codon_start 1 locus_tag LOCUS_45450 gene hslV CDS 11539..12870 product HslU--HslV peptidase ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001293341.1 transl_table 11 codon_start 1 locus_tag LOCUS_45460 gene hslU CDS 12937..13866 product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000139635.1 transl_table 11 codon_start 1 locus_tag LOCUS_45470 gene menA CDS 13958..14443 product ribonuclease E activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000872918.1 transl_table 11 codon_start 1 locus_tag LOCUS_45480 gene rraA sequence089 source 1..14215 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 198..1346 product MFS transporter AraJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196824.1 transl_table 11 codon_start 1 locus_tag LOCUS_45490 gene araJ CDS complement(1380..2288) product fructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219315.1 transl_table 11 codon_start 1 locus_tag LOCUS_45500 gene mak CDS 2416..3327 product recombination-associated protein RdgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000964305.1 transl_table 11 codon_start 1 locus_tag LOCUS_45510 gene rdgC CDS complement(3381..3701) product pyrimidine/purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000941942.1 transl_table 11 codon_start 1 locus_tag LOCUS_45520 gene ppnP CDS complement(3736..4413) product AroM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001276434.1 transl_table 11 codon_start 1 locus_tag LOCUS_45530 CDS complement(4672..4863) product protein YaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001143161.1 transl_table 11 codon_start 1 locus_tag LOCUS_45540 gene yaiA CDS complement(4891..5379) product shikimate kinase AroL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000193385.1 transl_table 11 codon_start 1 locus_tag LOCUS_45550 gene aroL CDS complement(5612..6076) product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000158137.1 transl_table 11 codon_start 1 locus_tag LOCUS_45560 CDS 6225..7034 product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295331.1 transl_table 11 codon_start 1 locus_tag LOCUS_45570 gene proC CDS complement(7050..8150) product diguanylate cyclase AdrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000484068.1 transl_table 11 codon_start 1 locus_tag LOCUS_45580 gene adrA CDS complement(8289..8609) product phosphate starvation-inducible protein PsiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295332.1 transl_table 11 codon_start 1 locus_tag LOCUS_45590 gene psiF CDS complement(8787..10202) product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000814386.1 transl_table 11 codon_start 1 locus_tag LOCUS_45600 gene phoA CDS complement(10414..10674) product anti-adapter protein IraP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001518423.1 transl_table 11 codon_start 1 locus_tag LOCUS_45610 gene iraP CDS complement(10928..12133) product multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000446769.1 transl_table 11 codon_start 1 locus_tag LOCUS_45620 CDS complement(12302..12985) product extensin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000480796.1 transl_table 11 codon_start 1 locus_tag LOCUS_45630 CDS 13153..14187 product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000413677.1 transl_table 11 codon_start 1 locus_tag LOCUS_45640 gene ddlA sequence090 source 1..14213 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 273..413 product Hok/Gef family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000078916.1 transl_table 11 codon_start 1 locus_tag LOCUS_45650 CDS 549..845 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45660 CDS 1180..1971 product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038090.1 transl_table 11 codon_start 1 locus_tag LOCUS_45670 CDS 2181..3386 product flagellin lysine-N-methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816588.1 transl_table 11 codon_start 1 locus_tag LOCUS_45680 gene fliB CDS 3610..4299 product RNA polymerase sigma factor FliA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001087453.1 transl_table 11 codon_start 1 locus_tag LOCUS_45690 CDS 4356..4907 product flagella biosynthesis regulatory protein FliZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000218080.1 transl_table 11 codon_start 1 locus_tag LOCUS_45700 gene fliZ CDS 4995..5795 product cystine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096020.1 transl_table 11 codon_start 1 locus_tag LOCUS_45710 gene tcyJ CDS 5901..6887 product D-cysteine desulfhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001128215.1 transl_table 11 codon_start 1 locus_tag LOCUS_45720 gene dcyD CDS 6903..7571 product cystine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001158238.1 transl_table 11 codon_start 1 locus_tag LOCUS_45730 gene tcyL CDS 7568..8320 product L-cystine ABC transporter ATP-binding protein YecC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273000.1 transl_table 11 codon_start 1 locus_tag LOCUS_45740 gene yecC CDS 8586..9272 product transcriptional regulator SdiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001157173.1 transl_table 11 codon_start 1 locus_tag LOCUS_45750 gene sdiA CDS complement(9339..9563) product DUF2594 family protein YecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000106474.1 transl_table 11 codon_start 1 locus_tag LOCUS_45760 gene yecF CDS 10024..10680 product UvrY/SirA/GacA family response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000611323.1 transl_table 11 codon_start 1 locus_tag LOCUS_45770 gene uvrY CDS 10677..12509 product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001289473.1 transl_table 11 codon_start 1 locus_tag LOCUS_45780 gene uvrC CDS 12566..13114 product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001160192.1 transl_table 11 codon_start 1 locus_tag LOCUS_45790 gene pgsA tRNA 13265..13340 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00500 tRNA 13391..13464 product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00510 tRNA 13477..13563 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00520 misc_feature complement(13649..>14213) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_122974009.1:IS3 family transposase locus_tag LOCUS_45800 sequence091 source 1..13839 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(70..1710) product phosphoglucomutase (alpha-D-glucose-1,6-bisphosphate-dependent) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297249.1 transl_table 11 codon_start 1 locus_tag LOCUS_45810 gene pgm CDS complement(1734..2279) product replication initiation negative regulator SeqA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000848395.1 transl_table 11 codon_start 1 locus_tag LOCUS_45820 gene seqA CDS 2469..3242 product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000773280.1 transl_table 11 codon_start 1 locus_tag LOCUS_45830 gene ybfF CDS 3371..3664 product LexA regulated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000291238.1 transl_table 11 codon_start 1 locus_tag LOCUS_45840 gene ybfE note possible pseudo, frameshifted CDS 3814..4344 product flavodoxin FldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018618.1 transl_table 11 codon_start 1 locus_tag LOCUS_45850 gene fldA CDS 4626..5072 product ferric iron uptake transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000131702.1 transl_table 11 codon_start 1 locus_tag LOCUS_45860 gene fur CDS 5198..6124 product tricarballylate utilization LysR family transcriptional regulator TcuR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000423368.1 transl_table 11 codon_start 1 locus_tag LOCUS_45870 gene tcuR CDS 6220..7623 product FAD-dependent tricarballylate dehydrogenase TcuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228705.1 transl_table 11 codon_start 1 locus_tag LOCUS_45880 gene tcuA CDS 7610..8749 product tricarballylate utilization 4Fe-4S protein TcuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704751.1 transl_table 11 codon_start 1 locus_tag LOCUS_45890 gene tcuB CDS 8804..10093 product tricarballylate/proton symporter TcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057014.1 transl_table 11 codon_start 1 locus_tag LOCUS_45900 gene tcuC CDS complement(10188..11594) product chitoporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001258803.1 transl_table 11 codon_start 1 locus_tag LOCUS_45910 gene chiP CDS complement(12081..13748) product glutamine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287188.1 transl_table 11 codon_start 1 locus_tag LOCUS_45920 gene glnS sequence092 source 1..13724 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..757 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015705755.1:TonB-dependent siderophore receptor locus_tag LOCUS_45930 CDS 858..1259 product acyl-CoA thioester hydrolase YciA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000210317.1 transl_table 11 codon_start 1 locus_tag LOCUS_45940 gene yciA CDS complement(1323..2057) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45950 CDS 2309..2605 product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000967595.1 transl_table 11 codon_start 1 locus_tag LOCUS_45960 CDS 2961..4421 product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000206886.1 transl_table 11 codon_start 1 locus_tag LOCUS_45970 gene cls CDS 4456..4785 product HI1450 family dsDNA-mimic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000425070.1 transl_table 11 codon_start 1 locus_tag LOCUS_45980 CDS complement(5066..6070) product murein tripeptide/oligopeptide ABC transporter ATP-binding protein OppF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367066.1 transl_table 11 codon_start 1 locus_tag LOCUS_45990 gene oppF CDS complement(6067..7080) product murein tripeptide/oligopeptide ABC transporter ATP-binding protein OppD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001100712.1 transl_table 11 codon_start 1 locus_tag LOCUS_46000 gene oppD CDS complement(7092..8000) product oligopeptide ABC transporter permease OppC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096272.1 transl_table 11 codon_start 1 locus_tag LOCUS_46010 gene oppC CDS complement(8015..8935) product oligopeptide ABC transporter permease OppB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000911094.1 transl_table 11 codon_start 1 locus_tag LOCUS_46020 gene oppB CDS complement(9056..10684) product oligopeptide ABC transporter substrate-binding protein OppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000560668.1 transl_table 11 codon_start 1 locus_tag LOCUS_46030 gene oppA CDS complement(11445..12092) product NAAT family transporter YchE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000616773.1 transl_table 11 codon_start 1 locus_tag LOCUS_46040 gene ychE sequence093 source 1..13303 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 24..965 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001162859.1 transl_table 11 codon_start 1 locus_tag LOCUS_46050 CDS complement(975..1916) product fatty acid biosynthesis protein FabY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000080770.1 transl_table 11 codon_start 1 locus_tag LOCUS_46060 gene fabY CDS complement(1961..2398) product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000560978.1 transl_table 11 codon_start 1 locus_tag LOCUS_46070 gene dtd CDS complement(2395..3267) product virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000921423.1 transl_table 11 codon_start 1 locus_tag LOCUS_46080 CDS complement(3261..3860) product glucose-1-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295269.1 transl_table 11 codon_start 1 locus_tag LOCUS_46090 gene yihX CDS complement(4044..6806) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46100 CDS complement(6988..7239) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46110 CDS complement(7263..8066) product DeoR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000059689.1 transl_table 11 codon_start 1 locus_tag LOCUS_46120 CDS complement(8100..8996) product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001520529.1 transl_table 11 codon_start 1 locus_tag LOCUS_46130 CDS 9163..10053 product sulfolactaldehyde 3-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000268240.1 transl_table 11 codon_start 1 locus_tag LOCUS_46140 gene yihU CDS 10073..10951 product sulfofructosephosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046464.1 transl_table 11 codon_start 1 locus_tag LOCUS_46150 gene yihT CDS 10965..12206 product sulfoquinovose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000870897.1 transl_table 11 codon_start 1 locus_tag LOCUS_46160 gene yihS CDS 12263..13180 product aldose-1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001315929.1 transl_table 11 codon_start 1 locus_tag LOCUS_46170 sequence094 source 1..12919 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 329..1075 product glutamine ABC transporter substrate-binding protein GlnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843866.1 transl_table 11 codon_start 1 locus_tag LOCUS_46180 gene glnH CDS 1186..1845 product glutamine ABC transporter permease GlnP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858462.1 transl_table 11 codon_start 1 locus_tag LOCUS_46190 gene glnP CDS 1842..2564 product glutamine ABC transporter ATP-binding protein GlnQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569093.1 transl_table 11 codon_start 1 locus_tag LOCUS_46200 gene glnQ CDS 2681..4921 product mechanosensitive channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001267252.1 transl_table 11 codon_start 1 locus_tag LOCUS_46210 gene ybiO CDS complement(4840..5850) product 23S rRNA (adenine(1618)-N(6))-methyltransferase RlmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001275941.1 transl_table 11 codon_start 1 locus_tag LOCUS_46220 gene rlmF CDS 6018..6284 product DksA/TraR family C4-type zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097470.1 transl_table 11 codon_start 1 locus_tag LOCUS_46230 CDS 6571..6831 product DUF1471 family protein YbiJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367588.1 transl_table 11 codon_start 1 locus_tag LOCUS_46240 gene ybiJ CDS complement(6941..7909) product DNA-binding protein YbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000386540.1 transl_table 11 codon_start 1 locus_tag LOCUS_46250 gene ybiB CDS complement(7936..10089) product ATP-dependent DNA helicase DinG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001218658.1 transl_table 11 codon_start 1 locus_tag LOCUS_46260 gene dinG CDS complement(10280..11635) product ATP-dependent RNA helicase RhlE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007058.1 transl_table 11 codon_start 1 locus_tag LOCUS_46270 gene rhlE misc_feature complement(11837..>12919) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013096268.1:bifunctional acetaldehyde-CoA/alcohol dehydrogenase locus_tag LOCUS_46280 sequence095 source 1..12547 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(29..235) product YbfA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000401435.1 transl_table 11 codon_start 1 locus_tag LOCUS_46290 CDS 633..2312 product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000730077.1 transl_table 11 codon_start 1 locus_tag LOCUS_46300 gene kdpA CDS 2327..4378 product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000087964.1 transl_table 11 codon_start 1 locus_tag LOCUS_46310 gene kdpB CDS 4387..4953 product K(+)-transporting ATPase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602229.1 transl_table 11 codon_start 1 locus_tag LOCUS_46320 gene kdpC CDS 4953..7640 product two-component system sensor histidine kinase KdpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309343.1 transl_table 11 codon_start 1 locus_tag LOCUS_46330 gene kdpD CDS 7637..8314 product two-component system response regulator KdpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000186103.1 transl_table 11 codon_start 1 locus_tag LOCUS_46340 gene kdpE CDS 8954..11152 product ornithine decarboxylase SpeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046082898.1 transl_table 11 codon_start 1 locus_tag LOCUS_46350 gene speF CDS 11149..12468 product putrescine-ornithine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000075831.1 transl_table 11 codon_start 1 locus_tag LOCUS_46360 gene potE sequence096 source 1..12382 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(245..3928) product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000096011.1 transl_table 11 codon_start 1 locus_tag LOCUS_46370 gene metH CDS 4124..4948 product glyoxylate bypass operon transcriptional repressor IclR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000226433.1 transl_table 11 codon_start 1 locus_tag LOCUS_46380 gene iclR CDS complement(4945..5547) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46390 CDS complement(5570..7306) product bifunctional isocitrate dehydrogenase kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001137261.1 transl_table 11 codon_start 1 locus_tag LOCUS_46400 gene aceK CDS complement(7412..8731) product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857886.1 transl_table 11 codon_start 1 locus_tag LOCUS_46410 gene aceA CDS complement(8808..10409) product malate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001069369.1 transl_table 11 codon_start 1 locus_tag LOCUS_46420 gene aceB CDS complement(10678..11607) product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001122765.1 transl_table 11 codon_start 1 locus_tag LOCUS_46430 gene metA CDS 11764..12201 product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000236960.1 transl_table 11 codon_start 1 locus_tag LOCUS_46440 sequence097 source 1..11646 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(85..1191) product porin OmpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705623.1 transl_table 11 codon_start 1 locus_tag LOCUS_46450 gene ompC CDS complement(1847..3184) product YadA-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869132.1 transl_table 11 codon_start 1 locus_tag LOCUS_46460 CDS complement(3760..4461) product envelope stress response activation lipoprotein NlpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000239181.1 transl_table 11 codon_start 1 locus_tag LOCUS_46470 gene nlpE CDS complement(4495..4914) product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000560526.1 transl_table 11 codon_start 1 locus_tag LOCUS_46480 gene arfB CDS complement(4911..5456) product YaeQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001185319.1 transl_table 11 codon_start 1 locus_tag LOCUS_46490 CDS 5645..5845 product YaeP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001518678.1 transl_table 11 codon_start 1 locus_tag LOCUS_46500 CDS 5832..6092 product Rho-binding antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062312.1 transl_table 11 codon_start 1 locus_tag LOCUS_46510 gene rof CDS complement(6177..7475) product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000210062.1 transl_table 11 codon_start 1 locus_tag LOCUS_46520 gene tilS CDS complement(7537..7926) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000901086.1 transl_table 11 codon_start 1 locus_tag LOCUS_46530 CDS complement(7992..10130) product lysine decarboxylase LdcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001021059.1 transl_table 11 codon_start 1 locus_tag LOCUS_46540 gene ldcC misc_feature complement(10207..>11646) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000524168.1:chitinase locus_tag LOCUS_46550 sequence098 source 1..10918 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1..516 product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001025397.1 transl_table 11 codon_start 1 locus_tag LOCUS_46560 CDS 621..1163 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001083906.1 transl_table 11 codon_start 1 locus_tag LOCUS_46570 CDS 1160..1411 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001230707.1 transl_table 11 codon_start 1 locus_tag LOCUS_46580 CDS 1398..1625 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000801440.1 transl_table 11 codon_start 1 locus_tag LOCUS_46590 CDS 2079..2378 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012599848.1 transl_table 11 codon_start 1 locus_tag LOCUS_46600 CDS 2470..2820 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46610 CDS 2896..3033 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46620 CDS 3126..3374 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46630 CDS 3371..3718 product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668012.1 transl_table 11 codon_start 1 locus_tag LOCUS_46640 CDS 4082..4585 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46650 CDS 4589..5818 product MOBP family relaxase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001549912.1 transl_table 11 codon_start 1 locus_tag LOCUS_46660 CDS 5895..6161 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46670 CDS 6166..6399 product EexN family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000835348.1 transl_table 11 codon_start 1 locus_tag LOCUS_46680 CDS 6658..6834 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46690 CDS 6837..7457 product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000953528.1 transl_table 11 codon_start 1 locus_tag LOCUS_46700 CDS 7471..7797 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46710 CDS 7816..10563 product VirB3 family type IV secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096399.1 transl_table 11 codon_start 1 locus_tag LOCUS_46720 sequence099 source 1..9333 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1003..1227 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46730 CDS complement(1330..2610) product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989217.1 transl_table 11 codon_start 1 locus_tag LOCUS_46740 CDS complement(2675..4819) product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208470.1 transl_table 11 codon_start 1 locus_tag LOCUS_46750 CDS complement(4824..5957) product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367420.1 transl_table 11 codon_start 1 locus_tag LOCUS_46760 sequence100 source 1..8568 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1065 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000438819.1:MFS transporter locus_tag LOCUS_46770 CDS complement(1114..1755) product bifunctional nicotinamidase/pyrazinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001120535.1 transl_table 11 codon_start 1 locus_tag LOCUS_46780 gene pncA CDS complement(1766..2782) product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001170154.1 transl_table 11 codon_start 1 locus_tag LOCUS_46790 gene ansA CDS complement(2859..4715) product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001259874.1 transl_table 11 codon_start 1 locus_tag LOCUS_46800 gene sppA CDS 4881..5432 product NAD(P)H nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000339283.1 transl_table 11 codon_start 1 locus_tag LOCUS_46810 CDS 5549..6592 product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295485.1 transl_table 11 codon_start 1 locus_tag LOCUS_46820 gene selD CDS 6597..8543 product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001235813.1 transl_table 11 codon_start 1 locus_tag LOCUS_46830 gene topB sequence101 source 1..8481 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(178..597) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000126294.1 transl_table 11 codon_start 1 locus_tag LOCUS_46840 CDS complement(594..905) product type II toxin-antitoxin system HigB family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074398.1 transl_table 11 codon_start 1 locus_tag LOCUS_46850 CDS 1134..1463 product YqcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000207010.1 transl_table 11 codon_start 1 locus_tag LOCUS_46860 CDS 1463..1753 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46870 note possible pseudo, internal stop codon CDS 1757..2245 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46880 note possible pseudo, internal stop codon CDS 2263..2712 product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000807756.1 transl_table 11 codon_start 1 locus_tag LOCUS_46890 CDS 3196..4548 product galactarate/glucarate/glycerate transporter GudP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000097082.1 transl_table 11 codon_start 1 locus_tag LOCUS_46900 gene gudP CDS 4551..5891 product enolase C-terminal domain-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211753.1 transl_table 11 codon_start 1 locus_tag LOCUS_46910 CDS 5912..7252 product glucarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098243.1 transl_table 11 codon_start 1 locus_tag LOCUS_46920 gene gudD sequence102 source 1..8302 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(336..629) product DUF1778 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001143724.1 transl_table 11 codon_start 1 locus_tag LOCUS_46930 CDS complement(1087..1356) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46940 CDS complement(1724..2050) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46950 CDS 2367..3149 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46960 CDS 3136..4065 product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144321.1 transl_table 11 codon_start 1 locus_tag LOCUS_46970 CDS complement(4661..5953) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46980 CDS complement(6044..6496) product glyoxalase/bleomycin resistance/dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383881.1 transl_table 11 codon_start 1 locus_tag LOCUS_46990 CDS complement(6973..7353) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47000 CDS 7525..8253 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47010 sequence103 source 1..7978 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(327..1277) product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703140.1 transl_table 11 codon_start 1 locus_tag LOCUS_47020 gene tal CDS complement(1293..1766) product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209402.1 transl_table 11 codon_start 1 locus_tag LOCUS_47030 gene rpiB CDS complement(1811..2176) product PTS glucitol/sorbitol transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000111554.1 transl_table 11 codon_start 1 locus_tag LOCUS_47040 gene srlB CDS complement(2178..3194) product 2-keto-3-deoxygluconate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439631.1 transl_table 11 codon_start 1 locus_tag LOCUS_47050 CDS complement(3287..5005) product four-carbon acid sugar kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047749.1 transl_table 11 codon_start 1 locus_tag LOCUS_47060 CDS complement(5041..6048) product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047748.1 transl_table 11 codon_start 1 locus_tag LOCUS_47070 gene pdxA CDS 6294..7088 product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389112.1 transl_table 11 codon_start 1 locus_tag LOCUS_47080 CDS complement(7211..7978) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47090 sequence104 source 1..7947 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(116..616) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47100 note possible pseudo, internal stop codon, frameshifted CDS complement(573..809) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47110 note possible pseudo, internal stop codon, frameshifted CDS complement(1333..2553) product type III secretion system LEE inner membrane ring protein EscD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000953255.1 transl_table 11 codon_start 1 locus_tag LOCUS_47120 gene escD CDS 2694..3749 product type III secretion system LEE gatekeeper SepL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273445.1 transl_table 11 codon_start 1 locus_tag LOCUS_47130 gene sepL CDS 3806..4384 product type III secretion system LEE translocon filament protein EspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000381516.1 transl_table 11 codon_start 1 locus_tag LOCUS_47140 gene espA CDS 4397..5539 product type III secretion system LEE translocon pore-forming subunit EspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000935759.1 transl_table 11 codon_start 1 locus_tag LOCUS_47150 gene espD CDS 5560..6525 product type III secretion system LEE translocon pore-forming subunit EspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001092000.1 transl_table 11 codon_start 1 locus_tag LOCUS_47160 gene espB CDS 6526..6939 product LcrR family type III secretion system chaperone CesD2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228583.1 transl_table 11 codon_start 1 locus_tag LOCUS_47170 gene cesD2 CDS 6976..7197 product type III secretion system LEE needle filament protein EscF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001053840.1 transl_table 11 codon_start 1 locus_tag LOCUS_47180 gene escF CDS 7204..7500 product type III secretion system LEE needle protein cochaperone EscG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000245816.1 transl_table 11 codon_start 1 locus_tag LOCUS_47190 gene escG sequence105 source 1..7653 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 321..578 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47200 CDS 578..757 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47210 CDS 1017..1217 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47220 CDS 1545..2237 product LuxR family transcriptional regulator YenR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170826.1 transl_table 11 codon_start 1 locus_tag LOCUS_47230 gene yenR CDS complement(2253..2888) product acyl-homoserine-lactone synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211858.1 transl_table 11 codon_start 1 locus_tag LOCUS_47240 CDS 3629..4399 product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704829.1 transl_table 11 codon_start 1 locus_tag LOCUS_47250 CDS 5287..5745 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47260 sequence106 source 1..7132 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(326..1693) product L-serine ammonia-lyase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626388.1 transl_table 11 codon_start 1 locus_tag LOCUS_47270 gene sdaB CDS complement(1754..3043) product HAAAP family serine/threonine permease SdaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000859030.1 transl_table 11 codon_start 1 locus_tag LOCUS_47280 gene sdaC CDS complement(3571..4935) product nucleotide 5'-monophosphate nucleosidase PpnN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098530.1 transl_table 11 codon_start 1 locus_tag LOCUS_47290 gene ppnN CDS complement(5048..5896) product NADPH-dependent 7-cyano-7-deazaguanine reductase QueF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100463.1 transl_table 11 codon_start 1 locus_tag LOCUS_47300 gene queF CDS 5965..6510 product SecY-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000343990.1 transl_table 11 codon_start 1 locus_tag LOCUS_47310 gene syd sequence107 source 1..6698 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(66..1784) product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001260716.1 transl_table 11 codon_start 1 locus_tag LOCUS_47320 gene proS CDS complement(1895..2602) product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000094011.1 transl_table 11 codon_start 1 locus_tag LOCUS_47330 CDS complement(2599..2895) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47340 CDS complement(3121..3936) product methionine ABC transporter substrate-binding lipoprotein MetQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000874224.1 transl_table 11 codon_start 1 locus_tag LOCUS_47350 gene metQ CDS complement(3978..4631) product methionine ABC transporter permease MetI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856130.1 transl_table 11 codon_start 1 locus_tag LOCUS_47360 CDS complement(4624..5655) product methionine ABC transporter ATP-binding protein MetN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000594006.1 transl_table 11 codon_start 1 locus_tag LOCUS_47370 gene metN CDS 5847..6413 product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140158.1 transl_table 11 codon_start 1 locus_tag LOCUS_47380 gene gmhB sequence108 source 1..6576 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 316..1500 product phage tail sheath family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000005414.1 transl_table 11 codon_start 1 locus_tag LOCUS_47390 CDS 1500..2012 product phage major tail tube protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000290443.1 transl_table 11 codon_start 1 locus_tag LOCUS_47400 CDS 2068..2442 product tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000665305.1 transl_table 11 codon_start 1 locus_tag LOCUS_47410 CDS 2370..2606 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47420 CDS 2593..5400 product phage tail tape measure protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001390260.1 transl_table 11 codon_start 1 locus_tag LOCUS_47430 CDS 5413..5901 product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000979946.1 transl_table 11 codon_start 1 locus_tag LOCUS_47440 CDS complement(5930..6529) product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000904922.1 transl_table 11 codon_start 1 locus_tag LOCUS_47450 sequence109 source 1..6013 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(136..372) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47460 sequence110 source 1..5467 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 221..586 product putative DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000472034.1 transl_table 11 codon_start 1 locus_tag LOCUS_47470 CDS 592..990 product putative DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000826515.1 transl_table 11 codon_start 1 locus_tag LOCUS_47480 CDS complement(1048..2463) product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000695623.1 transl_table 11 codon_start 1 locus_tag LOCUS_47490 gene gltX tRNA 2721..2796 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00530 tRNA 2842..2917 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00540 tRNA 2922..2997 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00550 CDS 3343..5421 product type VI secretion system tip protein VgrG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000103276.1 transl_table 11 codon_start 1 locus_tag LOCUS_47500 sequence111 source 1..5450 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 219..2003 product KAP family P-loop domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974286.1 transl_table 11 codon_start 1 locus_tag LOCUS_47510 CDS 2417..2755 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47520 CDS 2752..4056 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010884099.1 transl_table 11 codon_start 1 locus_tag LOCUS_47530 CDS 4053..4778 product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974283.1 transl_table 11 codon_start 1 locus_tag LOCUS_47540 sequence112 source 1..4739 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(598..673) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00560 tRNA complement(679..753) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00570 tRNA complement(869..953) product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00580 tRNA complement(962..1037) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00590 CDS 1465..2391 product type I pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000023068.1 transl_table 11 codon_start 1 locus_tag LOCUS_47550 gene coaA CDS complement(2420..3382) product bifunctional biotin--[acetyl-CoA-carboxylase] ligase/biotin operon repressor BirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000655746.1 transl_table 11 codon_start 1 locus_tag LOCUS_47560 gene birA CDS complement(3379..4407) product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001016664.1 transl_table 11 codon_start 1 locus_tag LOCUS_47570 gene murB sequence113 source 1..4645 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..949 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582801.1:ABC transporter permease locus_tag LOCUS_47580 CDS 1022..1972 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582802.1 transl_table 11 codon_start 1 locus_tag LOCUS_47590 CDS 2114..3112 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001232704.1 transl_table 11 codon_start 1 locus_tag LOCUS_47600 CDS 3159..3806 product L-fuculose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000440772.1 transl_table 11 codon_start 1 locus_tag LOCUS_47610 gene fucA CDS complement(3817..4572) product flap endonuclease Xni inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000268232.1 transl_table 11 codon_start 1 locus_tag LOCUS_47620 gene xni sequence114 source 1..4615 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence115 source 1..4193 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence116 source 1..3910 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(609..1628) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47630 CDS complement(2084..3640) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47640 sequence117 source 1..3842 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence118 source 1..3742 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence119 source 1..3674 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(595..2982) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47650 sequence120 source 1..3602 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(108..1229) product [50S ribosomal protein L16]-arginine 3-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295435.1 transl_table 11 codon_start 1 locus_tag LOCUS_47660 gene roxA CDS complement(1323..2783) product two-component system sensor histidine kinase PhoQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000735421.1 transl_table 11 codon_start 1 locus_tag LOCUS_47670 gene phoQ CDS complement(2783..3457) product two-component system response regulator PhoP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001265481.1 transl_table 11 codon_start 1 locus_tag LOCUS_47680 gene phoP sequence121 source 1..3172 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 239..409 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47690 CDS 373..801 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47700 CDS complement(1635..1829) product Rop family plasmid primer RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213433.1 transl_table 11 codon_start 1 locus_tag LOCUS_47710 CDS 2113..2436 product plasmid mobilization protein MobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000166966.1 transl_table 11 codon_start 1 locus_tag LOCUS_47720 gene mobA sequence122 source 1..3076 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(546..1364) product SdiA-regulated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000823897.1 transl_table 11 codon_start 1 locus_tag LOCUS_47730 CDS complement(1508..2653) product type III secretion system LEE effector EspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301460.1 transl_table 11 codon_start 1 locus_tag LOCUS_47740 gene espG sequence123 source 1..3005 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 178..381 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000985715.1 transl_table 11 codon_start 1 locus_tag LOCUS_47750 CDS 378..623 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153687.1 transl_table 11 codon_start 1 locus_tag LOCUS_47760 CDS 620..919 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000104305.1 transl_table 11 codon_start 1 locus_tag LOCUS_47770 CDS 931..1134 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47780 CDS 1131..1961 product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000755958.1 transl_table 11 codon_start 1 locus_tag LOCUS_47790 CDS 2330..2560 product derepression protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000775057.1 transl_table 11 codon_start 1 locus_tag LOCUS_47800 sequence124 source 1..2826 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1..771 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47810 CDS 1148..1714 product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244885.1 transl_table 11 codon_start 1 locus_tag LOCUS_47820 CDS 1767..2504 product fimbrial chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095625.1 transl_table 11 codon_start 1 locus_tag LOCUS_47830 sequence125 source 1..2768 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence126 source 1..2653 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 318..710 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47840 CDS complement(791..970) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47850 CDS 1077..2648 product IS66-like element ISCro1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000381397.1 transl_table 11 codon_start 1 locus_tag LOCUS_47860 sequence127 source 1..2652 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 861..1388 product tail fiber assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000902877.1 transl_table 11 codon_start 1 locus_tag LOCUS_47870 CDS complement(1417..1950) product tail fiber assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000902877.1 transl_table 11 codon_start 1 locus_tag LOCUS_47880 misc_feature complement(1953..>2652) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000216502.1:phage tail protein locus_tag LOCUS_47890 sequence128 source 1..2373 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(766..>2373) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011987103.1:glycosyl hydrolase family 18 protein locus_tag LOCUS_47900 sequence129 source 1..2248 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 178..381 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000985715.1 transl_table 11 codon_start 1 locus_tag LOCUS_47910 CDS 378..623 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153687.1 transl_table 11 codon_start 1 locus_tag LOCUS_47920 CDS 620..919 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000104305.1 transl_table 11 codon_start 1 locus_tag LOCUS_47930 CDS 1806..2036 product derepression protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000775057.1 transl_table 11 codon_start 1 locus_tag LOCUS_47940 sequence130 source 1..2058 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1269 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011987103.1:glycosyl hydrolase family 18 protein locus_tag LOCUS_47950 sequence131 source 1..2030 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(382..882) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47960 CDS complement(885..1844) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47970 sequence132 source 1..1854 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 32..355 product YfiM family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020685902.1 transl_table 11 codon_start 1 locus_tag LOCUS_47980 CDS complement(352..1650) product alpha-ketoglutarate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000841107.1 transl_table 11 codon_start 1 locus_tag LOCUS_47990 gene kgtP sequence133 source 1..1817 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence134 source 1..1670 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence135 source 1..1632 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence136 source 1..1585 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 169..594 product tail fiber assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001106835.1 transl_table 11 codon_start 1 locus_tag LOCUS_48000 CDS complement(566..1165) product tail fiber assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000548498.1 transl_table 11 codon_start 1 locus_tag LOCUS_48010 sequence137 source 1..1541 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(927..1058) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48020 sequence138 source 1..1511 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 455..1339 product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038157782.1 transl_table 11 codon_start 1 locus_tag LOCUS_48030 note possible pseudo, frameshifted sequence139 source 1..1457 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..527 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014966181.1:rhs element protein RhsC locus_tag LOCUS_48040 CDS 821..958 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48050 sequence140 source 1..1346 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence141 source 1..1340 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence142 source 1..1251 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 389..910 product tail fiber assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000420351.1 transl_table 11 codon_start 1 locus_tag LOCUS_48060 sequence143 source 1..1242 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 174..1154 product IS110-like element IS621 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000399635.1 transl_table 11 codon_start 1 locus_tag LOCUS_48070 sequence144 source 1..1225 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 140..289 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48080 note possible pseudo, internal stop codon CDS 472..765 product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000015547.1 transl_table 11 codon_start 1 locus_tag LOCUS_48090 sequence145 source 1..1051 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence146 source 1..1017 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(431..>1017) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000014997.1:RHS repeat-associated core domain-containing protein locus_tag LOCUS_48100 sequence147 source 1..1015 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..980 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000654812.1:IS5-like element IS903B family transposase locus_tag LOCUS_48110 sequence148 source 1..959 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence149 source 1..917 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence150 source 1..911 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence151 source 1..909 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(181..>909) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000509132.1:RHS element core protein note possible pseudo, frameshifted locus_tag LOCUS_48120 sequence152 source 1..877 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence153 source 1..874 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence154 source 1..820 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence155 source 1..773 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..510 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003147159.1:IS110-like element ISPa11 family transposase locus_tag LOCUS_48130 sequence156 source 1..737 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence157 source 1..709 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence158 source 1..701 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 66..626 product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000904922.1 transl_table 11 codon_start 1 locus_tag LOCUS_48140 sequence159 source 1..694 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence160 source 1..686 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence161 source 1..684 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence162 source 1..682 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence163 source 1..585 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(219..380) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48150 sequence164 source 1..574 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 90..479 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48160 note possible pseudo, internal stop codon sequence165 source 1..557 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence166 source 1..550 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence167 source 1..519 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence168 source 1..501 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence169 source 1..471 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence170 source 1..452 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence171 source 1..402 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence172 source 1..399 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence173 source 1..356 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence174 source 1..355 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence175 source 1..351 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence176 source 1..335 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence177 source 1..329 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence178 source 1..323 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence179 source 1..319 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 18..302 product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000537152.1 transl_table 11 codon_start 1 locus_tag LOCUS_48170 sequence180 source 1..313 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence181 source 1..281 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence182 source 1..279 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence183 source 1..279 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence184 source 1..271 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence185 source 1..263 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence186 source 1..261 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence187 source 1..249 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence188 source 1..245 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence189 source 1..233 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence190 source 1..233 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence191 source 1..44869 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..897 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013097050.1:glycoside hydrolase family 18 protein locus_tag LOCUS_48180 CDS 1016..1360 product HNH nuclease YajD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000974818.1 transl_table 11 codon_start 1 locus_tag LOCUS_48190 gene yajD CDS complement(1420..1695) product YeaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046790.1 transl_table 11 codon_start 1 locus_tag LOCUS_48200 CDS complement(1737..2150) product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001284618.1 transl_table 11 codon_start 1 locus_tag LOCUS_48210 gene msrB CDS 2484..3488 product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004203784.1 transl_table 11 codon_start 1 locus_tag LOCUS_48220 gene gapA CDS 3572..4456 product D-hexose-6-phosphate mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366147.1 transl_table 11 codon_start 1 locus_tag LOCUS_48230 CDS complement(4543..5397) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843742.1 transl_table 11 codon_start 1 locus_tag LOCUS_48240 CDS complement(5488..6234) product MipA/OmpV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000163762.1 transl_table 11 codon_start 1 locus_tag LOCUS_48250 CDS 6676..8610 product protein kinase YeaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019882.1 transl_table 11 codon_start 1 locus_tag LOCUS_48260 gene yeaG CDS 8734..10017 product YeaH/YhbH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000219687.1 transl_table 11 codon_start 1 locus_tag LOCUS_48270 CDS 10154..11644 product diguanylate cyclase DgcJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000766132.1 transl_table 11 codon_start 1 locus_tag LOCUS_48280 gene dgcJ CDS 11686..12189 product YbaK/prolyl-tRNA synthetase associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989016.1 transl_table 11 codon_start 1 locus_tag LOCUS_48290 CDS 12466..12912 product DUF441 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460707.1 transl_table 11 codon_start 1 locus_tag LOCUS_48300 CDS complement(13030..13737) product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097066.1 transl_table 11 codon_start 1 locus_tag LOCUS_48310 CDS 13892..14401 product DUF523 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705161.1 transl_table 11 codon_start 1 locus_tag LOCUS_48320 CDS 14385..14732 product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000678599.1 transl_table 11 codon_start 1 locus_tag LOCUS_48330 CDS complement(14718..15029) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000487129.1 transl_table 11 codon_start 1 locus_tag LOCUS_48340 CDS complement(15104..15262) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48350 CDS complement(15781..16029) product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000512149.1 transl_table 11 codon_start 1 locus_tag LOCUS_48360 CDS complement(16415..17098) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000762776.1 transl_table 11 codon_start 1 locus_tag LOCUS_48370 CDS complement(17261..17443) product DUF1869 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000513737.1 transl_table 11 codon_start 1 locus_tag LOCUS_48380 CDS complement(17446..17808) product DUF1971 domain-containing protein YeaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001248993.1 transl_table 11 codon_start 1 locus_tag LOCUS_48390 gene yeaR CDS complement(17974..18612) product leucine efflux protein LeuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000457190.1 transl_table 11 codon_start 1 locus_tag LOCUS_48400 gene leuE CDS complement(18816..18980) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48410 CDS 19016..20281 product Y-family DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366112.1 transl_table 11 codon_start 1 locus_tag LOCUS_48420 CDS 20410..21297 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037382345.1 transl_table 11 codon_start 1 locus_tag LOCUS_48430 CDS complement(21342..22679) product CitMHS family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038452.1 transl_table 11 codon_start 1 locus_tag LOCUS_48440 CDS complement(22755..23498) product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193701.1 transl_table 11 codon_start 1 locus_tag LOCUS_48450 CDS 23799..24899 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48460 CDS complement(24930..25853) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807817.1 transl_table 11 codon_start 1 locus_tag LOCUS_48470 CDS complement(25868..28516) product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259000.1 transl_table 11 codon_start 1 locus_tag LOCUS_48480 gene acnA CDS complement(28641..29318) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815414.1 transl_table 11 codon_start 1 locus_tag LOCUS_48490 CDS complement(29305..30687) product glucarate transporter GudP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234818.1 transl_table 11 codon_start 1 locus_tag LOCUS_48500 gene gudP CDS complement(30711..31589) product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153441905.1 transl_table 11 codon_start 1 locus_tag LOCUS_48510 CDS complement(31622..32275) product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085692.1 transl_table 11 codon_start 1 locus_tag LOCUS_48520 CDS complement(32327..33397) product isocitrate/isopropylmalate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139076345.1 transl_table 11 codon_start 1 locus_tag LOCUS_48530 CDS 33720..34982 product four-carbon acid sugar kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298110.1 transl_table 11 codon_start 1 locus_tag LOCUS_48540 CDS 34975..35613 product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170138703.1 transl_table 11 codon_start 1 locus_tag LOCUS_48550 CDS 35692..36993 product CitMHS family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003313973.1 transl_table 11 codon_start 1 locus_tag LOCUS_48560 CDS complement(37075..37491) product translesion error-prone DNA polymerase V autoproteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000897380.1 transl_table 11 codon_start 1 locus_tag LOCUS_48570 CDS complement(37704..38351) product metal-binding protein ZinT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000234684.1 transl_table 11 codon_start 1 locus_tag LOCUS_48580 gene zinT CDS complement(38490..38816) product four-helix bundle copper-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001183698.1 transl_table 11 codon_start 1 locus_tag LOCUS_48590 CDS 39166..40053 product extended-spectrum class A beta-lactamase CTX-M-15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000239590.1 transl_table 11 codon_start 1 locus_tag LOCUS_48600 gene blaCTX-M CDS 40140..40478 product DUF1471 family virulence protein SrfN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000745961.1 transl_table 11 codon_start 1 locus_tag LOCUS_48610 gene srfN tRNA complement(40573..40647) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00600 CDS 40888..41085 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096722.1 transl_table 11 codon_start 1 locus_tag LOCUS_48620 CDS 41087..41848 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096723.1 transl_table 11 codon_start 1 locus_tag LOCUS_48630 CDS 42106..42663 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48640 CDS complement(42824..43027) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48650 CDS complement(43234..44484) product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444506.1 transl_table 11 codon_start 1 locus_tag LOCUS_48660 gene icd