COMMON DATATYPE type WGS KEYWORD keyword WGS KEYWORD keyword STANDARD_DRAFT DBLINK project biosample SUBMITTER ab_name ab_name ab_name contact email phone fax institute country city street zip REFERENCE title ab_name ab_name ab_name status Unpublished year COMMENT line Annotated by DFAST v.1.2.20 (https://dfast.nig.ac.jp) ST_COMMENT tagset_id Genome-Assembly-Data Assembly Method Genome Coverage Sequencing Technology sequence1 source 1..1974256 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1037..2491) product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895182.1 transl_table 11 codon_start 1 locus_tag LOCUS_00010 gene proS CDS 3090..4085 product catabolite control protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564050.1 transl_table 11 codon_start 1 locus_tag LOCUS_00020 gene ccpA CDS 4120..4644 product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002385758.1 transl_table 11 codon_start 1 locus_tag LOCUS_00030 CDS complement(4733..5878) product mannitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476472.1 transl_table 11 codon_start 1 locus_tag LOCUS_00040 CDS complement(5878..6321) product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701041.1 transl_table 11 codon_start 1 locus_tag LOCUS_00050 CDS complement(6372..8498) product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387671.1 transl_table 11 codon_start 1 locus_tag LOCUS_00060 CDS complement(8612..10420) product PTS mannitol-specific transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391686.1 transl_table 11 codon_start 1 locus_tag LOCUS_00070 CDS 10718..11437 product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476356.1 transl_table 11 codon_start 1 locus_tag LOCUS_00080 gene nagB CDS 11430..12386 product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355148.1 transl_table 11 codon_start 1 locus_tag LOCUS_00090 CDS complement(12475..13992) product ABC transporter substrate-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674478.1 transl_table 11 codon_start 1 locus_tag LOCUS_00100 CDS complement(13983..15401) product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056221.1 transl_table 11 codon_start 1 locus_tag LOCUS_00110 gene argH CDS complement(15453..16940) product ABC transporter substrate-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476410.1 transl_table 11 codon_start 1 locus_tag LOCUS_00120 CDS complement(17332..18738) product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832742.1 transl_table 11 codon_start 1 locus_tag LOCUS_00130 CDS 18909..20627 product putative basic amino acid antiporter YfcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294022.1 transl_table 11 codon_start 1 locus_tag LOCUS_00140 gene yfcC CDS 20642..21823 product beta-aspartyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287126.1 transl_table 11 codon_start 1 locus_tag LOCUS_00150 gene iadA CDS complement(21877..22779) product acetamidase/formamidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000285667.1 transl_table 11 codon_start 1 locus_tag LOCUS_00160 CDS complement(22916..24211) product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359782.1 transl_table 11 codon_start 1 locus_tag LOCUS_00170 gene purB CDS 24856..26142 product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004254838.1 transl_table 11 codon_start 1 locus_tag LOCUS_00180 CDS complement(26269..27897) product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288864.1 transl_table 11 codon_start 1 locus_tag LOCUS_00190 gene groL CDS complement(27980..28249) product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288862.1 transl_table 11 codon_start 1 locus_tag LOCUS_00200 gene groES CDS complement(28607..29260) product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003710514.1 transl_table 11 codon_start 1 locus_tag LOCUS_00210 CDS 29495..31444 product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379727.1 transl_table 11 codon_start 1 locus_tag LOCUS_00220 CDS complement(31510..31791) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00230 CDS complement(31844..32860) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288444.1 transl_table 11 codon_start 1 locus_tag LOCUS_00240 gene tsaD CDS complement(32838..33236) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00250 CDS complement(33277..33939) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00260 CDS complement(33920..34651) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000865740.1 transl_table 11 codon_start 1 locus_tag LOCUS_00270 gene tsaB CDS 34832..35071 product DUF896 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831015.1 transl_table 11 codon_start 1 locus_tag LOCUS_00280 CDS complement(35178..35555) product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263544.1 transl_table 11 codon_start 1 locus_tag LOCUS_00290 CDS complement(35631..36074) product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000961810.1 transl_table 11 codon_start 1 locus_tag LOCUS_00300 CDS 36317..36472 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00310 CDS 36476..36646 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00320 repeat_region 36740..37560 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ggatcacccccgcatgtgcgggaaaaag CDS complement(37575..38495) product type I-E CRISPR-associated endoribonuclease Cas2e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674076.1 transl_table 11 codon_start 1 locus_tag LOCUS_00330 gene cas2e CDS complement(38496..39446) product type I-E CRISPR-associated endonuclease Cas1e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116440418.1 transl_table 11 codon_start 1 locus_tag LOCUS_00340 gene cas1e CDS complement(39451..40086) product type I-E CRISPR-associated protein Cas6/Cse3/CasE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112674.1 transl_table 11 codon_start 1 locus_tag LOCUS_00350 gene cas6e CDS complement(40089..40799) product type I-E CRISPR-associated protein Cas5/CasD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994022.1 transl_table 11 codon_start 1 locus_tag LOCUS_00360 gene cas5e CDS complement(40799..41923) product type I-E CRISPR-associated protein Cas7/Cse4/CasC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004138505.1 transl_table 11 codon_start 1 locus_tag LOCUS_00370 gene cas7e CDS complement(41913..42524) product type I-E CRISPR-associated protein Cse2/CasB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994023.1 transl_table 11 codon_start 1 locus_tag LOCUS_00380 gene casB CDS complement(42517..44247) product type I-E CRISPR-associated protein Cse1/CasA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994024.1 transl_table 11 codon_start 1 locus_tag LOCUS_00390 CDS complement(44252..47005) product CRISPR-associated helicase Cas3' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116440412.1 transl_table 11 codon_start 1 locus_tag LOCUS_00400 gene cas3 CDS complement(47278..48123) product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701698.1 transl_table 11 codon_start 1 locus_tag LOCUS_00410 CDS complement(48251..49558) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00420 CDS complement(49714..50709) product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702981.1 transl_table 11 codon_start 1 locus_tag LOCUS_00430 CDS 50961..52310 product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361550.1 transl_table 11 codon_start 1 locus_tag LOCUS_00440 gene brnQ CDS complement(52377..53234) product glutathione S-transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978084.1 transl_table 11 codon_start 1 locus_tag LOCUS_00450 CDS complement(53327..53593) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00460 CDS complement(53813..54904) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00470 CDS complement(54923..55636) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00480 CDS complement(55895..56077) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00490 CDS complement(56242..56496) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00500 repeat_region 56513..58674 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ggatcacccccgcatgtgcgggaaaaag CDS complement(58770..59072) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00510 CDS complement(59114..59731) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476045.1 transl_table 11 codon_start 1 locus_tag LOCUS_00520 CDS complement(59830..61155) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014636651.1 transl_table 11 codon_start 1 locus_tag LOCUS_00530 CDS complement(61211..62338) product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776662.1 transl_table 11 codon_start 1 locus_tag LOCUS_00540 CDS complement(62343..63491) product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776663.1 transl_table 11 codon_start 1 locus_tag LOCUS_00550 CDS 63808..64110 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00560 CDS 64395..65603 product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861646.1 transl_table 11 codon_start 1 locus_tag LOCUS_00570 CDS complement(65676..66380) product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000236018.1 transl_table 11 codon_start 1 locus_tag LOCUS_00580 CDS 66714..68030 product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048240.1 transl_table 11 codon_start 1 locus_tag LOCUS_00590 gene brnQ CDS 68167..68607 product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944311.1 transl_table 11 codon_start 1 locus_tag LOCUS_00600 CDS complement(68678..69991) product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389943.1 transl_table 11 codon_start 1 locus_tag LOCUS_00610 CDS 70213..70833 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00620 CDS complement(70908..71876) product 2-keto-3-deoxygluconate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003395562.1 transl_table 11 codon_start 1 locus_tag LOCUS_00630 CDS 72166..74712 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00640 CDS 74883..75854 product rhodanese-related sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836611.1 transl_table 11 codon_start 1 locus_tag LOCUS_00650 CDS complement(75948..76310) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00660 CDS complement(76545..77753) product cobalamin-independent methionine synthase II family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856473.1 transl_table 11 codon_start 1 locus_tag LOCUS_00670 tRNA complement(78012..78087) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00010 CDS 78202..78954 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836799.1 transl_table 11 codon_start 1 locus_tag LOCUS_00680 CDS complement(78991..79587) product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262735.1 transl_table 11 codon_start 1 locus_tag LOCUS_00690 CDS complement(79732..80640) product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254510.1 transl_table 11 codon_start 1 locus_tag LOCUS_00700 gene fba CDS complement(80920..82062) product alpha-hydroxy-acid oxidizing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296473.1 transl_table 11 codon_start 1 locus_tag LOCUS_00710 CDS complement(82237..84225) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002470142.1 transl_table 11 codon_start 1 locus_tag LOCUS_00720 CDS complement(84227..84976) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830627.1 transl_table 11 codon_start 1 locus_tag LOCUS_00730 CDS complement(85083..85988) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002456718.1 transl_table 11 codon_start 1 locus_tag LOCUS_00740 CDS complement(85985..86677) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830679.1 transl_table 11 codon_start 1 locus_tag LOCUS_00750 CDS 87555..88598 product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673966.1 transl_table 11 codon_start 1 locus_tag LOCUS_00760 gene trpD CDS 88570..89370 product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003592589.1 transl_table 11 codon_start 1 locus_tag LOCUS_00770 gene trpC CDS 89357..89962 product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966436.1 transl_table 11 codon_start 1 locus_tag LOCUS_00780 CDS 89955..91139 product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101492.1 transl_table 11 codon_start 1 locus_tag LOCUS_00790 gene trpB CDS 91132..91905 product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673965.1 transl_table 11 codon_start 1 locus_tag LOCUS_00800 gene trpA CDS complement(91987..93573) product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029492321.1 transl_table 11 codon_start 1 locus_tag LOCUS_00810 gene sppA CDS 94083..95114 product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136824.1 transl_table 11 codon_start 1 locus_tag LOCUS_00820 CDS 95114..95308 product PTS ascorbate transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000796544.1 transl_table 11 codon_start 1 locus_tag LOCUS_00830 CDS complement(95366..96103) product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000560304.1 transl_table 11 codon_start 1 locus_tag LOCUS_00840 gene yjfP CDS complement(96307..96597) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00850 CDS 96794..97330 product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814144.1 transl_table 11 codon_start 1 locus_tag LOCUS_00860 CDS 97330..97875 product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052021.1 transl_table 11 codon_start 1 locus_tag LOCUS_00870 CDS complement(97922..98179) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00880 CDS 98460..99494 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00890 CDS 99613..100485 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670726.1 transl_table 11 codon_start 1 locus_tag LOCUS_00900 CDS 100549..101265 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681811.1 transl_table 11 codon_start 1 locus_tag LOCUS_00910 CDS 101292..102509 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00920 CDS complement(102581..103003) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00930 CDS complement(103154..104128) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459857.1 transl_table 11 codon_start 1 locus_tag LOCUS_00940 CDS complement(104410..106845) product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966018.1 transl_table 11 codon_start 1 locus_tag LOCUS_00950 CDS complement(106838..107518) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888282.1 transl_table 11 codon_start 1 locus_tag LOCUS_00960 CDS complement(107609..108448) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00970 CDS complement(108445..109086) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861224.1 transl_table 11 codon_start 1 locus_tag LOCUS_00980 CDS complement(109475..110911) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109309.1 transl_table 11 codon_start 1 locus_tag LOCUS_00990 CDS complement(111527..111964) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01000 CDS complement(112018..112665) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01010 CDS complement(112662..113000) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026184004.1 transl_table 11 codon_start 1 locus_tag LOCUS_01020 CDS complement(113143..113382) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01030 CDS complement(113629..114093) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01040 note possible pseudo, internal stop codon CDS complement(114096..114836) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01050 CDS complement(114856..115797) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673984.1 transl_table 11 codon_start 1 locus_tag LOCUS_01060 CDS complement(115809..116387) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01070 CDS complement(116649..116996) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01080 CDS complement(117181..118575) product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476294.1 transl_table 11 codon_start 1 locus_tag LOCUS_01090 gene rlmD CDS complement(118872..120023) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01100 CDS complement(120036..120842) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01110 CDS complement(120839..121528) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893181.1 transl_table 11 codon_start 1 locus_tag LOCUS_01120 CDS complement(121521..121898) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392689.1 transl_table 11 codon_start 1 locus_tag LOCUS_01130 CDS complement(122126..122479) product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011241744.1 transl_table 11 codon_start 1 locus_tag LOCUS_01140 CDS complement(122473..122715) product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001748109.1 transl_table 11 codon_start 1 locus_tag LOCUS_01150 CDS 122981..123538 product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933341.1 transl_table 11 codon_start 1 locus_tag LOCUS_01160 CDS complement(123664..124011) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01170 CDS complement(124052..124276) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01180 CDS complement(124450..125586) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01190 CDS complement(125719..126225) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01200 CDS complement(126251..126865) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01210 CDS complement(126913..127143) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01220 CDS complement(127730..128608) product S-adenosyl-l-methionine hydroxide adenosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000528922.1 transl_table 11 codon_start 1 locus_tag LOCUS_01230 CDS complement(128612..129460) product S-adenosyl-l-methionine hydroxide adenosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000528922.1 transl_table 11 codon_start 1 locus_tag LOCUS_01240 CDS complement(129542..130384) product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262139.1 transl_table 11 codon_start 1 locus_tag LOCUS_01250 CDS complement(130385..132115) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100903.1 transl_table 11 codon_start 1 locus_tag LOCUS_01260 CDS complement(132115..132669) product ECF-type riboflavin transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005375133.1 transl_table 11 codon_start 1 locus_tag LOCUS_01270 CDS 133042..133308 product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272532.1 transl_table 11 codon_start 1 locus_tag LOCUS_01280 CDS complement(133437..133589) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01290 CDS complement(133573..133947) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01300 note possible pseudo, frameshifted CDS complement(133995..134210) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01310 CDS complement(134421..135800) product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361260.1 transl_table 11 codon_start 1 locus_tag LOCUS_01320 gene rlmD CDS 135981..136733 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109565.1 transl_table 11 codon_start 1 locus_tag LOCUS_01330 CDS 136836..137672 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000451355.1 transl_table 11 codon_start 1 locus_tag LOCUS_01340 CDS complement(137739..138224) product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700626.1 transl_table 11 codon_start 1 locus_tag LOCUS_01350 CDS complement(138291..139277) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475724.1 transl_table 11 codon_start 1 locus_tag LOCUS_01360 CDS complement(139301..140881) product bifunctional metallophosphatase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002378886.1 transl_table 11 codon_start 1 locus_tag LOCUS_01370 CDS complement(140893..141708) product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905273.1 transl_table 11 codon_start 1 locus_tag LOCUS_01380 gene phnE CDS complement(141720..142523) product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131699.1 transl_table 11 codon_start 1 locus_tag LOCUS_01390 gene phnE CDS complement(142534..143271) product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905272.1 transl_table 11 codon_start 1 locus_tag LOCUS_01400 gene phnC CDS complement(143448..144491) product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905271.1 transl_table 11 codon_start 1 locus_tag LOCUS_01410 CDS complement(144850..149817) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01420 CDS complement(150091..157947) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01430 CDS complement(158327..159757) product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288473.1 transl_table 11 codon_start 1 locus_tag LOCUS_01440 gene gatB CDS complement(159773..161224) product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361259.1 transl_table 11 codon_start 1 locus_tag LOCUS_01450 gene gatA CDS complement(161230..161529) product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288477.1 transl_table 11 codon_start 1 locus_tag LOCUS_01460 gene gatC CDS complement(161671..162807) product CamS family sex pheromone protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701508.1 transl_table 11 codon_start 1 locus_tag LOCUS_01470 CDS complement(162871..164904) product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361258.1 transl_table 11 codon_start 1 locus_tag LOCUS_01480 gene ligA CDS complement(164916..167372) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01490 CDS complement(167531..168187) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721889.1 transl_table 11 codon_start 1 locus_tag LOCUS_01500 CDS complement(168268..168921) product glycoside hydrolase family 73 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905908.1 transl_table 11 codon_start 1 locus_tag LOCUS_01510 CDS complement(169422..170240) product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830630.1 transl_table 11 codon_start 1 locus_tag LOCUS_01520 CDS complement(170237..170866) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009933158.1 transl_table 11 codon_start 1 locus_tag LOCUS_01530 CDS complement(170914..173553) product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830624.1 transl_table 11 codon_start 1 locus_tag LOCUS_01540 gene ppdK CDS complement(174013..174720) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646064.1 transl_table 11 codon_start 1 locus_tag LOCUS_01550 CDS complement(174724..175497) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002937291.1 transl_table 11 codon_start 1 locus_tag LOCUS_01560 CDS complement(175499..176506) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101995.1 transl_table 11 codon_start 1 locus_tag LOCUS_01570 CDS complement(176516..177394) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000941421.1 transl_table 11 codon_start 1 locus_tag LOCUS_01580 CDS complement(177543..178721) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393979.1 transl_table 11 codon_start 1 locus_tag LOCUS_01590 CDS complement(178944..180119) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415515.1 transl_table 11 codon_start 1 locus_tag LOCUS_01600 CDS complement(180968..182131) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101996.1 transl_table 11 codon_start 1 locus_tag LOCUS_01610 CDS complement(182485..185316) product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286287.1 transl_table 11 codon_start 1 locus_tag LOCUS_01620 CDS complement(185310..186011) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549550.1 transl_table 11 codon_start 1 locus_tag LOCUS_01630 CDS 186179..186994 product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003662288.1 transl_table 11 codon_start 1 locus_tag LOCUS_01640 CDS complement(187105..188277) product PIN/TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287448.1 transl_table 11 codon_start 1 locus_tag LOCUS_01650 CDS complement(188364..189752) product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643928.1 transl_table 11 codon_start 1 locus_tag LOCUS_01660 gene radA CDS complement(189782..190303) product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287450.1 transl_table 11 codon_start 1 locus_tag LOCUS_01670 CDS 190460..190645 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01680 CDS complement(190872..193799) product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048254.1 transl_table 11 codon_start 1 locus_tag LOCUS_01690 CDS 193976..194749 product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967191.1 transl_table 11 codon_start 1 locus_tag LOCUS_01700 gene pgeF CDS complement(194823..197468) product bifunctional acetaldehyde-CoA/alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000137036.1 transl_table 11 codon_start 1 locus_tag LOCUS_01710 gene adhE CDS complement(197867..199315) product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941267.1 transl_table 11 codon_start 1 locus_tag LOCUS_01720 gene thiD CDS complement(199302..200141) product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966377.1 transl_table 11 codon_start 1 locus_tag LOCUS_01730 gene thiM CDS complement(200789..201487) product LysM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286836.1 transl_table 11 codon_start 1 locus_tag LOCUS_01740 CDS complement(201803..202678) product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016071.1 transl_table 11 codon_start 1 locus_tag LOCUS_01750 gene nadC CDS 202965..203546 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262515.1 transl_table 11 codon_start 1 locus_tag LOCUS_01760 tRNA complement(203674..203747) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00020 tRNA complement(203759..203841) product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00030 CDS 204074..204925 product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643987.1 transl_table 11 codon_start 1 locus_tag LOCUS_01770 gene cdaA CDS 204918..206012 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01780 CDS 206084..207451 product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287824.1 transl_table 11 codon_start 1 locus_tag LOCUS_01790 gene glmM CDS complement(207558..207701) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01800 CDS complement(207848..208429) product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964937.1 transl_table 11 codon_start 1 locus_tag LOCUS_01810 CDS complement(208531..208833) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002300467.1 transl_table 11 codon_start 1 locus_tag LOCUS_01820 CDS complement(208933..209838) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288888.1 transl_table 11 codon_start 1 locus_tag LOCUS_01830 CDS complement(209866..210960) product cystathionine gamma-synthase/O-acetylhomoserine thiolyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000103910.1 transl_table 11 codon_start 1 locus_tag LOCUS_01840 gene metI tRNA complement(211158..211230) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00040 tRNA complement(211251..211326) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00050 rRNA complement(211341..211451) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00010 rRNA complement(211534..214433) product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00020 tRNA complement(214603..214675) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00060 tRNA complement(214710..214783) product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00070 rRNA complement(214866..216409) product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00030 CDS complement(216834..217598) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01850 CDS complement(217832..218551) product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000008113.1 transl_table 11 codon_start 1 locus_tag LOCUS_01860 CDS 218741..219952 product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732150.1 transl_table 11 codon_start 1 locus_tag LOCUS_01870 CDS complement(220029..220505) product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986910.1 transl_table 11 codon_start 1 locus_tag LOCUS_01880 CDS complement(220498..221304) product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459298.1 transl_table 11 codon_start 1 locus_tag LOCUS_01890 CDS complement(221892..222605) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01900 CDS 222769..223464 product YoaK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836830.1 transl_table 11 codon_start 1 locus_tag LOCUS_01910 CDS complement(223493..224440) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01920 CDS 224629..225177 product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009993984.1 transl_table 11 codon_start 1 locus_tag LOCUS_01930 CDS complement(225269..226462) product DUF819 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356229.1 transl_table 11 codon_start 1 locus_tag LOCUS_01940 CDS complement(226497..227684) product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135960345.1 transl_table 11 codon_start 1 locus_tag LOCUS_01950 CDS 228211..229413 product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808619.1 transl_table 11 codon_start 1 locus_tag LOCUS_01960 CDS 229759..230940 product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016308.1 transl_table 11 codon_start 1 locus_tag LOCUS_01970 gene trpB CDS complement(231101..232246) product ArgE/DapE family deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368474.1 transl_table 11 codon_start 1 locus_tag LOCUS_01980 CDS 232428..234068 product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808649.1 transl_table 11 codon_start 1 locus_tag LOCUS_01990 CDS 234155..234586 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02000 CDS complement(234964..236115) product lactaldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288246.1 transl_table 11 codon_start 1 locus_tag LOCUS_02010 gene fucO CDS 236760..237020 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02020 CDS 237033..237182 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02030 tRNA complement(237495..237567) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00080 CDS complement(237714..239087) product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381331.1 transl_table 11 codon_start 1 locus_tag LOCUS_02040 gene dnaB CDS complement(239236..239688) product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356023.1 transl_table 11 codon_start 1 locus_tag LOCUS_02050 gene rplI CDS complement(239822..240601) product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095910.1 transl_table 11 codon_start 1 locus_tag LOCUS_02060 gene fetB CDS complement(240615..241397) product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643458.1 transl_table 11 codon_start 1 locus_tag LOCUS_02070 gene fetB CDS complement(241390..242100) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642453.1 transl_table 11 codon_start 1 locus_tag LOCUS_02080 CDS complement(242218..244248) product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643610.1 transl_table 11 codon_start 1 locus_tag LOCUS_02090 CDS complement(246821..247339) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02100 CDS complement(247323..247532) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001082472.1 transl_table 11 codon_start 1 locus_tag LOCUS_02110 CDS complement(247778..248017) product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701427.1 transl_table 11 codon_start 1 locus_tag LOCUS_02120 gene rpsR CDS complement(248045..248617) product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003662304.1 transl_table 11 codon_start 1 locus_tag LOCUS_02130 gene ssb CDS complement(248653..248955) product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002983117.1 transl_table 11 codon_start 1 locus_tag LOCUS_02140 gene rpsF CDS complement(248997..249194) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02150 CDS 249279..250580 product M20 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705259.1 transl_table 11 codon_start 1 locus_tag LOCUS_02160 CDS 250573..251991 product YfcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966488.1 transl_table 11 codon_start 1 locus_tag LOCUS_02170 CDS 252023..253012 product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567083.1 transl_table 11 codon_start 1 locus_tag LOCUS_02180 tRNA 253161..253240 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00090 CDS complement(253600..254091) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922234.1 transl_table 11 codon_start 1 locus_tag LOCUS_02190 CDS complement(254219..255523) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296456.1 transl_table 11 codon_start 1 locus_tag LOCUS_02200 CDS complement(255516..256421) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295091.1 transl_table 11 codon_start 1 locus_tag LOCUS_02210 CDS complement(256802..259450) product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641633.1 transl_table 11 codon_start 1 locus_tag LOCUS_02220 gene gyrA CDS complement(259470..261452) product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288364.1 transl_table 11 codon_start 1 locus_tag LOCUS_02230 gene gyrB CDS complement(261463..262581) product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243515.1 transl_table 11 codon_start 1 locus_tag LOCUS_02240 gene recF CDS complement(262571..262834) product S4 domain-containing protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356015.1 transl_table 11 codon_start 1 locus_tag LOCUS_02250 gene yaaA CDS complement(263177..264511) product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965834.1 transl_table 11 codon_start 1 locus_tag LOCUS_02260 CDS complement(264766..265917) product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356014.1 transl_table 11 codon_start 1 locus_tag LOCUS_02270 gene dnaN CDS complement(266165..267517) product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673926.1 transl_table 11 codon_start 1 locus_tag LOCUS_02280 gene dnaA CDS complement(268491..269540) product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594488.1 transl_table 11 codon_start 1 locus_tag LOCUS_02290 CDS complement(269616..271067) product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369348.1 transl_table 11 codon_start 1 locus_tag LOCUS_02300 CDS complement(271111..272100) product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003579170.1 transl_table 11 codon_start 1 locus_tag LOCUS_02310 CDS complement(272134..273168) product thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674510.1 transl_table 11 codon_start 1 locus_tag LOCUS_02320 CDS complement(273219..274631) product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706660.1 transl_table 11 codon_start 1 locus_tag LOCUS_02330 gene lpdA CDS 275004..275138 product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293121.1 transl_table 11 codon_start 1 locus_tag LOCUS_02340 gene rpmH CDS 275190..275576 product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701410.1 transl_table 11 codon_start 1 locus_tag LOCUS_02350 gene rnpA CDS 275566..276417 product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641627.1 transl_table 11 codon_start 1 locus_tag LOCUS_02360 gene yidC CDS 276433..277425 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02370 CDS 277774..278691 product 3-hydroxyacyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460375.1 transl_table 11 codon_start 1 locus_tag LOCUS_02380 CDS 278794..280008 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013536.1 transl_table 11 codon_start 1 locus_tag LOCUS_02390 CDS complement(280142..281473) product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641042.1 transl_table 11 codon_start 1 locus_tag LOCUS_02400 gene rpoN CDS 281604..282023 product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002989935.1 transl_table 11 codon_start 1 locus_tag LOCUS_02410 CDS 282048..282542 product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354800.1 transl_table 11 codon_start 1 locus_tag LOCUS_02420 CDS 282565..283383 product PTS mannose/fructose/sorbose/N-acetylgalactosamine transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002365419.1 transl_table 11 codon_start 1 locus_tag LOCUS_02430 CDS 283380..284228 product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354796.1 transl_table 11 codon_start 1 locus_tag LOCUS_02440 CDS 284322..286889 product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010819093.1 transl_table 11 codon_start 1 locus_tag LOCUS_02450 CDS complement(287205..287867) product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009933281.1 transl_table 11 codon_start 1 locus_tag LOCUS_02460 CDS complement(288062..288385) product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289297.1 transl_table 11 codon_start 1 locus_tag LOCUS_02470 CDS complement(288538..289752) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262240.1 transl_table 11 codon_start 1 locus_tag LOCUS_02480 CDS 289972..291768 product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287647.1 transl_table 11 codon_start 1 locus_tag LOCUS_02490 CDS complement(292487..293809) product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080781.1 transl_table 11 codon_start 1 locus_tag LOCUS_02500 CDS 294244..294975 product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002901131.1 transl_table 11 codon_start 1 locus_tag LOCUS_02510 CDS 294976..295263 product energy-coupling factor ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721603.1 transl_table 11 codon_start 1 locus_tag LOCUS_02520 CDS 295353..296030 product energy-coupling factor ABC transporter transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721604.1 transl_table 11 codon_start 1 locus_tag LOCUS_02530 CDS 296114..296854 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836535.1 transl_table 11 codon_start 1 locus_tag LOCUS_02540 CDS 297044..298432 product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295261.1 transl_table 11 codon_start 1 locus_tag LOCUS_02550 gene mnmE CDS 298739..299728 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459857.1 transl_table 11 codon_start 1 locus_tag LOCUS_02560 CDS 299956..301845 product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288799.1 transl_table 11 codon_start 1 locus_tag LOCUS_02570 gene mnmG CDS complement(302147..303649) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970010.1 transl_table 11 codon_start 1 locus_tag LOCUS_02580 CDS complement(303656..304435) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388559.1 transl_table 11 codon_start 1 locus_tag LOCUS_02590 CDS complement(304425..305348) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867267.1 transl_table 11 codon_start 1 locus_tag LOCUS_02600 CDS complement(305399..306910) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015726.1 transl_table 11 codon_start 1 locus_tag LOCUS_02610 CDS 307163..308080 product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721353.1 transl_table 11 codon_start 1 locus_tag LOCUS_02620 CDS 309114..309320 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02630 CDS 309377..310369 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02640 CDS 310552..311706 product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093428.1 transl_table 11 codon_start 1 locus_tag LOCUS_02650 CDS complement(312060..312743) product antiholin-like protein LrgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002365411.1 transl_table 11 codon_start 1 locus_tag LOCUS_02660 gene lrgB CDS complement(312797..313246) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02670 CDS complement(313402..314133) product LytTR family transcriptional regulator DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002367483.1 transl_table 11 codon_start 1 locus_tag LOCUS_02680 CDS complement(314136..315917) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354827.1 transl_table 11 codon_start 1 locus_tag LOCUS_02690 CDS 316267..316986 product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355977.1 transl_table 11 codon_start 1 locus_tag LOCUS_02700 gene rsmG CDS 317448..321281 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02710 CDS 321575..322795 product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016614.1 transl_table 11 codon_start 1 locus_tag LOCUS_02720 gene pepT CDS 323095..324003 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263495.1 transl_table 11 codon_start 1 locus_tag LOCUS_02730 CDS 324008..324757 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922411.1 transl_table 11 codon_start 1 locus_tag LOCUS_02740 CDS 324754..325488 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922410.1 transl_table 11 codon_start 1 locus_tag LOCUS_02750 CDS complement(325658..326902) product aminoacyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485777.1 transl_table 11 codon_start 1 locus_tag LOCUS_02760 CDS 327155..328870 product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564130.1 transl_table 11 codon_start 1 locus_tag LOCUS_02770 CDS 329050..329259 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02780 CDS 329581..330345 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355976.1 transl_table 11 codon_start 1 locus_tag LOCUS_02790 CDS 330335..331300 product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288806.1 transl_table 11 codon_start 1 locus_tag LOCUS_02800 CDS 331311..331514 product DUF951 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226838.1 transl_table 11 codon_start 1 locus_tag LOCUS_02810 CDS 331623..332720 product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293105.1 transl_table 11 codon_start 1 locus_tag LOCUS_02820 gene ychF CDS 332733..333446 product DUF1129 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002363563.1 transl_table 11 codon_start 1 locus_tag LOCUS_02830 CDS complement(333934..336645) product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012560551.1 transl_table 11 codon_start 1 locus_tag LOCUS_02840 gene ppc CDS 337021..338652 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02850 CDS complement(338977..340239) product lipid II:glycine glycyltransferase FemX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002438530.1 transl_table 11 codon_start 1 locus_tag LOCUS_02860 CDS complement(340349..341419) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475731.1 transl_table 11 codon_start 1 locus_tag LOCUS_02870 CDS complement(341454..342212) product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076168.1 transl_table 11 codon_start 1 locus_tag LOCUS_02880 CDS 343015..343704 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355963.1 transl_table 11 codon_start 1 locus_tag LOCUS_02890 CDS 344108..345265 product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642423.1 transl_table 11 codon_start 1 locus_tag LOCUS_02900 CDS 345249..346616 product D-alanyl-D-alanine carboxypeptidase PBPD1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990060.1 transl_table 11 codon_start 1 locus_tag LOCUS_02910 gene pbpD1 CDS complement(346693..347085) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02920 CDS complement(347099..347560) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02930 CDS 348004..349302 product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949123.1 transl_table 11 codon_start 1 locus_tag LOCUS_02940 CDS 349318..351021 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681029.1 transl_table 11 codon_start 1 locus_tag LOCUS_02950 CDS 351051..351824 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061777.1 transl_table 11 codon_start 1 locus_tag LOCUS_02960 CDS 351827..352288 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02970 CDS 352301..352876 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02980 note possible pseudo, internal stop codon CDS 352879..353649 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064800.1 transl_table 11 codon_start 1 locus_tag LOCUS_02990 CDS complement(353826..353951) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03000 CDS complement(354082..355443) product guanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379675.1 transl_table 11 codon_start 1 locus_tag LOCUS_03010 gene guaD CDS 355811..357037 product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861646.1 transl_table 11 codon_start 1 locus_tag LOCUS_03020 CDS 357521..358819 product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130891.1 transl_table 11 codon_start 1 locus_tag LOCUS_03030 gene serS CDS 359132..359656 product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723414.1 transl_table 11 codon_start 1 locus_tag LOCUS_03040 gene msrA CDS 360543..361571 product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701500.1 transl_table 11 codon_start 1 locus_tag LOCUS_03050 CDS 362027..362251 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03060 CDS 362293..362565 product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000041497.1 transl_table 11 codon_start 1 locus_tag LOCUS_03070 CDS complement(362787..362969) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03080 CDS 362982..364928 product copper/silver-translocating P-type ATPase CopB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296533.1 transl_table 11 codon_start 1 locus_tag LOCUS_03090 gene copB CDS complement(365294..365995) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03100 note possible pseudo, frameshifted CDS complement(366112..366843) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03110 CDS 366988..367173 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03120 CDS 367215..367484 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03130 CDS 367905..369101 product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016536.1 transl_table 11 codon_start 1 locus_tag LOCUS_03140 CDS 369180..369587 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002388239.1 transl_table 11 codon_start 1 locus_tag LOCUS_03150 CDS 369767..370678 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964896.1 transl_table 11 codon_start 1 locus_tag LOCUS_03160 CDS complement(370675..371211) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03170 CDS 371509..372882 product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228523.1 transl_table 11 codon_start 1 locus_tag LOCUS_03180 gene fumC CDS 372955..374385 product anion permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830484.1 transl_table 11 codon_start 1 locus_tag LOCUS_03190 CDS 374455..375810 product flavocytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356617.1 transl_table 11 codon_start 1 locus_tag LOCUS_03200 CDS 376035..376691 product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721855.1 transl_table 11 codon_start 1 locus_tag LOCUS_03210 gene rpe CDS 376853..378238 product PTS galactitol transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966239.1 transl_table 11 codon_start 1 locus_tag LOCUS_03220 CDS 378241..379164 product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693668.1 transl_table 11 codon_start 1 locus_tag LOCUS_03230 gene rbsK CDS 379405..380121 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03240 CDS 380194..380889 product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003706781.1 transl_table 11 codon_start 1 locus_tag LOCUS_03250 gene rpiA CDS 381015..381764 product myo-inositol utilization transcriptional regulator IolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227050.1 transl_table 11 codon_start 1 locus_tag LOCUS_03260 gene iolR CDS 381778..382725 product 1-phosphofructokinase family hexose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989895.1 transl_table 11 codon_start 1 locus_tag LOCUS_03270 CDS 382730..383356 product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989894.1 transl_table 11 codon_start 1 locus_tag LOCUS_03280 CDS 383863..385860 product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295818.1 transl_table 11 codon_start 1 locus_tag LOCUS_03290 gene tkt CDS 385963..386610 product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723193.1 transl_table 11 codon_start 1 locus_tag LOCUS_03300 gene fsa CDS 387314..387469 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03310 CDS 387488..388144 product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646055.1 transl_table 11 codon_start 1 locus_tag LOCUS_03320 CDS 388757..389413 product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646055.1 transl_table 11 codon_start 1 locus_tag LOCUS_03330 CDS 389653..390606 product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476540.1 transl_table 11 codon_start 1 locus_tag LOCUS_03340 gene trxB CDS 390667..390978 product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004596708.1 transl_table 11 codon_start 1 locus_tag LOCUS_03350 gene trxA CDS 391418..392179 product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001158696.1 transl_table 11 codon_start 1 locus_tag LOCUS_03360 CDS complement(392224..393162) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722212.1 transl_table 11 codon_start 1 locus_tag LOCUS_03370 CDS 393396..394181 product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082975.1 transl_table 11 codon_start 1 locus_tag LOCUS_03380 CDS 394250..395197 product DUF561 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722294.1 transl_table 11 codon_start 1 locus_tag LOCUS_03390 CDS 395397..396650 product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808812.1 transl_table 11 codon_start 1 locus_tag LOCUS_03400 CDS complement(396750..397004) product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464459.1 transl_table 11 codon_start 1 locus_tag LOCUS_03410 CDS complement(397004..397249) product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_125586694.1 transl_table 11 codon_start 1 locus_tag LOCUS_03420 CDS complement(397387..398124) product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000195907.1 transl_table 11 codon_start 1 locus_tag LOCUS_03430 CDS complement(398831..399502) product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243990.1 transl_table 11 codon_start 1 locus_tag LOCUS_03440 CDS 399653..400141 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011675005.1 transl_table 11 codon_start 1 locus_tag LOCUS_03450 CDS complement(400243..401433) product DUF6287 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000732627.1 transl_table 11 codon_start 1 locus_tag LOCUS_03460 CDS 401648..401887 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03470 CDS 402394..403206 product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434107.1 transl_table 11 codon_start 1 locus_tag LOCUS_03480 CDS 403208..404179 product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949059.1 transl_table 11 codon_start 1 locus_tag LOCUS_03490 CDS 404181..404840 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358543.1 transl_table 11 codon_start 1 locus_tag LOCUS_03500 CDS 404879..405892 product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837554.1 transl_table 11 codon_start 1 locus_tag LOCUS_03510 CDS complement(406016..406699) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03520 CDS 406947..407552 product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000599739.1 transl_table 11 codon_start 1 locus_tag LOCUS_03530 CDS complement(407647..407973) product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293844.1 transl_table 11 codon_start 1 locus_tag LOCUS_03540 CDS complement(407978..409678) product DUF2075 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399551.1 transl_table 11 codon_start 1 locus_tag LOCUS_03550 CDS 410599..411828 product DNA (cytosine-5-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964810.1 transl_table 11 codon_start 1 locus_tag LOCUS_03560 gene dcm CDS 411851..413026 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03570 CDS complement(413090..413308) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03580 CDS complement(413727..413948) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03590 CDS 414318..415181 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03600 CDS complement(415325..415909) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03610 CDS 416082..416231 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03620 CDS 416593..417510 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03630 CDS 417619..418065 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03640 CDS 418049..418207 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03650 CDS 418273..418800 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03660 CDS 418954..419151 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03670 CDS 419183..419425 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03680 CDS 419519..419803 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03690 CDS 419794..420027 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03700 CDS 420002..420853 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03710 CDS complement(420900..421418) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03720 CDS 421650..423116 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459518.1 transl_table 11 codon_start 1 locus_tag LOCUS_03730 CDS 423129..423398 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03740 CDS 423590..424348 product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814140.1 transl_table 11 codon_start 1 locus_tag LOCUS_03750 CDS 424560..425624 product DUF871 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905774.1 transl_table 11 codon_start 1 locus_tag LOCUS_03760 CDS 425629..426549 product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642887.1 transl_table 11 codon_start 1 locus_tag LOCUS_03770 gene murQ CDS 426542..428014 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03780 CDS 428020..428883 product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002385762.1 transl_table 11 codon_start 1 locus_tag LOCUS_03790 CDS 429074..430567 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011675060.1 transl_table 11 codon_start 1 locus_tag LOCUS_03800 CDS 430571..431308 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000598666.1 transl_table 11 codon_start 1 locus_tag LOCUS_03810 CDS 431444..432511 product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289801.1 transl_table 11 codon_start 1 locus_tag LOCUS_03820 CDS 432569..433576 product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002321171.1 transl_table 11 codon_start 1 locus_tag LOCUS_03830 CDS 433850..435646 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703251.1 transl_table 11 codon_start 1 locus_tag LOCUS_03840 CDS complement(435722..436615) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890955.1 transl_table 11 codon_start 1 locus_tag LOCUS_03850 CDS 436884..437765 product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002983735.1 transl_table 11 codon_start 1 locus_tag LOCUS_03860 CDS 437799..439016 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704390.1 transl_table 11 codon_start 1 locus_tag LOCUS_03870 CDS 439031..439789 product type I 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357400.1 transl_table 11 codon_start 1 locus_tag LOCUS_03880 gene aroD CDS 439850..441208 product citrate:proton symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263232.1 transl_table 11 codon_start 1 locus_tag LOCUS_03890 CDS 441562..442578 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001033831.1 transl_table 11 codon_start 1 locus_tag LOCUS_03900 CDS 442600..443076 product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425168.1 transl_table 11 codon_start 1 locus_tag LOCUS_03910 CDS 443106..443870 product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355079.1 transl_table 11 codon_start 1 locus_tag LOCUS_03920 CDS 443873..444688 product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435940.1 transl_table 11 codon_start 1 locus_tag LOCUS_03930 CDS 444714..445121 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03940 CDS complement(445194..445943) product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096592.1 transl_table 11 codon_start 1 locus_tag LOCUS_03950 CDS 446374..447060 product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721855.1 transl_table 11 codon_start 1 locus_tag LOCUS_03960 gene rpe CDS 447062..447619 product 6-phospho-3-hexuloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246343.1 transl_table 11 codon_start 1 locus_tag LOCUS_03970 gene hxlB CDS 447635..448048 product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898137.1 transl_table 11 codon_start 1 locus_tag LOCUS_03980 CDS 448045..448530 product PTS fructose transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399158.1 transl_table 11 codon_start 1 locus_tag LOCUS_03990 gene levE CDS 448543..449364 product PTS fructose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229833.1 transl_table 11 codon_start 1 locus_tag LOCUS_04000 gene levF CDS 449381..450217 product PTS fructose transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229834.1 transl_table 11 codon_start 1 locus_tag LOCUS_04010 gene levG CDS complement(450389..451327) product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721341.1 transl_table 11 codon_start 1 locus_tag LOCUS_04020 CDS 451479..452324 product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003579877.1 transl_table 11 codon_start 1 locus_tag LOCUS_04030 CDS 452328..453014 product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674983.1 transl_table 11 codon_start 1 locus_tag LOCUS_04040 CDS 453029..453550 product YjbQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003576695.1 transl_table 11 codon_start 1 locus_tag LOCUS_04050 CDS 453556..454290 product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000064392.1 transl_table 11 codon_start 1 locus_tag LOCUS_04060 CDS complement(454340..455272) product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339369.1 transl_table 11 codon_start 1 locus_tag LOCUS_04070 CDS 455425..456318 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000442783.1 transl_table 11 codon_start 1 locus_tag LOCUS_04080 CDS 456340..457005 product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251054.1 transl_table 11 codon_start 1 locus_tag LOCUS_04090 gene deoC CDS 457342..457794 product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642910.1 transl_table 11 codon_start 1 locus_tag LOCUS_04100 CDS 457806..458090 product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428537.1 transl_table 11 codon_start 1 locus_tag LOCUS_04110 CDS 458122..459390 product PTS galactitol transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722022.1 transl_table 11 codon_start 1 locus_tag LOCUS_04120 CDS 459523..460575 product galactitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930553.1 transl_table 11 codon_start 1 locus_tag LOCUS_04130 CDS 460576..461655 product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733054.1 transl_table 11 codon_start 1 locus_tag LOCUS_04140 CDS 461715..462398 product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722018.1 transl_table 11 codon_start 1 locus_tag LOCUS_04150 CDS 462639..463310 product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922247.1 transl_table 11 codon_start 1 locus_tag LOCUS_04160 CDS 463322..464002 product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582846.1 transl_table 11 codon_start 1 locus_tag LOCUS_04170 CDS 464326..465126 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262910.1 transl_table 11 codon_start 1 locus_tag LOCUS_04180 CDS 465142..466998 product HTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002364610.1 transl_table 11 codon_start 1 locus_tag LOCUS_04190 CDS 466995..467477 product transcriptional regulator GutM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355985.1 transl_table 11 codon_start 1 locus_tag LOCUS_04200 CDS 467481..468035 product PTS glucitol/sorbitol transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262907.1 transl_table 11 codon_start 1 locus_tag LOCUS_04210 CDS 468047..469066 product PTS glucitol/sorbitol transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262906.1 transl_table 11 codon_start 1 locus_tag LOCUS_04220 CDS 469118..469474 product PTS glucitol/sorbitol transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355981.1 transl_table 11 codon_start 1 locus_tag LOCUS_04230 CDS complement(469609..470121) product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703592.1 transl_table 11 codon_start 1 locus_tag LOCUS_04240 CDS 470454..471386 product DUF561 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722294.1 transl_table 11 codon_start 1 locus_tag LOCUS_04250 CDS complement(471720..471938) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04260 CDS complement(471976..473946) product fructose-1,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989588.1 transl_table 11 codon_start 1 locus_tag LOCUS_04270 CDS 474215..475447 product NupC/NupG family nucleoside CNT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000876187.1 transl_table 11 codon_start 1 locus_tag LOCUS_04280 CDS 475780..476697 product ribonucleoside hydrolase RihC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052500.1 transl_table 11 codon_start 1 locus_tag LOCUS_04290 gene rihC CDS 477110..477307 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04300 CDS 477424..477591 product tautomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130513.1 transl_table 11 codon_start 1 locus_tag LOCUS_04310 CDS complement(477660..478493) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04320 CDS complement(478493..479104) product DUF1700 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000031387.1 transl_table 11 codon_start 1 locus_tag LOCUS_04330 CDS complement(479108..479419) product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963892.1 transl_table 11 codon_start 1 locus_tag LOCUS_04340 CDS 479636..479866 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04350 CDS 479869..480105 product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129080272.1 transl_table 11 codon_start 1 locus_tag LOCUS_04360 CDS 480357..482249 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04370 CDS complement(482731..482910) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04380 CDS 483070..483693 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287965.1 transl_table 11 codon_start 1 locus_tag LOCUS_04390 CDS 483921..486743 product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361280.1 transl_table 11 codon_start 1 locus_tag LOCUS_04400 gene uvrA CDS 487200..488366 product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000765153.1 transl_table 11 codon_start 1 locus_tag LOCUS_04410 CDS 488390..491512 product SMC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072762.1 transl_table 11 codon_start 1 locus_tag LOCUS_04420 CDS 491962..492318 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04430 CDS 492311..492676 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04440 CDS complement(492899..493039) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04450 CDS 493113..494093 product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564222.1 transl_table 11 codon_start 1 locus_tag LOCUS_04460 gene hprK CDS 494090..494980 product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722614.1 transl_table 11 codon_start 1 locus_tag LOCUS_04470 gene lgt CDS 495023..496105 product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357312.1 transl_table 11 codon_start 1 locus_tag LOCUS_04480 CDS 496275..497150 product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357314.1 transl_table 11 codon_start 1 locus_tag LOCUS_04490 gene galU CDS 497238..498170 product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476540.1 transl_table 11 codon_start 1 locus_tag LOCUS_04500 gene trxB CDS 498830..501235 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04510 CDS 501252..512453 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04520 CDS 512764..514005 product conjugated bile salt MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861900.1 transl_table 11 codon_start 1 locus_tag LOCUS_04530 CDS 514244..515965 product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156264938.1 transl_table 11 codon_start 1 locus_tag LOCUS_04540 CDS 516242..517138 product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920236.1 transl_table 11 codon_start 1 locus_tag LOCUS_04550 gene rapZ CDS 517135..518139 product YvcK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355627.1 transl_table 11 codon_start 1 locus_tag LOCUS_04560 CDS 518168..519091 product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641038.1 transl_table 11 codon_start 1 locus_tag LOCUS_04570 gene whiA CDS 519265..519741 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130515.1 transl_table 11 codon_start 1 locus_tag LOCUS_04580 CDS complement(520001..520357) product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732514.1 transl_table 11 codon_start 1 locus_tag LOCUS_04590 gene ssb CDS 520554..521270 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564436.1 transl_table 11 codon_start 1 locus_tag LOCUS_04600 CDS 521273..522784 product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288588.1 transl_table 11 codon_start 1 locus_tag LOCUS_04610 CDS 522848..522979 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04620 CDS 522976..523614 product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674405.1 transl_table 11 codon_start 1 locus_tag LOCUS_04630 CDS 523618..524805 product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288581.1 transl_table 11 codon_start 1 locus_tag LOCUS_04640 CDS 525414..527132 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04650 CDS complement(527476..528234) product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061433.1 transl_table 11 codon_start 1 locus_tag LOCUS_04660 CDS complement(528545..528970) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04670 CDS complement(529168..529857) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04680 CDS 530333..531055 product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775019.1 transl_table 11 codon_start 1 locus_tag LOCUS_04690 gene yaaA CDS 531373..531867 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04700 CDS 532017..533510 product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287447.1 transl_table 11 codon_start 1 locus_tag LOCUS_04710 gene gltX CDS 533626..533994 product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207564.1 transl_table 11 codon_start 1 locus_tag LOCUS_04720 CDS 534010..534843 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04730 CDS 534865..535779 product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922301.1 transl_table 11 codon_start 1 locus_tag LOCUS_04740 CDS 535883..537226 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04750 CDS 537249..538055 product sugar-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704455.1 transl_table 11 codon_start 1 locus_tag LOCUS_04760 gene yidA CDS 538107..538739 product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011921852.1 transl_table 11 codon_start 1 locus_tag LOCUS_04770 CDS 538732..539313 product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476271.1 transl_table 11 codon_start 1 locus_tag LOCUS_04780 CDS 539405..540151 product 16S rRNA pseudouridine(516) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001235024.1 transl_table 11 codon_start 1 locus_tag LOCUS_04790 CDS 540203..541525 product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356719.1 transl_table 11 codon_start 1 locus_tag LOCUS_04800 CDS 541735..543015 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04810 CDS 543148..544545 product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289073.1 transl_table 11 codon_start 1 locus_tag LOCUS_04820 CDS 545109..546593 product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476240.1 transl_table 11 codon_start 1 locus_tag LOCUS_04830 CDS 546639..547469 product ammonia-dependent NAD(+) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476239.1 transl_table 11 codon_start 1 locus_tag LOCUS_04840 gene nadE CDS 548014..549429 product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287445.1 transl_table 11 codon_start 1 locus_tag LOCUS_04850 gene cysS CDS 549429..549833 product Mini-ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700685.1 transl_table 11 codon_start 1 locus_tag LOCUS_04860 CDS 549823..550584 product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643931.1 transl_table 11 codon_start 1 locus_tag LOCUS_04870 gene rlmB CDS 550632..551147 product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287439.1 transl_table 11 codon_start 1 locus_tag LOCUS_04880 CDS 551160..551774 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04890 CDS 551886..552038 product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700682.1 transl_table 11 codon_start 1 locus_tag LOCUS_04900 gene rpmG CDS 552061..552225 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04910 CDS 552350..552910 product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702631.1 transl_table 11 codon_start 1 locus_tag LOCUS_04920 gene nusG CDS 552943..553221 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04930 CDS 553363..553788 product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085792.1 transl_table 11 codon_start 1 locus_tag LOCUS_04940 gene rplK CDS 553897..554598 product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989382.1 transl_table 11 codon_start 1 locus_tag LOCUS_04950 gene rplA CDS 554803..554973 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04960 CDS 555259..555777 product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002291634.1 transl_table 11 codon_start 1 locus_tag LOCUS_04970 gene rplJ CDS 555846..556217 product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294588.1 transl_table 11 codon_start 1 locus_tag LOCUS_04980 gene rplL CDS 556652..557632 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963715.1 transl_table 11 codon_start 1 locus_tag LOCUS_04990 CDS 557844..558791 product 2-dehydro-3-deoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230727.1 transl_table 11 codon_start 1 locus_tag LOCUS_05000 gene kdgK CDS 558807..559799 product 2-keto-3-deoxygluconate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230734.1 transl_table 11 codon_start 1 locus_tag LOCUS_05010 gene kdgT CDS 559930..560535 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930903.1 transl_table 11 codon_start 1 locus_tag LOCUS_05020 CDS 560810..562027 product glycine betaine/L-proline ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130443.1 transl_table 11 codon_start 1 locus_tag LOCUS_05030 CDS 562020..562874 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05040 note possible pseudo, internal stop codon, frameshifted CDS 562888..563766 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05050 note possible pseudo, internal stop codon, frameshifted CDS 563943..564386 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290187.1 transl_table 11 codon_start 1 locus_tag LOCUS_05060 CDS 564513..564776 product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871082.1 transl_table 11 codon_start 1 locus_tag LOCUS_05070 CDS 564788..566146 product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989505.1 transl_table 11 codon_start 1 locus_tag LOCUS_05080 CDS 566388..567122 product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682266.1 transl_table 11 codon_start 1 locus_tag LOCUS_05090 CDS complement(567296..567772) product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357448.1 transl_table 11 codon_start 1 locus_tag LOCUS_05100 gene msrA CDS 568159..571755 product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295964.1 transl_table 11 codon_start 1 locus_tag LOCUS_05110 gene rpoB CDS 571959..575639 product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288141.1 transl_table 11 codon_start 1 locus_tag LOCUS_05120 gene rpoC CDS 575935..578517 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05130 CDS 579315..579908 product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836563.1 transl_table 11 codon_start 1 locus_tag LOCUS_05140 CDS complement(580259..580972) product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208225.1 transl_table 11 codon_start 1 locus_tag LOCUS_05150 tRNA 581123..581195 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00100 tRNA 581199..581273 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00110 tRNA 581307..581378 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00120 tRNA 581407..581494 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00130 tRNA 581512..581585 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00140 tRNA 581590..581664 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00150 tRNA 581720..581793 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00160 CDS 582307..582546 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05160 CDS 583090..583794 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000424353.1 transl_table 11 codon_start 1 locus_tag LOCUS_05170 CDS 583787..585415 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000200922.1 transl_table 11 codon_start 1 locus_tag LOCUS_05180 CDS 585933..587057 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05190 CDS 587175..587633 product CtsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644086.1 transl_table 11 codon_start 1 locus_tag LOCUS_05200 CDS 587664..590183 product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101242.1 transl_table 11 codon_start 1 locus_tag LOCUS_05210 CDS 590250..590462 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05220 CDS 590921..591865 product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905887.1 transl_table 11 codon_start 1 locus_tag LOCUS_05230 CDS 592206..592694 product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931378.1 transl_table 11 codon_start 1 locus_tag LOCUS_05240 gene tadA CDS 593028..594923 product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356340.1 transl_table 11 codon_start 1 locus_tag LOCUS_05250 gene dnaX CDS 594948..595262 product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549112.1 transl_table 11 codon_start 1 locus_tag LOCUS_05260 CDS 595346..595942 product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296223.1 transl_table 11 codon_start 1 locus_tag LOCUS_05270 gene recR CDS 595956..596597 product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356366.1 transl_table 11 codon_start 1 locus_tag LOCUS_05280 gene tmk CDS 596615..597628 product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288071.1 transl_table 11 codon_start 1 locus_tag LOCUS_05290 gene holB CDS complement(597689..598480) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05300 CDS 598675..599040 product DNA replication initiation control protein YabA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356372.1 transl_table 11 codon_start 1 locus_tag LOCUS_05310 CDS 599053..599790 product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288957.1 transl_table 11 codon_start 1 locus_tag LOCUS_05320 CDS 599816..600118 product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002304776.1 transl_table 11 codon_start 1 locus_tag LOCUS_05330 CDS 600141..601043 product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359438.1 transl_table 11 codon_start 1 locus_tag LOCUS_05340 gene rsmI CDS 601040..602077 product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254625.1 transl_table 11 codon_start 1 locus_tag LOCUS_05350 CDS 602107..602475 product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254148.1 transl_table 11 codon_start 1 locus_tag LOCUS_05360 gene mscL CDS complement(602571..603671) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049552700.1 transl_table 11 codon_start 1 locus_tag LOCUS_05370 CDS complement(603674..604696) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05380 CDS 604881..606032 product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546886.1 transl_table 11 codon_start 1 locus_tag LOCUS_05390 CDS complement(606524..607891) product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002304556.1 transl_table 11 codon_start 1 locus_tag LOCUS_05400 CDS complement(607898..608758) product biotin/lipoate A/B protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002984547.1 transl_table 11 codon_start 1 locus_tag LOCUS_05410 CDS 608939..609379 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05420 CDS 609428..610069 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05430 CDS 611059..612324 product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294056.1 transl_table 11 codon_start 1 locus_tag LOCUS_05440 CDS 612355..613656 product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357968.1 transl_table 11 codon_start 1 locus_tag LOCUS_05450 gene rho CDS 613761..614027 product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290330.1 transl_table 11 codon_start 1 locus_tag LOCUS_05460 CDS 614219..614926 product class A sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296196.1 transl_table 11 codon_start 1 locus_tag LOCUS_05470 CDS complement(615348..615965) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05480 CDS 615957..616154 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05490 CDS 616129..616902 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354996.1 transl_table 11 codon_start 1 locus_tag LOCUS_05500 CDS 616905..617975 product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010774177.1 transl_table 11 codon_start 1 locus_tag LOCUS_05510 CDS 617980..619368 product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643844.1 transl_table 11 codon_start 1 locus_tag LOCUS_05520 CDS 619499..621025 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355724.1 transl_table 11 codon_start 1 locus_tag LOCUS_05530 CDS 621039..621395 product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000635015.1 transl_table 11 codon_start 1 locus_tag LOCUS_05540 gene acpS CDS 621533..622129 product DUF2179 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361848.1 transl_table 11 codon_start 1 locus_tag LOCUS_05550 CDS 622453..622608 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05560 CDS complement(622759..622941) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05570 CDS 623131..623634 product QueT transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642074.1 transl_table 11 codon_start 1 locus_tag LOCUS_05580 CDS 623863..624633 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815788.1 transl_table 11 codon_start 1 locus_tag LOCUS_05590 CDS 624626..624829 product PLD nuclease N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425157.1 transl_table 11 codon_start 1 locus_tag LOCUS_05600 CDS 624829..625725 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860718.1 transl_table 11 codon_start 1 locus_tag LOCUS_05610 CDS 625722..626492 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05620 CDS 626695..628020 product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002363168.1 transl_table 11 codon_start 1 locus_tag LOCUS_05630 CDS complement(628224..628448) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05640 rRNA 628891..630435 product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00040 rRNA 630649..633548 product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00050 rRNA 633631..633741 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00060 CDS 634005..634547 product 5'-3'-deoxyribonucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002468869.1 transl_table 11 codon_start 1 locus_tag LOCUS_05650 CDS complement(634572..635516) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002994177.1 transl_table 11 codon_start 1 locus_tag LOCUS_05660 CDS 635650..636024 product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263516.1 transl_table 11 codon_start 1 locus_tag LOCUS_05670 CDS 636154..636603 product ribonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214288.1 transl_table 11 codon_start 1 locus_tag LOCUS_05680 CDS 636615..636959 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05690 CDS 636974..637810 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05700 CDS 637832..639766 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05710 CDS complement(639842..641665) product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476164.1 transl_table 11 codon_start 1 locus_tag LOCUS_05720 gene uvrC CDS 641856..642968 product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037684.1 transl_table 11 codon_start 1 locus_tag LOCUS_05730 CDS 642971..644275 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379207.1 transl_table 11 codon_start 1 locus_tag LOCUS_05740 CDS 644338..645723 product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706816.1 transl_table 11 codon_start 1 locus_tag LOCUS_05750 gene glmU CDS 645808..646797 product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475682.1 transl_table 11 codon_start 1 locus_tag LOCUS_05760 CDS 647141..647704 product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722742.1 transl_table 11 codon_start 1 locus_tag LOCUS_05770 gene pth CDS 647718..651287 product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387517.1 transl_table 11 codon_start 1 locus_tag LOCUS_05780 gene mfd CDS 651274..652899 product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476304.1 transl_table 11 codon_start 1 locus_tag LOCUS_05790 CDS 652909..653190 product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567635.1 transl_table 11 codon_start 1 locus_tag LOCUS_05800 CDS 653267..653719 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05810 CDS 653737..654195 product S1 domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567630.1 transl_table 11 codon_start 1 locus_tag LOCUS_05820 CDS 654284..655702 product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287414.1 transl_table 11 codon_start 1 locus_tag LOCUS_05830 gene tilS CDS 655808..656341 product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003705261.1 transl_table 11 codon_start 1 locus_tag LOCUS_05840 gene hpt CDS 656407..658557 product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287418.1 transl_table 11 codon_start 1 locus_tag LOCUS_05850 gene ftsH CDS 658784..659665 product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296053.1 transl_table 11 codon_start 1 locus_tag LOCUS_05860 gene hslO CDS 659745..660602 product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003577893.1 transl_table 11 codon_start 1 locus_tag LOCUS_05870 gene cysK CDS 661270..662319 product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290055.1 transl_table 11 codon_start 1 locus_tag LOCUS_05880 gene dusB CDS 662409..663911 product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242743.1 transl_table 11 codon_start 1 locus_tag LOCUS_05890 gene lysS CDS 664349..666040 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000821217.1 transl_table 11 codon_start 1 locus_tag LOCUS_05900 CDS 666380..666793 product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356190.1 transl_table 11 codon_start 1 locus_tag LOCUS_05910 gene rpsL CDS 666820..667290 product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225784.1 transl_table 11 codon_start 1 locus_tag LOCUS_05920 gene rpsG CDS 667393..669486 product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294317.1 transl_table 11 codon_start 1 locus_tag LOCUS_05930 gene fusA CDS 669623..670807 product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356194.1 transl_table 11 codon_start 1 locus_tag LOCUS_05940 gene tuf CDS 670985..672400 product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287397.1 transl_table 11 codon_start 1 locus_tag LOCUS_05950 CDS 672834..673142 product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002389727.1 transl_table 11 codon_start 1 locus_tag LOCUS_05960 gene rpsJ CDS 673188..673823 product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356199.1 transl_table 11 codon_start 1 locus_tag LOCUS_05970 gene rplC CDS 673846..674469 product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290446.1 transl_table 11 codon_start 1 locus_tag LOCUS_05980 gene rplD CDS 674469..674771 product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641254.1 transl_table 11 codon_start 1 locus_tag LOCUS_05990 gene rplW CDS 674783..675619 product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356204.1 transl_table 11 codon_start 1 locus_tag LOCUS_06000 gene rplB CDS 675654..675932 product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129963.1 transl_table 11 codon_start 1 locus_tag LOCUS_06010 gene rpsS CDS 675955..676311 product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567555.1 transl_table 11 codon_start 1 locus_tag LOCUS_06020 gene rplV CDS 676315..676965 product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701310.1 transl_table 11 codon_start 1 locus_tag LOCUS_06030 gene rpsC CDS 676968..677396 product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288661.1 transl_table 11 codon_start 1 locus_tag LOCUS_06040 gene rplP CDS 677389..677583 product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003638068.1 transl_table 11 codon_start 1 locus_tag LOCUS_06050 gene rpmC CDS 677616..677882 product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129955.1 transl_table 11 codon_start 1 locus_tag LOCUS_06060 gene rpsQ CDS 677910..678278 product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723686.1 transl_table 11 codon_start 1 locus_tag LOCUS_06070 gene rplN CDS 678306..678614 product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156486.1 transl_table 11 codon_start 1 locus_tag LOCUS_06080 gene rplX CDS 678640..679182 product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701318.1 transl_table 11 codon_start 1 locus_tag LOCUS_06090 gene rplE CDS 679201..679386 product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129946.1 transl_table 11 codon_start 1 locus_tag LOCUS_06100 CDS 679416..679814 product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356215.1 transl_table 11 codon_start 1 locus_tag LOCUS_06110 gene rpsH CDS 679849..680388 product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723683.1 transl_table 11 codon_start 1 locus_tag LOCUS_06120 gene rplF CDS 680440..680796 product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288679.1 transl_table 11 codon_start 1 locus_tag LOCUS_06130 gene rplR CDS 680817..681323 product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288681.1 transl_table 11 codon_start 1 locus_tag LOCUS_06140 gene rpsE CDS 681335..681517 product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288686.1 transl_table 11 codon_start 1 locus_tag LOCUS_06150 gene rpmD CDS 681541..681981 product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723680.1 transl_table 11 codon_start 1 locus_tag LOCUS_06160 gene rplO CDS 681981..683279 product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288688.1 transl_table 11 codon_start 1 locus_tag LOCUS_06170 gene secY CDS 683300..683953 product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567523.1 transl_table 11 codon_start 1 locus_tag LOCUS_06180 CDS 684053..684271 product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689399.1 transl_table 11 codon_start 1 locus_tag LOCUS_06190 gene infA CDS 684434..684799 product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090788.1 transl_table 11 codon_start 1 locus_tag LOCUS_06200 gene rpsM CDS 684831..685226 product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829725.1 transl_table 11 codon_start 1 locus_tag LOCUS_06210 gene rpsK CDS 685302..686246 product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010774253.1 transl_table 11 codon_start 1 locus_tag LOCUS_06220 CDS 686274..686654 product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288716.1 transl_table 11 codon_start 1 locus_tag LOCUS_06230 gene rplQ CDS 686864..688747 product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002378047.1 transl_table 11 codon_start 1 locus_tag LOCUS_06240 CDS 688990..689829 product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288720.1 transl_table 11 codon_start 1 locus_tag LOCUS_06250 CDS 689805..690683 product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641276.1 transl_table 11 codon_start 1 locus_tag LOCUS_06260 CDS 690673..691467 product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288724.1 transl_table 11 codon_start 1 locus_tag LOCUS_06270 CDS 691571..692365 product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288727.1 transl_table 11 codon_start 1 locus_tag LOCUS_06280 gene truA CDS 692514..693473 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06290 CDS 693534..693695 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06300 CDS 693835..694278 product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295975.1 transl_table 11 codon_start 1 locus_tag LOCUS_06310 gene rplM CDS 694292..694684 product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549055.1 transl_table 11 codon_start 1 locus_tag LOCUS_06320 gene rpsI CDS complement(694875..696077) product HP1165 family MFS efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000944753.1 transl_table 11 codon_start 1 locus_tag LOCUS_06330 CDS 696894..697694 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06340 note possible pseudo, frameshifted CDS 697808..701140 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06350 CDS 701528..710200 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06360 CDS complement(710399..711541) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_182893188.1 transl_table 11 codon_start 1 locus_tag LOCUS_06370 CDS 711843..713033 product NADH-dependent flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130389.1 transl_table 11 codon_start 1 locus_tag LOCUS_06380 CDS 713112..714041 product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379732.1 transl_table 11 codon_start 1 locus_tag LOCUS_06390 CDS complement(714179..714841) product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000949176.1 transl_table 11 codon_start 1 locus_tag LOCUS_06400 gene nth CDS complement(715016..716887) product flavocytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101399.1 transl_table 11 codon_start 1 locus_tag LOCUS_06410 CDS 717168..718709 product ABC transporter permease/substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289765.1 transl_table 11 codon_start 1 locus_tag LOCUS_06420 CDS 718709..719677 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289763.1 transl_table 11 codon_start 1 locus_tag LOCUS_06430 CDS 719807..720814 product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289464.1 transl_table 11 codon_start 1 locus_tag LOCUS_06440 CDS complement(720889..721488) product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071130048.1 transl_table 11 codon_start 1 locus_tag LOCUS_06450 CDS 721647..722411 product NADPH-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546159.1 transl_table 11 codon_start 1 locus_tag LOCUS_06460 CDS 722445..722714 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06470 CDS complement(722601..723305) product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892161.1 transl_table 11 codon_start 1 locus_tag LOCUS_06480 CDS 723467..724387 product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004111821.1 transl_table 11 codon_start 1 locus_tag LOCUS_06490 CDS 724679..725680 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000481279.1 transl_table 11 codon_start 1 locus_tag LOCUS_06500 CDS 725786..727042 product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067908.1 transl_table 11 codon_start 1 locus_tag LOCUS_06510 CDS 727140..727871 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06520 CDS 727988..728689 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06530 note possible pseudo, frameshifted CDS complement(729057..730280) product NADH-dependent flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000286459.1 transl_table 11 codon_start 1 locus_tag LOCUS_06540 CDS 730434..731435 product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000240063.1 transl_table 11 codon_start 1 locus_tag LOCUS_06550 CDS 731610..732887 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06560 CDS 733132..733464 product glycine cleavage system protein H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002984553.1 transl_table 11 codon_start 1 locus_tag LOCUS_06570 CDS 733535..734347 product protein-ADP-ribose hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000449069.1 transl_table 11 codon_start 1 locus_tag LOCUS_06580 CDS 734348..735220 product NAD-dependent deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000219401.1 transl_table 11 codon_start 1 locus_tag LOCUS_06590 CDS 735239..736267 product lipoate--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922342.1 transl_table 11 codon_start 1 locus_tag LOCUS_06600 CDS complement(736778..737311) product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000705809.1 transl_table 11 codon_start 1 locus_tag LOCUS_06610 CDS 737562..738557 product D-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922317.1 transl_table 11 codon_start 1 locus_tag LOCUS_06620 CDS complement(738666..739532) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06630 CDS complement(739695..740708) product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775237.1 transl_table 11 codon_start 1 locus_tag LOCUS_06640 gene galE CDS complement(740866..742158) product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775347.1 transl_table 11 codon_start 1 locus_tag LOCUS_06650 CDS 742381..742728 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06660 CDS 742988..743245 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06670 CDS 743601..744458 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06680 CDS 744508..745524 product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475719.1 transl_table 11 codon_start 1 locus_tag LOCUS_06690 gene recX CDS 745521..746735 product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102122.1 transl_table 11 codon_start 1 locus_tag LOCUS_06700 gene mutY CDS complement(746846..747433) product DUF402 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003710725.1 transl_table 11 codon_start 1 locus_tag LOCUS_06710 CDS 747584..748798 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06720 CDS 748995..750995 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06730 CDS complement(751071..752186) product aromatic acid exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000765787.1 transl_table 11 codon_start 1 locus_tag LOCUS_06740 CDS 752370..752825 product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643467.1 transl_table 11 codon_start 1 locus_tag LOCUS_06750 CDS complement(752942..753739) product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898446.1 transl_table 11 codon_start 1 locus_tag LOCUS_06760 gene proC CDS 753804..754625 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06770 rRNA 755120..756664 product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00070 rRNA 756878..759777 product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00080 rRNA 759860..759970 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00090 tRNA 759985..760060 product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00170 tRNA 760093..760181 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00180 tRNA 760193..760266 product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00190 tRNA 760286..760358 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00200 tRNA 760371..760445 product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00210 tRNA 760457..760529 product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00220 tRNA 760537..760617 product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00230 tRNA 760646..760718 product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00240 tRNA 760745..760818 product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00250 tRNA 760824..760897 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00260 tRNA 760971..761041 product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00270 tRNA 761053..761137 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00280 CDS complement(761351..762001) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06780 CDS 762454..762606 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06790 CDS complement(762716..763282) product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948277.1 transl_table 11 codon_start 1 locus_tag LOCUS_06800 CDS complement(763285..763872) product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948278.1 transl_table 11 codon_start 1 locus_tag LOCUS_06810 CDS 764030..765358 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06820 CDS complement(765435..767177) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06830 CDS 767380..767952 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06840 CDS 768466..769248 product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002389938.1 transl_table 11 codon_start 1 locus_tag LOCUS_06850 CDS 769287..770579 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002389936.1 transl_table 11 codon_start 1 locus_tag LOCUS_06860 CDS 770657..771952 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002389936.1 transl_table 11 codon_start 1 locus_tag LOCUS_06870 CDS 771983..772858 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034565176.1 transl_table 11 codon_start 1 locus_tag LOCUS_06880 CDS 772848..773681 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002299926.1 transl_table 11 codon_start 1 locus_tag LOCUS_06890 CDS 773714..774889 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002299925.1 transl_table 11 codon_start 1 locus_tag LOCUS_06900 CDS 774921..776228 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002389936.1 transl_table 11 codon_start 1 locus_tag LOCUS_06910 CDS 776298..777104 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06920 CDS 777118..777798 product DUF1868 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035307.1 transl_table 11 codon_start 1 locus_tag LOCUS_06930 CDS 777779..778738 product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014308.1 transl_table 11 codon_start 1 locus_tag LOCUS_06940 CDS 779241..782660 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06950 note possible pseudo, internal stop codon, frameshifted CDS 782889..783161 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06960 CDS 783134..788329 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06970 note possible pseudo, frameshifted CDS complement(788590..789063) product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893617.1 transl_table 11 codon_start 1 locus_tag LOCUS_06980 CDS 789286..790053 product DUF4931 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703308.1 transl_table 11 codon_start 1 locus_tag LOCUS_06990 CDS complement(790107..791087) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700709.1 transl_table 11 codon_start 1 locus_tag LOCUS_07000 CDS complement(791101..792594) product sucrose-6-phosphate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382334.1 transl_table 11 codon_start 1 locus_tag LOCUS_07010 CDS 792817..794775 product sucrose-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641781.1 transl_table 11 codon_start 1 locus_tag LOCUS_07020 CDS 795012..795755 product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012774968.1 transl_table 11 codon_start 1 locus_tag LOCUS_07030 CDS 795791..796750 product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963416.1 transl_table 11 codon_start 1 locus_tag LOCUS_07040 CDS complement(796835..797416) product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119547.1 transl_table 11 codon_start 1 locus_tag LOCUS_07050 CDS 797606..798139 product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010774238.1 transl_table 11 codon_start 1 locus_tag LOCUS_07060 gene trmL CDS 798235..800316 product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475775.1 transl_table 11 codon_start 1 locus_tag LOCUS_07070 CDS 800416..800802 product YlbF family regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002285994.1 transl_table 11 codon_start 1 locus_tag LOCUS_07080 CDS 800976..802220 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07090 CDS 802245..805016 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286213.1 transl_table 11 codon_start 1 locus_tag LOCUS_07100 CDS 805037..806002 product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002373338.1 transl_table 11 codon_start 1 locus_tag LOCUS_07110 CDS 806457..807281 product glycosyltransferase family 8 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262299.1 transl_table 11 codon_start 1 locus_tag LOCUS_07120 CDS complement(807338..808372) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000823432.1 transl_table 11 codon_start 1 locus_tag LOCUS_07130 CDS complement(808508..808894) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07140 CDS complement(808898..809326) product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286201.1 transl_table 11 codon_start 1 locus_tag LOCUS_07150 CDS 809511..810251 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286199.1 transl_table 11 codon_start 1 locus_tag LOCUS_07160 CDS 810241..811476 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101412.1 transl_table 11 codon_start 1 locus_tag LOCUS_07170 CDS 811554..812387 product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640254.1 transl_table 11 codon_start 1 locus_tag LOCUS_07180 CDS 812493..813134 product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286189.1 transl_table 11 codon_start 1 locus_tag LOCUS_07190 gene trmB CDS complement(813228..813614) product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723577.1 transl_table 11 codon_start 1 locus_tag LOCUS_07200 CDS 813841..814467 product DUF4479 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001006759.1 transl_table 11 codon_start 1 locus_tag LOCUS_07210 CDS 814522..815238 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07220 CDS 815242..816600 product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357163.1 transl_table 11 codon_start 1 locus_tag LOCUS_07230 gene murC CDS 816587..817477 product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357314.1 transl_table 11 codon_start 1 locus_tag LOCUS_07240 gene galU CDS 817538..818539 product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387246.1 transl_table 11 codon_start 1 locus_tag LOCUS_07250 CDS 818947..820248 product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392070.1 transl_table 11 codon_start 1 locus_tag LOCUS_07260 CDS complement(820323..821009) product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732396.1 transl_table 11 codon_start 1 locus_tag LOCUS_07270 CDS 821401..823815 product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706700.1 transl_table 11 codon_start 1 locus_tag LOCUS_07280 gene leuS CDS 823828..824691 product pyridoxamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944146.1 transl_table 11 codon_start 1 locus_tag LOCUS_07290 CDS 824853..825617 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433939.1 transl_table 11 codon_start 1 locus_tag LOCUS_07300 CDS 825617..826438 product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000714633.1 transl_table 11 codon_start 1 locus_tag LOCUS_07310 CDS 826506..827195 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000505205.1 transl_table 11 codon_start 1 locus_tag LOCUS_07320 CDS 827199..827900 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356307.1 transl_table 11 codon_start 1 locus_tag LOCUS_07330 CDS 827902..828888 product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837553.1 transl_table 11 codon_start 1 locus_tag LOCUS_07340 CDS 829096..830730 product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564130.1 transl_table 11 codon_start 1 locus_tag LOCUS_07350 CDS complement(830773..832275) product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000747274.1 transl_table 11 codon_start 1 locus_tag LOCUS_07360 gene malQ CDS 832516..833907 product dipeptidase PepV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002371462.1 transl_table 11 codon_start 1 locus_tag LOCUS_07370 gene pepV CDS 833909..834658 product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674568.1 transl_table 11 codon_start 1 locus_tag LOCUS_07380 CDS 834694..835305 product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356666.1 transl_table 11 codon_start 1 locus_tag LOCUS_07390 CDS 835331..835663 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358035.1 transl_table 11 codon_start 1 locus_tag LOCUS_07400 CDS 836225..837274 product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288048.1 transl_table 11 codon_start 1 locus_tag LOCUS_07410 gene pheS CDS 837274..839724 product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475969.1 transl_table 11 codon_start 1 locus_tag LOCUS_07420 gene pheT CDS 839955..841370 product alanine/glycine:cation symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356603.1 transl_table 11 codon_start 1 locus_tag LOCUS_07430 CDS 841533..842531 product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355836.1 transl_table 11 codon_start 1 locus_tag LOCUS_07440 gene pta CDS 842668..843261 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07450 CDS 843430..844002 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355832.1 transl_table 11 codon_start 1 locus_tag LOCUS_07460 CDS 844129..845691 product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002456666.1 transl_table 11 codon_start 1 locus_tag LOCUS_07470 gene ppx CDS 845840..848035 product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002470194.1 transl_table 11 codon_start 1 locus_tag LOCUS_07480 CDS complement(848133..848678) product TIGR01440 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393868.1 transl_table 11 codon_start 1 locus_tag LOCUS_07490 CDS 848875..849342 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476188.1 transl_table 11 codon_start 1 locus_tag LOCUS_07500 gene tsaE CDS 849345..849920 product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002366315.1 transl_table 11 codon_start 1 locus_tag LOCUS_07510 CDS complement(850028..850267) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07520 CDS 850441..851346 product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287058.1 transl_table 11 codon_start 1 locus_tag LOCUS_07530 gene murB CDS 851619..853289 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011921978.1 transl_table 11 codon_start 1 locus_tag LOCUS_07540 CDS complement(853386..853970) product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002898317.1 transl_table 11 codon_start 1 locus_tag LOCUS_07550 CDS 854596..855612 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016716307.1 transl_table 11 codon_start 1 locus_tag LOCUS_07560 CDS 855934..856986 product tryptophan ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674603.1 transl_table 11 codon_start 1 locus_tag LOCUS_07570 gene trpX CDS 856989..857888 product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549276.1 transl_table 11 codon_start 1 locus_tag LOCUS_07580 CDS 857891..858658 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289388.1 transl_table 11 codon_start 1 locus_tag LOCUS_07590 CDS complement(859056..859505) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07600 note possible pseudo, frameshifted CDS complement(859547..859756) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07610 note possible pseudo, frameshifted CDS complement(859873..860604) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07620 CDS complement(860693..863101) product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674291.1 transl_table 11 codon_start 1 locus_tag LOCUS_07630 CDS 863367..864098 product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674355.1 transl_table 11 codon_start 1 locus_tag LOCUS_07640 CDS 864436..865770 product aminopeptidase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731859.1 transl_table 11 codon_start 1 locus_tag LOCUS_07650 gene pepC CDS 866038..867105 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296464.1 transl_table 11 codon_start 1 locus_tag LOCUS_07660 CDS 867134..867802 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296462.1 transl_table 11 codon_start 1 locus_tag LOCUS_07670 CDS complement(867861..868961) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014119.1 transl_table 11 codon_start 1 locus_tag LOCUS_07680 CDS 869363..870547 product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860903.1 transl_table 11 codon_start 1 locus_tag LOCUS_07690 CDS 870803..871345 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07700 CDS 871467..873206 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002364705.1 transl_table 11 codon_start 1 locus_tag LOCUS_07710 CDS 873207..874943 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965688.1 transl_table 11 codon_start 1 locus_tag LOCUS_07720 CDS 875024..875722 product DUF3800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028388.1 transl_table 11 codon_start 1 locus_tag LOCUS_07730 CDS 875757..876434 product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254138.1 transl_table 11 codon_start 1 locus_tag LOCUS_07740 gene deoC CDS complement(876525..877673) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07750 CDS complement(877678..878307) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07760 CDS 878667..879935 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07770 CDS 880024..880929 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07780 CDS complement(880959..881501) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07790 CDS complement(881756..883270) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_101721463.1 transl_table 11 codon_start 1 locus_tag LOCUS_07800 CDS 883491..884198 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07810 CDS 884405..885277 product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921879.1 transl_table 11 codon_start 1 locus_tag LOCUS_07820 CDS 885274..885966 product N-acetylmannosamine-6-phosphate 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027343.1 transl_table 11 codon_start 1 locus_tag LOCUS_07830 CDS 885982..887961 product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027342.1 transl_table 11 codon_start 1 locus_tag LOCUS_07840 CDS 888036..889178 product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775571.1 transl_table 11 codon_start 1 locus_tag LOCUS_07850 gene nagA CDS 889742..890755 product class 1b ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192437.1 transl_table 11 codon_start 1 locus_tag LOCUS_07860 gene nrdF CDS 890755..891183 product class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010874679.1 transl_table 11 codon_start 1 locus_tag LOCUS_07870 gene nrdI CDS 891234..893432 product class 1b ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000194382.1 transl_table 11 codon_start 1 locus_tag LOCUS_07880 gene nrdE CDS complement(893524..894204) product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703418.1 transl_table 11 codon_start 1 locus_tag LOCUS_07890 CDS complement(894352..895020) product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566791.1 transl_table 11 codon_start 1 locus_tag LOCUS_07900 CDS 895356..895928 product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704526.1 transl_table 11 codon_start 1 locus_tag LOCUS_07910 CDS complement(895993..896550) product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027512.1 transl_table 11 codon_start 1 locus_tag LOCUS_07920 CDS 896714..898501 product pyruvate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836483.1 transl_table 11 codon_start 1 locus_tag LOCUS_07930 gene spxB CDS complement(898643..899230) product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001098896.1 transl_table 11 codon_start 1 locus_tag LOCUS_07940 CDS 899477..901771 product bifunctional glutamate--cysteine ligase GshA/glutathione synthetase GshB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287901.1 transl_table 11 codon_start 1 locus_tag LOCUS_07950 gene gshAB CDS 902382..903467 product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546234.1 transl_table 11 codon_start 1 locus_tag LOCUS_07960 gene ugpC CDS 903460..904338 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722709.1 transl_table 11 codon_start 1 locus_tag LOCUS_07970 CDS 904335..905174 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804269.1 transl_table 11 codon_start 1 locus_tag LOCUS_07980 CDS 905180..906505 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815926.1 transl_table 11 codon_start 1 locus_tag LOCUS_07990 CDS 906675..907355 product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286851.1 transl_table 11 codon_start 1 locus_tag LOCUS_08000 CDS 907365..907553 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08010 CDS complement(907623..908177) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461583.1 transl_table 11 codon_start 1 locus_tag LOCUS_08020 CDS complement(908263..909660) product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461705.1 transl_table 11 codon_start 1 locus_tag LOCUS_08030 CDS 909779..910654 product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138517.1 transl_table 11 codon_start 1 locus_tag LOCUS_08040 gene pdxS CDS 910656..911240 product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461704.1 transl_table 11 codon_start 1 locus_tag LOCUS_08050 gene pdxT CDS complement(911304..911810) product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003729316.1 transl_table 11 codon_start 1 locus_tag LOCUS_08060 CDS complement(911825..912589) product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289867.1 transl_table 11 codon_start 1 locus_tag LOCUS_08070 CDS complement(912742..913614) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08080 CDS complement(913830..914381) product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100931.1 transl_table 11 codon_start 1 locus_tag LOCUS_08090 CDS 914607..915896 product Y-family DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009924327.1 transl_table 11 codon_start 1 locus_tag LOCUS_08100 CDS 915992..916234 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08110 CDS 916672..917511 product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002390147.1 transl_table 11 codon_start 1 locus_tag LOCUS_08120 CDS 917569..918783 product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293788.1 transl_table 11 codon_start 1 locus_tag LOCUS_08130 CDS complement(919553..919855) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08140 CDS 927666..928040 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08150 CDS 928177..929691 product accessory Sec system glycosyltransferase GtfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836746.1 transl_table 11 codon_start 1 locus_tag LOCUS_08160 gene gtfA CDS 929688..931010 product accessory Sec system glycosylation chaperone GtfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836747.1 transl_table 11 codon_start 1 locus_tag LOCUS_08170 gene gtfB CDS 931039..932493 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08180 CDS 932592..933866 product accessory Sec system protein translocase subunit SecY2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836742.1 transl_table 11 codon_start 1 locus_tag LOCUS_08190 gene secY2 CDS 933879..935429 product accessory Sec system protein Asp1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000468347.1 transl_table 11 codon_start 1 locus_tag LOCUS_08200 gene asp1 CDS 935422..936972 product accessory Sec system protein Asp2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001137481.1 transl_table 11 codon_start 1 locus_tag LOCUS_08210 gene asp2 CDS 936969..937943 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08220 CDS 937954..940320 product accessory Sec system translocase SecA2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000560050.1 transl_table 11 codon_start 1 locus_tag LOCUS_08230 gene secA2 CDS 940348..940539 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08240 CDS 940566..941852 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08250 CDS 942099..942992 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808885.1 transl_table 11 codon_start 1 locus_tag LOCUS_08260 CDS complement(943085..943927) product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016439.1 transl_table 11 codon_start 1 locus_tag LOCUS_08270 CDS complement(944085..944774) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08280 CDS complement(944761..945678) product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066567803.1 transl_table 11 codon_start 1 locus_tag LOCUS_08290 gene cysK CDS complement(945893..946942) product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831537.1 transl_table 11 codon_start 1 locus_tag LOCUS_08300 gene fni CDS complement(947007..948128) product phosphomevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012774951.1 transl_table 11 codon_start 1 locus_tag LOCUS_08310 CDS complement(948129..949373) product diphosphomevalonate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011921869.1 transl_table 11 codon_start 1 locus_tag LOCUS_08320 gene mvaD CDS complement(949377..950351) product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288231.1 transl_table 11 codon_start 1 locus_tag LOCUS_08330 gene mvk CDS 950611..952161 product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130105.1 transl_table 11 codon_start 1 locus_tag LOCUS_08340 gene guaA CDS complement(953121..954404) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08350 CDS complement(954912..955376) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08360 CDS complement(955556..956482) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08370 CDS complement(956625..956756) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08380 CDS complement(956794..957879) product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387189.1 transl_table 11 codon_start 1 locus_tag LOCUS_08390 CDS complement(958068..958718) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08400 CDS 958957..960045 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021361893.1 transl_table 11 codon_start 1 locus_tag LOCUS_08410 CDS 960092..960778 product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459538.1 transl_table 11 codon_start 1 locus_tag LOCUS_08420 gene tsaA CDS 960872..961417 product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812910.1 transl_table 11 codon_start 1 locus_tag LOCUS_08430 CDS 961411..963222 product DUF2207 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042338789.1 transl_table 11 codon_start 1 locus_tag LOCUS_08440 CDS 963420..964061 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642548.1 transl_table 11 codon_start 1 locus_tag LOCUS_08450 CDS 964233..966260 product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475586.1 transl_table 11 codon_start 1 locus_tag LOCUS_08460 CDS 966380..967288 product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289459.1 transl_table 11 codon_start 1 locus_tag LOCUS_08470 CDS 967552..968445 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546199.1 transl_table 11 codon_start 1 locus_tag LOCUS_08480 CDS 968479..969963 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08490 CDS 970090..970668 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08500 CDS 970684..971253 product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295088.1 transl_table 11 codon_start 1 locus_tag LOCUS_08510 CDS 971711..972220 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08520 note possible pseudo, frameshifted CDS 972217..974097 product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296458.1 transl_table 11 codon_start 1 locus_tag LOCUS_08530 note possible pseudo, frameshifted CDS 974257..974571 product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723853.1 transl_table 11 codon_start 1 locus_tag LOCUS_08540 gene trxA CDS 974819..975247 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08550 CDS complement(975323..975790) product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723016.1 transl_table 11 codon_start 1 locus_tag LOCUS_08560 gene mgsA CDS complement(975886..977106) product sodium/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003392508.1 transl_table 11 codon_start 1 locus_tag LOCUS_08570 gene gltS CDS 977462..978283 product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002317207.1 transl_table 11 codon_start 1 locus_tag LOCUS_08580 gene racE CDS 978287..978901 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08590 CDS 978898..979398 product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476166.1 transl_table 11 codon_start 1 locus_tag LOCUS_08600 CDS complement(979995..980882) product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000631144.1 transl_table 11 codon_start 1 locus_tag LOCUS_08610 CDS 981050..981568 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08620 CDS 981612..982106 product YtxH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381831.1 transl_table 11 codon_start 1 locus_tag LOCUS_08630 CDS complement(982224..982880) product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_183773554.1 transl_table 11 codon_start 1 locus_tag LOCUS_08640 CDS complement(982880..984313) product ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053740.1 transl_table 11 codon_start 1 locus_tag LOCUS_08650 CDS complement(984326..986089) product ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250553.1 transl_table 11 codon_start 1 locus_tag LOCUS_08660 CDS complement(986093..986671) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08670 CDS complement(986686..986994) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08680 CDS complement(986994..987440) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08690 CDS complement(987494..989443) product V-type ATPase 116kDa subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869273.1 transl_table 11 codon_start 1 locus_tag LOCUS_08700 CDS complement(989458..990495) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08710 CDS complement(990488..990817) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08720 CDS 991162..992166 product competence type IV pilus ATPase ComGA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475745.1 transl_table 11 codon_start 1 locus_tag LOCUS_08730 gene comGA CDS 992111..993196 product competence type IV pilus assembly protein ComGB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990101.1 transl_table 11 codon_start 1 locus_tag LOCUS_08740 gene comGB CDS 993193..993516 product competence type IV pilus major pilin ComGC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011921720.1 transl_table 11 codon_start 1 locus_tag LOCUS_08750 gene comGC CDS 993519..993971 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08760 CDS 993946..994248 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08770 CDS 994217..994690 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08780 CDS 994683..995639 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08790 CDS 995936..997015 product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286665.1 transl_table 11 codon_start 1 locus_tag LOCUS_08800 CDS 997112..997669 product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699839.1 transl_table 11 codon_start 1 locus_tag LOCUS_08810 gene efp CDS 997844..998215 product fatty acid biosynthesis protein YqhY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230254.1 transl_table 11 codon_start 1 locus_tag LOCUS_08820 gene yqhY CDS 998229..998813 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08830 CDS 999040..999891 product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286660.1 transl_table 11 codon_start 1 locus_tag LOCUS_08840 CDS 999884..1001269 product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387036.1 transl_table 11 codon_start 1 locus_tag LOCUS_08850 gene xseA CDS 1001262..1001507 product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355878.1 transl_table 11 codon_start 1 locus_tag LOCUS_08860 CDS 1001507..1002406 product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000183383.1 transl_table 11 codon_start 1 locus_tag LOCUS_08870 CDS 1002409..1003227 product TlyA family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286655.1 transl_table 11 codon_start 1 locus_tag LOCUS_08880 CDS 1003243..1004955 product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003660689.1 transl_table 11 codon_start 1 locus_tag LOCUS_08890 gene recN CDS 1004945..1005883 product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002366931.1 transl_table 11 codon_start 1 locus_tag LOCUS_08900 gene miaA CDS 1005903..1007135 product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379600.1 transl_table 11 codon_start 1 locus_tag LOCUS_08910 gene hflX tRNA complement(1007446..1007521) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00290 CDS 1007796..1008329 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08920 CDS 1008326..1008718 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08930 CDS 1008697..1009107 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08940 CDS 1009307..1011124 product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101224.1 transl_table 11 codon_start 1 locus_tag LOCUS_08950 CDS 1011593..1012396 product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002390188.1 transl_table 11 codon_start 1 locus_tag LOCUS_08960 CDS 1012491..1013258 product Wzz/FepE/Etk N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000393128.1 transl_table 11 codon_start 1 locus_tag LOCUS_08970 CDS 1013273..1013980 product CpsD/CapB family tyrosine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476420.1 transl_table 11 codon_start 1 locus_tag LOCUS_08980 CDS 1014002..1014769 product tyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099684015.1 transl_table 11 codon_start 1 locus_tag LOCUS_08990 CDS 1014818..1016635 product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002902060.1 transl_table 11 codon_start 1 locus_tag LOCUS_09000 CDS 1016653..1017282 product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003025211.1 transl_table 11 codon_start 1 locus_tag LOCUS_09010 CDS 1017279..1018124 product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003014975.1 transl_table 11 codon_start 1 locus_tag LOCUS_09020 CDS 1018126..1019346 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776619.1 transl_table 11 codon_start 1 locus_tag LOCUS_09030 CDS 1019353..1020402 product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107231.1 transl_table 11 codon_start 1 locus_tag LOCUS_09040 CDS 1020405..1021517 product capsular polysaccharide biosynthesis protein CapF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202261.1 transl_table 11 codon_start 1 locus_tag LOCUS_09050 CDS 1021517..1022641 product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963417.1 transl_table 11 codon_start 1 locus_tag LOCUS_09060 gene wecB CDS 1022643..1023878 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203512.1 transl_table 11 codon_start 1 locus_tag LOCUS_09070 CDS complement(1024170..1024349) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09080 CDS complement(1024620..1024763) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09090 CDS complement(1024922..1025095) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09100 CDS 1025028..1025960 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000908873.1 transl_table 11 codon_start 1 locus_tag LOCUS_09110 CDS 1025969..1026880 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054958832.1 transl_table 11 codon_start 1 locus_tag LOCUS_09120 CDS 1026950..1028365 product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768493.1 transl_table 11 codon_start 1 locus_tag LOCUS_09130 CDS 1028485..1029651 product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097850.1 transl_table 11 codon_start 1 locus_tag LOCUS_09140 gene ugd CDS complement(1029762..1030094) product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262989.1 transl_table 11 codon_start 1 locus_tag LOCUS_09150 CDS complement(1030088..1030333) product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262990.1 transl_table 11 codon_start 1 locus_tag LOCUS_09160 CDS 1031154..1031297 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09170 CDS 1031413..1031904 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09180 CDS 1032331..1032990 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09190 CDS 1033178..1033879 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09200 note possible pseudo, internal stop codon, frameshifted CDS 1034469..1036175 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09210 CDS 1036186..1037052 product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546167.1 transl_table 11 codon_start 1 locus_tag LOCUS_09220 CDS complement(1037199..1037714) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09230 note possible pseudo, frameshifted CDS complement(1037711..1038835) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09240 note possible pseudo, frameshifted CDS complement(1038893..1039243) product IS66 family insertion sequence element accessory protein TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000973424.1 transl_table 11 codon_start 1 locus_tag LOCUS_09250 gene tnpB CDS 1039898..1040353 product PTS ascorbate transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368614.1 transl_table 11 codon_start 1 locus_tag LOCUS_09260 gene ulaC CDS 1040350..1040634 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09270 CDS 1040631..1041905 product PTS ascorbate transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705655.1 transl_table 11 codon_start 1 locus_tag LOCUS_09280 CDS 1042044..1042565 product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000811662.1 transl_table 11 codon_start 1 locus_tag LOCUS_09290 CDS complement(1042590..1042820) product DUF2188 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107539.1 transl_table 11 codon_start 1 locus_tag LOCUS_09300 CDS 1043098..1043964 product polyphosphate kinase 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928954.1 transl_table 11 codon_start 1 locus_tag LOCUS_09310 CDS complement(1044009..1044230) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002982695.1 transl_table 11 codon_start 1 locus_tag LOCUS_09320 CDS complement(1044230..1044556) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09330 CDS complement(1044753..1047284) product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101213.1 transl_table 11 codon_start 1 locus_tag LOCUS_09340 tRNA 1047487..1047558 product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00300 CDS 1047585..1047746 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09350 CDS 1047800..1048576 product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837696.1 transl_table 11 codon_start 1 locus_tag LOCUS_09360 CDS 1048557..1049381 product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837697.1 transl_table 11 codon_start 1 locus_tag LOCUS_09370 CDS 1049411..1049935 product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002391486.1 transl_table 11 codon_start 1 locus_tag LOCUS_09380 CDS 1050101..1051003 product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001132846.1 transl_table 11 codon_start 1 locus_tag LOCUS_09390 gene rbsK CDS 1051160..1051756 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09400 CDS 1052134..1052424 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09410 CDS 1052529..1053491 product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286461.1 transl_table 11 codon_start 1 locus_tag LOCUS_09420 CDS 1053527..1054813 product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564988.1 transl_table 11 codon_start 1 locus_tag LOCUS_09430 CDS 1054791..1055153 product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000218967.1 transl_table 11 codon_start 1 locus_tag LOCUS_09440 CDS 1055156..1055506 product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409234.1 transl_table 11 codon_start 1 locus_tag LOCUS_09450 gene gcvH CDS 1055542..1056042 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09460 CDS complement(1056122..1056865) product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358005.1 transl_table 11 codon_start 1 locus_tag LOCUS_09470 CDS 1056965..1058869 product peptidase M13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102166.1 transl_table 11 codon_start 1 locus_tag LOCUS_09480 CDS 1059754..1061349 product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010709260.1 transl_table 11 codon_start 1 locus_tag LOCUS_09490 CDS 1061419..1063047 product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010709260.1 transl_table 11 codon_start 1 locus_tag LOCUS_09500 CDS 1063122..1064372 product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016614.1 transl_table 11 codon_start 1 locus_tag LOCUS_09510 gene pepT CDS 1064548..1066917 product phosphoketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294145.1 transl_table 11 codon_start 1 locus_tag LOCUS_09520 CDS 1067107..1068798 product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288432.1 transl_table 11 codon_start 1 locus_tag LOCUS_09530 gene argS CDS 1069231..1077465 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09540 CDS 1077804..1083356 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09550 CDS 1083914..1089970 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09560 CDS complement(1090102..1091298) product O-antigen ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000835615.1 transl_table 11 codon_start 1 locus_tag LOCUS_09570 CDS 1091483..1092175 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09580 CDS 1092154..1093506 product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000043884.1 transl_table 11 codon_start 1 locus_tag LOCUS_09590 gene gorA CDS 1093628..1094197 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09600 CDS complement(1094271..1094792) product HdeD family acid-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723402.1 transl_table 11 codon_start 1 locus_tag LOCUS_09610 CDS 1094977..1095843 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287606.1 transl_table 11 codon_start 1 locus_tag LOCUS_09620 CDS complement(1095939..1096508) product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476379.1 transl_table 11 codon_start 1 locus_tag LOCUS_09630 CDS complement(1096552..1097628) product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172824468.1 transl_table 11 codon_start 1 locus_tag LOCUS_09640 CDS complement(1097662..1098729) product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172824468.1 transl_table 11 codon_start 1 locus_tag LOCUS_09650 CDS complement(1098768..1099220) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000845489.1 transl_table 11 codon_start 1 locus_tag LOCUS_09660 CDS 1099588..1100073 product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244134.1 transl_table 11 codon_start 1 locus_tag LOCUS_09670 gene purE CDS 1100057..1101196 product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288025.1 transl_table 11 codon_start 1 locus_tag LOCUS_09680 gene purK CDS 1101196..1101915 product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548371.1 transl_table 11 codon_start 1 locus_tag LOCUS_09690 CDS 1101949..1102194 product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295474.1 transl_table 11 codon_start 1 locus_tag LOCUS_09700 gene purS CDS 1102200..1102883 product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733240.1 transl_table 11 codon_start 1 locus_tag LOCUS_09710 gene purQ CDS 1102889..1105114 product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288015.1 transl_table 11 codon_start 1 locus_tag LOCUS_09720 gene purL CDS 1105084..1106592 product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288013.1 transl_table 11 codon_start 1 locus_tag LOCUS_09730 gene purF CDS 1106585..1107637 product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009933235.1 transl_table 11 codon_start 1 locus_tag LOCUS_09740 gene purM CDS 1107637..1108227 product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288010.1 transl_table 11 codon_start 1 locus_tag LOCUS_09750 gene purN CDS 1108208..1109761 product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288009.1 transl_table 11 codon_start 1 locus_tag LOCUS_09760 gene purH CDS 1109778..1111058 product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011921653.1 transl_table 11 codon_start 1 locus_tag LOCUS_09770 gene purD CDS 1111062..1112366 product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102100.1 transl_table 11 codon_start 1 locus_tag LOCUS_09780 gene purB CDS complement(1112641..1112826) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09790 tRNA 1112985..1113057 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00310 CDS 1113493..1114416 product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922125.1 transl_table 11 codon_start 1 locus_tag LOCUS_09800 CDS complement(1114590..1115960) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830662.1 transl_table 11 codon_start 1 locus_tag LOCUS_09810 CDS complement(1116394..1119117) product calcium-translocating P-type ATPase, PMCA-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000910746.1 transl_table 11 codon_start 1 locus_tag LOCUS_09820 CDS 1119459..1121609 product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382246.1 transl_table 11 codon_start 1 locus_tag LOCUS_09830 CDS 1121703..1122146 product SprT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000778583.1 transl_table 11 codon_start 1 locus_tag LOCUS_09840 CDS complement(1122196..1123164) product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722739.1 transl_table 11 codon_start 1 locus_tag LOCUS_09850 CDS 1123614..1124804 product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223511.1 transl_table 11 codon_start 1 locus_tag LOCUS_09860 CDS 1124889..1125620 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09870 CDS 1125737..1125946 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09880 note possible pseudo, frameshifted CDS 1125988..1126437 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09890 note possible pseudo, frameshifted CDS 1126959..1128470 product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775048.1 transl_table 11 codon_start 1 locus_tag LOCUS_09900 gene glpK CDS 1128495..1130333 product type 1 glycerol-3-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837394.1 transl_table 11 codon_start 1 locus_tag LOCUS_09910 gene glpO CDS 1130366..1131073 product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357140.1 transl_table 11 codon_start 1 locus_tag LOCUS_09920 CDS complement(1131178..1131654) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357065.1 transl_table 11 codon_start 1 locus_tag LOCUS_09930 CDS complement(1132072..1133346) product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109512.1 transl_table 11 codon_start 1 locus_tag LOCUS_09940 CDS 1133487..1134611 product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101678.1 transl_table 11 codon_start 1 locus_tag LOCUS_09950 CDS 1134643..1134990 product DUF1831 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286736.1 transl_table 11 codon_start 1 locus_tag LOCUS_09960 CDS 1135188..1136312 product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286726.1 transl_table 11 codon_start 1 locus_tag LOCUS_09970 gene mnmA CDS 1136591..1139056 product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289594.1 transl_table 11 codon_start 1 locus_tag LOCUS_09980 CDS 1139293..1140111 product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003727259.1 transl_table 11 codon_start 1 locus_tag LOCUS_09990 CDS 1140429..1143080 product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357736.1 transl_table 11 codon_start 1 locus_tag LOCUS_10000 gene alaS CDS 1143143..1143406 product IreB family regulatory phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290885.1 transl_table 11 codon_start 1 locus_tag LOCUS_10010 CDS 1143409..1143831 product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001222109.1 transl_table 11 codon_start 1 locus_tag LOCUS_10020 gene ruvX CDS 1143848..1144129 product DUF1292 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674279.1 transl_table 11 codon_start 1 locus_tag LOCUS_10030 CDS 1144362..1145504 product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289159.1 transl_table 11 codon_start 1 locus_tag LOCUS_10040 gene mltG CDS 1145587..1146066 product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355133.1 transl_table 11 codon_start 1 locus_tag LOCUS_10050 gene greA CDS 1146737..1148062 product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948514.1 transl_table 11 codon_start 1 locus_tag LOCUS_10060 gene brnQ CDS 1148269..1149321 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10070 CDS 1149573..1149935 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10080 CDS 1150134..1151144 product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132499.1 transl_table 11 codon_start 1 locus_tag LOCUS_10090 CDS 1151198..1151425 product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132501.1 transl_table 11 codon_start 1 locus_tag LOCUS_10100 CDS 1151467..1152420 product enoyl-[acyl-carrier-protein] reductase FabK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002373895.1 transl_table 11 codon_start 1 locus_tag LOCUS_10110 gene fabK CDS 1152525..1153469 product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356280.1 transl_table 11 codon_start 1 locus_tag LOCUS_10120 gene fabD CDS 1153471..1154202 product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966837.1 transl_table 11 codon_start 1 locus_tag LOCUS_10130 gene fabG CDS 1154236..1155480 product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099549.1 transl_table 11 codon_start 1 locus_tag LOCUS_10140 gene fabF CDS 1155480..1155962 product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001161071.1 transl_table 11 codon_start 1 locus_tag LOCUS_10150 gene accB CDS 1156064..1156522 product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287621.1 transl_table 11 codon_start 1 locus_tag LOCUS_10160 gene fabZ CDS 1156535..1157938 product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002384028.1 transl_table 11 codon_start 1 locus_tag LOCUS_10170 CDS 1157951..1158832 product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287623.1 transl_table 11 codon_start 1 locus_tag LOCUS_10180 gene accD CDS 1158822..1159631 product acetyl-CoA carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001017392.1 transl_table 11 codon_start 1 locus_tag LOCUS_10190 CDS 1159762..1160709 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10200 CDS 1160690..1161124 product ribonuclease HI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369306.1 transl_table 11 codon_start 1 locus_tag LOCUS_10210 CDS complement(1161226..1162869) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10220 CDS 1163081..1163725 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10230 CDS 1163971..1164855 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10240 CDS 1164970..1166787 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272246.1 transl_table 11 codon_start 1 locus_tag LOCUS_10250 CDS 1166990..1168252 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014119.1 transl_table 11 codon_start 1 locus_tag LOCUS_10260 CDS 1168426..1169901 product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263876.1 transl_table 11 codon_start 1 locus_tag LOCUS_10270 CDS 1169927..1170721 product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002484998.1 transl_table 11 codon_start 1 locus_tag LOCUS_10280 CDS 1170894..1171418 product acid-activated urea channel protein UreI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000901247.1 transl_table 11 codon_start 1 locus_tag LOCUS_10290 gene ureI CDS complement(1171556..1172698) product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644375.1 transl_table 11 codon_start 1 locus_tag LOCUS_10300 CDS complement(1172822..1173013) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10310 CDS complement(1173223..1173588) product cell division regulator GpsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003638751.1 transl_table 11 codon_start 1 locus_tag LOCUS_10320 gene gpsB CDS 1173801..1174298 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10330 CDS 1174314..1175264 product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001099294.1 transl_table 11 codon_start 1 locus_tag LOCUS_10340 gene prmA CDS 1175356..1177602 product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357079.1 transl_table 11 codon_start 1 locus_tag LOCUS_10350 CDS 1177681..1178127 product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289097.1 transl_table 11 codon_start 1 locus_tag LOCUS_10360 gene dtd CDS complement(1178210..1179592) product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723525.1 transl_table 11 codon_start 1 locus_tag LOCUS_10370 CDS 1180034..1181332 product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002366882.1 transl_table 11 codon_start 1 locus_tag LOCUS_10380 gene hisS CDS 1181332..1183101 product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379571.1 transl_table 11 codon_start 1 locus_tag LOCUS_10390 gene aspS CDS 1183177..1184202 product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229337.1 transl_table 11 codon_start 1 locus_tag LOCUS_10400 gene sppA CDS 1184204..1184818 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10410 CDS complement(1184964..1185791) product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002326754.1 transl_table 11 codon_start 1 locus_tag LOCUS_10420 CDS 1185891..1186328 product zinc uptake transcriptional repressor Zur inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398578.1 transl_table 11 codon_start 1 locus_tag LOCUS_10430 gene zur CDS complement(1186453..1187400) product 2-keto-3-deoxygluconate permease 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001022089.1 transl_table 11 codon_start 1 locus_tag LOCUS_10440 CDS 1187667..1188725 product BMP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028212.1 transl_table 11 codon_start 1 locus_tag LOCUS_10450 CDS 1188739..1190286 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289202.1 transl_table 11 codon_start 1 locus_tag LOCUS_10460 CDS 1190279..1191346 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383845.1 transl_table 11 codon_start 1 locus_tag LOCUS_10470 CDS 1191350..1192306 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000022879.1 transl_table 11 codon_start 1 locus_tag LOCUS_10480 CDS 1192325..1193257 product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071727514.1 transl_table 11 codon_start 1 locus_tag LOCUS_10490 CDS 1193415..1193588 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10500 CDS 1193625..1194068 product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002319218.1 transl_table 11 codon_start 1 locus_tag LOCUS_10510 CDS 1194229..1195212 product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356743.1 transl_table 11 codon_start 1 locus_tag LOCUS_10520 CDS 1195215..1195691 product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387079.1 transl_table 11 codon_start 1 locus_tag LOCUS_10530 gene ybeY CDS 1195666..1196091 product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700252.1 transl_table 11 codon_start 1 locus_tag LOCUS_10540 CDS 1196110..1197021 product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288753.1 transl_table 11 codon_start 1 locus_tag LOCUS_10550 gene era CDS 1197055..1197822 product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359746.1 transl_table 11 codon_start 1 locus_tag LOCUS_10560 gene recO CDS 1198127..1199053 product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706545.1 transl_table 11 codon_start 1 locus_tag LOCUS_10570 gene glyQ CDS 1199046..1201139 product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288758.1 transl_table 11 codon_start 1 locus_tag LOCUS_10580 gene glyS CDS 1201170..1202504 product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836728.1 transl_table 11 codon_start 1 locus_tag LOCUS_10590 gene obgE CDS 1202515..1203438 product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295809.1 transl_table 11 codon_start 1 locus_tag LOCUS_10600 gene rnz CDS 1203464..1204240 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547056.1 transl_table 11 codon_start 1 locus_tag LOCUS_10610 CDS 1204280..1206598 product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109501.1 transl_table 11 codon_start 1 locus_tag LOCUS_10620 gene recJ CDS 1206595..1207110 product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902332.1 transl_table 11 codon_start 1 locus_tag LOCUS_10630 CDS complement(1207185..1207796) product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254404.1 transl_table 11 codon_start 1 locus_tag LOCUS_10640 gene lexA CDS complement(1207942..1209597) product NFACT RNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640521.1 transl_table 11 codon_start 1 locus_tag LOCUS_10650 CDS 1209738..1210160 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10660 CDS 1210362..1210874 product ComE operon protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356697.1 transl_table 11 codon_start 1 locus_tag LOCUS_10670 CDS 1210994..1212340 product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135782805.1 transl_table 11 codon_start 1 locus_tag LOCUS_10680 gene gdhA CDS 1212438..1213295 product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000449218.1 transl_table 11 codon_start 1 locus_tag LOCUS_10690 CDS 1213288..1213746 product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830357.1 transl_table 11 codon_start 1 locus_tag LOCUS_10700 gene ybaK CDS complement(1213712..1214311) product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000834298.1 transl_table 11 codon_start 1 locus_tag LOCUS_10710 CDS complement(1214304..1214951) product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262694.1 transl_table 11 codon_start 1 locus_tag LOCUS_10720 gene nth CDS complement(1215041..1215475) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131384.1 transl_table 11 codon_start 1 locus_tag LOCUS_10730 CDS complement(1215491..1215919) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706572.1 transl_table 11 codon_start 1 locus_tag LOCUS_10740 CDS 1216098..1216724 product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003026840.1 transl_table 11 codon_start 1 locus_tag LOCUS_10750 gene pnuC CDS 1216807..1217715 product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000710090.1 transl_table 11 codon_start 1 locus_tag LOCUS_10760 CDS 1217837..1220320 product bifunctional lysylphosphatidylglycerol flippase/synthetase MprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000010848.1 transl_table 11 codon_start 1 locus_tag LOCUS_10770 gene mprF CDS 1220386..1220829 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10780 CDS 1221011..1223158 product PTS glucose transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000473177.1 transl_table 11 codon_start 1 locus_tag LOCUS_10790 gene ptsG CDS 1223377..1224315 product prolyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680838.1 transl_table 11 codon_start 1 locus_tag LOCUS_10800 gene pip CDS complement(1224379..1225017) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289118.1 transl_table 11 codon_start 1 locus_tag LOCUS_10810 CDS complement(1225109..1225660) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10820 CDS 1225892..1226254 product YbaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001237212.1 transl_table 11 codon_start 1 locus_tag LOCUS_10830 CDS complement(1226259..1227131) product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001005523.1 transl_table 11 codon_start 1 locus_tag LOCUS_10840 CDS complement(1227199..1228020) product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003662288.1 transl_table 11 codon_start 1 locus_tag LOCUS_10850 CDS 1228198..1229406 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643555.1 transl_table 11 codon_start 1 locus_tag LOCUS_10860 CDS 1229448..1231007 product VWA-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102172.1 transl_table 11 codon_start 1 locus_tag LOCUS_10870 CDS 1231029..1231493 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10880 CDS 1231569..1232039 product superoxide dismutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880100.1 transl_table 11 codon_start 1 locus_tag LOCUS_10890 CDS 1232233..1233393 product ArgE/DapE family deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368474.1 transl_table 11 codon_start 1 locus_tag LOCUS_10900 CDS 1233429..1234154 product DUF5058 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680854.1 transl_table 11 codon_start 1 locus_tag LOCUS_10910 CDS 1234167..1234853 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673400.1 transl_table 11 codon_start 1 locus_tag LOCUS_10920 CDS 1235389..1236525 product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812397.1 transl_table 11 codon_start 1 locus_tag LOCUS_10930 CDS 1236763..1237938 product betaine/proline/choline family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355745.1 transl_table 11 codon_start 1 locus_tag LOCUS_10940 CDS 1237935..1238582 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644316.1 transl_table 11 codon_start 1 locus_tag LOCUS_10950 CDS 1238585..1239541 product osmoprotectant ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296564.1 transl_table 11 codon_start 1 locus_tag LOCUS_10960 CDS 1239544..1240215 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721930.1 transl_table 11 codon_start 1 locus_tag LOCUS_10970 CDS 1240232..1240978 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642658.1 transl_table 11 codon_start 1 locus_tag LOCUS_10980 CDS complement(1241041..1241580) product DUF924 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207956.1 transl_table 11 codon_start 1 locus_tag LOCUS_10990 CDS 1241755..1242615 product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964728.1 transl_table 11 codon_start 1 locus_tag LOCUS_11000 CDS 1242924..1243211 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11010 note possible pseudo, frameshifted CDS 1243400..1244281 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11020 note possible pseudo, frameshifted CDS 1244278..1244463 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11030 CDS 1244635..1245051 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11040 CDS complement(1245678..1246151) product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582990.1 transl_table 11 codon_start 1 locus_tag LOCUS_11050 gene folK CDS complement(1246148..1246981) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11060 CDS complement(1247230..1248564) product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775168.1 transl_table 11 codon_start 1 locus_tag LOCUS_11070 CDS complement(1248595..1250466) product flavocytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262027.1 transl_table 11 codon_start 1 locus_tag LOCUS_11080 CDS 1250685..1251374 product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_113849253.1 transl_table 11 codon_start 1 locus_tag LOCUS_11090 CDS complement(1251446..1252255) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000054430.1 transl_table 11 codon_start 1 locus_tag LOCUS_11100 CDS complement(1252268..1253158) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002940642.1 transl_table 11 codon_start 1 locus_tag LOCUS_11110 CDS complement(1253163..1254116) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028292.1 transl_table 11 codon_start 1 locus_tag LOCUS_11120 CDS complement(1254765..1255700) product manganese-dependent inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547481.1 transl_table 11 codon_start 1 locus_tag LOCUS_11130 CDS complement(1255834..1258290) product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357527.1 transl_table 11 codon_start 1 locus_tag LOCUS_11140 gene parC CDS complement(1258280..1260355) product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003598661.1 transl_table 11 codon_start 1 locus_tag LOCUS_11150 gene parE CDS 1260498..1261109 product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644419.1 transl_table 11 codon_start 1 locus_tag LOCUS_11160 gene plsY CDS complement(1261142..1261963) product GTP-sensing pleiotropic transcriptional regulator CodY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357492.1 transl_table 11 codon_start 1 locus_tag LOCUS_11170 gene codY CDS complement(1261960..1262889) product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357488.1 transl_table 11 codon_start 1 locus_tag LOCUS_11180 gene xerC CDS complement(1263053..1265143) product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357484.1 transl_table 11 codon_start 1 locus_tag LOCUS_11190 gene topA CDS complement(1265231..1266115) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11200 CDS complement(1266165..1266941) product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296990.1 transl_table 11 codon_start 1 locus_tag LOCUS_11210 CDS complement(1266934..1267815) product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296988.1 transl_table 11 codon_start 1 locus_tag LOCUS_11220 gene ylqF CDS complement(1267888..1268415) product type I signal peptidase SipX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723887.1 transl_table 11 codon_start 1 locus_tag LOCUS_11230 gene sipX CDS complement(1268433..1270055) product carboxy-terminal processing protease CtpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231186.1 transl_table 11 codon_start 1 locus_tag LOCUS_11240 gene ctpA CDS complement(1270074..1270295) product YozE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231160.1 transl_table 11 codon_start 1 locus_tag LOCUS_11250 CDS complement(1270297..1270923) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11260 CDS complement(1270942..1271442) product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723427.1 transl_table 11 codon_start 1 locus_tag LOCUS_11270 CDS complement(1271484..1272425) product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700096.1 transl_table 11 codon_start 1 locus_tag LOCUS_11280 CDS complement(1272499..1274415) product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475878.1 transl_table 11 codon_start 1 locus_tag LOCUS_11290 CDS complement(1274488..1276170) product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369307.1 transl_table 11 codon_start 1 locus_tag LOCUS_11300 CDS complement(1276419..1277489) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404253.1 transl_table 11 codon_start 1 locus_tag LOCUS_11310 CDS complement(1277591..1277932) product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101950.1 transl_table 11 codon_start 1 locus_tag LOCUS_11320 CDS complement(1277932..1278153) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11330 CDS complement(1278223..1280061) product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706535.1 transl_table 11 codon_start 1 locus_tag LOCUS_11340 gene lepA CDS complement(1280261..1281421) product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357822.1 transl_table 11 codon_start 1 locus_tag LOCUS_11350 gene dnaJ CDS complement(1281493..1283313) product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002292134.1 transl_table 11 codon_start 1 locus_tag LOCUS_11360 gene dnaK CDS complement(1283335..1284003) product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296525.1 transl_table 11 codon_start 1 locus_tag LOCUS_11370 gene grpE CDS complement(1284008..1285078) product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003726026.1 transl_table 11 codon_start 1 locus_tag LOCUS_11380 gene hrcA CDS complement(1285380..1286336) product riboflavin biosynthesis protein RibF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002363808.1 transl_table 11 codon_start 1 locus_tag LOCUS_11390 gene ribF CDS complement(1286364..1287275) product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294474.1 transl_table 11 codon_start 1 locus_tag LOCUS_11400 gene truB CDS complement(1287290..1289080) product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965975.1 transl_table 11 codon_start 1 locus_tag LOCUS_11410 gene recQ CDS complement(1289283..1290764) product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379222.1 transl_table 11 codon_start 1 locus_tag LOCUS_11420 CDS complement(1290853..1291659) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000157662.1 transl_table 11 codon_start 1 locus_tag LOCUS_11430 CDS complement(1291676..1292560) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002940642.1 transl_table 11 codon_start 1 locus_tag LOCUS_11440 CDS complement(1292642..1293607) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028292.1 transl_table 11 codon_start 1 locus_tag LOCUS_11450 CDS complement(1294418..1294771) product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360497.1 transl_table 11 codon_start 1 locus_tag LOCUS_11460 gene rbfA CDS complement(1294793..1297060) product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288511.1 transl_table 11 codon_start 1 locus_tag LOCUS_11470 gene infB CDS complement(1297132..1297413) product YlxQ-related RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357860.1 transl_table 11 codon_start 1 locus_tag LOCUS_11480 CDS complement(1297406..1297702) product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002363794.1 transl_table 11 codon_start 1 locus_tag LOCUS_11490 CDS complement(1297714..1299081) product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357862.1 transl_table 11 codon_start 1 locus_tag LOCUS_11500 gene nusA CDS complement(1299094..1299567) product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357863.1 transl_table 11 codon_start 1 locus_tag LOCUS_11510 gene rimP CDS complement(1299674..1300333) product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272632.1 transl_table 11 codon_start 1 locus_tag LOCUS_11520 CDS complement(1300366..1301826) product DUF1538 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048012.1 transl_table 11 codon_start 1 locus_tag LOCUS_11530 CDS complement(1301851..1302162) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11540 CDS complement(1302374..1306687) product PolC-type DNA polymerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382781.1 transl_table 11 codon_start 1 locus_tag LOCUS_11550 CDS complement(1306739..1308001) product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294136.1 transl_table 11 codon_start 1 locus_tag LOCUS_11560 gene rseP CDS complement(1308014..1308805) product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732813.1 transl_table 11 codon_start 1 locus_tag LOCUS_11570 CDS complement(1308821..1309561) product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640735.1 transl_table 11 codon_start 1 locus_tag LOCUS_11580 CDS complement(1309814..1310374) product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003598868.1 transl_table 11 codon_start 1 locus_tag LOCUS_11590 gene frr CDS complement(1310379..1311095) product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293877.1 transl_table 11 codon_start 1 locus_tag LOCUS_11600 gene pyrH CDS complement(1311177..1312052) product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293878.1 transl_table 11 codon_start 1 locus_tag LOCUS_11610 gene tsf CDS complement(1312200..1312985) product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356759.1 transl_table 11 codon_start 1 locus_tag LOCUS_11620 gene rpsB CDS complement(1313157..1313735) product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922263.1 transl_table 11 codon_start 1 locus_tag LOCUS_11630 CDS complement(1313749..1314963) product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_140834638.1 transl_table 11 codon_start 1 locus_tag LOCUS_11640 CDS complement(1315000..1318194) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362298.1 transl_table 11 codon_start 1 locus_tag LOCUS_11650 CDS complement(1318412..1319659) product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888593.1 transl_table 11 codon_start 1 locus_tag LOCUS_11660 CDS complement(1319710..1321287) product acyl CoA:acetate/3-ketoacid CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989914.1 transl_table 11 codon_start 1 locus_tag LOCUS_11670 CDS complement(1321324..1322664) product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775168.1 transl_table 11 codon_start 1 locus_tag LOCUS_11680 CDS complement(1322742..1323479) product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000395038.1 transl_table 11 codon_start 1 locus_tag LOCUS_11690 gene fabG CDS 1323700..1324641 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000795892.1 transl_table 11 codon_start 1 locus_tag LOCUS_11700 CDS complement(1324722..1325510) product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939818.1 transl_table 11 codon_start 1 locus_tag LOCUS_11710 CDS 1325678..1326814 product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861586.1 transl_table 11 codon_start 1 locus_tag LOCUS_11720 CDS complement(1326898..1327227) product branched-chain amino acid transporter AzlD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245988.1 transl_table 11 codon_start 1 locus_tag LOCUS_11730 gene azlD CDS complement(1327224..1327907) product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460301.1 transl_table 11 codon_start 1 locus_tag LOCUS_11740 CDS complement(1328097..1328633) product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356260.1 transl_table 11 codon_start 1 locus_tag LOCUS_11750 gene hpt CDS complement(1328746..1329285) product energy coupling factor transporter S component ThiW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047762.1 transl_table 11 codon_start 1 locus_tag LOCUS_11760 gene thiW CDS complement(1329524..1330573) product PTS transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000063580.1 transl_table 11 codon_start 1 locus_tag LOCUS_11770 CDS complement(1330952..1331917) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028292.1 transl_table 11 codon_start 1 locus_tag LOCUS_11780 CDS complement(1332455..1333111) product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905124.1 transl_table 11 codon_start 1 locus_tag LOCUS_11790 CDS complement(1333210..1333428) product YneF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262555.1 transl_table 11 codon_start 1 locus_tag LOCUS_11800 CDS complement(1333521..1334468) product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245307.1 transl_table 11 codon_start 1 locus_tag LOCUS_11810 CDS complement(1334473..1334922) product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295859.1 transl_table 11 codon_start 1 locus_tag LOCUS_11820 gene lspA CDS complement(1334945..1335535) product ribonuclease H family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166524.1 transl_table 11 codon_start 1 locus_tag LOCUS_11830 tRNA complement(1335603..1335673) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00320 CDS complement(1335748..1339596) product helicase-exonuclease AddAB subunit AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288050.1 transl_table 11 codon_start 1 locus_tag LOCUS_11840 gene addA CDS complement(1339599..1343207) product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386608.1 transl_table 11 codon_start 1 locus_tag LOCUS_11850 CDS complement(1343231..1344355) product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379409.1 transl_table 11 codon_start 1 locus_tag LOCUS_11860 CDS complement(1344345..1345055) product tRNA (adenine(22)-N(1))-methyltransferase TrmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130628.1 transl_table 11 codon_start 1 locus_tag LOCUS_11870 CDS complement(1345055..1345585) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11880 CDS 1345693..1346004 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11890 CDS complement(1346068..1347510) product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100853.1 transl_table 11 codon_start 1 locus_tag LOCUS_11900 gene glgA CDS complement(1347554..1348708) product glucose-1-phosphate adenylyltransferase subunit GlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674727.1 transl_table 11 codon_start 1 locus_tag LOCUS_11910 gene glgD CDS complement(1348695..1349834) product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003659327.1 transl_table 11 codon_start 1 locus_tag LOCUS_11920 CDS complement(1349909..1351897) product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476259.1 transl_table 11 codon_start 1 locus_tag LOCUS_11930 gene glgB CDS complement(1352148..1352528) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002327753.1 transl_table 11 codon_start 1 locus_tag LOCUS_11940 tRNA complement(1352956..1353040) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00330 CDS complement(1353223..1354101) product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382324.1 transl_table 11 codon_start 1 locus_tag LOCUS_11950 CDS complement(1354288..1355028) product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002895490.1 transl_table 11 codon_start 1 locus_tag LOCUS_11960 CDS 1355848..1356279 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130113.1 transl_table 11 codon_start 1 locus_tag LOCUS_11970 CDS 1356294..1358021 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287267.1 transl_table 11 codon_start 1 locus_tag LOCUS_11980 CDS 1358021..1359820 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359616.1 transl_table 11 codon_start 1 locus_tag LOCUS_11990 CDS complement(1359882..1360922) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475752.1 transl_table 11 codon_start 1 locus_tag LOCUS_12000 CDS complement(1360996..1361277) product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003726866.1 transl_table 11 codon_start 1 locus_tag LOCUS_12010 gene rpmA CDS complement(1361296..1361586) product ribosomal-processing cysteine protease Prp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000613699.1 transl_table 11 codon_start 1 locus_tag LOCUS_12020 CDS complement(1361634..1361942) product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700335.1 transl_table 11 codon_start 1 locus_tag LOCUS_12030 gene rplU CDS complement(1362188..1363099) product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475575.1 transl_table 11 codon_start 1 locus_tag LOCUS_12040 CDS complement(1363092..1364390) product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254442.1 transl_table 11 codon_start 1 locus_tag LOCUS_12050 CDS complement(1364390..1365304) product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548032.1 transl_table 11 codon_start 1 locus_tag LOCUS_12060 CDS complement(1365353..1368529) product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837069.1 transl_table 11 codon_start 1 locus_tag LOCUS_12070 gene carB CDS complement(1368572..1369651) product carbamoyl phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002939138.1 transl_table 11 codon_start 1 locus_tag LOCUS_12080 CDS complement(1369933..1370604) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815786.1 transl_table 11 codon_start 1 locus_tag LOCUS_12090 CDS complement(1370632..1372125) product amino acid ABC transporter substrate-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296521.1 transl_table 11 codon_start 1 locus_tag LOCUS_12100 CDS complement(1372466..1372987) product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287385.1 transl_table 11 codon_start 1 locus_tag LOCUS_12110 gene mreD CDS complement(1373002..1373931) product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565129.1 transl_table 11 codon_start 1 locus_tag LOCUS_12120 gene mreC CDS complement(1374189..1374923) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963439.1 transl_table 11 codon_start 1 locus_tag LOCUS_12130 CDS complement(1375151..1376515) product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931234.1 transl_table 11 codon_start 1 locus_tag LOCUS_12140 CDS complement(1376699..1377904) product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640674.1 transl_table 11 codon_start 1 locus_tag LOCUS_12150 gene rpoD CDS complement(1377905..1379770) product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476034.1 transl_table 11 codon_start 1 locus_tag LOCUS_12160 gene dnaG CDS complement(1379883..1380485) product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775089.1 transl_table 11 codon_start 1 locus_tag LOCUS_12170 gene yihA CDS complement(1380656..1381912) product ATP-dependent protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723886.1 transl_table 11 codon_start 1 locus_tag LOCUS_12180 gene clpX CDS complement(1382026..1383306) product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002292069.1 transl_table 11 codon_start 1 locus_tag LOCUS_12190 gene tig CDS 1383599..1384207 product Holliday junction resolvase RecU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723001.1 transl_table 11 codon_start 1 locus_tag LOCUS_12200 gene recU CDS 1384359..1386683 product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360569.1 transl_table 11 codon_start 1 locus_tag LOCUS_12210 CDS complement(1386888..1388048) product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836969.1 transl_table 11 codon_start 1 locus_tag LOCUS_12220 CDS 1388214..1389182 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387471.1 transl_table 11 codon_start 1 locus_tag LOCUS_12230 CDS 1389188..1389622 product CopY/TcrY family copper transport repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379040.1 transl_table 11 codon_start 1 locus_tag LOCUS_12240 CDS complement(1389628..1390302) product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387025.1 transl_table 11 codon_start 1 locus_tag LOCUS_12250 CDS 1390412..1391320 product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641058.1 transl_table 11 codon_start 1 locus_tag LOCUS_12260 CDS 1391310..1391879 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12270 CDS complement(1391985..1392632) product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898027.1 transl_table 11 codon_start 1 locus_tag LOCUS_12280 CDS 1392823..1394451 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000633864.1 transl_table 11 codon_start 1 locus_tag LOCUS_12290 CDS complement(1394531..1395271) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263655.1 transl_table 11 codon_start 1 locus_tag LOCUS_12300 CDS complement(1395281..1395970) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837551.1 transl_table 11 codon_start 1 locus_tag LOCUS_12310 CDS complement(1395975..1396667) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002907938.1 transl_table 11 codon_start 1 locus_tag LOCUS_12320 CDS complement(1396826..1397680) product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837552.1 transl_table 11 codon_start 1 locus_tag LOCUS_12330 CDS complement(1397670..1398677) product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837553.1 transl_table 11 codon_start 1 locus_tag LOCUS_12340 CDS 1399061..1400797 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262897.1 transl_table 11 codon_start 1 locus_tag LOCUS_12350 CDS 1400787..1402586 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028081.1 transl_table 11 codon_start 1 locus_tag LOCUS_12360 CDS complement(1403020..1404186) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132377852.1 transl_table 11 codon_start 1 locus_tag LOCUS_12370 CDS complement(1404199..1405131) product type I pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356160.1 transl_table 11 codon_start 1 locus_tag LOCUS_12380 gene coaA CDS complement(1405147..1405902) product acyl-[acyl-carrier-protein] thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009660378.1 transl_table 11 codon_start 1 locus_tag LOCUS_12390 CDS 1406106..1406399 product iron-sulfur cluster biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381169.1 transl_table 11 codon_start 1 locus_tag LOCUS_12400 CDS 1406420..1406686 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12410 CDS 1406901..1408496 product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963362.1 transl_table 11 codon_start 1 locus_tag LOCUS_12420 CDS complement(1408616..1409773) product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837503.1 transl_table 11 codon_start 1 locus_tag LOCUS_12430 CDS 1409948..1410625 product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131502.1 transl_table 11 codon_start 1 locus_tag LOCUS_12440 CDS 1410759..1410977 product DNA-directed RNA polymerase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355123.1 transl_table 11 codon_start 1 locus_tag LOCUS_12450 CDS 1410977..1412650 product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287948.1 transl_table 11 codon_start 1 locus_tag LOCUS_12460 CDS complement(1412725..1412910) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12470 CDS complement(1412907..1414220) product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699949.1 transl_table 11 codon_start 1 locus_tag LOCUS_12480 gene murA CDS complement(1414275..1414916) product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000515974.1 transl_table 11 codon_start 1 locus_tag LOCUS_12490 gene upp CDS complement(1414952..1416169) product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294099.1 transl_table 11 codon_start 1 locus_tag LOCUS_12500 CDS complement(1416247..1417278) product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641435.1 transl_table 11 codon_start 1 locus_tag LOCUS_12510 CDS complement(1417280..1418158) product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379699.1 transl_table 11 codon_start 1 locus_tag LOCUS_12520 gene prmC CDS complement(1418142..1419224) product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641433.1 transl_table 11 codon_start 1 locus_tag LOCUS_12530 gene prfA CDS complement(1419240..1419860) product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262254.1 transl_table 11 codon_start 1 locus_tag LOCUS_12540 CDS complement(1420016..1420663) product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287245.1 transl_table 11 codon_start 1 locus_tag LOCUS_12550 CDS complement(1420660..1422015) product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287244.1 transl_table 11 codon_start 1 locus_tag LOCUS_12560 CDS complement(1422152..1423396) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287273.1 transl_table 11 codon_start 1 locus_tag LOCUS_12570 CDS 1423497..1424510 product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357153.1 transl_table 11 codon_start 1 locus_tag LOCUS_12580 CDS 1424615..1425442 product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706548.1 transl_table 11 codon_start 1 locus_tag LOCUS_12590 CDS complement(1425512..1426615) product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830775.1 transl_table 11 codon_start 1 locus_tag LOCUS_12600 gene ald CDS complement(1426741..1427712) product diaminopimelate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808153.1 transl_table 11 codon_start 1 locus_tag LOCUS_12610 CDS complement(1427743..1429059) product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398851.1 transl_table 11 codon_start 1 locus_tag LOCUS_12620 gene lysA CDS 1429411..1430082 product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357304.1 transl_table 11 codon_start 1 locus_tag LOCUS_12630 gene phoU CDS complement(1430300..1431511) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000074744.1 transl_table 11 codon_start 1 locus_tag LOCUS_12640 CDS complement(1431581..1432216) product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288884.1 transl_table 11 codon_start 1 locus_tag LOCUS_12650 gene pyrE CDS complement(1432217..1432912) product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000083500.1 transl_table 11 codon_start 1 locus_tag LOCUS_12660 gene pyrF CDS 1433544..1434116 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12670 tmRNA complement(1434228..1434586) product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_tm00010 CDS complement(1434717..1435436) product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732396.1 transl_table 11 codon_start 1 locus_tag LOCUS_12680 CDS 1435608..1436480 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12690 CDS complement(1436663..1437127) product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085183.1 transl_table 11 codon_start 1 locus_tag LOCUS_12700 gene smpB CDS complement(1437149..1439473) product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289014.1 transl_table 11 codon_start 1 locus_tag LOCUS_12710 gene rnr CDS complement(1439481..1440230) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641051.1 transl_table 11 codon_start 1 locus_tag LOCUS_12720 CDS complement(1440305..1440535) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12730 CDS complement(1440638..1441822) product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000232156.1 transl_table 11 codon_start 1 locus_tag LOCUS_12740 CDS complement(1441809..1442900) product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000442921.1 transl_table 11 codon_start 1 locus_tag LOCUS_12750 gene serC CDS complement(1443019..1443594) product TIGR01906 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386635.1 transl_table 11 codon_start 1 locus_tag LOCUS_12760 CDS complement(1443621..1444445) product TIGR01457 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674293.1 transl_table 11 codon_start 1 locus_tag LOCUS_12770 CDS complement(1444445..1445047) product YutD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287156.1 transl_table 11 codon_start 1 locus_tag LOCUS_12780 CDS complement(1445217..1446515) product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263196.1 transl_table 11 codon_start 1 locus_tag LOCUS_12790 gene eno CDS complement(1446564..1447319) product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002292815.1 transl_table 11 codon_start 1 locus_tag LOCUS_12800 gene tpiA CDS complement(1447335..1448531) product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357094.1 transl_table 11 codon_start 1 locus_tag LOCUS_12810 CDS complement(1448630..1449628) product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002292818.1 transl_table 11 codon_start 1 locus_tag LOCUS_12820 gene gap CDS complement(1449665..1450705) product central glycolytic genes regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564263.1 transl_table 11 codon_start 1 locus_tag LOCUS_12830 CDS complement(1450948..1451550) product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289402.1 transl_table 11 codon_start 1 locus_tag LOCUS_12840 gene clpP tRNA 1451831..1451904 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00340 CDS 1452397..1453083 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12850 CDS 1453106..1453786 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12860 CDS complement(1453915..1454736) product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383735.1 transl_table 11 codon_start 1 locus_tag LOCUS_12870 CDS complement(1455070..1457067) product fructose-specific PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000701402.1 transl_table 11 codon_start 1 locus_tag LOCUS_12880 CDS complement(1457086..1458006) product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000640859.1 transl_table 11 codon_start 1 locus_tag LOCUS_12890 gene pfkB CDS complement(1458003..1458743) product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002323503.1 transl_table 11 codon_start 1 locus_tag LOCUS_12900 tRNA complement(1458966..1459039) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00350 tRNA complement(1459054..1459126) product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00360 tRNA complement(1459139..1459211) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00370 tRNA complement(1459234..1459308) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00380 tRNA complement(1459341..1459414) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00390 tRNA complement(1459422..1459511) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00400 tRNA complement(1459522..1459597) product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00410 tRNA complement(1459607..1459677) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00420 tRNA complement(1459681..1459753) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00430 tRNA complement(1459770..1459844) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00440 tRNA complement(1459855..1459944) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00450 tRNA complement(1459963..1460036) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00460 tRNA complement(1460045..1460120) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00470 tRNA complement(1460134..1460206) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00480 tRNA complement(1460211..1460285) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00490 tRNA complement(1460290..1460363) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00500 tRNA complement(1460381..1460468) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00510 tRNA complement(1460500..1460571) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00520 tRNA complement(1460583..1460655) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00530 tRNA complement(1460666..1460748) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00540 tRNA complement(1460755..1460829) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00550 tRNA complement(1460832..1460906) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00560 rRNA complement(1460918..1461028) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00100 rRNA complement(1461111..1464010) product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00110 tRNA complement(1464179..1464251) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00570 tRNA complement(1464286..1464359) product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00580 rRNA complement(1464442..1465986) product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00120 CDS complement(1466474..1467823) product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288574.1 transl_table 11 codon_start 1 locus_tag LOCUS_12910 CDS complement(1467826..1468236) product CvfD/Ygs/GSP13 family RNA-binding post-transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287231.1 transl_table 11 codon_start 1 locus_tag LOCUS_12920 CDS complement(1468236..1468829) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355150.1 transl_table 11 codon_start 1 locus_tag LOCUS_12930 CDS 1468984..1469487 product divergent PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009925810.1 transl_table 11 codon_start 1 locus_tag LOCUS_12940 CDS 1469487..1470491 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287165.1 transl_table 11 codon_start 1 locus_tag LOCUS_12950 CDS complement(1470565..1471236) product DnaD domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003706143.1 transl_table 11 codon_start 1 locus_tag LOCUS_12960 CDS complement(1471251..1472438) product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837099.1 transl_table 11 codon_start 1 locus_tag LOCUS_12970 CDS complement(1472452..1472928) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12980 CDS complement(1472940..1475612) product ATP-dependent DNA helicase DinG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_212965591.1 transl_table 11 codon_start 1 locus_tag LOCUS_12990 gene dinG CDS complement(1475640..1476878) product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475877.1 transl_table 11 codon_start 1 locus_tag LOCUS_13000 CDS complement(1476875..1477657) product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723017.1 transl_table 11 codon_start 1 locus_tag LOCUS_13010 gene dapB CDS complement(1477710..1478999) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289879.1 transl_table 11 codon_start 1 locus_tag LOCUS_13020 CDS complement(1479116..1479394) product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290178.1 transl_table 11 codon_start 1 locus_tag LOCUS_13030 CDS complement(1479519..1480829) product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379441.1 transl_table 11 codon_start 1 locus_tag LOCUS_13040 gene der CDS complement(1480920..1482242) product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640589.1 transl_table 11 codon_start 1 locus_tag LOCUS_13050 gene rpsA CDS complement(1482375..1483049) product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357612.1 transl_table 11 codon_start 1 locus_tag LOCUS_13060 gene cmk CDS complement(1483081..1483809) product LysM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565353.1 transl_table 11 codon_start 1 locus_tag LOCUS_13070 CDS complement(1483888..1485366) product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476027.1 transl_table 11 codon_start 1 locus_tag LOCUS_13080 CDS complement(1485360..1486364) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645009.1 transl_table 11 codon_start 1 locus_tag LOCUS_13090 CDS 1486900..1487250 product IS66 family insertion sequence element accessory protein TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000973424.1 transl_table 11 codon_start 1 locus_tag LOCUS_13100 gene tnpB CDS 1487308..1488945 product IS66-like element short variant transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068990772.1 transl_table 11 codon_start 1 locus_tag LOCUS_13110 CDS 1489016..1490599 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13120 CDS complement(1490708..1491298) product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674489.1 transl_table 11 codon_start 1 locus_tag LOCUS_13130 CDS complement(1491581..1492303) product 23S rRNA pseudouridine(2605) synthase RluB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398815.1 transl_table 11 codon_start 1 locus_tag LOCUS_13140 gene rluB CDS complement(1492303..1492863) product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565342.1 transl_table 11 codon_start 1 locus_tag LOCUS_13150 gene scpB CDS complement(1492860..1493630) product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723598.1 transl_table 11 codon_start 1 locus_tag LOCUS_13160 CDS complement(1493627..1494031) product reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700315.1 transl_table 11 codon_start 1 locus_tag LOCUS_13170 CDS complement(1494160..1494891) product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837019.1 transl_table 11 codon_start 1 locus_tag LOCUS_13180 CDS 1495026..1495832 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13190 CDS complement(1495986..1497374) product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808874.1 transl_table 11 codon_start 1 locus_tag LOCUS_13200 gene ltrA CDS complement(1497834..1498733) product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294386.1 transl_table 11 codon_start 1 locus_tag LOCUS_13210 gene xerD CDS complement(1498738..1499607) product S1-like domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565335.1 transl_table 11 codon_start 1 locus_tag LOCUS_13220 CDS complement(1499743..1501530) product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010714110.1 transl_table 11 codon_start 1 locus_tag LOCUS_13230 gene pyk CDS complement(1501551..1502537) product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355947.1 transl_table 11 codon_start 1 locus_tag LOCUS_13240 gene pfkA CDS complement(1502627..1506001) product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101583.1 transl_table 11 codon_start 1 locus_tag LOCUS_13250 gene dnaE CDS complement(1506090..1507148) product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296565.1 transl_table 11 codon_start 1 locus_tag LOCUS_13260 gene queA CDS complement(1507123..1508160) product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641514.1 transl_table 11 codon_start 1 locus_tag LOCUS_13270 gene ruvB CDS complement(1508180..1508788) product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700560.1 transl_table 11 codon_start 1 locus_tag LOCUS_13280 gene ruvA CDS complement(1508801..1509238) product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294252.1 transl_table 11 codon_start 1 locus_tag LOCUS_13290 gene msrB CDS complement(1509301..1511199) product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476177.1 transl_table 11 codon_start 1 locus_tag LOCUS_13300 gene mutL CDS complement(1511201..1513789) product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002378992.1 transl_table 11 codon_start 1 locus_tag LOCUS_13310 gene mutS CDS 1513917..1514543 product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101549.1 transl_table 11 codon_start 1 locus_tag LOCUS_13320 tRNA 1514575..1514662 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00590 CDS complement(1514991..1515263) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13330 CDS complement(1515256..1515507) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13340 CDS complement(1515711..1516127) product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000381519.1 transl_table 11 codon_start 1 locus_tag LOCUS_13350 CDS complement(1516111..1516305) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13360 CDS complement(1516503..1516631) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13370 CDS complement(1517063..1517545) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13380 CDS complement(1517590..1518195) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13390 CDS complement(1518216..1518581) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13400 CDS complement(1518603..1519037) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13410 CDS complement(1519195..1519464) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13420 CDS complement(1519479..1519721) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13430 CDS complement(1519733..1519975) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13440 CDS complement(1519986..1520234) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13450 CDS complement(1520537..1522015) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13460 CDS complement(1522008..1522946) product primase alpha helix C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000158193.1 transl_table 11 codon_start 1 locus_tag LOCUS_13470 CDS complement(1522956..1523441) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13480 CDS complement(1523596..1523880) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13490 CDS complement(1523893..1524297) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13500 CDS complement(1524392..1524691) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13510 CDS complement(1524675..1525001) product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002292678.1 transl_table 11 codon_start 1 locus_tag LOCUS_13520 CDS complement(1525172..1525516) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13530 CDS complement(1525548..1525697) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13540 CDS complement(1525887..1526063) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13550 CDS complement(1526185..1526805) product Rha family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000424672.1 transl_table 11 codon_start 1 locus_tag LOCUS_13560 CDS complement(1527082..1527300) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001060953.1 transl_table 11 codon_start 1 locus_tag LOCUS_13570 CDS 1527425..1528204 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13580 CDS 1528321..1529478 product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087235334.1 transl_table 11 codon_start 1 locus_tag LOCUS_13590 CDS complement(1529848..1529982) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13600 CDS complement(1530310..1531881) product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644638.1 transl_table 11 codon_start 1 locus_tag LOCUS_13610 gene rny CDS complement(1532176..1533291) product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641504.1 transl_table 11 codon_start 1 locus_tag LOCUS_13620 gene recA CDS complement(1533373..1534611) product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025189782.1 transl_table 11 codon_start 1 locus_tag LOCUS_13630 CDS complement(1534663..1535241) product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002365382.1 transl_table 11 codon_start 1 locus_tag LOCUS_13640 gene pgsA CDS complement(1535487..1537841) product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289244.1 transl_table 11 codon_start 1 locus_tag LOCUS_13650 CDS 1537995..1538273 product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548299.1 transl_table 11 codon_start 1 locus_tag LOCUS_13660 CDS 1538337..1539263 product membrane protein insertase YidC2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262549.1 transl_table 11 codon_start 1 locus_tag LOCUS_13670 gene yidC2 CDS complement(1539353..1540060) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290973.1 transl_table 11 codon_start 1 locus_tag LOCUS_13680 CDS complement(1540087..1541520) product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355953.1 transl_table 11 codon_start 1 locus_tag LOCUS_13690 gene gndA CDS complement(1541453..1541632) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13700 CDS 1541751..1541924 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13710 CDS complement(1542010..1543233) product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001200061.1 transl_table 11 codon_start 1 locus_tag LOCUS_13720 gene thiI CDS complement(1543242..1544396) product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644645.1 transl_table 11 codon_start 1 locus_tag LOCUS_13730 CDS complement(1544543..1546264) product septation ring formation regulator EzrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287957.1 transl_table 11 codon_start 1 locus_tag LOCUS_13740 CDS complement(1546450..1547061) product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294265.1 transl_table 11 codon_start 1 locus_tag LOCUS_13750 gene rpsD CDS complement(1547313..1548008) product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263611.1 transl_table 11 codon_start 1 locus_tag LOCUS_13760 CDS complement(1548018..1548413) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13770 CDS complement(1548419..1548970) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723131.1 transl_table 11 codon_start 1 locus_tag LOCUS_13780 CDS 1549134..1549379 product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289280.1 transl_table 11 codon_start 1 locus_tag LOCUS_13790 CDS complement(1549464..1550807) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905313.1 transl_table 11 codon_start 1 locus_tag LOCUS_13800 CDS complement(1551083..1551286) product cold shock domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002303804.1 transl_table 11 codon_start 1 locus_tag LOCUS_13810 CDS complement(1551289..1554072) product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286621.1 transl_table 11 codon_start 1 locus_tag LOCUS_13820 gene ileS CDS complement(1554391..1555083) product DivIVA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003570134.1 transl_table 11 codon_start 1 locus_tag LOCUS_13830 CDS complement(1555097..1555882) product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476135.1 transl_table 11 codon_start 1 locus_tag LOCUS_13840 CDS complement(1555900..1556148) product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644609.1 transl_table 11 codon_start 1 locus_tag LOCUS_13850 CDS complement(1556163..1556708) product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286628.1 transl_table 11 codon_start 1 locus_tag LOCUS_13860 CDS complement(1556836..1558125) product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476137.1 transl_table 11 codon_start 1 locus_tag LOCUS_13870 gene ftsZ CDS complement(1558158..1559540) product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286631.1 transl_table 11 codon_start 1 locus_tag LOCUS_13880 gene ftsA CDS complement(1559750..1561018) product cell division protein FtsQ/DivIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286633.1 transl_table 11 codon_start 1 locus_tag LOCUS_13890 CDS complement(1561030..1562124) product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476139.1 transl_table 11 codon_start 1 locus_tag LOCUS_13900 gene murG CDS complement(1562139..1563527) product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286638.1 transl_table 11 codon_start 1 locus_tag LOCUS_13910 gene murD CDS complement(1563537..1564484) product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286639.1 transl_table 11 codon_start 1 locus_tag LOCUS_13920 gene mraY CDS complement(1564505..1566661) product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476141.1 transl_table 11 codon_start 1 locus_tag LOCUS_13930 CDS complement(1566645..1567055) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13940 CDS complement(1567075..1568031) product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286642.1 transl_table 11 codon_start 1 locus_tag LOCUS_13950 gene rsmH CDS complement(1568047..1568478) product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286645.1 transl_table 11 codon_start 1 locus_tag LOCUS_13960 gene mraZ CDS complement(1568693..1569064) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13970 CDS complement(1569267..1569455) product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699811.1 transl_table 11 codon_start 1 locus_tag LOCUS_13980 gene rpmF CDS complement(1569485..1570036) product YceD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674574.1 transl_table 11 codon_start 1 locus_tag LOCUS_13990 CDS complement(1570145..1571359) product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287640.1 transl_table 11 codon_start 1 locus_tag LOCUS_14000 CDS complement(1571410..1572168) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905221.1 transl_table 11 codon_start 1 locus_tag LOCUS_14010 CDS complement(1572158..1572535) product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475792.1 transl_table 11 codon_start 1 locus_tag LOCUS_14020 gene rsfS CDS complement(1572532..1573143) product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287635.1 transl_table 11 codon_start 1 locus_tag LOCUS_14030 gene yqeK CDS complement(1573136..1573780) product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287632.1 transl_table 11 codon_start 1 locus_tag LOCUS_14040 CDS complement(1573784..1574107) product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287630.1 transl_table 11 codon_start 1 locus_tag LOCUS_14050 gene yhbY CDS complement(1574116..1575228) product ribosome biogenesis GTPase YqeH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287628.1 transl_table 11 codon_start 1 locus_tag LOCUS_14060 gene yqeH CDS complement(1575221..1575751) product YqeG family HAD IIIA-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475789.1 transl_table 11 codon_start 1 locus_tag LOCUS_14070 CDS complement(1575877..1576776) product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387081.1 transl_table 11 codon_start 1 locus_tag LOCUS_14080 gene thrB CDS complement(1576780..1578060) product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009924346.1 transl_table 11 codon_start 1 locus_tag LOCUS_14090 CDS complement(1578078..1579592) product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--L-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002285962.1 transl_table 11 codon_start 1 locus_tag LOCUS_14100 CDS complement(1579716..1579943) product YkuJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379802.1 transl_table 11 codon_start 1 locus_tag LOCUS_14110 CDS complement(1580008..1581216) product cell wall glycolipid biosynthesis glucosyltransferase BgsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706866.1 transl_table 11 codon_start 1 locus_tag LOCUS_14120 gene bgsB CDS complement(1581383..1583107) product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138153.1 transl_table 11 codon_start 1 locus_tag LOCUS_14130 gene ptsP CDS complement(1583109..1583375) product phosphocarrier protein HPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287602.1 transl_table 11 codon_start 1 locus_tag LOCUS_14140 CDS 1583666..1585852 product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287598.1 transl_table 11 codon_start 1 locus_tag LOCUS_14150 CDS complement(1585961..1587442) product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355966.1 transl_table 11 codon_start 1 locus_tag LOCUS_14160 gene guaB CDS complement(1587717..1589288) product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355543.1 transl_table 11 codon_start 1 locus_tag LOCUS_14170 CDS complement(1589925..1590668) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294240.1 transl_table 11 codon_start 1 locus_tag LOCUS_14180 CDS complement(1590658..1592304) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706796.1 transl_table 11 codon_start 1 locus_tag LOCUS_14190 CDS complement(1592506..1593144) product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357673.1 transl_table 11 codon_start 1 locus_tag LOCUS_14200 CDS complement(1593165..1594604) product V-type ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002292842.1 transl_table 11 codon_start 1 locus_tag LOCUS_14210 CDS complement(1594604..1596385) product V-type ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295101.1 transl_table 11 codon_start 1 locus_tag LOCUS_14220 CDS complement(1596404..1596715) product V-type ATP synthase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986934.1 transl_table 11 codon_start 1 locus_tag LOCUS_14230 CDS complement(1596705..1597727) product V-type ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010774209.1 transl_table 11 codon_start 1 locus_tag LOCUS_14240 CDS complement(1597744..1598325) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14250 CDS complement(1598347..1598826) product V-type ATP synthase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002898768.1 transl_table 11 codon_start 1 locus_tag LOCUS_14260 CDS complement(1598842..1600815) product V-type ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379422.1 transl_table 11 codon_start 1 locus_tag LOCUS_14270 CDS complement(1600802..1601128) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14280 CDS 1601430..1601867 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355539.1 transl_table 11 codon_start 1 locus_tag LOCUS_14290 CDS complement(1601873..1602799) product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965131.1 transl_table 11 codon_start 1 locus_tag LOCUS_14300 gene metA CDS complement(1603136..1604545) product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294561.1 transl_table 11 codon_start 1 locus_tag LOCUS_14310 gene mgtE CDS complement(1604546..1605409) product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027041.1 transl_table 11 codon_start 1 locus_tag LOCUS_14320 CDS complement(1605459..1606277) product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564146.1 transl_table 11 codon_start 1 locus_tag LOCUS_14330 CDS 1606506..1607102 product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732426.1 transl_table 11 codon_start 1 locus_tag LOCUS_14340 CDS 1607142..1607879 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14350 CDS complement(1607938..1608984) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14360 CDS complement(1609058..1610047) product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002378619.1 transl_table 11 codon_start 1 locus_tag LOCUS_14370 gene trpS CDS 1610418..1610813 product transcriptional regulator SpxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003720569.1 transl_table 11 codon_start 1 locus_tag LOCUS_14380 gene spxA CDS 1610975..1611622 product adaptor protein MecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288948.1 transl_table 11 codon_start 1 locus_tag LOCUS_14390 CDS complement(1611637..1612161) product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387179.1 transl_table 11 codon_start 1 locus_tag LOCUS_14400 CDS complement(1612334..1613209) product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002390147.1 transl_table 11 codon_start 1 locus_tag LOCUS_14410 CDS complement(1613236..1613913) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359998.1 transl_table 11 codon_start 1 locus_tag LOCUS_14420 CDS complement(1613916..1614971) product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356948.1 transl_table 11 codon_start 1 locus_tag LOCUS_14430 CDS 1615181..1615651 product Dps family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002297290.1 transl_table 11 codon_start 1 locus_tag LOCUS_14440 CDS complement(1615710..1616069) product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289310.1 transl_table 11 codon_start 1 locus_tag LOCUS_14450 gene rplT CDS complement(1616126..1616326) product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699793.1 transl_table 11 codon_start 1 locus_tag LOCUS_14460 gene rpmI CDS complement(1616344..1616679) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14470 CDS complement(1617102..1618310) product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898184.1 transl_table 11 codon_start 1 locus_tag LOCUS_14480 CDS complement(1618339..1618803) product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065167.1 transl_table 11 codon_start 1 locus_tag LOCUS_14490 CDS complement(1618805..1619185) product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114300.1 transl_table 11 codon_start 1 locus_tag LOCUS_14500 CDS complement(1619307..1621262) product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356319.1 transl_table 11 codon_start 1 locus_tag LOCUS_14510 gene thrS CDS complement(1621566..1622495) product primosomal protein DnaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288331.1 transl_table 11 codon_start 1 locus_tag LOCUS_14520 gene dnaI CDS complement(1622492..1623895) product DnaD domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699787.1 transl_table 11 codon_start 1 locus_tag LOCUS_14530 CDS complement(1623892..1624275) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14540 CDS complement(1624514..1625122) product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475784.1 transl_table 11 codon_start 1 locus_tag LOCUS_14550 gene coaE CDS complement(1625136..1625948) product DNA-formamidopyrimidine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001114617.1 transl_table 11 codon_start 1 locus_tag LOCUS_14560 gene mutM CDS 1626236..1626385 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14570 CDS complement(1626574..1629240) product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355755.1 transl_table 11 codon_start 1 locus_tag LOCUS_14580 gene polA CDS complement(1629261..1629641) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14590 CDS complement(1629858..1631579) product 1,4-beta-N-acetylmuramoylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990043.1 transl_table 11 codon_start 1 locus_tag LOCUS_14600 CDS 1631735..1632316 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002285906.1 transl_table 11 codon_start 1 locus_tag LOCUS_14610 CDS complement(1633078..1633773) product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706793.1 transl_table 11 codon_start 1 locus_tag LOCUS_14620 gene radC CDS complement(1633912..1635720) product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000334463.1 transl_table 11 codon_start 1 locus_tag LOCUS_14630 gene glmS CDS complement(1636393..1639038) product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287953.1 transl_table 11 codon_start 1 locus_tag LOCUS_14640 CDS complement(1639343..1639969) product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002364174.1 transl_table 11 codon_start 1 locus_tag LOCUS_14650 CDS complement(1639969..1640391) product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640328.1 transl_table 11 codon_start 1 locus_tag LOCUS_14660 CDS complement(1640395..1641360) product ROK family glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775546.1 transl_table 11 codon_start 1 locus_tag LOCUS_14670 CDS complement(1641370..1642035) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14680 CDS complement(1642306..1642485) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14690 CDS complement(1642520..1643287) product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832302.1 transl_table 11 codon_start 1 locus_tag LOCUS_14700 CDS complement(1643308..1644726) product acyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012416341.1 transl_table 11 codon_start 1 locus_tag LOCUS_14710 CDS complement(1644719..1645756) product coenzyme F390 synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068525.1 transl_table 11 codon_start 1 locus_tag LOCUS_14720 CDS complement(1646298..1646453) product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358586.1 transl_table 11 codon_start 1 locus_tag LOCUS_14730 gene rpmG CDS complement(1646562..1648640) product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721943.1 transl_table 11 codon_start 1 locus_tag LOCUS_14740 CDS 1648857..1651550 product YfhO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101465.1 transl_table 11 codon_start 1 locus_tag LOCUS_14750 CDS complement(1651612..1652286) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392690.1 transl_table 11 codon_start 1 locus_tag LOCUS_14760 CDS 1652473..1653375 product DUF1189 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289147.1 transl_table 11 codon_start 1 locus_tag LOCUS_14770 CDS complement(1653402..1654751) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379408.1 transl_table 11 codon_start 1 locus_tag LOCUS_14780 CDS 1654936..1656393 product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644713.1 transl_table 11 codon_start 1 locus_tag LOCUS_14790 gene zwf CDS complement(1656959..1657924) product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263149.1 transl_table 11 codon_start 1 locus_tag LOCUS_14800 CDS complement(1657952..1659265) product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000201587.1 transl_table 11 codon_start 1 locus_tag LOCUS_14810 CDS complement(1659285..1660403) product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294035.1 transl_table 11 codon_start 1 locus_tag LOCUS_14820 gene dinB CDS complement(1660524..1660817) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14830 CDS complement(1660820..1661203) product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294182.1 transl_table 11 codon_start 1 locus_tag LOCUS_14840 gene yajC CDS complement(1661241..1662380) product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355772.1 transl_table 11 codon_start 1 locus_tag LOCUS_14850 gene tgt CDS complement(1662578..1665196) product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356811.1 transl_table 11 codon_start 1 locus_tag LOCUS_14860 gene clpB CDS complement(1665388..1668006) product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288348.1 transl_table 11 codon_start 1 locus_tag LOCUS_14870 gene clpB CDS complement(1668109..1669326) product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263119.1 transl_table 11 codon_start 1 locus_tag LOCUS_14880 CDS complement(1669341..1670372) product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002897598.1 transl_table 11 codon_start 1 locus_tag LOCUS_14890 CDS complement(1670406..1671479) product thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002897599.1 transl_table 11 codon_start 1 locus_tag LOCUS_14900 CDS complement(1671513..1672859) product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263116.1 transl_table 11 codon_start 1 locus_tag LOCUS_14910 gene lpdA CDS complement(1673137..1674357) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813994.1 transl_table 11 codon_start 1 locus_tag LOCUS_14920 CDS complement(1674440..1675372) product DUF561 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722294.1 transl_table 11 codon_start 1 locus_tag LOCUS_14930 CDS 1675638..1676567 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002329656.1 transl_table 11 codon_start 1 locus_tag LOCUS_14940 CDS 1676735..1677946 product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986697.1 transl_table 11 codon_start 1 locus_tag LOCUS_14950 CDS 1677980..1678945 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14960 CDS complement(1679192..1680256) product butyrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454677.1 transl_table 11 codon_start 1 locus_tag LOCUS_14970 gene buk CDS complement(1680260..1681150) product bifunctional enoyl-CoA hydratase/phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436909.1 transl_table 11 codon_start 1 locus_tag LOCUS_14980 CDS complement(1681163..1682506) product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454646.1 transl_table 11 codon_start 1 locus_tag LOCUS_14990 CDS complement(1682530..1683276) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931125.1 transl_table 11 codon_start 1 locus_tag LOCUS_15000 CDS complement(1683506..1684384) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15010 CDS complement(1684593..1686896) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15020 CDS complement(1687311..1687844) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15030 CDS complement(1688001..1688453) product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121358.1 transl_table 11 codon_start 1 locus_tag LOCUS_15040 CDS complement(1688527..1688889) product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286913.1 transl_table 11 codon_start 1 locus_tag LOCUS_15050 gene rplS CDS complement(1689008..1689766) product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699993.1 transl_table 11 codon_start 1 locus_tag LOCUS_15060 gene trmD CDS complement(1689756..1690295) product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369214.1 transl_table 11 codon_start 1 locus_tag LOCUS_15070 gene rimM CDS complement(1690386..1690640) product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640382.1 transl_table 11 codon_start 1 locus_tag LOCUS_15080 CDS complement(1690656..1690928) product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290274.1 transl_table 11 codon_start 1 locus_tag LOCUS_15090 gene rpsP CDS complement(1691096..1691671) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15100 CDS complement(1691671..1692654) product flotillin-like protein FloA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000492108.1 transl_table 11 codon_start 1 locus_tag LOCUS_15110 gene floA CDS complement(1692716..1693318) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15120 CDS complement(1693601..1695358) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15130 CDS complement(1695351..1697066) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976341.1 transl_table 11 codon_start 1 locus_tag LOCUS_15140 CDS complement(1697306..1698556) product aminoacyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383740.1 transl_table 11 codon_start 1 locus_tag LOCUS_15150 CDS complement(1698581..1700056) product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293709.1 transl_table 11 codon_start 1 locus_tag LOCUS_15160 gene ffh CDS complement(1700060..1700407) product putative DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699985.1 transl_table 11 codon_start 1 locus_tag LOCUS_15170 CDS complement(1700683..1701708) product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287900.1 transl_table 11 codon_start 1 locus_tag LOCUS_15180 gene ftsY CDS complement(1701723..1702535) product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287898.1 transl_table 11 codon_start 1 locus_tag LOCUS_15190 CDS complement(1703128..1706688) product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287897.1 transl_table 11 codon_start 1 locus_tag LOCUS_15200 gene smc CDS complement(1706703..1707401) product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354946.1 transl_table 11 codon_start 1 locus_tag LOCUS_15210 gene rnc CDS complement(1707420..1707665) product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564726.1 transl_table 11 codon_start 1 locus_tag LOCUS_15220 gene acpP CDS complement(1707705..1708724) product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011921644.1 transl_table 11 codon_start 1 locus_tag LOCUS_15230 gene plsX CDS complement(1708748..1710787) product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002370092.1 transl_table 11 codon_start 1 locus_tag LOCUS_15240 gene recG CDS complement(1710815..1711828) product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000594045.1 transl_table 11 codon_start 1 locus_tag LOCUS_15250 CDS complement(1711884..1713551) product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354936.1 transl_table 11 codon_start 1 locus_tag LOCUS_15260 CDS complement(1713573..1713935) product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003638623.1 transl_table 11 codon_start 1 locus_tag LOCUS_15270 CDS complement(1714141..1714329) product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290463.1 transl_table 11 codon_start 1 locus_tag LOCUS_15280 gene rpmB CDS complement(1714430..1715101) product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287382.1 transl_table 11 codon_start 1 locus_tag LOCUS_15290 CDS complement(1715117..1715764) product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027876.1 transl_table 11 codon_start 1 locus_tag LOCUS_15300 gene rpe CDS complement(1715761..1716693) product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232060.1 transl_table 11 codon_start 1 locus_tag LOCUS_15310 gene rsgA CDS complement(1716686..1718737) product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674550.1 transl_table 11 codon_start 1 locus_tag LOCUS_15320 gene pknB CDS complement(1718734..1719477) product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564704.1 transl_table 11 codon_start 1 locus_tag LOCUS_15330 CDS complement(1719489..1720883) product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002378969.1 transl_table 11 codon_start 1 locus_tag LOCUS_15340 gene rsmB CDS complement(1720858..1721814) product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287372.1 transl_table 11 codon_start 1 locus_tag LOCUS_15350 gene fmt CDS complement(1721858..1724290) product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002378970.1 transl_table 11 codon_start 1 locus_tag LOCUS_15360 gene priA CDS complement(1724415..1724639) product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640362.1 transl_table 11 codon_start 1 locus_tag LOCUS_15370 gene rpoZ CDS complement(1724642..1725244) product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287358.1 transl_table 11 codon_start 1 locus_tag LOCUS_15380 gene gmk CDS 1725616..1725996 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15390 CDS complement(1726249..1727709) product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722636.1 transl_table 11 codon_start 1 locus_tag LOCUS_15400 gene cls CDS complement(1727850..1728455) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15410 CDS complement(1728475..1730295) product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287130.1 transl_table 11 codon_start 1 locus_tag LOCUS_15420 CDS complement(1730392..1731435) product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244674.1 transl_table 11 codon_start 1 locus_tag LOCUS_15430 gene asd CDS complement(1731683..1733071) product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808874.1 transl_table 11 codon_start 1 locus_tag LOCUS_15440 gene ltrA CDS complement(1733544..1735664) product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002297086.1 transl_table 11 codon_start 1 locus_tag LOCUS_15450 gene pnp CDS complement(1735839..1736108) product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701713.1 transl_table 11 codon_start 1 locus_tag LOCUS_15460 gene rpsO CDS 1736333..1737220 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15470 CDS complement(1737341..1739335) product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000607031.1 transl_table 11 codon_start 1 locus_tag LOCUS_15480 gene uvrB CDS 1739516..1739770 product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002292188.1 transl_table 11 codon_start 1 locus_tag LOCUS_15490 gene rpsT CDS complement(1739848..1740867) product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002320835.1 transl_table 11 codon_start 1 locus_tag LOCUS_15500 gene holA CDS complement(1740929..1743253) product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990137.1 transl_table 11 codon_start 1 locus_tag LOCUS_15510 CDS complement(1743255..1744001) product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000387350.1 transl_table 11 codon_start 1 locus_tag LOCUS_15520 CDS complement(1744095..1744655) product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475855.1 transl_table 11 codon_start 1 locus_tag LOCUS_15530 gene rsmD CDS complement(1744861..1746135) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15540 CDS complement(1746603..1747991) product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808874.1 transl_table 11 codon_start 1 locus_tag LOCUS_15550 gene ltrA CDS complement(1748525..1749973) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15560 CDS complement(1750429..1750737) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15570 CDS complement(1750774..1754208) product pyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706553.1 transl_table 11 codon_start 1 locus_tag LOCUS_15580 CDS complement(1754285..1755565) product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645668.1 transl_table 11 codon_start 1 locus_tag LOCUS_15590 CDS complement(1755726..1757564) product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061563670.1 transl_table 11 codon_start 1 locus_tag LOCUS_15600 gene typA CDS complement(1757766..1758560) product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356680.1 transl_table 11 codon_start 1 locus_tag LOCUS_15610 CDS complement(1758644..1758916) product UPF0223 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131743.1 transl_table 11 codon_start 1 locus_tag LOCUS_15620 CDS 1759458..1759637 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15630 CDS 1759722..1760453 product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860778.1 transl_table 11 codon_start 1 locus_tag LOCUS_15640 CDS complement(1760553..1761200) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288036.1 transl_table 11 codon_start 1 locus_tag LOCUS_15650 CDS complement(1761215..1761856) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288038.1 transl_table 11 codon_start 1 locus_tag LOCUS_15660 CDS complement(1761858..1762700) product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288041.1 transl_table 11 codon_start 1 locus_tag LOCUS_15670 CDS complement(1762715..1763449) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288042.1 transl_table 11 codon_start 1 locus_tag LOCUS_15680 CDS complement(1763726..1764151) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15690 CDS complement(1764298..1765707) product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382270.1 transl_table 11 codon_start 1 locus_tag LOCUS_15700 gene lpdA CDS complement(1765723..1767348) product dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002363856.1 transl_table 11 codon_start 1 locus_tag LOCUS_15710 CDS complement(1767401..1768387) product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931056.1 transl_table 11 codon_start 1 locus_tag LOCUS_15720 CDS complement(1768390..1769493) product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289692.1 transl_table 11 codon_start 1 locus_tag LOCUS_15730 gene pdhA CDS 1769935..1770513 product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546838.1 transl_table 11 codon_start 1 locus_tag LOCUS_15740 gene def CDS complement(1770588..1771826) product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003660695.1 transl_table 11 codon_start 1 locus_tag LOCUS_15750 gene coaBC CDS complement(1771836..1773311) product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012774945.1 transl_table 11 codon_start 1 locus_tag LOCUS_15760 gene thrC CDS 1773601..1774230 product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082103.1 transl_table 11 codon_start 1 locus_tag LOCUS_15770 CDS complement(1774290..1775279) product putative sulfate exporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476545.1 transl_table 11 codon_start 1 locus_tag LOCUS_15780 CDS complement(1775418..1777307) product aryl-sulfate sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813245.1 transl_table 11 codon_start 1 locus_tag LOCUS_15790 CDS complement(1777310..1777618) product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222500.1 transl_table 11 codon_start 1 locus_tag LOCUS_15800 gene trxA CDS complement(1777734..1778387) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15810 CDS complement(1778475..1779731) product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986227.1 transl_table 11 codon_start 1 locus_tag LOCUS_15820 CDS complement(1780056..1780622) product energy-coupled thiamine transporter ThiT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263320.1 transl_table 11 codon_start 1 locus_tag LOCUS_15830 gene thiT CDS complement(1780771..1781304) product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295862.1 transl_table 11 codon_start 1 locus_tag LOCUS_15840 gene pyrR CDS 1781460..1782287 product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001076712.1 transl_table 11 codon_start 1 locus_tag LOCUS_15850 CDS 1782392..1782715 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15860 CDS 1782849..1784159 product hydroxymethylglutaryl-CoA reductase, degradative inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074567.1 transl_table 11 codon_start 1 locus_tag LOCUS_15870 CDS complement(1784416..1785579) product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732325.1 transl_table 11 codon_start 1 locus_tag LOCUS_15880 CDS complement(1786035..1786964) product oligopeptide ABC transporter ATP-binding protein Opp1F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355795.1 transl_table 11 codon_start 1 locus_tag LOCUS_15890 gene opp1F CDS complement(1786957..1788078) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476524.1 transl_table 11 codon_start 1 locus_tag LOCUS_15900 CDS complement(1788090..1789127) product oligopeptide ABC transporter permease Opp1C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355787.1 transl_table 11 codon_start 1 locus_tag LOCUS_15910 gene opp1C CDS complement(1789130..1790074) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293573.1 transl_table 11 codon_start 1 locus_tag LOCUS_15920 CDS complement(1790746..1792374) product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289796.1 transl_table 11 codon_start 1 locus_tag LOCUS_15930 CDS complement(1792585..1794213) product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289796.1 transl_table 11 codon_start 1 locus_tag LOCUS_15940 CDS complement(1794466..1796097) product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289796.1 transl_table 11 codon_start 1 locus_tag LOCUS_15950 CDS complement(1796381..1797751) product dipeptidase PepV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459801.1 transl_table 11 codon_start 1 locus_tag LOCUS_15960 gene pepV CDS 1797961..1799073 product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426912.1 transl_table 11 codon_start 1 locus_tag LOCUS_15970 CDS complement(1799274..1799621) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15980 CDS 1799829..1801040 product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355656.1 transl_table 11 codon_start 1 locus_tag LOCUS_15990 gene metK CDS complement(1801125..1801601) product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009933317.1 transl_table 11 codon_start 1 locus_tag LOCUS_16000 CDS 1801697..1802854 product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475712.1 transl_table 11 codon_start 1 locus_tag LOCUS_16010 gene alr CDS 1802949..1803836 product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422063.1 transl_table 11 codon_start 1 locus_tag LOCUS_16020 gene dapA CDS 1803966..1804796 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16030 CDS complement(1804944..1805990) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16040 CDS complement(1806096..1806644) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16050 CDS 1806877..1808061 product haloacid dehalogenase-like hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679711.1 transl_table 11 codon_start 1 locus_tag LOCUS_16060 CDS complement(1808051..1808992) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16070 CDS 1809114..1809920 product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002389550.1 transl_table 11 codon_start 1 locus_tag LOCUS_16080 gene proB CDS 1809950..1811206 product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287452.1 transl_table 11 codon_start 1 locus_tag LOCUS_16090 CDS complement(1811631..1812098) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16100 CDS complement(1812100..1812261) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16110 CDS complement(1812291..1813046) product CpsD/CapB family tyrosine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002338483.1 transl_table 11 codon_start 1 locus_tag LOCUS_16120 CDS complement(1813065..1813793) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16130 CDS complement(1813875..1814624) product tyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003570845.1 transl_table 11 codon_start 1 locus_tag LOCUS_16140 CDS complement(1814640..1815101) product 8-oxo-dGTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436879.1 transl_table 11 codon_start 1 locus_tag LOCUS_16150 CDS complement(1815276..1816160) product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922353.1 transl_table 11 codon_start 1 locus_tag LOCUS_16160 CDS complement(1816194..1817075) product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922353.1 transl_table 11 codon_start 1 locus_tag LOCUS_16170 CDS complement(1817260..1818228) product GMP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000688122.1 transl_table 11 codon_start 1 locus_tag LOCUS_16180 gene guaC CDS complement(1818398..1818901) product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295492.1 transl_table 11 codon_start 1 locus_tag LOCUS_16190 gene coaD CDS complement(1818945..1820402) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16200 CDS complement(1820422..1821237) product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003705135.1 transl_table 11 codon_start 1 locus_tag LOCUS_16210 gene map CDS 1821504..1822211 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16220 CDS 1822353..1822802 product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356885.1 transl_table 11 codon_start 1 locus_tag LOCUS_16230 CDS 1822865..1823152 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16240 CDS 1823272..1824936 product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731898.1 transl_table 11 codon_start 1 locus_tag LOCUS_16250 CDS 1825088..1826440 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16260 CDS complement(1826548..1827633) product bifunctional glycosyltransferase family 2/GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016893.1 transl_table 11 codon_start 1 locus_tag LOCUS_16270 tRNA complement(1827695..1827769) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00600 CDS complement(1827806..1828765) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16280 CDS complement(1828773..1829588) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107948.1 transl_table 11 codon_start 1 locus_tag LOCUS_16290 CDS complement(1829603..1830559) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16300 CDS complement(1830676..1832178) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16310 CDS complement(1832513..1833577) product N-acetylneuraminate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986974.1 transl_table 11 codon_start 1 locus_tag LOCUS_16320 CDS complement(1833588..1835222) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986975.1 transl_table 11 codon_start 1 locus_tag LOCUS_16330 CDS complement(1835322..1837079) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16340 CDS complement(1837177..1838505) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16350 CDS complement(1838630..1840144) product O-antigen ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034537005.1 transl_table 11 codon_start 1 locus_tag LOCUS_16360 CDS complement(1840149..1841249) product polysialyltransferase family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002302730.1 transl_table 11 codon_start 1 locus_tag LOCUS_16370 CDS complement(1841254..1842750) product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002292875.1 transl_table 11 codon_start 1 locus_tag LOCUS_16380 CDS complement(1842891..1843703) product pur operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642030.1 transl_table 11 codon_start 1 locus_tag LOCUS_16390 gene purR CDS complement(1843877..1844566) product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989362.1 transl_table 11 codon_start 1 locus_tag LOCUS_16400 CDS complement(1844620..1845330) product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356064.1 transl_table 11 codon_start 1 locus_tag LOCUS_16410 CDS complement(1845344..1846354) product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287342.1 transl_table 11 codon_start 1 locus_tag LOCUS_16420 CDS complement(1846495..1847367) product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002321008.1 transl_table 11 codon_start 1 locus_tag LOCUS_16430 gene ispE CDS complement(1847527..1847760) product Veg family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287434.1 transl_table 11 codon_start 1 locus_tag LOCUS_16440 CDS complement(1847946..1848647) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16450 CDS complement(1848647..1849384) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16460 CDS complement(1849389..1850150) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16470 CDS complement(1850317..1851201) product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294004.1 transl_table 11 codon_start 1 locus_tag LOCUS_16480 gene rsmA CDS complement(1851194..1851793) product ribonuclease M5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002305490.1 transl_table 11 codon_start 1 locus_tag LOCUS_16490 gene rnmV CDS complement(1851778..1852572) product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294001.1 transl_table 11 codon_start 1 locus_tag LOCUS_16500 CDS complement(1852698..1854698) product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289325.1 transl_table 11 codon_start 1 locus_tag LOCUS_16510 gene metG CDS complement(1854807..1856069) product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001021122.1 transl_table 11 codon_start 1 locus_tag LOCUS_16520 gene tyrS CDS complement(1856400..1859042) product magnesium-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296188.1 transl_table 11 codon_start 1 locus_tag LOCUS_16530 gene mgtA CDS complement(1859555..1860181) product cyclodeaminase/cyclohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583068.1 transl_table 11 codon_start 1 locus_tag LOCUS_16540 CDS 1860496..1861833 product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356929.1 transl_table 11 codon_start 1 locus_tag LOCUS_16550 gene glnA CDS complement(1861919..1862626) product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287139.1 transl_table 11 codon_start 1 locus_tag LOCUS_16560 CDS complement(1862698..1863663) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002989577.1 transl_table 11 codon_start 1 locus_tag LOCUS_16570 CDS 1863926..1864534 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16580 CDS 1864527..1865840 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16590 CDS complement(1865887..1867056) product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808537.1 transl_table 11 codon_start 1 locus_tag LOCUS_16600 CDS complement(1867053..1867547) product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814642.1 transl_table 11 codon_start 1 locus_tag LOCUS_16610 CDS 1867762..1868739 product DUF1002 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548693.1 transl_table 11 codon_start 1 locus_tag LOCUS_16620 CDS complement(1868830..1869309) product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837730.1 transl_table 11 codon_start 1 locus_tag LOCUS_16630 gene rlmH CDS complement(1869683..1870966) product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290101.1 transl_table 11 codon_start 1 locus_tag LOCUS_16640 CDS complement(1871055..1871885) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475475.1 transl_table 11 codon_start 1 locus_tag LOCUS_16650 CDS complement(1871905..1873563) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16660 CDS complement(1873579..1874478) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16670 CDS complement(1874493..1875968) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16680 CDS complement(1875968..1877839) product cell wall metabolism sensor histidine kinase WalK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641656.1 transl_table 11 codon_start 1 locus_tag LOCUS_16690 gene walK CDS complement(1877846..1878553) product response regulator YycF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003658889.1 transl_table 11 codon_start 1 locus_tag LOCUS_16700 gene yycF CDS complement(1878939..1880408) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16710 CDS 1880896..1882443 product ClC family H(+)/Cl(-) exchange transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025189815.1 transl_table 11 codon_start 1 locus_tag LOCUS_16720 CDS complement(1882832..1883029) product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804217.1 transl_table 11 codon_start 1 locus_tag LOCUS_16730 CDS 1883217..1884200 product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948775.1 transl_table 11 codon_start 1 locus_tag LOCUS_16740 CDS 1884304..1884858 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16750 CDS complement(1884909..1885931) product lipoate--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288102.1 transl_table 11 codon_start 1 locus_tag LOCUS_16760 CDS 1886113..1887555 product RsmF rRNA methyltransferase first C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287145.1 transl_table 11 codon_start 1 locus_tag LOCUS_16770 CDS 1887629..1888465 product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700602.1 transl_table 11 codon_start 1 locus_tag LOCUS_16780 CDS 1888537..1889319 product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459298.1 transl_table 11 codon_start 1 locus_tag LOCUS_16790 CDS 1889316..1889813 product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829634.1 transl_table 11 codon_start 1 locus_tag LOCUS_16800 CDS 1889832..1890851 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16810 CDS complement(1890962..1891915) product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112414.1 transl_table 11 codon_start 1 locus_tag LOCUS_16820 CDS complement(1892102..1893520) product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681245.1 transl_table 11 codon_start 1 locus_tag LOCUS_16830 CDS 1893720..1894496 product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723335.1 transl_table 11 codon_start 1 locus_tag LOCUS_16840 CDS complement(1894565..1895332) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16850 CDS complement(1895325..1896323) product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349245.1 transl_table 11 codon_start 1 locus_tag LOCUS_16860 gene hemC CDS complement(1896320..1896778) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009659744.1 transl_table 11 codon_start 1 locus_tag LOCUS_16870 CDS complement(1896791..1897378) product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724741.1 transl_table 11 codon_start 1 locus_tag LOCUS_16880 CDS complement(1897381..1898886) product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836536.1 transl_table 11 codon_start 1 locus_tag LOCUS_16890 CDS complement(1898891..1899598) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16900 note possible pseudo, frameshifted CDS complement(1899588..1900373) product sirohydrochlorin cobaltochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002898260.1 transl_table 11 codon_start 1 locus_tag LOCUS_16910 CDS complement(1900385..1901395) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16920 CDS complement(1901388..1902215) product precorrin-6A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002896460.1 transl_table 11 codon_start 1 locus_tag LOCUS_16930 gene cobK CDS complement(1902258..1902998) product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002896461.1 transl_table 11 codon_start 1 locus_tag LOCUS_16940 gene cobJ CDS complement(1903005..1904177) product cobalt-precorrin 5A hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002901140.1 transl_table 11 codon_start 1 locus_tag LOCUS_16950 gene cbiG CDS complement(1904161..1904913) product cobalt-precorrin-4 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002896463.1 transl_table 11 codon_start 1 locus_tag LOCUS_16960 CDS complement(1904947..1905501) product decarboxylating cobalt-precorrin-6B (C(15))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836530.1 transl_table 11 codon_start 1 locus_tag LOCUS_16970 CDS complement(1905491..1906117) product cobalt-precorrin-7 (C(5))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437741.1 transl_table 11 codon_start 1 locus_tag LOCUS_16980 CDS complement(1906114..1907241) product cobalt-precorrin-5B (C(1))-methyltransferase CbiD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836528.1 transl_table 11 codon_start 1 locus_tag LOCUS_16990 gene cbiD CDS complement(1907287..1907940) product cobalt-precorrin-8 methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721591.1 transl_table 11 codon_start 1 locus_tag LOCUS_17000 CDS complement(1907943..1909331) product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002917659.1 transl_table 11 codon_start 1 locus_tag LOCUS_17010 CDS complement(1909328..1909798) product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001062752.1 transl_table 11 codon_start 1 locus_tag LOCUS_17020 CDS complement(1910052..1911692) product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289796.1 transl_table 11 codon_start 1 locus_tag LOCUS_17030 CDS complement(1911708..1912226) product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009934281.1 transl_table 11 codon_start 1 locus_tag LOCUS_17040 CDS complement(1912301..1913251) product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002898268.1 transl_table 11 codon_start 1 locus_tag LOCUS_17050 gene cbiB CDS complement(1913278..1914330) product threonine-phosphate decarboxylase CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002896402.1 transl_table 11 codon_start 1 locus_tag LOCUS_17060 gene cobD CDS complement(1914348..1914998) product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836545.1 transl_table 11 codon_start 1 locus_tag LOCUS_17070 CDS complement(1914998..1915759) product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836544.1 transl_table 11 codon_start 1 locus_tag LOCUS_17080 gene cobS CDS complement(1915756..1916352) product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836543.1 transl_table 11 codon_start 1 locus_tag LOCUS_17090 gene cobU CDS complement(1916354..1917130) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948522.1 transl_table 11 codon_start 1 locus_tag LOCUS_17100 CDS 1917517..1919796 product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905853.1 transl_table 11 codon_start 1 locus_tag LOCUS_17110 gene metE CDS 1919774..1920628 product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563579.1 transl_table 11 codon_start 1 locus_tag LOCUS_17120 gene metF CDS complement(1920687..1921613) product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037992.1 transl_table 11 codon_start 1 locus_tag LOCUS_17130 gene arcC CDS complement(1921734..1922825) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048179.1 transl_table 11 codon_start 1 locus_tag LOCUS_17140 CDS complement(1922815..1923996) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986817.1 transl_table 11 codon_start 1 locus_tag LOCUS_17150 CDS complement(1924043..1926592) product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869824.1 transl_table 11 codon_start 1 locus_tag LOCUS_17160 gene clpB CDS complement(1926809..1928179) product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948762.1 transl_table 11 codon_start 1 locus_tag LOCUS_17170 CDS complement(1928561..1929553) product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682235.1 transl_table 11 codon_start 1 locus_tag LOCUS_17180 gene argF CDS 1929818..1931059 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17190 CDS complement(1931131..1932087) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920615.1 transl_table 11 codon_start 1 locus_tag LOCUS_17200 CDS complement(1932175..1932855) product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100884.1 transl_table 11 codon_start 1 locus_tag LOCUS_17210 gene larB CDS complement(1932907..1933701) product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641716.1 transl_table 11 codon_start 1 locus_tag LOCUS_17220 gene larE CDS complement(1933715..1934158) product DUF111 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641714.1 transl_table 11 codon_start 1 locus_tag LOCUS_17230 CDS complement(1934182..1934922) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17240 note possible pseudo, frameshifted CDS 1935104..1936342 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17250 CDS complement(1936387..1937586) product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948371.1 transl_table 11 codon_start 1 locus_tag LOCUS_17260 CDS 1937782..1938747 product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922180.1 transl_table 11 codon_start 1 locus_tag LOCUS_17270 CDS complement(1938836..1939135) product DUF2316 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102157.1 transl_table 11 codon_start 1 locus_tag LOCUS_17280 CDS 1939248..1939940 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101108.1 transl_table 11 codon_start 1 locus_tag LOCUS_17290 CDS 1939937..1940833 product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836490.1 transl_table 11 codon_start 1 locus_tag LOCUS_17300 CDS complement(1940913..1941692) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262302.1 transl_table 11 codon_start 1 locus_tag LOCUS_17310 CDS complement(1941696..1942616) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836495.1 transl_table 11 codon_start 1 locus_tag LOCUS_17320 CDS complement(1942889..1943902) product lipoate--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356394.1 transl_table 11 codon_start 1 locus_tag LOCUS_17330 CDS complement(1944124..1948290) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17340 CDS complement(1948308..1949249) product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002913975.1 transl_table 11 codon_start 1 locus_tag LOCUS_17350 CDS 1949469..1951304 product beta-glucuronidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000966715.1 transl_table 11 codon_start 1 locus_tag LOCUS_17360 gene uidA CDS 1951551..1953053 product DUF1846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002302627.1 transl_table 11 codon_start 1 locus_tag LOCUS_17370 CDS complement(1953089..1953763) product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002938014.1 transl_table 11 codon_start 1 locus_tag LOCUS_17380 CDS complement(1953804..1955180) product potassium transporter TrkG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002918889.1 transl_table 11 codon_start 1 locus_tag LOCUS_17390 CDS complement(1955198..1955503) product DUF4298 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837143.1 transl_table 11 codon_start 1 locus_tag LOCUS_17400 CDS complement(1955705..1956508) product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870525.1 transl_table 11 codon_start 1 locus_tag LOCUS_17410 gene pstB CDS complement(1956510..1957331) product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049767.1 transl_table 11 codon_start 1 locus_tag LOCUS_17420 gene pstA CDS complement(1957331..1958203) product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000595180.1 transl_table 11 codon_start 1 locus_tag LOCUS_17430 gene pstC CDS complement(1958311..1959198) product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000716331.1 transl_table 11 codon_start 1 locus_tag LOCUS_17440 CDS complement(1959512..1961356) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722633.1 transl_table 11 codon_start 1 locus_tag LOCUS_17450 CDS complement(1961353..1962096) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293705.1 transl_table 11 codon_start 1 locus_tag LOCUS_17460 CDS complement(1962181..1963173) product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096948712.1 transl_table 11 codon_start 1 locus_tag LOCUS_17470 gene prfB CDS complement(1963800..1966172) product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289770.1 transl_table 11 codon_start 1 locus_tag LOCUS_17480 gene secA CDS complement(1966446..1967015) product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289771.1 transl_table 11 codon_start 1 locus_tag LOCUS_17490 gene raiA CDS complement(1967134..1967511) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17500 CDS complement(1967804..1969150) product DNA/RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101146.1 transl_table 11 codon_start 1 locus_tag LOCUS_17510 CDS 1969308..1969955 product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000926669.1 transl_table 11 codon_start 1 locus_tag LOCUS_17520 CDS complement(1970083..1970709) product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354907.1 transl_table 11 codon_start 1 locus_tag LOCUS_17530 CDS 1971171..1971800 product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000909526.1 transl_table 11 codon_start 1 locus_tag LOCUS_17540 CDS 1971817..1972569 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17550 misc_feature complement(1972721..>1974256) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000950158.1:glycogen/starch/alpha-glucan family phosphorylase locus_tag LOCUS_17560