>Feature sequence1 365 30 gene locus_tag LOCUS_00010 365 30 CDS product DUF3039 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030402030.1 protein_id gnl|my_center|LOCUS_00010 1989 403 gene locus_tag LOCUS_00020 1989 403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 2276 1971 gene locus_tag LOCUS_00030 2276 1971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00030 2804 2298 gene locus_tag LOCUS_00040 2804 2298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00040 3791 2820 gene locus_tag LOCUS_00050 3791 2820 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775931.1 protein_id gnl|my_center|LOCUS_00050 4021 5370 gene locus_tag LOCUS_00060 4021 5370 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225393.1 protein_id gnl|my_center|LOCUS_00060 5718 5386 gene locus_tag LOCUS_00070 5718 5386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229480.1 protein_id gnl|my_center|LOCUS_00070 5773 6468 gene locus_tag LOCUS_00080 gene nucS 5773 6468 CDS product endonuclease NucS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775934.1 protein_id gnl|my_center|LOCUS_00080 6930 6646 gene locus_tag LOCUS_00090 6930 6646 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004116284.1 protein_id gnl|my_center|LOCUS_00090 8396 6933 gene locus_tag LOCUS_00100 gene atpD 8396 6933 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814333.1 protein_id gnl|my_center|LOCUS_00100 9368 8442 gene locus_tag LOCUS_00110 9368 8442 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973625.1 protein_id gnl|my_center|LOCUS_00110 11064 9430 gene locus_tag LOCUS_00120 gene atpA 11064 9430 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775940.1 protein_id gnl|my_center|LOCUS_00120 12020 11202 gene locus_tag LOCUS_00130 12020 11202 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327277.1 protein_id gnl|my_center|LOCUS_00130 12571 12020 gene locus_tag LOCUS_00140 12571 12020 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229526.1 protein_id gnl|my_center|LOCUS_00140 12826 12623 gene locus_tag LOCUS_00150 12826 12623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 13748 12960 gene locus_tag LOCUS_00160 gene atpB 13748 12960 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229528.1 protein_id gnl|my_center|LOCUS_00160 14133 13834 gene locus_tag LOCUS_00170 14133 13834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 14606 14130 gene locus_tag LOCUS_00180 14606 14130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 15628 14603 gene locus_tag LOCUS_00190 15628 14603 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391404.1 protein_id gnl|my_center|LOCUS_00190 17553 15634 gene locus_tag LOCUS_00200 17553 15634 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066564050.1 protein_id gnl|my_center|LOCUS_00200 19415 17550 gene locus_tag LOCUS_00210 19415 17550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 19723 20787 gene locus_tag LOCUS_00220 19723 20787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 21853 20795 gene locus_tag LOCUS_00230 21853 20795 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775947.1 protein_id gnl|my_center|LOCUS_00230 22932 21850 gene locus_tag LOCUS_00240 gene prmC 22932 21850 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775948.1 protein_id gnl|my_center|LOCUS_00240 24016 22937 gene locus_tag LOCUS_00250 gene prfA 24016 22937 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973637.1 protein_id gnl|my_center|LOCUS_00250 26267 24201 gene locus_tag LOCUS_00260 gene rho 26267 24201 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030205.1 protein_id gnl|my_center|LOCUS_00260 27728 26667 gene locus_tag LOCUS_00270 gene thrB 27728 26667 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030204.1 protein_id gnl|my_center|LOCUS_00270 29035 27737 gene locus_tag LOCUS_00280 29035 27737 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189283905.1 protein_id gnl|my_center|LOCUS_00280 30670 29102 gene locus_tag LOCUS_00290 gene lysA 30670 29102 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030202.1 protein_id gnl|my_center|LOCUS_00290 32328 30670 gene locus_tag LOCUS_00300 gene argS 32328 30670 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014179.1 protein_id gnl|my_center|LOCUS_00300 32406 32479 gene locus_tag LOCUS_t00010 32406 32479 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 33083 32610 gene locus_tag LOCUS_00310 33083 32610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803992.1 protein_id gnl|my_center|LOCUS_00310 33199 37407 gene locus_tag LOCUS_00320 33199 37407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 37923 37519 gene locus_tag LOCUS_00330 37923 37519 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403876.1 protein_id gnl|my_center|LOCUS_00330 38615 37962 gene locus_tag LOCUS_00340 38615 37962 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972584.1 protein_id gnl|my_center|LOCUS_00340 38856 39311 gene locus_tag LOCUS_00350 38856 39311 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007449657.1 protein_id gnl|my_center|LOCUS_00350 40318 39344 gene locus_tag LOCUS_00360 40318 39344 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230418.1 protein_id gnl|my_center|LOCUS_00360 41187 40318 gene locus_tag LOCUS_00370 41187 40318 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230419.1 protein_id gnl|my_center|LOCUS_00370 42217 41270 gene locus_tag LOCUS_00380 42217 41270 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005114975.1 protein_id gnl|my_center|LOCUS_00380 43397 42324 gene locus_tag LOCUS_00390 43397 42324 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_183373870.1 protein_id gnl|my_center|LOCUS_00390 44797 43394 gene locus_tag LOCUS_00400 44797 43394 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226803.1 protein_id gnl|my_center|LOCUS_00400 46425 44947 gene locus_tag LOCUS_00410 46425 44947 CDS product GuaB1 family IMP dehydrogenase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164279790.1 protein_id gnl|my_center|LOCUS_00410 46730 50542 gene locus_tag LOCUS_00420 46730 50542 CDS product multifunctional oxoglutarate decarboxylase/oxoglutarate dehydrogenase thiamine pyrophosphate-binding subunit/dihydrolipoyllysine-residue succinyltransferase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030150.1 protein_id gnl|my_center|LOCUS_00420 50727 51326 gene locus_tag LOCUS_00430 50727 51326 CDS product GDSL-type esterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775967.1 protein_id gnl|my_center|LOCUS_00430 51404 51562 gene locus_tag LOCUS_00440 51404 51562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 52014 51739 gene locus_tag LOCUS_00450 gene rsrA 52014 51739 CDS product mycothiol system anti-sigma-R factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056340.1 protein_id gnl|my_center|LOCUS_00450 52723 52037 gene locus_tag LOCUS_00460 gene sigR 52723 52037 CDS product RNA polymerase sigma factor SigR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973756.1 protein_id gnl|my_center|LOCUS_00460 53065 53565 gene locus_tag LOCUS_00470 53065 53565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 53695 55101 gene locus_tag LOCUS_00480 gene aroA 53695 55101 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973760.1 protein_id gnl|my_center|LOCUS_00480 55098 56285 gene locus_tag LOCUS_00490 gene rsgA 55098 56285 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775972.1 protein_id gnl|my_center|LOCUS_00490 56296 57105 gene locus_tag LOCUS_00500 gene hisN 56296 57105 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973764.1 protein_id gnl|my_center|LOCUS_00500 58084 57284 gene locus_tag LOCUS_00510 58084 57284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 58574 58203 gene locus_tag LOCUS_tm00010 58574 58203 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 59179 58679 gene locus_tag LOCUS_00520 gene smpB 59179 58679 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975846.1 protein_id gnl|my_center|LOCUS_00520 60307 59189 gene locus_tag LOCUS_00530 gene prfB 60307 59189 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776050.1 protein_id gnl|my_center|LOCUS_00530 61053 60532 gene locus_tag LOCUS_00540 61053 60532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 61484 61050 gene locus_tag LOCUS_00550 61484 61050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 61938 61468 gene locus_tag LOCUS_00560 61938 61468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 62159 61941 gene locus_tag LOCUS_00570 62159 61941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 63165 62215 gene locus_tag LOCUS_00580 63165 62215 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776056.1 protein_id gnl|my_center|LOCUS_00580 64019 63162 gene locus_tag LOCUS_00590 64019 63162 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776057.1 protein_id gnl|my_center|LOCUS_00590 65311 64016 gene locus_tag LOCUS_00600 65311 64016 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776058.1 protein_id gnl|my_center|LOCUS_00600 66297 65509 gene locus_tag LOCUS_00610 66297 65509 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776098.1 protein_id gnl|my_center|LOCUS_00610 67179 66304 gene locus_tag LOCUS_00620 67179 66304 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112141.1 protein_id gnl|my_center|LOCUS_00620 69221 67176 gene locus_tag LOCUS_00630 69221 67176 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776100.1 protein_id gnl|my_center|LOCUS_00630 70405 69218 gene locus_tag LOCUS_00640 gene glf 70405 69218 CDS product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776101.1 protein_id gnl|my_center|LOCUS_00640 70734 74684 gene locus_tag LOCUS_00650 70734 74684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 75074 74622 gene locus_tag LOCUS_00660 75074 74622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 75355 75603 gene locus_tag LOCUS_00670 75355 75603 CDS product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973730.1 protein_id gnl|my_center|LOCUS_00670 77273 75699 gene locus_tag LOCUS_00680 77273 75699 CDS product histidine kinase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776067.1 protein_id gnl|my_center|LOCUS_00680 78689 77343 gene locus_tag LOCUS_00690 78689 77343 CDS product P-loop NTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776070.1 protein_id gnl|my_center|LOCUS_00690 79387 78734 gene locus_tag LOCUS_00700 79387 78734 CDS product flagellar protein FlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776071.1 protein_id gnl|my_center|LOCUS_00700 79667 79888 gene locus_tag LOCUS_00710 79667 79888 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776072.1 protein_id gnl|my_center|LOCUS_00710 80501 79932 gene locus_tag LOCUS_00720 80501 79932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 80642 81688 gene locus_tag LOCUS_00730 80642 81688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 81811 82365 gene locus_tag LOCUS_00740 81811 82365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 85183 82385 gene locus_tag LOCUS_00750 gene secA 85183 82385 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776076.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_00750 86138 85443 gene locus_tag LOCUS_00760 gene raiA 86138 85443 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776077.1 protein_id gnl|my_center|LOCUS_00760 87150 86326 gene locus_tag LOCUS_00770 87150 86326 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028713.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_00770 88946 87240 gene locus_tag LOCUS_00780 88946 87240 CDS product LpqB family beta-propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776079.1 protein_id gnl|my_center|LOCUS_00780 90676 88943 gene locus_tag LOCUS_00790 gene mtrB 90676 88943 CDS product MtrAB system histidine kinase MtrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776080.1 protein_id gnl|my_center|LOCUS_00790 91379 90690 gene locus_tag LOCUS_00800 gene mtrA 91379 90690 CDS product two-component system response regulator MtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975799.1 protein_id gnl|my_center|LOCUS_00800 92646 91576 gene locus_tag LOCUS_00810 92646 91576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 93031 92639 gene locus_tag LOCUS_00820 93031 92639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 94229 93042 gene locus_tag LOCUS_00830 gene mnmA 94229 93042 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973510.1 protein_id gnl|my_center|LOCUS_00830 95526 94321 gene locus_tag LOCUS_00840 95526 94321 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030274.1 protein_id gnl|my_center|LOCUS_00840 95711 96175 gene locus_tag LOCUS_00850 95711 96175 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080688.1 protein_id gnl|my_center|LOCUS_00850 97965 96307 gene locus_tag LOCUS_00860 97965 96307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 98186 100258 gene locus_tag LOCUS_00870 98186 100258 CDS product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729869.1 protein_id gnl|my_center|LOCUS_00870 100392 101108 gene locus_tag LOCUS_00880 100392 101108 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057529.1 protein_id gnl|my_center|LOCUS_00880 101197 102135 gene locus_tag LOCUS_00890 101197 102135 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228484.1 protein_id gnl|my_center|LOCUS_00890 102132 103019 gene locus_tag LOCUS_00900 102132 103019 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228483.1 protein_id gnl|my_center|LOCUS_00900 103016 103927 gene locus_tag LOCUS_00910 103016 103927 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228482.1 protein_id gnl|my_center|LOCUS_00910 104189 104115 gene locus_tag LOCUS_t00020 104189 104115 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 107438 104352 gene locus_tag LOCUS_00920 107438 104352 CDS product UPF0182 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068258.1 protein_id gnl|my_center|LOCUS_00920 108811 107669 gene locus_tag LOCUS_00930 108811 107669 CDS product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804763.1 protein_id gnl|my_center|LOCUS_00930 109092 110513 gene locus_tag LOCUS_00940 109092 110513 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973777.1 protein_id gnl|my_center|LOCUS_00940 111091 110420 gene locus_tag LOCUS_00950 111091 110420 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030867997.1 protein_id gnl|my_center|LOCUS_00950 111266 112027 gene locus_tag LOCUS_00960 111266 112027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 113953 112145 gene locus_tag LOCUS_00970 113953 112145 CDS product ATP-dependent DNA helicase UvrD2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173668762.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00970 115071 113950 gene locus_tag LOCUS_00980 115071 113950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 115143 116090 gene locus_tag LOCUS_00990 115143 116090 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804756.1 protein_id gnl|my_center|LOCUS_00990 119846 116205 gene locus_tag LOCUS_01000 119846 116205 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804755.1 protein_id gnl|my_center|LOCUS_01000 123313 119843 gene locus_tag LOCUS_01010 123313 119843 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223038.1 protein_id gnl|my_center|LOCUS_01010 123455 124177 gene locus_tag LOCUS_01020 123455 124177 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030642.1 protein_id gnl|my_center|LOCUS_01020 125627 124287 gene locus_tag LOCUS_01030 gene hemL 125627 124287 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222429.1 protein_id gnl|my_center|LOCUS_01030 126741 125701 gene locus_tag LOCUS_01040 gene hemB 126741 125701 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013646.1 protein_id gnl|my_center|LOCUS_01040 127695 126874 gene locus_tag LOCUS_01050 127695 126874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 130176 128845 gene locus_tag LOCUS_01060 130176 128845 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776654.1 protein_id gnl|my_center|LOCUS_01060 130946 130173 gene locus_tag LOCUS_01070 130946 130173 CDS product chlorite dismutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224514.1 protein_id gnl|my_center|LOCUS_01070 132494 131043 gene locus_tag LOCUS_01080 gene hemG 132494 131043 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776652.1 protein_id gnl|my_center|LOCUS_01080 133653 132481 gene locus_tag LOCUS_01090 gene hemE 133653 132481 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224512.1 protein_id gnl|my_center|LOCUS_01090 133805 135112 gene locus_tag LOCUS_01100 133805 135112 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776650.1 protein_id gnl|my_center|LOCUS_01100 135284 135517 gene locus_tag LOCUS_01110 135284 135517 CDS product DUF3107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223016.1 protein_id gnl|my_center|LOCUS_01110 135695 137335 gene locus_tag LOCUS_01120 135695 137335 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804750.1 protein_id gnl|my_center|LOCUS_01120 137347 138225 gene locus_tag LOCUS_01130 137347 138225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 139087 138233 gene locus_tag LOCUS_01140 139087 138233 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804749.1 protein_id gnl|my_center|LOCUS_01140 139150 140712 gene locus_tag LOCUS_01150 139150 140712 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930178.1 protein_id gnl|my_center|LOCUS_01150 141685 140789 gene locus_tag LOCUS_01160 141685 140789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 141802 143094 gene locus_tag LOCUS_01170 141802 143094 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030088.1 protein_id gnl|my_center|LOCUS_01170 143123 143770 gene locus_tag LOCUS_01180 143123 143770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 143767 144924 gene locus_tag LOCUS_01190 143767 144924 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406273.1 protein_id gnl|my_center|LOCUS_01190 145349 144990 gene locus_tag LOCUS_01200 145349 144990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 145613 145446 gene locus_tag LOCUS_01210 145613 145446 CDS product DUF3117 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010551467.1 protein_id gnl|my_center|LOCUS_01210 147091 145733 gene locus_tag LOCUS_01220 147091 145733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 147243 147088 gene locus_tag LOCUS_01230 147243 147088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 147357 148139 gene locus_tag LOCUS_01240 147357 148139 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973246.1 protein_id gnl|my_center|LOCUS_01240 148174 149010 gene locus_tag LOCUS_01250 148174 149010 CDS product glutamate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776276.1 protein_id gnl|my_center|LOCUS_01250 149024 149698 gene locus_tag LOCUS_01260 149024 149698 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776275.1 protein_id gnl|my_center|LOCUS_01260 149665 150555 gene locus_tag LOCUS_01270 149665 150555 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776274.1 protein_id gnl|my_center|LOCUS_01270 151740 150625 gene locus_tag LOCUS_01280 gene dapE 151740 150625 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030079.1 protein_id gnl|my_center|LOCUS_01280 151820 152791 gene locus_tag LOCUS_01290 gene dapD 151820 152791 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930176.1 protein_id gnl|my_center|LOCUS_01290 152837 153856 gene locus_tag LOCUS_01300 gene galE 152837 153856 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244356.1 protein_id gnl|my_center|LOCUS_01300 155287 154007 gene locus_tag LOCUS_01310 155287 154007 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230153.1 protein_id gnl|my_center|LOCUS_01310 156704 155577 gene locus_tag LOCUS_01320 156704 155577 CDS product bifunctional succinyldiaminopimelate transaminase/glutamate-prephenate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030077.1 protein_id gnl|my_center|LOCUS_01320 157036 156713 gene locus_tag LOCUS_01330 157036 156713 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973842.1 protein_id gnl|my_center|LOCUS_01330 158597 157245 gene locus_tag LOCUS_01340 158597 157245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 160535 158619 gene locus_tag LOCUS_01350 gene typA 160535 158619 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804730.1 protein_id gnl|my_center|LOCUS_01350 160788 161843 gene locus_tag LOCUS_01360 160788 161843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 163784 161877 gene locus_tag LOCUS_01370 163784 161877 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113016.1 protein_id gnl|my_center|LOCUS_01370 163803 164483 gene locus_tag LOCUS_01380 163803 164483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 165636 164506 gene locus_tag LOCUS_01390 165636 164506 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229761.1 protein_id gnl|my_center|LOCUS_01390 167186 165633 gene locus_tag LOCUS_01400 167186 165633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 169083 167350 gene locus_tag LOCUS_01410 169083 167350 CDS product ABC transporter family substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034283994.1 protein_id gnl|my_center|LOCUS_01410 171201 169375 gene locus_tag LOCUS_01420 171201 169375 CDS product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804291.1 protein_id gnl|my_center|LOCUS_01420 171504 173180 gene locus_tag LOCUS_01430 gene pgi 171504 173180 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804725.1 protein_id gnl|my_center|LOCUS_01430 173300 173914 gene locus_tag LOCUS_01440 173300 173914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 174708 174019 gene locus_tag LOCUS_01450 gene pcp 174708 174019 CDS product pyroglutamyl-peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209662.1 protein_id gnl|my_center|LOCUS_01450 176732 174723 gene locus_tag LOCUS_01460 176732 174723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 177161 176736 gene locus_tag LOCUS_01470 177161 176736 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_078330934.1 protein_id gnl|my_center|LOCUS_01470 177493 177209 gene locus_tag LOCUS_01480 177493 177209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 177945 177595 gene locus_tag LOCUS_01490 177945 177595 CDS product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944052.1 protein_id gnl|my_center|LOCUS_01490 178117 180369 gene locus_tag LOCUS_01500 178117 180369 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013800.1 protein_id gnl|my_center|LOCUS_01500 180465 180734 gene locus_tag LOCUS_01510 180465 180734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 182217 180778 gene locus_tag LOCUS_01520 182217 180778 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223495682.1 protein_id gnl|my_center|LOCUS_01520 183287 182355 gene locus_tag LOCUS_01530 183287 182355 CDS product PRC and DUF2382 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027446.1 protein_id gnl|my_center|LOCUS_01530 184998 183517 gene locus_tag LOCUS_01540 184998 183517 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001083410.1 protein_id gnl|my_center|LOCUS_01540 185602 185144 gene locus_tag LOCUS_01550 185602 185144 CDS product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804009.1 protein_id gnl|my_center|LOCUS_01550 186495 185599 gene locus_tag LOCUS_01560 186495 185599 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804010.1 protein_id gnl|my_center|LOCUS_01560 187068 186691 gene locus_tag LOCUS_01570 187068 186691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 187290 187778 gene locus_tag LOCUS_01580 187290 187778 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804098.1 protein_id gnl|my_center|LOCUS_01580 188253 187801 gene locus_tag LOCUS_01590 188253 187801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 189111 188299 gene locus_tag LOCUS_01600 189111 188299 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390517.1 protein_id gnl|my_center|LOCUS_01600 189149 189652 gene locus_tag LOCUS_01610 189149 189652 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776234.1 protein_id gnl|my_center|LOCUS_01610 191080 189686 gene locus_tag LOCUS_01620 191080 189686 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104427.1 protein_id gnl|my_center|LOCUS_01620 192491 191091 gene locus_tag LOCUS_01630 192491 191091 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975127.1 protein_id gnl|my_center|LOCUS_01630 193830 192523 gene locus_tag LOCUS_01640 193830 192523 CDS product peptide synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014153.1 protein_id gnl|my_center|LOCUS_01640 193923 194756 gene locus_tag LOCUS_01650 193923 194756 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014152.1 protein_id gnl|my_center|LOCUS_01650 194821 195471 gene locus_tag LOCUS_01660 194821 195471 CDS product mismatch-specific DNA-glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929986.1 protein_id gnl|my_center|LOCUS_01660 196407 195514 gene locus_tag LOCUS_01670 196407 195514 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015607.1 protein_id gnl|my_center|LOCUS_01670 197585 196521 gene locus_tag LOCUS_01680 197585 196521 CDS product arsenic resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014387.1 protein_id gnl|my_center|LOCUS_01680 197584 198282 gene locus_tag LOCUS_01690 197584 198282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 198279 198809 gene locus_tag LOCUS_01700 198279 198809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 198822 198992 gene locus_tag LOCUS_01710 198822 198992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 199819 199133 gene locus_tag LOCUS_01720 199819 199133 CDS product alpha-ketoglutarate-dependent dioxygenase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196240169.1 protein_id gnl|my_center|LOCUS_01720 200736 199816 gene locus_tag LOCUS_01730 200736 199816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 202185 201178 gene locus_tag LOCUS_01740 202185 201178 CDS product aldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088575.1 protein_id gnl|my_center|LOCUS_01740 203173 202217 gene locus_tag LOCUS_01750 203173 202217 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804143.1 protein_id gnl|my_center|LOCUS_01750 203678 203250 gene locus_tag LOCUS_01760 203678 203250 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766948.1 protein_id gnl|my_center|LOCUS_01760 203914 203675 gene locus_tag LOCUS_01770 203914 203675 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026614401.1 protein_id gnl|my_center|LOCUS_01770 204293 204051 gene locus_tag LOCUS_01780 204293 204051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 204696 204448 gene locus_tag LOCUS_01790 204696 204448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 205760 204849 gene locus_tag LOCUS_01800 205760 204849 CDS product Abi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083539905.1 protein_id gnl|my_center|LOCUS_01800 206984 205899 gene locus_tag LOCUS_01810 gene ychF 206984 205899 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730394.1 protein_id gnl|my_center|LOCUS_01810 208133 207072 gene locus_tag LOCUS_01820 208133 207072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 208767 208243 gene locus_tag LOCUS_01830 208767 208243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 208877 209815 gene locus_tag LOCUS_01840 208877 209815 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049878179.1 protein_id gnl|my_center|LOCUS_01840 209819 210583 gene locus_tag LOCUS_01850 209819 210583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 210580 211821 gene locus_tag LOCUS_01860 210580 211821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 211818 212426 gene locus_tag LOCUS_01870 211818 212426 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228375.1 protein_id gnl|my_center|LOCUS_01870 212605 213804 gene locus_tag LOCUS_01880 212605 213804 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390292.1 protein_id gnl|my_center|LOCUS_01880 214776 213844 gene locus_tag LOCUS_01890 214776 213844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 214925 216433 gene locus_tag LOCUS_01900 gene xseA 214925 216433 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776296.1 protein_id gnl|my_center|LOCUS_01900 216430 216681 gene locus_tag LOCUS_01910 216430 216681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 217925 216702 gene locus_tag LOCUS_01920 217925 216702 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892107.1 protein_id gnl|my_center|LOCUS_01920 219003 217969 gene locus_tag LOCUS_01930 219003 217969 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049743594.1 protein_id gnl|my_center|LOCUS_01930 219452 219021 gene locus_tag LOCUS_01940 219452 219021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 219721 219440 gene locus_tag LOCUS_01950 219721 219440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 219654 220778 gene locus_tag LOCUS_01960 219654 220778 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978023.1 protein_id gnl|my_center|LOCUS_01960 221652 220672 gene locus_tag LOCUS_01970 221652 220672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 221742 221815 gene locus_tag LOCUS_t00030 221742 221815 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 222361 221903 gene locus_tag LOCUS_01980 222361 221903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 224293 222743 gene locus_tag LOCUS_01990 224293 222743 CDS product CYTH and CHAD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110443.1 protein_id gnl|my_center|LOCUS_01990 225317 224319 gene locus_tag LOCUS_02000 225317 224319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 226311 225424 gene locus_tag LOCUS_02010 gene galU 226311 225424 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975635.1 protein_id gnl|my_center|LOCUS_02010 226471 227127 gene locus_tag LOCUS_02020 226471 227127 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804924.1 protein_id gnl|my_center|LOCUS_02020 227188 227400 gene locus_tag LOCUS_02030 227188 227400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02030 227516 228247 gene locus_tag LOCUS_02040 227516 228247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 228594 228367 gene locus_tag LOCUS_02050 228594 228367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 232705 228587 gene locus_tag LOCUS_02060 232705 228587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 232896 232702 gene locus_tag LOCUS_02070 232896 232702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 234488 232893 gene locus_tag LOCUS_02080 gene guaA 234488 232893 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804508.1 protein_id gnl|my_center|LOCUS_02080 235235 234660 gene locus_tag LOCUS_02090 235235 234660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 236190 235240 gene locus_tag LOCUS_02100 236190 235240 CDS product SURF1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929892.1 protein_id gnl|my_center|LOCUS_02100 236311 238290 gene locus_tag LOCUS_02110 236311 238290 CDS product potassium transporter Kup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820366.1 protein_id gnl|my_center|LOCUS_02110 239532 238402 gene locus_tag LOCUS_02120 239532 238402 CDS product GuaB3 family IMP dehydrogenase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813354.1 protein_id gnl|my_center|LOCUS_02120 241135 239618 gene locus_tag LOCUS_02130 gene guaB 241135 239618 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052449.1 protein_id gnl|my_center|LOCUS_02130 243438 241309 gene locus_tag LOCUS_02140 243438 241309 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776647.1 protein_id gnl|my_center|LOCUS_02140 245322 243733 gene locus_tag LOCUS_02150 gene groL 245322 243733 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974210.1 protein_id gnl|my_center|LOCUS_02150 245681 245385 gene locus_tag LOCUS_02160 gene groES 245681 245385 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004559922.1 protein_id gnl|my_center|LOCUS_02160 245845 247188 gene locus_tag LOCUS_02170 245845 247188 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804479.1 protein_id gnl|my_center|LOCUS_02170 247268 248413 gene locus_tag LOCUS_02180 247268 248413 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224327.1 protein_id gnl|my_center|LOCUS_02180 249559 248465 gene locus_tag LOCUS_02190 gene tsaD 249559 248465 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029841.1 protein_id gnl|my_center|LOCUS_02190 250155 249556 gene locus_tag LOCUS_02200 250155 249556 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776312.1 protein_id gnl|my_center|LOCUS_02200 250589 250152 gene locus_tag LOCUS_02210 250589 250152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02210 250903 250574 gene locus_tag LOCUS_02220 250903 250574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02220 251544 250948 gene locus_tag LOCUS_02230 251544 250948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 252863 251541 gene locus_tag LOCUS_02240 gene alr 252863 251541 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727747.1 protein_id gnl|my_center|LOCUS_02240 253000 254397 gene locus_tag LOCUS_02250 gene mshA 253000 254397 CDS product D-inositol-3-phosphate glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742053.1 protein_id gnl|my_center|LOCUS_02250 254547 255344 gene locus_tag LOCUS_02260 254547 255344 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976029.1 protein_id gnl|my_center|LOCUS_02260 255581 257017 gene locus_tag LOCUS_02270 255581 257017 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803920.1 protein_id gnl|my_center|LOCUS_02270 258651 257011 gene locus_tag LOCUS_02280 258651 257011 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080591.1 protein_id gnl|my_center|LOCUS_02280 259046 258642 gene locus_tag LOCUS_02290 259046 258642 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974229.1 protein_id gnl|my_center|LOCUS_02290 261029 259176 gene locus_tag LOCUS_02300 gene glmS 261029 259176 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015000.1 protein_id gnl|my_center|LOCUS_02300 261132 262088 gene locus_tag LOCUS_02310 gene coaA 261132 262088 CDS product type I pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776319.1 protein_id gnl|my_center|LOCUS_02310 262088 262867 gene locus_tag LOCUS_02320 262088 262867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 262980 263396 gene locus_tag LOCUS_02330 gene mscL 262980 263396 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815058.1 protein_id gnl|my_center|LOCUS_02330 264912 263581 gene locus_tag LOCUS_02340 gene glmM 264912 263581 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776320.1 protein_id gnl|my_center|LOCUS_02340 266062 264992 gene locus_tag LOCUS_02350 gene ppk2 266062 264992 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082944.1 protein_id gnl|my_center|LOCUS_02350 266669 266169 gene locus_tag LOCUS_02360 gene rpsI 266669 266169 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974238.1 protein_id gnl|my_center|LOCUS_02360 267148 266705 gene locus_tag LOCUS_02370 gene rplM 267148 266705 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776324.1 protein_id gnl|my_center|LOCUS_02370 268453 267440 gene locus_tag LOCUS_02380 gene truA 268453 267440 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776325.1 protein_id gnl|my_center|LOCUS_02380 269365 268661 gene locus_tag LOCUS_02390 269365 268661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 270482 269478 gene locus_tag LOCUS_02400 270482 269478 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776351.1 protein_id gnl|my_center|LOCUS_02400 271067 270663 gene locus_tag LOCUS_02410 gene rpsK 271067 270663 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948617.1 protein_id gnl|my_center|LOCUS_02410 271464 271096 gene locus_tag LOCUS_02420 gene rpsM 271464 271096 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808138.1 protein_id gnl|my_center|LOCUS_02420 272046 271825 gene locus_tag LOCUS_02430 gene infA 272046 271825 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004558881.1 protein_id gnl|my_center|LOCUS_02430 273495 272320 gene locus_tag LOCUS_02440 gene rlmN 273495 272320 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973380.1 protein_id gnl|my_center|LOCUS_02440 274376 273549 gene locus_tag LOCUS_02450 gene map 274376 273549 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776355.1 protein_id gnl|my_center|LOCUS_02450 274945 274376 gene locus_tag LOCUS_02460 274945 274376 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776356.1 protein_id gnl|my_center|LOCUS_02460 276252 274942 gene locus_tag LOCUS_02470 gene secY 276252 274942 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974248.1 protein_id gnl|my_center|LOCUS_02470 276983 276510 gene locus_tag LOCUS_02480 gene rplO 276983 276510 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776358.1 protein_id gnl|my_center|LOCUS_02480 277195 276986 gene locus_tag LOCUS_02490 gene rpmD 277195 276986 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974250.1 protein_id gnl|my_center|LOCUS_02490 277905 277195 gene locus_tag LOCUS_02500 277905 277195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 278264 277902 gene locus_tag LOCUS_02510 gene rplR 278264 277902 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776361.1 protein_id gnl|my_center|LOCUS_02510 278804 278268 gene locus_tag LOCUS_02520 gene rplF 278804 278268 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005055712.1 protein_id gnl|my_center|LOCUS_02520 279231 278833 gene locus_tag LOCUS_02530 gene rpsH 279231 278833 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974254.1 protein_id gnl|my_center|LOCUS_02530 279859 279299 gene locus_tag LOCUS_02540 gene rplE 279859 279299 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974255.1 protein_id gnl|my_center|LOCUS_02540 280194 279859 gene locus_tag LOCUS_02550 gene rplX 280194 279859 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776365.1 protein_id gnl|my_center|LOCUS_02550 280569 280198 gene locus_tag LOCUS_02560 gene rplN 280569 280198 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974257.1 protein_id gnl|my_center|LOCUS_02560 283267 280961 gene locus_tag LOCUS_02570 283267 280961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 287539 283436 gene locus_tag LOCUS_02580 287539 283436 CDS product non-ribosomal peptide synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053385512.1 protein_id gnl|my_center|LOCUS_02580 287784 287554 gene locus_tag LOCUS_02590 287784 287554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 289548 287821 gene locus_tag LOCUS_02600 289548 287821 CDS product (2,3-dihydroxybenzoyl)adenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243083.1 protein_id gnl|my_center|LOCUS_02600 290858 289614 gene locus_tag LOCUS_02610 gene fes 290858 289614 CDS product enterochelin esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704705.1 protein_id gnl|my_center|LOCUS_02610 291667 290855 gene locus_tag LOCUS_02620 291667 290855 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027975.1 protein_id gnl|my_center|LOCUS_02620 292734 291664 gene locus_tag LOCUS_02630 292734 291664 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112992.1 protein_id gnl|my_center|LOCUS_02630 293750 292731 gene locus_tag LOCUS_02640 293750 292731 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027977.1 protein_id gnl|my_center|LOCUS_02640 294770 293751 gene locus_tag LOCUS_02650 294770 293751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 297115 294773 gene locus_tag LOCUS_02660 297115 294773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 298149 297112 gene locus_tag LOCUS_02670 298149 297112 CDS product amonabactin ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705834.1 protein_id gnl|my_center|LOCUS_02670 298616 298344 gene locus_tag LOCUS_02680 gene rpsQ 298616 298344 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974258.1 protein_id gnl|my_center|LOCUS_02680 298936 298613 gene locus_tag LOCUS_02690 298936 298613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 299355 298939 gene locus_tag LOCUS_02700 gene rplP 299355 298939 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974260.1 protein_id gnl|my_center|LOCUS_02700 300225 299356 gene locus_tag LOCUS_02710 300225 299356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 300591 300226 gene locus_tag LOCUS_02720 gene rplV 300591 300226 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776372.1 protein_id gnl|my_center|LOCUS_02720 300935 300654 gene locus_tag LOCUS_02730 gene rpsS 300935 300654 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974263.1 protein_id gnl|my_center|LOCUS_02730 301784 300948 gene locus_tag LOCUS_02740 gene rplB 301784 300948 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727672.1 protein_id gnl|my_center|LOCUS_02740 302121 301819 gene locus_tag LOCUS_02750 gene rplW 302121 301819 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776375.1 protein_id gnl|my_center|LOCUS_02750 302741 302118 gene locus_tag LOCUS_02760 302741 302118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02760 303402 302746 gene locus_tag LOCUS_02770 gene rplC 303402 302746 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776377.1 protein_id gnl|my_center|LOCUS_02770 303727 303419 gene locus_tag LOCUS_02780 gene rpsJ 303727 303419 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776378.1 protein_id gnl|my_center|LOCUS_02780 305488 304298 gene locus_tag LOCUS_02790 gene tuf 305488 304298 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776383.1 protein_id gnl|my_center|LOCUS_02790 307777 305663 gene locus_tag LOCUS_02800 gene fusA 307777 305663 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776384.1 protein_id gnl|my_center|LOCUS_02800 308323 307850 gene locus_tag LOCUS_02810 gene rpsG 308323 307850 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974303.1 protein_id gnl|my_center|LOCUS_02810 308697 308323 gene locus_tag LOCUS_02820 gene rpsL 308697 308323 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948652.1 protein_id gnl|my_center|LOCUS_02820 309881 309120 gene locus_tag LOCUS_02830 309881 309120 CDS product IclR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223757.1 protein_id gnl|my_center|LOCUS_02830 310927 309917 gene locus_tag LOCUS_02840 310927 309917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 311138 312118 gene locus_tag LOCUS_02850 311138 312118 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198727.1 protein_id gnl|my_center|LOCUS_02850 312115 313974 gene locus_tag LOCUS_02860 gene qsuB 312115 313974 CDS product dehydroshikimate dehydratase QsuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013639.1 protein_id gnl|my_center|LOCUS_02860 318009 314116 gene locus_tag LOCUS_02870 318009 314116 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776388.1 protein_id gnl|my_center|LOCUS_02870 321580 318065 gene locus_tag LOCUS_02880 gene rpoB 321580 318065 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029792.1 protein_id gnl|my_center|LOCUS_02880 323097 321919 gene locus_tag LOCUS_02890 323097 321919 CDS product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994895.1 protein_id gnl|my_center|LOCUS_02890 324146 323094 gene locus_tag LOCUS_02900 324146 323094 CDS product hydroxymethylglutaryl-CoA reductase (NADPH) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957686.1 protein_id gnl|my_center|LOCUS_02900 325300 324143 gene locus_tag LOCUS_02910 gene fni 325300 324143 CDS product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399734.1 protein_id gnl|my_center|LOCUS_02910 326454 325297 gene locus_tag LOCUS_02920 326454 325297 CDS product phosphomevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288233.1 protein_id gnl|my_center|LOCUS_02920 327446 326451 gene locus_tag LOCUS_02930 gene mvaD 327446 326451 CDS product diphosphomevalonate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011921869.1 protein_id gnl|my_center|LOCUS_02930 328522 327443 gene locus_tag LOCUS_02940 gene mvk 328522 327443 CDS product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012774950.1 protein_id gnl|my_center|LOCUS_02940 330131 328689 gene locus_tag LOCUS_02950 330131 328689 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877699.1 protein_id gnl|my_center|LOCUS_02950 331305 330136 gene locus_tag LOCUS_02960 gene gcvT 331305 330136 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973526.1 protein_id gnl|my_center|LOCUS_02960 334239 331312 gene locus_tag LOCUS_02970 gene gcvP 334239 331312 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027754.1 protein_id gnl|my_center|LOCUS_02970 334573 335568 gene locus_tag LOCUS_02980 334573 335568 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002363973.1 protein_id gnl|my_center|LOCUS_02980 337633 335621 gene locus_tag LOCUS_02990 337633 335621 CDS product sucrose-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015272.1 protein_id gnl|my_center|LOCUS_02990 339198 337759 gene locus_tag LOCUS_03000 gene scrB 339198 337759 CDS product sucrose-6-phosphate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015273.1 protein_id gnl|my_center|LOCUS_03000 339100 339399 gene locus_tag LOCUS_03010 339100 339399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 339903 339514 gene locus_tag LOCUS_03020 gene rplL 339903 339514 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776391.1 protein_id gnl|my_center|LOCUS_03020 340578 340039 gene locus_tag LOCUS_03030 gene rplJ 340578 340039 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974311.1 protein_id gnl|my_center|LOCUS_03030 341660 340965 gene locus_tag LOCUS_03040 gene rplA 341660 340965 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776393.1 protein_id gnl|my_center|LOCUS_03040 342246 341818 gene locus_tag LOCUS_03050 gene rplK 342246 341818 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892734.1 protein_id gnl|my_center|LOCUS_03050 343436 342486 gene locus_tag LOCUS_03060 gene nusG 343436 342486 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029791.1 protein_id gnl|my_center|LOCUS_03060 343799 343533 gene locus_tag LOCUS_03070 343799 343533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 343961 343888 gene locus_tag LOCUS_t00040 343961 343888 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 344203 345411 gene locus_tag LOCUS_03080 344203 345411 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029790.1 protein_id gnl|my_center|LOCUS_03080 345605 346639 gene locus_tag LOCUS_03090 345605 346639 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804723.1 protein_id gnl|my_center|LOCUS_03090 347953 346769 gene locus_tag LOCUS_03100 347953 346769 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930019.1 protein_id gnl|my_center|LOCUS_03100 348570 347950 gene locus_tag LOCUS_03110 348570 347950 CDS product FABP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974791.1 protein_id gnl|my_center|LOCUS_03110 348812 348693 gene locus_tag LOCUS_03120 348812 348693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 349495 348806 gene locus_tag LOCUS_03130 349495 348806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 349705 350391 gene locus_tag LOCUS_03140 gene glnR 349705 350391 CDS product two-component system response regulator GlnR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029474.1 protein_id gnl|my_center|LOCUS_03140 351259 350396 gene locus_tag LOCUS_03150 351259 350396 CDS product VanW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001028237.1 protein_id gnl|my_center|LOCUS_03150 352793 351321 gene locus_tag LOCUS_03160 352793 351321 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893816.1 protein_id gnl|my_center|LOCUS_03160 353012 356338 gene locus_tag LOCUS_03170 353012 356338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 356435 357373 gene locus_tag LOCUS_03180 356435 357373 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776549.1 protein_id gnl|my_center|LOCUS_03180 357366 358196 gene locus_tag LOCUS_03190 357366 358196 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004574972.1 protein_id gnl|my_center|LOCUS_03190 358193 358774 gene locus_tag LOCUS_03200 358193 358774 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776902.1 protein_id gnl|my_center|LOCUS_03200 358967 360058 gene locus_tag LOCUS_03210 gene asd 358967 360058 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812646.1 protein_id gnl|my_center|LOCUS_03210 360188 360601 gene locus_tag LOCUS_03220 360188 360601 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009993516.1 protein_id gnl|my_center|LOCUS_03220 361253 360723 gene locus_tag LOCUS_03230 361253 360723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 361399 362385 gene locus_tag LOCUS_03240 gene dhaK 361399 362385 CDS product dihydroxyacetone kinase subunit DhaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728174.1 protein_id gnl|my_center|LOCUS_03240 362521 363132 gene locus_tag LOCUS_03250 gene dhaL 362521 363132 CDS product dihydroxyacetone kinase subunit DhaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257203.1 protein_id gnl|my_center|LOCUS_03250 363129 363533 gene locus_tag LOCUS_03260 363129 363533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 364704 363613 gene locus_tag LOCUS_03270 364704 363613 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222386.1 protein_id gnl|my_center|LOCUS_03270 366061 364814 gene locus_tag LOCUS_03280 366061 364814 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777113.1 protein_id gnl|my_center|LOCUS_03280 366704 366243 gene locus_tag LOCUS_03290 366704 366243 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029785.1 protein_id gnl|my_center|LOCUS_03290 367168 366701 gene locus_tag LOCUS_03300 367168 366701 CDS product MaoC family dehydratase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776156.1 protein_id gnl|my_center|LOCUS_03300 367376 367301 gene locus_tag LOCUS_t00050 367376 367301 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 367503 367431 gene locus_tag LOCUS_t00060 367503 367431 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 369630 367609 gene locus_tag LOCUS_03310 369630 367609 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896448.1 protein_id gnl|my_center|LOCUS_03310 371584 370019 gene locus_tag LOCUS_03320 371584 370019 CDS product DUF2079 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929884.1 protein_id gnl|my_center|LOCUS_03320 371739 372800 gene locus_tag LOCUS_03330 371739 372800 CDS product 3-methyladenine DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028728.1 protein_id gnl|my_center|LOCUS_03330 373314 372895 gene locus_tag LOCUS_03340 gene trxA 373314 372895 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027416.1 protein_id gnl|my_center|LOCUS_03340 373604 373521 gene locus_tag LOCUS_t00070 373604 373521 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 374090 373791 gene locus_tag LOCUS_03350 374090 373791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 374245 374736 gene locus_tag LOCUS_03360 374245 374736 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974333.1 protein_id gnl|my_center|LOCUS_03360 375706 374825 gene locus_tag LOCUS_03370 gene htpX 375706 374825 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974338.1 protein_id gnl|my_center|LOCUS_03370 377873 375864 gene locus_tag LOCUS_03380 377873 375864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 378380 378877 gene locus_tag LOCUS_03390 378380 378877 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899076.1 protein_id gnl|my_center|LOCUS_03390 378971 380455 gene locus_tag LOCUS_03400 378971 380455 CDS product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776487.1 protein_id gnl|my_center|LOCUS_03400 382081 380615 gene locus_tag LOCUS_03410 382081 380615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 382200 383684 gene locus_tag LOCUS_03420 382200 383684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 384904 383792 gene locus_tag LOCUS_03430 384904 383792 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776173.1 protein_id gnl|my_center|LOCUS_03430 386326 384995 gene locus_tag LOCUS_03440 386326 384995 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974386.1 protein_id gnl|my_center|LOCUS_03440 387032 386331 gene locus_tag LOCUS_03450 387032 386331 CDS product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974389.1 protein_id gnl|my_center|LOCUS_03450 387100 387747 gene locus_tag LOCUS_03460 387100 387747 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029478.1 protein_id gnl|my_center|LOCUS_03460 387848 390439 gene locus_tag LOCUS_03470 387848 390439 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_179552221.1 protein_id gnl|my_center|LOCUS_03470 392553 390586 gene locus_tag LOCUS_03480 gene menD 392553 390586 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930001.1 protein_id gnl|my_center|LOCUS_03480 395536 393347 gene locus_tag LOCUS_03490 395536 393347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 396759 395725 gene locus_tag LOCUS_03500 396759 395725 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013669.1 protein_id gnl|my_center|LOCUS_03500 396935 397861 gene locus_tag LOCUS_03510 396935 397861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 398794 397889 gene locus_tag LOCUS_03520 398794 397889 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228583.1 protein_id gnl|my_center|LOCUS_03520 399374 399009 gene locus_tag LOCUS_03530 399374 399009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 400009 400230 gene locus_tag LOCUS_03540 400009 400230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_03540 402086 403393 gene locus_tag LOCUS_03550 402086 403393 CDS product ISL3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068319765.1 protein_id gnl|my_center|LOCUS_03550 403695 403384 gene locus_tag LOCUS_03560 403695 403384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 403909 404895 gene locus_tag LOCUS_03570 gene gluQRS 403909 404895 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803860.1 protein_id gnl|my_center|LOCUS_03570 404882 405820 gene locus_tag LOCUS_03580 404882 405820 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726968.1 protein_id gnl|my_center|LOCUS_03580 405971 407485 gene locus_tag LOCUS_03590 gene putP 405971 407485 CDS product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776955.1 protein_id gnl|my_center|LOCUS_03590 407585 408550 gene locus_tag LOCUS_03600 407585 408550 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094646.1 protein_id gnl|my_center|LOCUS_03600 408956 410551 gene locus_tag LOCUS_03610 408956 410551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 410598 411476 gene locus_tag LOCUS_03620 410598 411476 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776415.1 protein_id gnl|my_center|LOCUS_03620 411473 412819 gene locus_tag LOCUS_03630 411473 412819 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461355.1 protein_id gnl|my_center|LOCUS_03630 413310 413005 gene locus_tag LOCUS_03640 413310 413005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 413467 414717 gene locus_tag LOCUS_03650 413467 414717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 414781 415137 gene locus_tag LOCUS_03660 414781 415137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 416426 415248 gene locus_tag LOCUS_03670 gene ccsB 416426 415248 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776418.1 protein_id gnl|my_center|LOCUS_03670 418197 416470 gene locus_tag LOCUS_03680 418197 416470 CDS product cytochrome c biogenesis protein ResB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776419.1 protein_id gnl|my_center|LOCUS_03680 418946 418194 gene locus_tag LOCUS_03690 418946 418194 CDS product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974477.1 protein_id gnl|my_center|LOCUS_03690 419597 418956 gene locus_tag LOCUS_03700 419597 418956 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776421.1 protein_id gnl|my_center|LOCUS_03700 420356 419679 gene locus_tag LOCUS_03710 420356 419679 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776422.1 protein_id gnl|my_center|LOCUS_03710 420764 420453 gene locus_tag LOCUS_03720 420764 420453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 421034 420897 gene locus_tag LOCUS_03730 421034 420897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 421983 421036 gene locus_tag LOCUS_03740 421983 421036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 422946 422044 gene locus_tag LOCUS_03750 422946 422044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 424226 423003 gene locus_tag LOCUS_03760 424226 423003 CDS product acetoin utilization protein AcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326515.1 protein_id gnl|my_center|LOCUS_03760 424503 425918 gene locus_tag LOCUS_03770 424503 425918 CDS product potassium transporter TrkG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776429.1 protein_id gnl|my_center|LOCUS_03770 425911 426579 gene locus_tag LOCUS_03780 425911 426579 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776430.1 protein_id gnl|my_center|LOCUS_03780 427032 426676 gene locus_tag LOCUS_03790 427032 426676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 427432 427157 gene locus_tag LOCUS_03800 427432 427157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 428271 427432 gene locus_tag LOCUS_03810 gene proC 428271 427432 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114890.1 protein_id gnl|my_center|LOCUS_03810 429362 428508 gene locus_tag LOCUS_03820 429362 428508 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775777.1 protein_id gnl|my_center|LOCUS_03820 430356 429376 gene locus_tag LOCUS_03830 430356 429376 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028926.1 protein_id gnl|my_center|LOCUS_03830 433216 430361 gene locus_tag LOCUS_03840 gene topA 433216 430361 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776591.1 protein_id gnl|my_center|LOCUS_03840 435068 433332 gene locus_tag LOCUS_03850 435068 433332 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776589.1 protein_id gnl|my_center|LOCUS_03850 435157 436239 gene locus_tag LOCUS_03860 435157 436239 CDS product glutathione S-transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878423.1 protein_id gnl|my_center|LOCUS_03860 436883 436353 gene locus_tag LOCUS_03870 436883 436353 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026192141.1 protein_id gnl|my_center|LOCUS_03870 437423 436995 gene locus_tag LOCUS_03880 437423 436995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 437557 440172 gene locus_tag LOCUS_03890 437557 440172 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776588.1 protein_id gnl|my_center|LOCUS_03890 439182 439260 gene locus_tag LOCUS_t00080 439182 439260 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 440462 440115 gene locus_tag LOCUS_03900 440462 440115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 441040 440612 gene locus_tag LOCUS_03910 441040 440612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 441415 441044 gene locus_tag LOCUS_03920 441415 441044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 441682 441482 gene locus_tag LOCUS_03930 441682 441482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03930 442865 442104 gene locus_tag LOCUS_03940 442865 442104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 444013 442862 gene locus_tag LOCUS_03950 444013 442862 CDS product TadA family conjugal transfer-associated ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731088.1 protein_id gnl|my_center|LOCUS_03950 445302 444013 gene locus_tag LOCUS_03960 445302 444013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 445438 447291 gene locus_tag LOCUS_03970 445438 447291 CDS product bifunctional 3'-5' exonuclease/DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930206.1 protein_id gnl|my_center|LOCUS_03970 448150 447356 gene locus_tag LOCUS_03980 448150 447356 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029090.1 protein_id gnl|my_center|LOCUS_03980 449045 448143 gene locus_tag LOCUS_03990 449045 448143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 448981 449367 gene locus_tag LOCUS_04000 448981 449367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 449725 451662 gene locus_tag LOCUS_04010 gene acs 449725 451662 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975373.1 protein_id gnl|my_center|LOCUS_04010 451712 452161 gene locus_tag LOCUS_04020 gene aroQ 451712 452161 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390186.1 protein_id gnl|my_center|LOCUS_04020 453336 452158 gene locus_tag LOCUS_04030 453336 452158 CDS product MarP family serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141863754.1 protein_id gnl|my_center|LOCUS_04030 453623 454300 gene locus_tag LOCUS_04040 453623 454300 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975365.1 protein_id gnl|my_center|LOCUS_04040 455391 454426 gene locus_tag LOCUS_04050 455391 454426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 455884 455393 gene locus_tag LOCUS_04060 455884 455393 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975361.1 protein_id gnl|my_center|LOCUS_04060 456086 455886 gene locus_tag LOCUS_04070 456086 455886 CDS product DUF4177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975360.1 protein_id gnl|my_center|LOCUS_04070 456267 458426 gene locus_tag LOCUS_04080 456267 458426 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930028.1 protein_id gnl|my_center|LOCUS_04080 458426 459568 gene locus_tag LOCUS_04090 458426 459568 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731114.1 protein_id gnl|my_center|LOCUS_04090 459547 461460 gene locus_tag LOCUS_04100 459547 461460 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803870.1 protein_id gnl|my_center|LOCUS_04100 461453 463405 gene locus_tag LOCUS_04110 461453 463405 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803869.1 protein_id gnl|my_center|LOCUS_04110 464249 464944 gene locus_tag LOCUS_04120 464249 464944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 465035 465111 gene locus_tag LOCUS_t00090 465035 465111 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 466687 465179 gene locus_tag LOCUS_04130 466687 465179 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803911.1 protein_id gnl|my_center|LOCUS_04130 466819 467883 gene locus_tag LOCUS_04140 466819 467883 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775875.1 protein_id gnl|my_center|LOCUS_04140 467888 469417 gene locus_tag LOCUS_04150 467888 469417 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027415.1 protein_id gnl|my_center|LOCUS_04150 469517 471205 gene locus_tag LOCUS_04160 469517 471205 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538164.1 protein_id gnl|my_center|LOCUS_04160 471270 472235 gene locus_tag LOCUS_04170 471270 472235 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104380.1 protein_id gnl|my_center|LOCUS_04170 472232 473149 gene locus_tag LOCUS_04180 472232 473149 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804198.1 protein_id gnl|my_center|LOCUS_04180 473152 474894 gene locus_tag LOCUS_04190 473152 474894 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804199.1 protein_id gnl|my_center|LOCUS_04190 474980 475621 gene locus_tag LOCUS_04200 gene udk 474980 475621 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986880.1 protein_id gnl|my_center|LOCUS_04200 476320 475634 gene locus_tag LOCUS_04210 476320 475634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 477244 476591 gene locus_tag LOCUS_04220 477244 476591 CDS product LUD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978042.1 protein_id gnl|my_center|LOCUS_04220 478975 477251 gene locus_tag LOCUS_04230 478975 477251 CDS product LutB/LldF family L-lactate oxidation iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727053.1 protein_id gnl|my_center|LOCUS_04230 479783 478983 gene locus_tag LOCUS_04240 479783 478983 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892015.1 protein_id gnl|my_center|LOCUS_04240 480285 480073 gene locus_tag LOCUS_04250 480285 480073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 480194 481858 gene locus_tag LOCUS_04260 480194 481858 CDS product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731564.1 protein_id gnl|my_center|LOCUS_04260 482114 482890 gene locus_tag LOCUS_04270 482114 482890 CDS product FCD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804816.1 protein_id gnl|my_center|LOCUS_04270 483973 483050 gene locus_tag LOCUS_04280 483973 483050 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974901.1 protein_id gnl|my_center|LOCUS_04280 485356 484064 gene locus_tag LOCUS_04290 gene purD 485356 484064 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029417.1 protein_id gnl|my_center|LOCUS_04290 485552 487066 gene locus_tag LOCUS_04300 gene purF 485552 487066 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124159.1 protein_id gnl|my_center|LOCUS_04300 487068 488150 gene locus_tag LOCUS_04310 487068 488150 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974786.1 protein_id gnl|my_center|LOCUS_04310 488150 488554 gene locus_tag LOCUS_04320 488150 488554 CDS product sterol carrier family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804521.1 protein_id gnl|my_center|LOCUS_04320 488555 488977 gene locus_tag LOCUS_04330 488555 488977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 489053 490213 gene locus_tag LOCUS_04340 gene purM 489053 490213 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804525.1 protein_id gnl|my_center|LOCUS_04340 490587 490381 gene locus_tag LOCUS_04350 490587 490381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 491665 490562 gene locus_tag LOCUS_04360 491665 490562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 491807 493057 gene locus_tag LOCUS_04370 gene lldD 491807 493057 CDS product quinone-dependent L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409382.1 protein_id gnl|my_center|LOCUS_04370 493141 494445 gene locus_tag LOCUS_04380 493141 494445 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731183.1 protein_id gnl|my_center|LOCUS_04380 497261 494655 gene locus_tag LOCUS_04390 gene clpB 497261 494655 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057489.1 protein_id gnl|my_center|LOCUS_04390 498027 497482 gene locus_tag LOCUS_04400 498027 497482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 498127 498819 gene locus_tag LOCUS_04410 498127 498819 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977169.1 protein_id gnl|my_center|LOCUS_04410 498978 499484 gene locus_tag LOCUS_04420 498978 499484 CDS product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804007.1 protein_id gnl|my_center|LOCUS_04420 499696 500157 gene locus_tag LOCUS_04430 499696 500157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777020.1 protein_id gnl|my_center|LOCUS_04430 500272 501828 gene locus_tag LOCUS_04440 500272 501828 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000956710.1 protein_id gnl|my_center|LOCUS_04440 501881 502636 gene locus_tag LOCUS_04450 gene trmB 501881 502636 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804561.1 protein_id gnl|my_center|LOCUS_04450 504458 502995 gene locus_tag LOCUS_04460 504458 502995 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000451023.1 protein_id gnl|my_center|LOCUS_04460 505025 504600 gene locus_tag LOCUS_04470 505025 504600 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804833.1 protein_id gnl|my_center|LOCUS_04470 506045 505029 gene locus_tag LOCUS_04480 506045 505029 CDS product DnaJ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804832.1 protein_id gnl|my_center|LOCUS_04480 506864 506268 gene locus_tag LOCUS_04490 506864 506268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 508723 506870 gene locus_tag LOCUS_04500 gene dnaK 508723 506870 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814044.1 protein_id gnl|my_center|LOCUS_04500 508955 509467 gene locus_tag LOCUS_04510 508955 509467 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804863.1 protein_id gnl|my_center|LOCUS_04510 509474 510067 gene locus_tag LOCUS_04520 509474 510067 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898102.1 protein_id gnl|my_center|LOCUS_04520 510172 511389 gene locus_tag LOCUS_04530 510172 511389 CDS product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929944.1 protein_id gnl|my_center|LOCUS_04530 511553 512464 gene locus_tag LOCUS_04540 511553 512464 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230727.1 protein_id gnl|my_center|LOCUS_04540 514150 512711 gene locus_tag LOCUS_04550 514150 512711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 515012 514155 gene locus_tag LOCUS_04560 515012 514155 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028774.1 protein_id gnl|my_center|LOCUS_04560 516092 515301 gene locus_tag LOCUS_04570 516092 515301 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731491.1 protein_id gnl|my_center|LOCUS_04570 517824 516094 gene locus_tag LOCUS_04580 517824 516094 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731492.1 protein_id gnl|my_center|LOCUS_04580 518450 517830 gene locus_tag LOCUS_04590 518450 517830 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858584.1 protein_id gnl|my_center|LOCUS_04590 518851 519123 gene locus_tag LOCUS_04600 518851 519123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 519610 519158 gene locus_tag LOCUS_04610 519610 519158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 519936 519616 gene locus_tag LOCUS_04620 519936 519616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 520619 519936 gene locus_tag LOCUS_04630 520619 519936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 522226 520619 gene locus_tag LOCUS_04640 522226 520619 CDS product Na+/H+ antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892272.1 protein_id gnl|my_center|LOCUS_04640 522741 522223 gene locus_tag LOCUS_04650 522741 522223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 525869 522738 gene locus_tag LOCUS_04660 525869 522738 CDS product Na+/H+ antiporter subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113179.1 protein_id gnl|my_center|LOCUS_04660 525999 527318 gene locus_tag LOCUS_04670 525999 527318 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015250.1 protein_id gnl|my_center|LOCUS_04670 528402 527338 gene locus_tag LOCUS_04680 528402 527338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803908.1 protein_id gnl|my_center|LOCUS_04680 529856 528447 gene locus_tag LOCUS_04690 529856 528447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 530476 529853 gene locus_tag LOCUS_04700 gene dcd 530476 529853 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975261.1 protein_id gnl|my_center|LOCUS_04700 530556 530629 gene locus_tag LOCUS_t00100 530556 530629 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 531376 530726 gene locus_tag LOCUS_04710 531376 530726 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079489.1 protein_id gnl|my_center|LOCUS_04710 532136 531447 gene locus_tag LOCUS_04720 532136 531447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 534084 532147 gene locus_tag LOCUS_04730 534084 532147 CDS product redoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026880.1 protein_id gnl|my_center|LOCUS_04730 534271 535263 gene locus_tag LOCUS_04740 534271 535263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 537503 535317 gene locus_tag LOCUS_04750 537503 535317 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776195.1 protein_id gnl|my_center|LOCUS_04750 538438 537704 gene locus_tag LOCUS_04760 538438 537704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 539274 538636 gene locus_tag LOCUS_04770 539274 538636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 539771 539487 gene locus_tag LOCUS_04780 539771 539487 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003950507.1 protein_id gnl|my_center|LOCUS_04780 540144 539839 gene locus_tag LOCUS_04790 gene rpsN 540144 539839 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897467.1 protein_id gnl|my_center|LOCUS_04790 540322 540152 gene locus_tag LOCUS_04800 gene rpmG 540322 540152 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005063154.1 protein_id gnl|my_center|LOCUS_04800 540561 540325 gene locus_tag LOCUS_04810 gene rpmB 540561 540325 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731012.1 protein_id gnl|my_center|LOCUS_04810 541749 540853 gene locus_tag LOCUS_04820 541749 540853 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742086.1 protein_id gnl|my_center|LOCUS_04820 542845 541880 gene locus_tag LOCUS_04830 542845 541880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04830 543803 542898 gene locus_tag LOCUS_04840 543803 542898 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013802.1 protein_id gnl|my_center|LOCUS_04840 544903 543800 gene locus_tag LOCUS_04850 544903 543800 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776629.1 protein_id gnl|my_center|LOCUS_04850 545865 544900 gene locus_tag LOCUS_04860 545865 544900 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082397.1 protein_id gnl|my_center|LOCUS_04860 547041 545980 gene locus_tag LOCUS_04870 547041 545980 CDS product iron-siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013805.1 protein_id gnl|my_center|LOCUS_04870 547222 548061 gene locus_tag LOCUS_04880 547222 548061 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930017.1 protein_id gnl|my_center|LOCUS_04880 548117 548710 gene locus_tag LOCUS_04890 548117 548710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 549460 548897 gene locus_tag LOCUS_04900 549460 548897 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887249.1 protein_id gnl|my_center|LOCUS_04900 549826 550689 gene locus_tag LOCUS_04910 549826 550689 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093548.1 protein_id gnl|my_center|LOCUS_04910 550722 551780 gene locus_tag LOCUS_04920 550722 551780 CDS product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082323.1 protein_id gnl|my_center|LOCUS_04920 551780 552493 gene locus_tag LOCUS_04930 551780 552493 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057738.1 protein_id gnl|my_center|LOCUS_04930 554136 552490 gene locus_tag LOCUS_04940 554136 552490 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188700193.1 protein_id gnl|my_center|LOCUS_04940 554251 554409 gene locus_tag LOCUS_04950 554251 554409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 554462 555184 gene locus_tag LOCUS_04960 554462 555184 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031718.1 protein_id gnl|my_center|LOCUS_04960 555181 556185 gene locus_tag LOCUS_04970 555181 556185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 558007 556352 gene locus_tag LOCUS_04980 558007 556352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 559197 558076 gene locus_tag LOCUS_04990 559197 558076 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326663.1 protein_id gnl|my_center|LOCUS_04990 560350 559199 gene locus_tag LOCUS_05000 gene pdhA 560350 559199 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230923.1 protein_id gnl|my_center|LOCUS_05000 561666 560491 gene locus_tag LOCUS_05010 gene hisC 561666 560491 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029330.1 protein_id gnl|my_center|LOCUS_05010 563499 561700 gene locus_tag LOCUS_05020 563499 561700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 564032 563499 gene locus_tag LOCUS_05030 564032 563499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 564320 565783 gene locus_tag LOCUS_05040 gene purB 564320 565783 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776538.1 protein_id gnl|my_center|LOCUS_05040 566768 565932 gene locus_tag LOCUS_05050 566768 565932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 567662 566832 gene locus_tag LOCUS_05060 567662 566832 CDS product fused MFS/spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804823.1 protein_id gnl|my_center|LOCUS_05060 568639 567659 gene locus_tag LOCUS_05070 568639 567659 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972246.1 protein_id gnl|my_center|LOCUS_05070 568953 568636 gene locus_tag LOCUS_05080 568953 568636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 569799 569122 gene locus_tag LOCUS_05090 569799 569122 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776232.1 protein_id gnl|my_center|LOCUS_05090 570124 570199 gene locus_tag LOCUS_t00110 570124 570199 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 571255 570275 gene locus_tag LOCUS_05100 571255 570275 CDS product Abi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947828.1 protein_id gnl|my_center|LOCUS_05100 571599 572450 gene locus_tag LOCUS_05110 571599 572450 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082640.1 protein_id gnl|my_center|LOCUS_05110 573341 572487 gene locus_tag LOCUS_05120 573341 572487 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803688.1 protein_id gnl|my_center|LOCUS_05120 574474 573341 gene locus_tag LOCUS_05130 574474 573341 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803689.1 protein_id gnl|my_center|LOCUS_05130 574581 576206 gene locus_tag LOCUS_05140 574581 576206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 576206 576856 gene locus_tag LOCUS_05150 576206 576856 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803691.1 protein_id gnl|my_center|LOCUS_05150 577419 576901 gene locus_tag LOCUS_05160 577419 576901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 577697 578830 gene locus_tag LOCUS_05170 577697 578830 CDS product PLP-dependent aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804431.1 protein_id gnl|my_center|LOCUS_05170 578911 579753 gene locus_tag LOCUS_05180 578911 579753 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027948.1 protein_id gnl|my_center|LOCUS_05180 579758 580432 gene locus_tag LOCUS_05190 579758 580432 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529174.1 protein_id gnl|my_center|LOCUS_05190 580425 581165 gene locus_tag LOCUS_05200 580425 581165 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966599.1 protein_id gnl|my_center|LOCUS_05200 581930 581313 gene locus_tag LOCUS_05210 581930 581313 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000800177.1 protein_id gnl|my_center|LOCUS_05210 582945 581986 gene locus_tag LOCUS_05220 582945 581986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079007.1 protein_id gnl|my_center|LOCUS_05220 583315 583121 gene locus_tag LOCUS_05230 583315 583121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 585642 583333 gene locus_tag LOCUS_05240 585642 583333 CDS product carbon starvation CstA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084321.1 protein_id gnl|my_center|LOCUS_05240 586750 585707 gene locus_tag LOCUS_05250 586750 585707 CDS product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975111.1 protein_id gnl|my_center|LOCUS_05250 586869 586957 gene locus_tag LOCUS_t00120 586869 586957 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 587332 587018 gene locus_tag LOCUS_05260 587332 587018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 589364 587376 gene locus_tag LOCUS_05270 589364 587376 CDS product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132113460.1 protein_id gnl|my_center|LOCUS_05270 589488 589578 gene locus_tag LOCUS_t00130 589488 589578 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 590320 589796 gene locus_tag LOCUS_05280 590320 589796 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084578.1 protein_id gnl|my_center|LOCUS_05280 591181 590396 gene locus_tag LOCUS_05290 591181 590396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 592156 591518 gene locus_tag LOCUS_05300 gene upp 592156 591518 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974921.1 protein_id gnl|my_center|LOCUS_05300 592118 592696 gene locus_tag LOCUS_05310 gene tadA 592118 592696 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803986.1 protein_id gnl|my_center|LOCUS_05310 592835 593638 gene locus_tag LOCUS_05320 592835 593638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 593648 596368 gene locus_tag LOCUS_05330 593648 596368 CDS product YhgE/Pip domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805172.1 protein_id gnl|my_center|LOCUS_05330 596373 597047 gene locus_tag LOCUS_05340 596373 597047 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227922.1 protein_id gnl|my_center|LOCUS_05340 597084 597172 gene locus_tag LOCUS_t00140 597084 597172 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 597352 598308 gene locus_tag LOCUS_05350 597352 598308 CDS product delta(1)-pyrroline-2-carboxylate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551610.1 protein_id gnl|my_center|LOCUS_05350 598311 601109 gene locus_tag LOCUS_05360 gene hrpB 598311 601109 CDS product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_221932996.1 protein_id gnl|my_center|LOCUS_05360 603304 601133 gene locus_tag LOCUS_05370 603304 601133 CDS product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775917.1 protein_id gnl|my_center|LOCUS_05370 603443 604156 gene locus_tag LOCUS_05380 603443 604156 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171830.1 protein_id gnl|my_center|LOCUS_05380 604260 605198 gene locus_tag LOCUS_05390 604260 605198 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898125.1 protein_id gnl|my_center|LOCUS_05390 605745 605257 gene locus_tag LOCUS_05400 605745 605257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 606586 606002 gene locus_tag LOCUS_05410 606586 606002 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164275233.1 protein_id gnl|my_center|LOCUS_05410 607608 606613 gene locus_tag LOCUS_05420 607608 606613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 609996 607639 gene locus_tag LOCUS_05430 609996 607639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 610220 610936 gene locus_tag LOCUS_05440 610220 610936 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265896.1 protein_id gnl|my_center|LOCUS_05440 611188 611757 gene locus_tag LOCUS_05450 611188 611757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 611750 612703 gene locus_tag LOCUS_05460 611750 612703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 612878 614521 gene locus_tag LOCUS_05470 612878 614521 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877773.1 protein_id gnl|my_center|LOCUS_05470 616432 614747 gene locus_tag LOCUS_05480 616432 614747 CDS product DUF853 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730039.1 protein_id gnl|my_center|LOCUS_05480 616724 617041 gene locus_tag LOCUS_05490 616724 617041 CDS product DUF2316 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479644.1 protein_id gnl|my_center|LOCUS_05490 617240 617980 gene locus_tag LOCUS_05500 617240 617980 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813694.1 protein_id gnl|my_center|LOCUS_05500 618054 619553 gene locus_tag LOCUS_05510 618054 619553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 619736 619650 gene locus_tag LOCUS_t00150 619736 619650 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 620084 623389 gene locus_tag LOCUS_05520 620084 623389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_05520 623459 624307 gene locus_tag LOCUS_05530 623459 624307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 625298 624372 gene locus_tag LOCUS_05540 625298 624372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 625499 626794 gene locus_tag LOCUS_05550 625499 626794 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975324.1 protein_id gnl|my_center|LOCUS_05550 626797 627750 gene locus_tag LOCUS_05560 626797 627750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226805.1 protein_id gnl|my_center|LOCUS_05560 627968 627780 gene locus_tag LOCUS_05570 627968 627780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 628455 628787 gene locus_tag LOCUS_05580 628455 628787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 628768 629886 gene locus_tag LOCUS_05590 628768 629886 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226862.1 protein_id gnl|my_center|LOCUS_05590 629883 631046 gene locus_tag LOCUS_05600 629883 631046 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186009675.1 protein_id gnl|my_center|LOCUS_05600 631043 631933 gene locus_tag LOCUS_05610 631043 631933 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027158.1 protein_id gnl|my_center|LOCUS_05610 632117 633169 gene locus_tag LOCUS_05620 gene fepB 632117 633169 CDS product Fe2+-enterobactin ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001234319.1 protein_id gnl|my_center|LOCUS_05620 633336 634514 gene locus_tag LOCUS_05630 633336 634514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 634679 634930 gene locus_tag LOCUS_05640 gene purS 634679 634930 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776336.1 protein_id gnl|my_center|LOCUS_05640 634936 635715 gene locus_tag LOCUS_05650 gene purQ 634936 635715 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776337.1 protein_id gnl|my_center|LOCUS_05650 635774 638077 gene locus_tag LOCUS_05660 gene purL 635774 638077 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974893.1 protein_id gnl|my_center|LOCUS_05660 638098 638895 gene locus_tag LOCUS_05670 638098 638895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 638938 639873 gene locus_tag LOCUS_05680 638938 639873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 640465 639998 gene locus_tag LOCUS_05690 640465 639998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 640670 643180 gene locus_tag LOCUS_05700 640670 643180 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898639.1 protein_id gnl|my_center|LOCUS_05700 643498 645705 gene locus_tag LOCUS_05710 643498 645705 CDS product glucose PTS transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014304.1 protein_id gnl|my_center|LOCUS_05710 646282 645809 gene locus_tag LOCUS_05720 646282 645809 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804770.1 protein_id gnl|my_center|LOCUS_05720 647870 646386 gene locus_tag LOCUS_05730 647870 646386 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777134.1 protein_id gnl|my_center|LOCUS_05730 648000 648893 gene locus_tag LOCUS_05740 648000 648893 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731106.1 protein_id gnl|my_center|LOCUS_05740 649590 648883 gene locus_tag LOCUS_05750 649590 648883 CDS product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070188143.1 protein_id gnl|my_center|LOCUS_05750 649762 650574 gene locus_tag LOCUS_05760 649762 650574 CDS product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776974.1 protein_id gnl|my_center|LOCUS_05760 651285 650590 gene locus_tag LOCUS_05770 651285 650590 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230202.1 protein_id gnl|my_center|LOCUS_05770 651648 651322 gene locus_tag LOCUS_05780 651648 651322 CDS product type II toxin-antitoxin system VapB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003999914.1 protein_id gnl|my_center|LOCUS_05780 653467 651689 gene locus_tag LOCUS_05790 653467 651689 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013615.1 protein_id gnl|my_center|LOCUS_05790 654117 653464 gene locus_tag LOCUS_05800 654117 653464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 654352 655137 gene locus_tag LOCUS_05810 654352 655137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 655942 655256 gene locus_tag LOCUS_05820 655942 655256 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908906.1 protein_id gnl|my_center|LOCUS_05820 655898 656134 gene locus_tag LOCUS_05830 655898 656134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 656341 657492 gene locus_tag LOCUS_05840 656341 657492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 657489 658919 gene locus_tag LOCUS_05850 657489 658919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 659732 658953 gene locus_tag LOCUS_05860 659732 658953 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804321.1 protein_id gnl|my_center|LOCUS_05860 661105 659771 gene locus_tag LOCUS_05870 gene serS 661105 659771 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814634.1 protein_id gnl|my_center|LOCUS_05870 661239 662297 gene locus_tag LOCUS_05880 661239 662297 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804319.1 protein_id gnl|my_center|LOCUS_05880 662420 664135 gene locus_tag LOCUS_05890 gene dld 662420 664135 CDS product D-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804158.1 protein_id gnl|my_center|LOCUS_05890 665096 664155 gene locus_tag LOCUS_05900 gene pheA 665096 664155 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804316.1 protein_id gnl|my_center|LOCUS_05900 665422 665099 gene locus_tag LOCUS_05910 665422 665099 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222088.1 protein_id gnl|my_center|LOCUS_05910 665591 666688 gene locus_tag LOCUS_05920 gene hutG 665591 666688 CDS product formimidoylglutamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777037.1 protein_id gnl|my_center|LOCUS_05920 666698 668332 gene locus_tag LOCUS_05930 gene pgm 666698 668332 CDS product phosphoglucomutase (alpha-D-glucose-1,6-bisphosphate-dependent) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971701.1 protein_id gnl|my_center|LOCUS_05930 668899 668336 gene locus_tag LOCUS_05940 668899 668336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 669120 669383 gene locus_tag LOCUS_05950 669120 669383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 669405 669758 gene locus_tag LOCUS_05960 669405 669758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 669805 671280 gene locus_tag LOCUS_05970 669805 671280 CDS product oligopeptide:H+ symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165446571.1 protein_id gnl|my_center|LOCUS_05970 671431 671979 gene locus_tag LOCUS_05980 671431 671979 CDS product DUF4242 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079458.1 protein_id gnl|my_center|LOCUS_05980 671991 673094 gene locus_tag LOCUS_05990 671991 673094 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895886.1 protein_id gnl|my_center|LOCUS_05990 673091 673822 gene locus_tag LOCUS_06000 673091 673822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 673819 675060 gene locus_tag LOCUS_06010 673819 675060 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729891.1 protein_id gnl|my_center|LOCUS_06010 675053 675814 gene locus_tag LOCUS_06020 675053 675814 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729892.1 protein_id gnl|my_center|LOCUS_06020 675859 677220 gene locus_tag LOCUS_06030 675859 677220 CDS product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052100.1 protein_id gnl|my_center|LOCUS_06030 678369 677413 gene locus_tag LOCUS_06040 678369 677413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 679693 678668 gene locus_tag LOCUS_06050 679693 678668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 680517 679735 gene locus_tag LOCUS_06060 680517 679735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 681350 680514 gene locus_tag LOCUS_06070 681350 680514 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974993.1 protein_id gnl|my_center|LOCUS_06070 681890 681351 gene locus_tag LOCUS_06080 681890 681351 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895586.1 protein_id gnl|my_center|LOCUS_06080 682903 681965 gene locus_tag LOCUS_06090 682903 681965 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730629.1 protein_id gnl|my_center|LOCUS_06090 683108 684202 gene locus_tag LOCUS_06100 683108 684202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 684453 685892 gene locus_tag LOCUS_06110 684453 685892 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244218.1 protein_id gnl|my_center|LOCUS_06110 687353 686022 gene locus_tag LOCUS_06120 687353 686022 CDS product M18 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776646.1 protein_id gnl|my_center|LOCUS_06120 688465 687350 gene locus_tag LOCUS_06130 688465 687350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 688552 690558 gene locus_tag LOCUS_06140 688552 690558 CDS product 5-oxoprolinase/urea amidolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266442.1 protein_id gnl|my_center|LOCUS_06140 690543 692405 gene locus_tag LOCUS_06150 690543 692405 CDS product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973423.1 protein_id gnl|my_center|LOCUS_06150 693869 692538 gene locus_tag LOCUS_06160 693869 692538 CDS product divalent metal cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014042.1 protein_id gnl|my_center|LOCUS_06160 695575 694091 gene locus_tag LOCUS_06170 695575 694091 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036462762.1 protein_id gnl|my_center|LOCUS_06170 696027 695572 gene locus_tag LOCUS_06180 696027 695572 CDS product pyrimidine dimer DNA glycosylase/endonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805109.1 protein_id gnl|my_center|LOCUS_06180 696292 697662 gene locus_tag LOCUS_06190 696292 697662 CDS product sodium/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015371.1 protein_id gnl|my_center|LOCUS_06190 697876 698700 gene locus_tag LOCUS_06200 697876 698700 CDS product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977203.1 protein_id gnl|my_center|LOCUS_06200 698869 699210 gene locus_tag LOCUS_06210 698869 699210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 700082 699291 gene locus_tag LOCUS_06220 700082 699291 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965302.1 protein_id gnl|my_center|LOCUS_06220 700313 701206 gene locus_tag LOCUS_06230 700313 701206 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225665818.1 protein_id gnl|my_center|LOCUS_06230 701305 702861 gene locus_tag LOCUS_06240 701305 702861 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064265.1 protein_id gnl|my_center|LOCUS_06240 702977 703720 gene locus_tag LOCUS_06250 gene treR 702977 703720 CDS product trehalose operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643703.1 protein_id gnl|my_center|LOCUS_06250 703717 705417 gene locus_tag LOCUS_06260 gene treC 703717 705417 CDS product alpha,alpha-phosphotrehalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100943.1 protein_id gnl|my_center|LOCUS_06260 706969 705503 gene locus_tag LOCUS_06270 706969 705503 CDS product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013450.1 protein_id gnl|my_center|LOCUS_06270 707253 708254 gene locus_tag LOCUS_06280 707253 708254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 708935 708366 gene locus_tag LOCUS_06290 708935 708366 CDS product YagU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001822554.1 protein_id gnl|my_center|LOCUS_06290 709218 710702 gene locus_tag LOCUS_06300 709218 710702 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230209.1 protein_id gnl|my_center|LOCUS_06300 710925 711341 gene locus_tag LOCUS_06310 710925 711341 CDS product YchJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208400687.1 protein_id gnl|my_center|LOCUS_06310 712048 711377 gene locus_tag LOCUS_06320 712048 711377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 712398 712045 gene locus_tag LOCUS_06330 712398 712045 CDS product MTH1187 family thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726762.1 protein_id gnl|my_center|LOCUS_06330 713462 712593 gene locus_tag LOCUS_06340 713462 712593 CDS product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014223.1 protein_id gnl|my_center|LOCUS_06340 715030 713510 gene locus_tag LOCUS_06350 715030 713510 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811563.1 protein_id gnl|my_center|LOCUS_06350 715118 715921 gene locus_tag LOCUS_06360 715118 715921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 715963 716379 gene locus_tag LOCUS_06370 715963 716379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06370 716408 716857 gene locus_tag LOCUS_06380 716408 716857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06380 716962 717741 gene locus_tag LOCUS_06390 716962 717741 CDS product VIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893323.1 protein_id gnl|my_center|LOCUS_06390 718411 717962 gene locus_tag LOCUS_06400 718411 717962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06400 718856 718440 gene locus_tag LOCUS_06410 718856 718440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06410 718930 721038 gene locus_tag LOCUS_06420 gene pta 718930 721038 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030239.1 protein_id gnl|my_center|LOCUS_06420 721488 721129 gene locus_tag LOCUS_06430 721488 721129 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887981.1 protein_id gnl|my_center|LOCUS_06430 721629 722873 gene locus_tag LOCUS_06440 gene ackA 721629 722873 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082978.1 protein_id gnl|my_center|LOCUS_06440 723148 724509 gene locus_tag LOCUS_06450 723148 724509 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803910.1 protein_id gnl|my_center|LOCUS_06450 724764 726407 gene locus_tag LOCUS_06460 724764 726407 CDS product GMC oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229262.1 protein_id gnl|my_center|LOCUS_06460 726462 727106 gene locus_tag LOCUS_06470 726462 727106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 727497 729167 gene locus_tag LOCUS_06480 727497 729167 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027264.1 protein_id gnl|my_center|LOCUS_06480 729490 730704 gene locus_tag LOCUS_06490 gene ugpC 729490 730704 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804887.1 protein_id gnl|my_center|LOCUS_06490 732129 730804 gene locus_tag LOCUS_06500 732129 730804 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930008.1 protein_id gnl|my_center|LOCUS_06500 732200 733576 gene locus_tag LOCUS_06510 732200 733576 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776454.1 protein_id gnl|my_center|LOCUS_06510 733579 734553 gene locus_tag LOCUS_06520 733579 734553 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776455.1 protein_id gnl|my_center|LOCUS_06520 734554 735483 gene locus_tag LOCUS_06530 734554 735483 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776456.1 protein_id gnl|my_center|LOCUS_06530 735530 737209 gene locus_tag LOCUS_06540 735530 737209 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776457.1 protein_id gnl|my_center|LOCUS_06540 739327 737342 gene locus_tag LOCUS_06550 739327 737342 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804046.1 protein_id gnl|my_center|LOCUS_06550 739473 739811 gene locus_tag LOCUS_06560 739473 739811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 739883 740101 gene locus_tag LOCUS_06570 739883 740101 CDS product heavy-metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228663.1 protein_id gnl|my_center|LOCUS_06570 740098 742416 gene locus_tag LOCUS_06580 740098 742416 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027542.1 protein_id gnl|my_center|LOCUS_06580 742605 743141 gene locus_tag LOCUS_06590 742605 743141 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222365.1 protein_id gnl|my_center|LOCUS_06590 743615 743166 gene locus_tag LOCUS_06600 743615 743166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 744312 743659 gene locus_tag LOCUS_06610 744312 743659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 746007 744403 gene locus_tag LOCUS_06620 746007 744403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 746242 747195 gene locus_tag LOCUS_06630 gene pdxS 746242 747195 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051767629.1 protein_id gnl|my_center|LOCUS_06630 747192 747797 gene locus_tag LOCUS_06640 gene pdxT 747192 747797 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013889.1 protein_id gnl|my_center|LOCUS_06640 747916 749406 gene locus_tag LOCUS_06650 747916 749406 CDS product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002438863.1 protein_id gnl|my_center|LOCUS_06650 750541 749468 gene locus_tag LOCUS_06660 750541 749468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 751891 750629 gene locus_tag LOCUS_06670 gene efeB 751891 750629 CDS product iron uptake transporter deferrochelatase/peroxidase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005073925.1 protein_id gnl|my_center|LOCUS_06670 753528 752203 gene locus_tag LOCUS_06680 753528 752203 CDS product peptidase M75 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229934.1 protein_id gnl|my_center|LOCUS_06680 754418 753525 gene locus_tag LOCUS_06690 754418 753525 CDS product FTR1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976536.1 protein_id gnl|my_center|LOCUS_06690 756103 754667 gene locus_tag LOCUS_06700 756103 754667 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485269.1 protein_id gnl|my_center|LOCUS_06700 757167 756166 gene locus_tag LOCUS_06710 757167 756166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 758225 757164 gene locus_tag LOCUS_06720 758225 757164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 758407 758829 gene locus_tag LOCUS_06730 758407 758829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06730 758799 759473 gene locus_tag LOCUS_06740 758799 759473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06740 760060 759584 gene locus_tag LOCUS_06750 760060 759584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 760578 760189 gene locus_tag LOCUS_06760 760578 760189 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804865.1 protein_id gnl|my_center|LOCUS_06760 761232 760627 gene locus_tag LOCUS_06770 761232 760627 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080700.1 protein_id gnl|my_center|LOCUS_06770 761590 762402 gene locus_tag LOCUS_06780 761590 762402 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015125.1 protein_id gnl|my_center|LOCUS_06780 762414 763340 gene locus_tag LOCUS_06790 762414 763340 CDS product DUF808 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014113.1 protein_id gnl|my_center|LOCUS_06790 763436 763912 gene locus_tag LOCUS_06800 763436 763912 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777051.1 protein_id gnl|my_center|LOCUS_06800 764191 764105 gene locus_tag LOCUS_t00160 764191 764105 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 764494 765471 gene locus_tag LOCUS_06810 764494 765471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 765456 765974 gene locus_tag LOCUS_06820 gene fhaB 765456 765974 CDS product antibiotic biosynthesis regulator FhaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975090.1 protein_id gnl|my_center|LOCUS_06820 765980 767806 gene locus_tag LOCUS_06830 765980 767806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 767803 769338 gene locus_tag LOCUS_06840 767803 769338 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776671.1 protein_id gnl|my_center|LOCUS_06840 769335 770777 gene locus_tag LOCUS_06850 769335 770777 CDS product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776672.1 protein_id gnl|my_center|LOCUS_06850 770774 772561 gene locus_tag LOCUS_06860 770774 772561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 772569 774731 gene locus_tag LOCUS_06870 gene pknB 772569 774731 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029269.1 protein_id gnl|my_center|LOCUS_06870 775500 774862 gene locus_tag LOCUS_06880 775500 774862 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776675.1 protein_id gnl|my_center|LOCUS_06880 775722 775549 gene locus_tag LOCUS_06890 775722 775549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776676.1 protein_id gnl|my_center|LOCUS_06890 776475 775723 gene locus_tag LOCUS_06900 776475 775723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06900 776737 777129 gene locus_tag LOCUS_06910 776737 777129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 777130 777462 gene locus_tag LOCUS_06920 777130 777462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 778296 777490 gene locus_tag LOCUS_06930 778296 777490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 779512 778517 gene locus_tag LOCUS_06940 779512 778517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 780254 779706 gene locus_tag LOCUS_06950 780254 779706 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776424.1 protein_id gnl|my_center|LOCUS_06950 780463 782070 gene locus_tag LOCUS_06960 780463 782070 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002352327.1 protein_id gnl|my_center|LOCUS_06960 782332 782985 gene locus_tag LOCUS_06970 782332 782985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 782985 783896 gene locus_tag LOCUS_06980 782985 783896 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777095.1 protein_id gnl|my_center|LOCUS_06980 783884 784744 gene locus_tag LOCUS_06990 783884 784744 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777094.1 protein_id gnl|my_center|LOCUS_06990 785668 784898 gene locus_tag LOCUS_07000 785668 784898 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777093.1 protein_id gnl|my_center|LOCUS_07000 787180 785780 gene locus_tag LOCUS_07010 787180 785780 CDS product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015481.1 protein_id gnl|my_center|LOCUS_07010 787854 787306 gene locus_tag LOCUS_07020 787854 787306 CDS product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082774477.1 protein_id gnl|my_center|LOCUS_07020 788262 789569 gene locus_tag LOCUS_07030 gene argE 788262 789569 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534727.1 protein_id gnl|my_center|LOCUS_07030 790537 789533 gene locus_tag LOCUS_07040 790537 789533 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081119.1 protein_id gnl|my_center|LOCUS_07040 790631 791833 gene locus_tag LOCUS_07050 790631 791833 CDS product TDT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066568686.1 protein_id gnl|my_center|LOCUS_07050 791985 793103 gene locus_tag LOCUS_07060 791985 793103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 793158 793595 gene locus_tag LOCUS_07070 793158 793595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 793731 795872 gene locus_tag LOCUS_07080 793731 795872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 798315 795994 gene locus_tag LOCUS_07090 798315 795994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 799230 798565 gene locus_tag LOCUS_07100 799230 798565 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971514.1 protein_id gnl|my_center|LOCUS_07100 800301 799471 gene locus_tag LOCUS_07110 800301 799471 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777053.1 protein_id gnl|my_center|LOCUS_07110 800772 800488 gene locus_tag LOCUS_07120 800772 800488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 800959 800792 gene locus_tag LOCUS_07130 800959 800792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 801883 801005 gene locus_tag LOCUS_07140 801883 801005 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107120.1 protein_id gnl|my_center|LOCUS_07140 802241 801873 gene locus_tag LOCUS_07150 802241 801873 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037644569.1 protein_id gnl|my_center|LOCUS_07150 803386 802316 gene locus_tag LOCUS_07160 803386 802316 CDS product ArsO family NAD(P)H-dependent flavin-containing monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043376805.1 protein_id gnl|my_center|LOCUS_07160 803804 803379 gene locus_tag LOCUS_07170 803804 803379 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222673.1 protein_id gnl|my_center|LOCUS_07170 804919 803801 gene locus_tag LOCUS_07180 gene arsB 804919 803801 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029172.1 protein_id gnl|my_center|LOCUS_07180 805785 804958 gene locus_tag LOCUS_07190 805785 804958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 805873 806256 gene locus_tag LOCUS_07200 805873 806256 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112711.1 protein_id gnl|my_center|LOCUS_07200 806302 806784 gene locus_tag LOCUS_07210 806302 806784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 807437 806862 gene locus_tag LOCUS_07220 807437 806862 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147567.1 protein_id gnl|my_center|LOCUS_07220 807843 807634 gene locus_tag LOCUS_07230 807843 807634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 807847 808206 gene locus_tag LOCUS_07240 807847 808206 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776291.1 protein_id gnl|my_center|LOCUS_07240 808203 808805 gene locus_tag LOCUS_07250 808203 808805 CDS product cadmium resistance transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053546291.1 protein_id gnl|my_center|LOCUS_07250 809874 809026 gene locus_tag LOCUS_07260 809874 809026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 810302 809964 gene locus_tag LOCUS_07270 810302 809964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 810532 810386 gene locus_tag LOCUS_07280 810532 810386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 810964 810551 gene locus_tag LOCUS_07290 810964 810551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 811497 811108 gene locus_tag LOCUS_07300 811497 811108 CDS product hypoxia response transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900026.1 protein_id gnl|my_center|LOCUS_07300 811604 813028 gene locus_tag LOCUS_07310 gene merA 811604 813028 CDS product mercury(II) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296234.1 protein_id gnl|my_center|LOCUS_07310 813078 813380 gene locus_tag LOCUS_07320 813078 813380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 814286 813399 gene locus_tag LOCUS_07330 814286 813399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 815160 814435 gene locus_tag LOCUS_07340 815160 814435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 815747 815157 gene locus_tag LOCUS_07350 815747 815157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 817165 815744 gene locus_tag LOCUS_07360 817165 815744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 817487 817149 gene locus_tag LOCUS_07370 817487 817149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 817732 817484 gene locus_tag LOCUS_07380 817732 817484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 817944 817732 gene locus_tag LOCUS_07390 817944 817732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 819527 818127 gene locus_tag LOCUS_07400 819527 818127 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003903979.1 protein_id gnl|my_center|LOCUS_07400 819857 819606 gene locus_tag LOCUS_07410 819857 819606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 819825 820004 gene locus_tag LOCUS_07420 819825 820004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 820001 820915 gene locus_tag LOCUS_07430 820001 820915 CDS product arginase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267511.1 protein_id gnl|my_center|LOCUS_07430 822059 820902 gene locus_tag LOCUS_07440 822059 820902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 822380 822814 gene locus_tag LOCUS_07450 822380 822814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 824576 822918 gene locus_tag LOCUS_07460 824576 822918 CDS product YdiU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728345.1 protein_id gnl|my_center|LOCUS_07460 825053 824625 gene locus_tag LOCUS_07470 825053 824625 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094405.1 protein_id gnl|my_center|LOCUS_07470 825390 824935 gene locus_tag LOCUS_07480 825390 824935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 826645 825560 gene locus_tag LOCUS_07490 826645 825560 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226330.1 protein_id gnl|my_center|LOCUS_07490 828188 826923 gene locus_tag LOCUS_07500 828188 826923 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538115.1 protein_id gnl|my_center|LOCUS_07500 829534 828629 gene locus_tag LOCUS_07510 829534 828629 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227571.1 protein_id gnl|my_center|LOCUS_07510 829627 830121 gene locus_tag LOCUS_07520 829627 830121 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969303.1 protein_id gnl|my_center|LOCUS_07520 830274 832226 gene locus_tag LOCUS_07530 830274 832226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 833002 832259 gene locus_tag LOCUS_07540 833002 832259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 834644 833142 gene locus_tag LOCUS_07550 834644 833142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 834647 834883 gene locus_tag LOCUS_07560 834647 834883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 836241 834904 gene locus_tag LOCUS_07570 836241 834904 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776842.1 protein_id gnl|my_center|LOCUS_07570 837407 836385 gene locus_tag LOCUS_07580 837407 836385 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804077.1 protein_id gnl|my_center|LOCUS_07580 837891 837475 gene locus_tag LOCUS_07590 837891 837475 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225568.1 protein_id gnl|my_center|LOCUS_07590 838874 837888 gene locus_tag LOCUS_07600 838874 837888 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804078.1 protein_id gnl|my_center|LOCUS_07600 840550 839036 gene locus_tag LOCUS_07610 gene cycA 840550 839036 CDS product D-serine/D-alanine/glycine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729183.1 protein_id gnl|my_center|LOCUS_07610 841471 840731 gene locus_tag LOCUS_07620 841471 840731 CDS product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775993.1 protein_id gnl|my_center|LOCUS_07620 843036 841474 gene locus_tag LOCUS_07630 843036 841474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 844974 843421 gene locus_tag LOCUS_07640 844974 843421 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005646006.1 protein_id gnl|my_center|LOCUS_07640 846544 845186 gene locus_tag LOCUS_07650 gene dnaB 846544 845186 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975021.1 protein_id gnl|my_center|LOCUS_07650 847216 846863 gene locus_tag LOCUS_07660 847216 846863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 847786 847337 gene locus_tag LOCUS_07670 gene rplI 847786 847337 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777136.1 protein_id gnl|my_center|LOCUS_07670 848044 847808 gene locus_tag LOCUS_07680 gene rpsR 848044 847808 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777137.1 protein_id gnl|my_center|LOCUS_07680 848758 848129 gene locus_tag LOCUS_07690 848758 848129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 849155 848850 gene locus_tag LOCUS_07700 gene rpsF 849155 848850 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975025.1 protein_id gnl|my_center|LOCUS_07700 850559 849324 gene locus_tag LOCUS_07710 850559 849324 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777090.1 protein_id gnl|my_center|LOCUS_07710 851266 850709 gene locus_tag LOCUS_07720 851266 850709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 852313 851417 gene locus_tag LOCUS_07730 852313 851417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 853275 852310 gene locus_tag LOCUS_07740 853275 852310 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228269.1 protein_id gnl|my_center|LOCUS_07740 853641 853495 gene locus_tag LOCUS_07750 853641 853495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 854579 853638 gene locus_tag LOCUS_07760 854579 853638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07760 854542 854805 gene locus_tag LOCUS_07770 854542 854805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 855546 854767 gene locus_tag LOCUS_07780 855546 854767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07780 856240 855569 gene locus_tag LOCUS_07790 856240 855569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 857765 856341 gene locus_tag LOCUS_07800 857765 856341 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975035.1 protein_id gnl|my_center|LOCUS_07800 857931 858395 gene locus_tag LOCUS_07810 857931 858395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 858448 860082 gene locus_tag LOCUS_07820 858448 860082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 860165 861679 gene locus_tag LOCUS_07830 860165 861679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 861886 862935 gene locus_tag LOCUS_07840 gene trxB 861886 862935 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975041.1 protein_id gnl|my_center|LOCUS_07840 862962 863288 gene locus_tag LOCUS_07850 gene trxA 862962 863288 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975042.1 protein_id gnl|my_center|LOCUS_07850 864830 863370 gene locus_tag LOCUS_07860 864830 863370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 865543 865376 gene locus_tag LOCUS_07870 865543 865376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 867394 866507 gene locus_tag LOCUS_07880 867394 866507 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029292.1 protein_id gnl|my_center|LOCUS_07880 868660 868040 gene locus_tag LOCUS_07890 gene rsmG 868660 868040 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029291.1 protein_id gnl|my_center|LOCUS_07890 869559 868822 gene locus_tag LOCUS_07900 869559 868822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 870622 869651 gene locus_tag LOCUS_07910 gene yidC 870622 869651 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777156.1 protein_id gnl|my_center|LOCUS_07910 871070 870636 gene locus_tag LOCUS_07920 871070 870636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 871414 871067 gene locus_tag LOCUS_07930 gene rnpA 871414 871067 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029288.1 protein_id gnl|my_center|LOCUS_07930 871657 871520 gene locus_tag LOCUS_07940 gene rpmH 871657 871520 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975051.1 protein_id gnl|my_center|LOCUS_07940 872244 873977 gene locus_tag LOCUS_07950 872244 873977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 874461 875585 gene locus_tag LOCUS_07960 gene dnaN 874461 875585 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803666.1 protein_id gnl|my_center|LOCUS_07960 875631 876860 gene locus_tag LOCUS_07970 gene recF 875631 876860 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975056.1 protein_id gnl|my_center|LOCUS_07970 876853 877470 gene locus_tag LOCUS_07980 876853 877470 CDS product DciA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221959.1 protein_id gnl|my_center|LOCUS_07980 877702 879729 gene locus_tag LOCUS_07990 gene gyrB 877702 879729 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803673.1 protein_id gnl|my_center|LOCUS_07990 879828 882509 gene locus_tag LOCUS_08000 gene gyrA 879828 882509 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326690.1 protein_id gnl|my_center|LOCUS_08000 882506 883093 gene locus_tag LOCUS_08010 882506 883093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 883206 883281 gene locus_tag LOCUS_t00170 883206 883281 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 883309 883428 gene locus_tag LOCUS_08020 883309 883428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 883436 883511 gene locus_tag LOCUS_t00180 883436 883511 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 883742 885013 gene locus_tag LOCUS_08030 883742 885013 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011265565.1 protein_id gnl|my_center|LOCUS_08030 885017 885313 gene locus_tag LOCUS_08040 885017 885313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727385.1 protein_id gnl|my_center|LOCUS_08040 885393 885782 gene locus_tag LOCUS_08050 885393 885782 CDS product DUF3349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094656.1 protein_id gnl|my_center|LOCUS_08050 886868 885966 gene locus_tag LOCUS_08060 886868 885966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 887099 887641 gene locus_tag LOCUS_08070 887099 887641 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929825.1 protein_id gnl|my_center|LOCUS_08070 887836 888633 gene locus_tag LOCUS_08080 887836 888633 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803866.1 protein_id gnl|my_center|LOCUS_08080 889307 889113 gene locus_tag LOCUS_08090 889307 889113 CDS product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855652.1 protein_id gnl|my_center|LOCUS_08090 890927 889521 gene locus_tag LOCUS_08100 gene galK 890927 889521 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028786.1 protein_id gnl|my_center|LOCUS_08100 891595 890999 gene locus_tag LOCUS_08110 891595 890999 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014884.1 protein_id gnl|my_center|LOCUS_08110 892284 891748 gene locus_tag LOCUS_08120 892284 891748 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727021.1 protein_id gnl|my_center|LOCUS_08120 892716 893639 gene locus_tag LOCUS_08130 892716 893639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 893895 894062 gene locus_tag LOCUS_08140 893895 894062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 894754 894092 gene locus_tag LOCUS_08150 894754 894092 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029801.1 protein_id gnl|my_center|LOCUS_08150 896236 894812 gene locus_tag LOCUS_08160 896236 894812 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029800.1 protein_id gnl|my_center|LOCUS_08160 896840 896286 gene locus_tag LOCUS_08170 896840 896286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 897134 896856 gene locus_tag LOCUS_08180 897134 896856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 897569 897475 gene locus_tag LOCUS_t00190 897569 897475 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 899338 898127 gene locus_tag LOCUS_08190 899338 898127 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975538.1 protein_id gnl|my_center|LOCUS_08190 900374 899541 gene locus_tag LOCUS_08200 900374 899541 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776999.1 protein_id gnl|my_center|LOCUS_08200 900890 900384 gene locus_tag LOCUS_08210 900890 900384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 901343 900900 gene locus_tag LOCUS_08220 901343 900900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08220 901948 901295 gene locus_tag LOCUS_08230 901948 901295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08230 903361 902057 gene locus_tag LOCUS_08240 903361 902057 CDS product glutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860838.1 protein_id gnl|my_center|LOCUS_08240 904716 903523 gene locus_tag LOCUS_08250 904716 903523 CDS product zinc-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226129.1 protein_id gnl|my_center|LOCUS_08250 906104 904857 gene locus_tag LOCUS_08260 906104 904857 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230022.1 protein_id gnl|my_center|LOCUS_08260 906305 907396 gene locus_tag LOCUS_08270 906305 907396 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039311.1 protein_id gnl|my_center|LOCUS_08270 908301 907501 gene locus_tag LOCUS_08280 908301 907501 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777089.1 protein_id gnl|my_center|LOCUS_08280 910009 908426 gene locus_tag LOCUS_08290 910009 908426 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803919.1 protein_id gnl|my_center|LOCUS_08290 910179 910700 gene locus_tag LOCUS_08300 910179 910700 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803918.1 protein_id gnl|my_center|LOCUS_08300 910727 911323 gene locus_tag LOCUS_08310 910727 911323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 911414 911836 gene locus_tag LOCUS_08320 911414 911836 CDS product organic hydroperoxide resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005063604.1 protein_id gnl|my_center|LOCUS_08320 912964 911864 gene locus_tag LOCUS_08330 912964 911864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777143.1 protein_id gnl|my_center|LOCUS_08330 913028 913834 gene locus_tag LOCUS_08340 913028 913834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 914633 913860 gene locus_tag LOCUS_08350 914633 913860 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263635.1 protein_id gnl|my_center|LOCUS_08350 916147 914939 gene locus_tag LOCUS_08360 916147 914939 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015374.1 protein_id gnl|my_center|LOCUS_08360 918355 916196 gene locus_tag LOCUS_08370 918355 916196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 919482 918448 gene locus_tag LOCUS_08380 919482 918448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 920426 919479 gene locus_tag LOCUS_08390 920426 919479 CDS product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068759.1 protein_id gnl|my_center|LOCUS_08390 921764 920748 gene locus_tag LOCUS_08400 921764 920748 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191773063.1 protein_id gnl|my_center|LOCUS_08400 922015 922734 gene locus_tag LOCUS_08410 922015 922734 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776465.1 protein_id gnl|my_center|LOCUS_08410 922942 923445 gene locus_tag LOCUS_08420 922942 923445 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803955.1 protein_id gnl|my_center|LOCUS_08420 924363 923590 gene locus_tag LOCUS_08430 924363 923590 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174552531.1 protein_id gnl|my_center|LOCUS_08430 925310 924360 gene locus_tag LOCUS_08440 925310 924360 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204051675.1 protein_id gnl|my_center|LOCUS_08440 927008 925563 gene locus_tag LOCUS_08450 927008 925563 CDS product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890696.1 protein_id gnl|my_center|LOCUS_08450 927199 929931 gene locus_tag LOCUS_08460 gene uvrA 927199 929931 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349876.1 protein_id gnl|my_center|LOCUS_08460 931855 930182 gene locus_tag LOCUS_08470 931855 930182 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228517.1 protein_id gnl|my_center|LOCUS_08470 932610 931855 gene locus_tag LOCUS_08480 932610 931855 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230642.1 protein_id gnl|my_center|LOCUS_08480 932771 933817 gene locus_tag LOCUS_08490 932771 933817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 934597 935097 gene locus_tag LOCUS_08500 934597 935097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 935378 936748 gene locus_tag LOCUS_08510 935378 936748 CDS product bifunctional glycosyltransferase family 2/GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228528.1 protein_id gnl|my_center|LOCUS_08510 936797 938944 gene locus_tag LOCUS_08520 936797 938944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 939225 938914 gene locus_tag LOCUS_08530 939225 938914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 939137 939616 gene locus_tag LOCUS_08540 939137 939616 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804081.1 protein_id gnl|my_center|LOCUS_08540 940054 939707 gene locus_tag LOCUS_08550 940054 939707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 940700 940041 gene locus_tag LOCUS_08560 940700 940041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230855.1 protein_id gnl|my_center|LOCUS_08560 941284 940697 gene locus_tag LOCUS_08570 941284 940697 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230856.1 protein_id gnl|my_center|LOCUS_08570 941613 942098 gene locus_tag LOCUS_08580 941613 942098 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005074067.1 protein_id gnl|my_center|LOCUS_08580 942240 942422 gene locus_tag LOCUS_08590 942240 942422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 942426 942836 gene locus_tag LOCUS_08600 942426 942836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 942833 943396 gene locus_tag LOCUS_08610 942833 943396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 943393 943992 gene locus_tag LOCUS_08620 943393 943992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 944828 944202 gene locus_tag LOCUS_08630 944828 944202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 946248 944932 gene locus_tag LOCUS_08640 946248 944932 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804568.1 protein_id gnl|my_center|LOCUS_08640 947350 946256 gene locus_tag LOCUS_08650 947350 946256 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032887275.1 protein_id gnl|my_center|LOCUS_08650 947530 947967 gene locus_tag LOCUS_08660 947530 947967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 947964 948368 gene locus_tag LOCUS_08670 gene crcB 947964 948368 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079419.1 protein_id gnl|my_center|LOCUS_08670 948529 949650 gene locus_tag LOCUS_08680 948529 949650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 949816 951204 gene locus_tag LOCUS_08690 949816 951204 CDS product MFS family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101889.1 protein_id gnl|my_center|LOCUS_08690 951793 951287 gene locus_tag LOCUS_08700 gene crr 951793 951287 CDS product PTS glucose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000522253.1 protein_id gnl|my_center|LOCUS_08700 951931 952698 gene locus_tag LOCUS_08710 951931 952698 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525366.1 protein_id gnl|my_center|LOCUS_08710 952852 952724 gene locus_tag LOCUS_08720 952852 952724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 953183 954706 gene locus_tag LOCUS_08730 953183 954706 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877107.1 protein_id gnl|my_center|LOCUS_08730 954772 955791 gene locus_tag LOCUS_08740 gene adhP 954772 955791 CDS product alcohol dehydrogenase AdhP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015397.1 protein_id gnl|my_center|LOCUS_08740 955791 956270 gene locus_tag LOCUS_08750 955791 956270 CDS product DUF779 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776831.1 protein_id gnl|my_center|LOCUS_08750 957064 956357 gene locus_tag LOCUS_08760 957064 956357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 957219 959219 gene locus_tag LOCUS_08770 gene oatA 957219 959219 CDS product peptidoglycan O-acetyltransferase OatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009932001.1 protein_id gnl|my_center|LOCUS_08770 960204 959245 gene locus_tag LOCUS_08780 960204 959245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 961274 960240 gene locus_tag LOCUS_08790 961274 960240 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113074.1 protein_id gnl|my_center|LOCUS_08790 962316 961417 gene locus_tag LOCUS_08800 962316 961417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08800 962896 962213 gene locus_tag LOCUS_08810 962896 962213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08810 963258 963530 gene locus_tag LOCUS_08820 963258 963530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 963607 964407 gene locus_tag LOCUS_08830 963607 964407 CDS product TRIC cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929937.1 protein_id gnl|my_center|LOCUS_08830 964951 964430 gene locus_tag LOCUS_08840 964951 964430 CDS product asparaginase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036092.1 protein_id gnl|my_center|LOCUS_08840 965101 966672 gene locus_tag LOCUS_08850 gene proP 965101 966672 CDS product glycine betaine/L-proline transporter ProP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046247708.1 protein_id gnl|my_center|LOCUS_08850 966814 967776 gene locus_tag LOCUS_08860 966814 967776 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858893.1 protein_id gnl|my_center|LOCUS_08860 968210 967950 gene locus_tag LOCUS_08870 968210 967950 CDS product SemiSWEET family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680497.1 protein_id gnl|my_center|LOCUS_08870 968962 968465 gene locus_tag LOCUS_08880 968962 968465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 969846 968959 gene locus_tag LOCUS_08890 969846 968959 CDS product PTS mannose transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211067.1 protein_id gnl|my_center|LOCUS_08890 970657 969857 gene locus_tag LOCUS_08900 gene manY 970657 969857 CDS product PTS mannose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859914.1 protein_id gnl|my_center|LOCUS_08900 971796 970654 gene locus_tag LOCUS_08910 971796 970654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 972349 971966 gene locus_tag LOCUS_08920 972349 971966 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244460.1 protein_id gnl|my_center|LOCUS_08920 973065 972496 gene locus_tag LOCUS_08930 973065 972496 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973464.1 protein_id gnl|my_center|LOCUS_08930 973181 974014 gene locus_tag LOCUS_08940 973181 974014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 974076 974918 gene locus_tag LOCUS_08950 974076 974918 CDS product IS481-like element IS1649 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027058.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08950 976622 975231 gene locus_tag LOCUS_08960 976622 975231 CDS product IS1380 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_110107303.1 protein_id gnl|my_center|LOCUS_08960 976741 977361 gene locus_tag LOCUS_08970 976741 977361 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013394.1 protein_id gnl|my_center|LOCUS_08970 977802 977389 gene locus_tag LOCUS_08980 977802 977389 CDS product ChaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225977.1 protein_id gnl|my_center|LOCUS_08980 979241 977838 gene locus_tag LOCUS_08990 979241 977838 CDS product carboxylesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878613.1 protein_id gnl|my_center|LOCUS_08990 980912 979902 gene locus_tag LOCUS_09000 980912 979902 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015031.1 protein_id gnl|my_center|LOCUS_09000 981590 983117 gene locus_tag LOCUS_r00010 981590 983117 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 983544 986631 gene locus_tag LOCUS_r00020 983544 986631 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 986813 986923 gene locus_tag LOCUS_r00030 986813 986923 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 987152 987262 gene locus_tag LOCUS_r00040 987152 987262 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 987381 987866 gene locus_tag LOCUS_09010 987381 987866 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081676.1 protein_id gnl|my_center|LOCUS_09010 988194 990242 gene locus_tag LOCUS_09020 988194 990242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930034.1 protein_id gnl|my_center|LOCUS_09020 990326 991081 gene locus_tag LOCUS_09030 990326 991081 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049878191.1 protein_id gnl|my_center|LOCUS_09030 991144 991596 gene locus_tag LOCUS_09040 991144 991596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 991593 992468 gene locus_tag LOCUS_09050 991593 992468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 992506 993915 gene locus_tag LOCUS_09060 992506 993915 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731069.1 protein_id gnl|my_center|LOCUS_09060 993912 994457 gene locus_tag LOCUS_09070 993912 994457 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228370.1 protein_id gnl|my_center|LOCUS_09070 994640 995170 gene locus_tag LOCUS_09080 994640 995170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 995195 995680 gene locus_tag LOCUS_09090 995195 995680 CDS product lamin tail domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109036335.1 protein_id gnl|my_center|LOCUS_09090 997124 995775 gene locus_tag LOCUS_09100 gene gdhA 997124 995775 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856385.1 protein_id gnl|my_center|LOCUS_09100 997358 997182 gene locus_tag LOCUS_09110 997358 997182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 997655 1002730 gene locus_tag LOCUS_09120 997655 1002730 CDS product NAD-glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028707.1 protein_id gnl|my_center|LOCUS_09120 1003163 1002960 gene locus_tag LOCUS_09130 1003163 1002960 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804343.1 protein_id gnl|my_center|LOCUS_09130 1004313 1003489 gene locus_tag LOCUS_09140 1004313 1003489 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413589.1 protein_id gnl|my_center|LOCUS_09140 1004440 1005150 gene locus_tag LOCUS_09150 1004440 1005150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 1005361 1007133 gene locus_tag LOCUS_09160 1005361 1007133 CDS product oleate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262036.1 protein_id gnl|my_center|LOCUS_09160 1008093 1007242 gene locus_tag LOCUS_09170 1008093 1007242 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963142.1 protein_id gnl|my_center|LOCUS_09170 1008383 1008790 gene locus_tag LOCUS_09180 1008383 1008790 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861911.1 protein_id gnl|my_center|LOCUS_09180 1008855 1009526 gene locus_tag LOCUS_09190 1008855 1009526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 1010933 1009674 gene locus_tag LOCUS_09200 1010933 1009674 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224417.1 protein_id gnl|my_center|LOCUS_09200 1011964 1011005 gene locus_tag LOCUS_09210 1011964 1011005 CDS product exonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964056.1 protein_id gnl|my_center|LOCUS_09210 1013591 1012014 gene locus_tag LOCUS_09220 1013591 1012014 CDS product PTS ascorbate transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015583.1 protein_id gnl|my_center|LOCUS_09220 1014467 1013637 gene locus_tag LOCUS_09230 1014467 1013637 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015584.1 protein_id gnl|my_center|LOCUS_09230 1014632 1022806 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ccctcaacgaaggcctccccacgaaggggaggcgag 1023311 1023009 gene locus_tag LOCUS_09240 1023311 1023009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 1024924 1023308 gene locus_tag LOCUS_09250 gene cas1 1024924 1023308 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940735.1 protein_id gnl|my_center|LOCUS_09250 1026009 1024921 gene locus_tag LOCUS_09260 1026009 1024921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 1028942 1026006 gene locus_tag LOCUS_09270 gene cas3u 1028942 1026006 CDS product type I-U CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930412.1 protein_id gnl|my_center|LOCUS_09270 1030531 1028939 gene locus_tag LOCUS_09280 1030531 1028939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 1031759 1030536 gene locus_tag LOCUS_09290 1031759 1030536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 1032064 1033155 gene locus_tag LOCUS_09300 1032064 1033155 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035469.1 protein_id gnl|my_center|LOCUS_09300 1035157 1033265 gene locus_tag LOCUS_09310 1035157 1033265 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156232373.1 protein_id gnl|my_center|LOCUS_09310 1035320 1037164 gene locus_tag LOCUS_09320 1035320 1037164 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156230396.1 protein_id gnl|my_center|LOCUS_09320 1039266 1037296 gene locus_tag LOCUS_09330 1039266 1037296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 1040900 1039467 gene locus_tag LOCUS_09340 1040900 1039467 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141748518.1 protein_id gnl|my_center|LOCUS_09340 1041077 1042684 gene locus_tag LOCUS_09350 1041077 1042684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 1042663 1043394 gene locus_tag LOCUS_09360 1042663 1043394 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224884.1 protein_id gnl|my_center|LOCUS_09360 1043406 1044932 gene locus_tag LOCUS_09370 gene hpaE 1043406 1044932 CDS product 5-carboxymethyl-2-hydroxymuconate semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889479.1 protein_id gnl|my_center|LOCUS_09370 1045033 1046142 gene locus_tag LOCUS_09380 gene hpaD 1045033 1046142 CDS product 3,4-dihydroxyphenylacetate 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392282.1 protein_id gnl|my_center|LOCUS_09380 1046152 1046937 gene locus_tag LOCUS_09390 gene hpaH 1046152 1046937 CDS product 2-oxo-hepta-3-ene-1,7-dioic acid hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084058.1 protein_id gnl|my_center|LOCUS_09390 1046922 1047758 gene locus_tag LOCUS_09400 gene hpaI 1046922 1047758 CDS product 4-hydroxy-2-oxoheptanedioate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205448.1 protein_id gnl|my_center|LOCUS_09400 1048940 1047993 gene locus_tag LOCUS_09410 1048940 1047993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09410 1049174 1048959 gene locus_tag LOCUS_09420 1049174 1048959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 1049486 1051117 gene locus_tag LOCUS_09430 1049486 1051117 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727782.1 protein_id gnl|my_center|LOCUS_09430 1051866 1051129 gene locus_tag LOCUS_09440 1051866 1051129 CDS product TetR/AcrR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891760.1 protein_id gnl|my_center|LOCUS_09440 1052105 1053427 gene locus_tag LOCUS_09450 1052105 1053427 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005095203.1 protein_id gnl|my_center|LOCUS_09450 1053424 1054323 gene locus_tag LOCUS_09460 1053424 1054323 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727781.1 protein_id gnl|my_center|LOCUS_09460 1054399 1055742 gene locus_tag LOCUS_09470 gene gabT 1054399 1055742 CDS product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112244.1 protein_id gnl|my_center|LOCUS_09470 1055817 1057325 gene locus_tag LOCUS_09480 1055817 1057325 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228082.1 protein_id gnl|my_center|LOCUS_09480 1058528 1057347 gene locus_tag LOCUS_09490 1058528 1057347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 1059337 1058705 gene locus_tag LOCUS_09500 1059337 1058705 CDS product arsenic metallochaperone ArsD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804467.1 protein_id gnl|my_center|LOCUS_09500 1060228 1059353 gene locus_tag LOCUS_09510 gene hchA 1060228 1059353 CDS product protein deglycase HchA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076404.1 protein_id gnl|my_center|LOCUS_09510 1061867 1060368 gene locus_tag LOCUS_09520 1061867 1060368 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863416.1 protein_id gnl|my_center|LOCUS_09520 1062515 1062045 gene locus_tag LOCUS_09530 1062515 1062045 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225292.1 protein_id gnl|my_center|LOCUS_09530 1062618 1062857 gene locus_tag LOCUS_09540 1062618 1062857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 1063011 1064606 gene locus_tag LOCUS_09550 1063011 1064606 CDS product Na+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411714.1 protein_id gnl|my_center|LOCUS_09550 1065383 1064670 gene locus_tag LOCUS_09560 1065383 1064670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 1068721 1065380 gene locus_tag LOCUS_09570 gene lysX 1068721 1065380 CDS product bifunctional lysylphosphatidylglycerol synthetase/lysine--tRNA ligase LysX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223114.1 protein_id gnl|my_center|LOCUS_09570 1069977 1068805 gene locus_tag LOCUS_09580 1069977 1068805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 1069916 1070176 gene locus_tag LOCUS_09590 1069916 1070176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 1070449 1073439 gene locus_tag LOCUS_09600 1070449 1073439 CDS product DUF4040 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013521.1 protein_id gnl|my_center|LOCUS_09600 1073436 1073843 gene locus_tag LOCUS_09610 1073436 1073843 CDS product cation:proton antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013520.1 protein_id gnl|my_center|LOCUS_09610 1073840 1075429 gene locus_tag LOCUS_09620 1073840 1075429 CDS product monovalent cation/H+ antiporter subunit D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211271326.1 protein_id gnl|my_center|LOCUS_09620 1075426 1075821 gene locus_tag LOCUS_09630 1075426 1075821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 1075854 1076078 gene locus_tag LOCUS_09640 1075854 1076078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 1076075 1076419 gene locus_tag LOCUS_09650 1076075 1076419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 1076409 1076978 gene locus_tag LOCUS_09660 1076409 1076978 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223356.1 protein_id gnl|my_center|LOCUS_09660 1077046 1077489 gene locus_tag LOCUS_09670 1077046 1077489 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013947.1 protein_id gnl|my_center|LOCUS_09670 1078674 1079801 gene locus_tag LOCUS_09680 1078674 1079801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 1079798 1080523 gene locus_tag LOCUS_09690 1079798 1080523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09690 1080535 1081419 gene locus_tag LOCUS_09700 gene thiD 1080535 1081419 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228119.1 protein_id gnl|my_center|LOCUS_09700 1081568 1082272 gene locus_tag LOCUS_09710 gene tenA 1081568 1082272 CDS product thiaminase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877712.1 protein_id gnl|my_center|LOCUS_09710 1083426 1082389 gene locus_tag LOCUS_09720 gene mmuM 1083426 1082389 CDS product homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101343.1 protein_id gnl|my_center|LOCUS_09720 1083644 1085179 gene locus_tag LOCUS_09730 1083644 1085179 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101342.1 protein_id gnl|my_center|LOCUS_09730 1085537 1085202 gene locus_tag LOCUS_09740 1085537 1085202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 1086271 1085591 gene locus_tag LOCUS_09750 1086271 1085591 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284464.1 protein_id gnl|my_center|LOCUS_09750 1086466 1088160 gene locus_tag LOCUS_09760 1086466 1088160 CDS product AbgT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013391.1 protein_id gnl|my_center|LOCUS_09760 1088407 1088925 gene locus_tag LOCUS_09770 1088407 1088925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 1089052 1089681 gene locus_tag LOCUS_09780 1089052 1089681 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775980.1 protein_id gnl|my_center|LOCUS_09780 1090842 1089913 gene locus_tag LOCUS_09790 1090842 1089913 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804024.1 protein_id gnl|my_center|LOCUS_09790 1091167 1090850 gene locus_tag LOCUS_09800 1091167 1090850 CDS product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776253.1 protein_id gnl|my_center|LOCUS_09800 1091238 1091759 gene locus_tag LOCUS_09810 1091238 1091759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 1091796 1092743 gene locus_tag LOCUS_09820 1091796 1092743 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804290.1 protein_id gnl|my_center|LOCUS_09820 1094456 1093020 gene locus_tag LOCUS_09830 1094456 1093020 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112837.1 protein_id gnl|my_center|LOCUS_09830 1095259 1094591 gene locus_tag LOCUS_09840 1095259 1094591 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005062703.1 protein_id gnl|my_center|LOCUS_09840 1096412 1095492 gene locus_tag LOCUS_09850 1096412 1095492 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811702.1 protein_id gnl|my_center|LOCUS_09850 1096835 1097005 gene locus_tag LOCUS_09860 1096835 1097005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 1098295 1096988 gene locus_tag LOCUS_09870 1098295 1096988 CDS product ISL3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068319765.1 protein_id gnl|my_center|LOCUS_09870 1098413 1098613 gene locus_tag LOCUS_09880 1098413 1098613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 1100714 1098645 gene locus_tag LOCUS_09890 1100714 1098645 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173514554.1 protein_id gnl|my_center|LOCUS_09890 1101355 1101050 gene locus_tag LOCUS_09900 1101355 1101050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 1103009 1101531 gene locus_tag LOCUS_09910 1103009 1101531 CDS product multicopper oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859486.1 protein_id gnl|my_center|LOCUS_09910 1104184 1103045 gene locus_tag LOCUS_09920 1104184 1103045 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015529.1 protein_id gnl|my_center|LOCUS_09920 1104879 1104184 gene locus_tag LOCUS_09930 1104879 1104184 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111761.1 protein_id gnl|my_center|LOCUS_09930 1105555 1104911 gene locus_tag LOCUS_09940 1105555 1104911 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389386.1 protein_id gnl|my_center|LOCUS_09940 1105706 1107097 gene locus_tag LOCUS_09950 1105706 1107097 CDS product IS1380 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_110107303.1 protein_id gnl|my_center|LOCUS_09950 1109060 1107369 gene locus_tag LOCUS_09960 1109060 1107369 CDS product 5-guanidino-2-oxopentanoate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112428.1 protein_id gnl|my_center|LOCUS_09960 1109304 1110965 gene locus_tag LOCUS_09970 1109304 1110965 CDS product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899273.1 protein_id gnl|my_center|LOCUS_09970 1112084 1111080 gene locus_tag LOCUS_09980 1112084 1111080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09980 1112642 1112106 gene locus_tag LOCUS_09990 1112642 1112106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09990 1113278 1112712 gene locus_tag LOCUS_10000 1113278 1112712 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479655.1 protein_id gnl|my_center|LOCUS_10000 1113500 1114504 gene locus_tag LOCUS_10010 1113500 1114504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 1115400 1114624 gene locus_tag LOCUS_10020 1115400 1114624 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263776.1 protein_id gnl|my_center|LOCUS_10020 1115500 1116252 gene locus_tag LOCUS_10030 1115500 1116252 CDS product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054285.1 protein_id gnl|my_center|LOCUS_10030 1116595 1117797 gene locus_tag LOCUS_10040 gene speB 1116595 1117797 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895813.1 protein_id gnl|my_center|LOCUS_10040 1117799 1119100 gene locus_tag LOCUS_10050 1117799 1119100 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231061.1 protein_id gnl|my_center|LOCUS_10050 1120412 1119159 gene locus_tag LOCUS_10060 1120412 1119159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 1120640 1121248 gene locus_tag LOCUS_10070 1120640 1121248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 1122490 1121294 gene locus_tag LOCUS_10080 1122490 1121294 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775996.1 protein_id gnl|my_center|LOCUS_10080 1122581 1123600 gene locus_tag LOCUS_10090 1122581 1123600 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804288.1 protein_id gnl|my_center|LOCUS_10090 1126544 1123749 gene locus_tag LOCUS_10100 1126544 1123749 CDS product multicopper oxidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_218916596.1 protein_id gnl|my_center|LOCUS_10100 1126784 1127326 gene locus_tag LOCUS_10110 1126784 1127326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 1127344 1128663 gene locus_tag LOCUS_10120 1127344 1128663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 1128801 1129994 gene locus_tag LOCUS_10130 1128801 1129994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 1130148 1131089 gene locus_tag LOCUS_10140 1130148 1131089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420405.1 protein_id gnl|my_center|LOCUS_10140 1131965 1131168 gene locus_tag LOCUS_10150 1131965 1131168 CDS product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731005.1 protein_id gnl|my_center|LOCUS_10150 1134040 1131962 gene locus_tag LOCUS_10160 1134040 1131962 CDS product M13 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726765.1 protein_id gnl|my_center|LOCUS_10160 1134179 1135600 gene locus_tag LOCUS_10170 1134179 1135600 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804380.1 protein_id gnl|my_center|LOCUS_10170 1135699 1136727 gene locus_tag LOCUS_10180 1135699 1136727 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004115580.1 protein_id gnl|my_center|LOCUS_10180 1136825 1136898 gene locus_tag LOCUS_t00200 1136825 1136898 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 1136975 1137049 gene locus_tag LOCUS_t00210 1136975 1137049 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 1137124 1137198 gene locus_tag LOCUS_t00220 1137124 1137198 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 1137271 1138113 gene locus_tag LOCUS_10190 1137271 1138113 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254611.1 protein_id gnl|my_center|LOCUS_10190 1139085 1138258 gene locus_tag LOCUS_10200 1139085 1138258 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402176.1 protein_id gnl|my_center|LOCUS_10200 1139328 1140620 gene locus_tag LOCUS_10210 1139328 1140620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 1140799 1142460 gene locus_tag LOCUS_10220 gene pelF 1140799 1142460 CDS product GT4 family glycosyltransferase PelF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016350.1 protein_id gnl|my_center|LOCUS_10220 1142457 1143650 gene locus_tag LOCUS_10230 1142457 1143650 CDS product putative glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229158.1 protein_id gnl|my_center|LOCUS_10230 1143739 1144698 gene locus_tag LOCUS_10240 1143739 1144698 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085733.1 protein_id gnl|my_center|LOCUS_10240 1144759 1145883 gene locus_tag LOCUS_10250 1144759 1145883 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908874.1 protein_id gnl|my_center|LOCUS_10250 1145965 1146777 gene locus_tag LOCUS_10260 1145965 1146777 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730436.1 protein_id gnl|my_center|LOCUS_10260 1147115 1147351 gene locus_tag LOCUS_10270 1147115 1147351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 1147742 1148137 gene locus_tag LOCUS_10280 1147742 1148137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 1148369 1150117 gene locus_tag LOCUS_10290 1148369 1150117 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053142070.1 protein_id gnl|my_center|LOCUS_10290 1151267 1150188 gene locus_tag LOCUS_10300 1151267 1150188 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168715519.1 protein_id gnl|my_center|LOCUS_10300 1153051 1151264 gene locus_tag LOCUS_10310 1153051 1151264 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226824.1 protein_id gnl|my_center|LOCUS_10310 1153677 1153048 gene locus_tag LOCUS_10320 1153677 1153048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 1154551 1153721 gene locus_tag LOCUS_10330 gene nadE 1154551 1153721 CDS product ammonia-dependent NAD(+) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246440.1 protein_id gnl|my_center|LOCUS_10330 1154874 1156070 gene locus_tag LOCUS_10340 1154874 1156070 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776991.1 protein_id gnl|my_center|LOCUS_10340 1157669 1156113 gene locus_tag LOCUS_10350 1157669 1156113 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285120.1 protein_id gnl|my_center|LOCUS_10350 1157891 1159297 gene locus_tag LOCUS_10360 1157891 1159297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 1159437 1161104 gene locus_tag LOCUS_10370 1159437 1161104 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000427574.1 protein_id gnl|my_center|LOCUS_10370 1162187 1161162 gene locus_tag LOCUS_10380 1162187 1161162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 1162387 1163652 gene locus_tag LOCUS_10390 1162387 1163652 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200855.1 protein_id gnl|my_center|LOCUS_10390 1163663 1164250 gene locus_tag LOCUS_10400 gene pyrE 1163663 1164250 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029143.1 protein_id gnl|my_center|LOCUS_10400 1164255 1165007 gene locus_tag LOCUS_10410 1164255 1165007 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085726.1 protein_id gnl|my_center|LOCUS_10410 1165322 1165495 gene locus_tag LOCUS_10420 1165322 1165495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 1165623 1166315 gene locus_tag LOCUS_10430 1165623 1166315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 1166602 1166351 gene locus_tag LOCUS_10440 1166602 1166351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 1166589 1167614 gene locus_tag LOCUS_10450 gene fbaA 1166589 1167614 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230818.1 protein_id gnl|my_center|LOCUS_10450 1167741 1168160 gene locus_tag LOCUS_10460 1167741 1168160 CDS product DUF3151 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975291.1 protein_id gnl|my_center|LOCUS_10460 1168311 1169402 gene locus_tag LOCUS_10470 gene ald 1168311 1169402 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479806.1 protein_id gnl|my_center|LOCUS_10470 1169881 1169465 gene locus_tag LOCUS_10480 1169881 1169465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 1170102 1173968 gene locus_tag LOCUS_10490 1170102 1173968 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466704.1 protein_id gnl|my_center|LOCUS_10490 1175270 1174131 gene locus_tag LOCUS_10500 1175270 1174131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 1175370 1176659 gene locus_tag LOCUS_10510 1175370 1176659 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804520.1 protein_id gnl|my_center|LOCUS_10510 1176668 1177651 gene locus_tag LOCUS_10520 gene corA 1176668 1177651 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950508.1 protein_id gnl|my_center|LOCUS_10520 1178700 1177681 gene locus_tag LOCUS_10530 1178700 1177681 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537420.1 protein_id gnl|my_center|LOCUS_10530 1179692 1178697 gene locus_tag LOCUS_10540 1179692 1178697 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537421.1 protein_id gnl|my_center|LOCUS_10540 1179826 1180854 gene locus_tag LOCUS_10550 1179826 1180854 CDS product iron-siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383252.1 protein_id gnl|my_center|LOCUS_10550 1182072 1180948 gene locus_tag LOCUS_10560 1182072 1180948 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093457344.1 protein_id gnl|my_center|LOCUS_10560 1182245 1183432 gene locus_tag LOCUS_10570 1182245 1183432 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030221.1 protein_id gnl|my_center|LOCUS_10570 1184252 1183440 gene locus_tag LOCUS_10580 1184252 1183440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804018.1 protein_id gnl|my_center|LOCUS_10580 1186165 1184444 gene locus_tag LOCUS_10590 1186165 1184444 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775796.1 protein_id gnl|my_center|LOCUS_10590 1188391 1186295 gene locus_tag LOCUS_10600 1188391 1186295 CDS product PTS glucose transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643705.1 protein_id gnl|my_center|LOCUS_10600 1189829 1188630 gene locus_tag LOCUS_10610 1189829 1188630 CDS product cobalamin-independent methionine synthase II family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856473.1 protein_id gnl|my_center|LOCUS_10610 1190049 1191581 gene locus_tag LOCUS_10620 1190049 1191581 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313426.1 protein_id gnl|my_center|LOCUS_10620 1191630 1193321 gene locus_tag LOCUS_10630 1191630 1193321 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313426.1 protein_id gnl|my_center|LOCUS_10630 1193450 1195291 gene locus_tag LOCUS_10640 gene ilvD 1193450 1195291 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775910.1 protein_id gnl|my_center|LOCUS_10640 1196328 1195525 gene locus_tag LOCUS_10650 gene bioD 1196328 1195525 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728882.1 protein_id gnl|my_center|LOCUS_10650 1197749 1196325 gene locus_tag LOCUS_10660 1197749 1196325 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027665.1 protein_id gnl|my_center|LOCUS_10660 1199041 1197746 gene locus_tag LOCUS_10670 gene bioB 1199041 1197746 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027664.1 protein_id gnl|my_center|LOCUS_10670 1199212 1200753 gene locus_tag LOCUS_10680 1199212 1200753 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313426.1 protein_id gnl|my_center|LOCUS_10680 1201195 1201491 gene locus_tag LOCUS_10690 1201195 1201491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10690 1201558 1202790 gene locus_tag LOCUS_10700 1201558 1202790 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313426.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10700 1202943 1204499 gene locus_tag LOCUS_10710 1202943 1204499 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313426.1 protein_id gnl|my_center|LOCUS_10710 1204513 1205346 gene locus_tag LOCUS_10720 1204513 1205346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 1205651 1206718 gene locus_tag LOCUS_10730 1205651 1206718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 1206777 1208000 gene locus_tag LOCUS_10740 1206777 1208000 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098426.1 protein_id gnl|my_center|LOCUS_10740 1208138 1209520 gene locus_tag LOCUS_10750 1208138 1209520 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920905.1 protein_id gnl|my_center|LOCUS_10750 1209531 1210571 gene locus_tag LOCUS_10760 1209531 1210571 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878198.1 protein_id gnl|my_center|LOCUS_10760 1210704 1211531 gene locus_tag LOCUS_10770 1210704 1211531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 1211583 1212224 gene locus_tag LOCUS_10780 1211583 1212224 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728695.1 protein_id gnl|my_center|LOCUS_10780 1212217 1213566 gene locus_tag LOCUS_10790 1212217 1213566 CDS product betaine/proline/choline family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110021.1 protein_id gnl|my_center|LOCUS_10790 1213563 1214321 gene locus_tag LOCUS_10800 1213563 1214321 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975878.1 protein_id gnl|my_center|LOCUS_10800 1214326 1215357 gene locus_tag LOCUS_10810 1214326 1215357 CDS product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728692.1 protein_id gnl|my_center|LOCUS_10810 1215390 1216358 gene locus_tag LOCUS_10820 1215390 1216358 CDS product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728692.1 protein_id gnl|my_center|LOCUS_10820 1217029 1216445 gene locus_tag LOCUS_10830 1217029 1216445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 1217478 1217029 gene locus_tag LOCUS_10840 1217478 1217029 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028460.1 protein_id gnl|my_center|LOCUS_10840 1218227 1217490 gene locus_tag LOCUS_10850 1218227 1217490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 1222041 1218214 gene locus_tag LOCUS_10860 1222041 1218214 CDS product TM0106 family RecB-like putative nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730276.1 protein_id gnl|my_center|LOCUS_10860 1222281 1223585 gene locus_tag LOCUS_10870 1222281 1223585 CDS product RbtT/DalT/CsbX family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706071.1 protein_id gnl|my_center|LOCUS_10870 1223619 1224674 gene locus_tag LOCUS_10880 1223619 1224674 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805179.1 protein_id gnl|my_center|LOCUS_10880 1224661 1225539 gene locus_tag LOCUS_10890 1224661 1225539 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432420.1 protein_id gnl|my_center|LOCUS_10890 1225893 1226966 gene locus_tag LOCUS_10900 1225893 1226966 CDS product 2,3-butanediol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980817.1 protein_id gnl|my_center|LOCUS_10900 1227378 1226968 gene locus_tag LOCUS_10910 1227378 1226968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 1227456 1227584 gene locus_tag LOCUS_10920 1227456 1227584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 1227585 1228061 gene locus_tag LOCUS_10930 1227585 1228061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10930 1229602 1228097 gene locus_tag LOCUS_10940 gene tctA 1229602 1228097 CDS product tripartite tricarboxylate transporter permease TctA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015409.1 protein_id gnl|my_center|LOCUS_10940 1230105 1229602 gene locus_tag LOCUS_10950 gene tctB 1230105 1229602 CDS product tripartite tricarboxylate transporter TctB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015410.1 protein_id gnl|my_center|LOCUS_10950 1231298 1230180 gene locus_tag LOCUS_10960 gene tctC 1231298 1230180 CDS product tripartite tricarboxylate transporter substrate binding protein TctC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015411.1 protein_id gnl|my_center|LOCUS_10960 1231446 1231808 gene locus_tag LOCUS_10970 1231446 1231808 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777009.1 protein_id gnl|my_center|LOCUS_10970 1231839 1232315 gene locus_tag LOCUS_10980 1231839 1232315 CDS product hotdog domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404521.1 protein_id gnl|my_center|LOCUS_10980 1232377 1233711 gene locus_tag LOCUS_10990 1232377 1233711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 1233859 1235247 gene locus_tag LOCUS_11000 gene proP 1233859 1235247 CDS product glycine betaine/L-proline transporter ProP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028291.1 protein_id gnl|my_center|LOCUS_11000 1235390 1236913 gene locus_tag LOCUS_11010 1235390 1236913 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804270.1 protein_id gnl|my_center|LOCUS_11010 1237085 1238488 gene locus_tag LOCUS_11020 gene brnQ 1237085 1238488 CDS product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015030.1 protein_id gnl|my_center|LOCUS_11020 1238520 1239998 gene locus_tag LOCUS_11030 1238520 1239998 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009939950.1 protein_id gnl|my_center|LOCUS_11030 1240009 1240533 gene locus_tag LOCUS_11040 1240009 1240533 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776976.1 protein_id gnl|my_center|LOCUS_11040 1241142 1240630 gene locus_tag LOCUS_11050 1241142 1240630 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731048.1 protein_id gnl|my_center|LOCUS_11050 1241280 1242722 gene locus_tag LOCUS_11060 gene dacB 1241280 1242722 CDS product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104179.1 protein_id gnl|my_center|LOCUS_11060 1242800 1244218 gene locus_tag LOCUS_11070 gene zwf 1242800 1244218 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037287.1 protein_id gnl|my_center|LOCUS_11070 1244222 1245553 gene locus_tag LOCUS_11080 1244222 1245553 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975426.1 protein_id gnl|my_center|LOCUS_11080 1245553 1246896 gene locus_tag LOCUS_11090 gene tilS 1245553 1246896 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975427.1 protein_id gnl|my_center|LOCUS_11090 1246952 1247503 gene locus_tag LOCUS_11100 gene hpt 1246952 1247503 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007452004.1 protein_id gnl|my_center|LOCUS_11100 1247652 1249856 gene locus_tag LOCUS_11110 gene ftsH 1247652 1249856 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804894.1 protein_id gnl|my_center|LOCUS_11110 1249856 1250431 gene locus_tag LOCUS_11120 gene folE 1249856 1250431 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975430.1 protein_id gnl|my_center|LOCUS_11120 1250428 1251360 gene locus_tag LOCUS_11130 gene folP 1250428 1251360 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975435.1 protein_id gnl|my_center|LOCUS_11130 1251439 1251852 gene locus_tag LOCUS_11140 1251439 1251852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11140 1251849 1252349 gene locus_tag LOCUS_11150 1251849 1252349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11150 1252356 1252901 gene locus_tag LOCUS_11160 1252356 1252901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 1252957 1253424 gene locus_tag LOCUS_11170 1252957 1253424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 1253421 1255169 gene locus_tag LOCUS_11180 1253421 1255169 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804900.1 protein_id gnl|my_center|LOCUS_11180 1255166 1256107 gene locus_tag LOCUS_11190 1255166 1256107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11190 1256215 1257168 gene locus_tag LOCUS_11200 gene panC 1256215 1257168 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013399.1 protein_id gnl|my_center|LOCUS_11200 1257222 1258766 gene locus_tag LOCUS_11210 gene lysS 1257222 1258766 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230454.1 protein_id gnl|my_center|LOCUS_11210 1258770 1258991 gene locus_tag LOCUS_11220 1258770 1258991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 1259162 1259512 gene locus_tag LOCUS_11230 1259162 1259512 CDS product Lsr2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975458.1 protein_id gnl|my_center|LOCUS_11230 1259703 1262333 gene locus_tag LOCUS_11240 1259703 1262333 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975461.1 protein_id gnl|my_center|LOCUS_11240 1262475 1263497 gene locus_tag LOCUS_11250 1262475 1263497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 1263494 1264330 gene locus_tag LOCUS_11260 1263494 1264330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 1264320 1264829 gene locus_tag LOCUS_11270 1264320 1264829 CDS product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804919.1 protein_id gnl|my_center|LOCUS_11270 1265847 1264870 gene locus_tag LOCUS_11280 1265847 1264870 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975480.1 protein_id gnl|my_center|LOCUS_11280 1265969 1266769 gene locus_tag LOCUS_11290 1265969 1266769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 1267969 1266899 gene locus_tag LOCUS_11300 gene disA 1267969 1266899 CDS product DNA integrity scanning diadenylate cyclase DisA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975482.1 protein_id gnl|my_center|LOCUS_11300 1269495 1268092 gene locus_tag LOCUS_11310 gene radA 1269495 1268092 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028928.1 protein_id gnl|my_center|LOCUS_11310 1270876 1269653 gene locus_tag LOCUS_11320 1270876 1269653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 1271084 1272187 gene locus_tag LOCUS_11330 gene pstS 1271084 1272187 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051436.1 protein_id gnl|my_center|LOCUS_11330 1272184 1273101 gene locus_tag LOCUS_11340 gene pstC 1272184 1273101 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068423.1 protein_id gnl|my_center|LOCUS_11340 1273098 1274231 gene locus_tag LOCUS_11350 gene pstA 1273098 1274231 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776545.1 protein_id gnl|my_center|LOCUS_11350 1274269 1275048 gene locus_tag LOCUS_11360 gene pstB 1274269 1275048 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776544.1 protein_id gnl|my_center|LOCUS_11360 1276089 1275076 gene locus_tag LOCUS_11370 gene pitH 1276089 1275076 CDS product low-affinity phosphate transporter PitH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029459.1 protein_id gnl|my_center|LOCUS_11370 1276710 1276093 gene locus_tag LOCUS_11380 1276710 1276093 CDS product DUF47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974832.1 protein_id gnl|my_center|LOCUS_11380 1277610 1276981 gene locus_tag LOCUS_11390 1277610 1276981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 1278521 1277721 gene locus_tag LOCUS_11400 1278521 1277721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 1279550 1278633 gene locus_tag LOCUS_11410 1279550 1278633 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776004.1 protein_id gnl|my_center|LOCUS_11410 1281049 1279667 gene locus_tag LOCUS_11420 1281049 1279667 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889602.1 protein_id gnl|my_center|LOCUS_11420 1281384 1284953 gene locus_tag LOCUS_11430 1281384 1284953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 1285548 1284961 gene locus_tag LOCUS_11440 1285548 1284961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 1285616 1286872 gene locus_tag LOCUS_11450 1285616 1286872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484522.1 protein_id gnl|my_center|LOCUS_11450 1288371 1286989 gene locus_tag LOCUS_11460 1288371 1286989 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889602.1 protein_id gnl|my_center|LOCUS_11460 1288836 1288498 gene locus_tag LOCUS_11470 1288836 1288498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 1290262 1288907 gene locus_tag LOCUS_11480 1290262 1288907 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082954.1 protein_id gnl|my_center|LOCUS_11480 1290407 1291759 gene locus_tag LOCUS_11490 1290407 1291759 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036689.1 protein_id gnl|my_center|LOCUS_11490 1291871 1291722 gene locus_tag LOCUS_11500 1291871 1291722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 1295343 1294255 gene locus_tag LOCUS_11510 1295343 1294255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 1295569 1295348 gene locus_tag LOCUS_11520 1295569 1295348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 1295599 1297821 gene locus_tag LOCUS_11530 1295599 1297821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 1297818 1298858 gene locus_tag LOCUS_11540 1297818 1298858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119847.1 protein_id gnl|my_center|LOCUS_11540 1298855 1299718 gene locus_tag LOCUS_11550 1298855 1299718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 1299828 1301102 gene locus_tag LOCUS_11560 1299828 1301102 CDS product ThiF family adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803828.1 protein_id gnl|my_center|LOCUS_11560 1301797 1301168 gene locus_tag LOCUS_11570 1301797 1301168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227179.1 protein_id gnl|my_center|LOCUS_11570 1302636 1301932 gene locus_tag LOCUS_11580 1302636 1301932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 1305035 1302798 gene locus_tag LOCUS_11590 1305035 1302798 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777103.1 protein_id gnl|my_center|LOCUS_11590 1305631 1305032 gene locus_tag LOCUS_11600 1305631 1305032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 1306110 1306709 gene locus_tag LOCUS_11610 1306110 1306709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11610 1306706 1307575 gene locus_tag LOCUS_11620 1306706 1307575 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244040.1 protein_id gnl|my_center|LOCUS_11620 1307755 1308426 gene locus_tag LOCUS_11630 1307755 1308426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 1309234 1308515 gene locus_tag LOCUS_11640 1309234 1308515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 1309376 1309450 gene locus_tag LOCUS_t00230 1309376 1309450 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 1310279 1309635 gene locus_tag LOCUS_11650 1310279 1309635 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729729.1 protein_id gnl|my_center|LOCUS_11650 1310773 1310276 gene locus_tag LOCUS_11660 1310773 1310276 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729728.1 protein_id gnl|my_center|LOCUS_11660 1311667 1311134 gene locus_tag LOCUS_11670 1311667 1311134 CDS product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804208.1 protein_id gnl|my_center|LOCUS_11670 1311895 1313028 gene locus_tag LOCUS_11680 1311895 1313028 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401058.1 protein_id gnl|my_center|LOCUS_11680 1313490 1313077 gene locus_tag LOCUS_11690 1313490 1313077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 1314305 1313487 gene locus_tag LOCUS_11700 1314305 1313487 CDS product N-acyl homoserine lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_222607811.1 protein_id gnl|my_center|LOCUS_11700 1318417 1314425 gene locus_tag LOCUS_11710 1318417 1314425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 1318571 1319716 gene locus_tag LOCUS_11720 1318571 1319716 CDS product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618818.1 protein_id gnl|my_center|LOCUS_11720 1319701 1322016 gene locus_tag LOCUS_11730 1319701 1322016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 1322103 1322642 gene locus_tag LOCUS_11740 1322103 1322642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 1322639 1324864 gene locus_tag LOCUS_11750 1322639 1324864 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013775.1 protein_id gnl|my_center|LOCUS_11750 1325403 1324900 gene locus_tag LOCUS_11760 1325403 1324900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 1326851 1325400 gene locus_tag LOCUS_11770 gene tgt 1326851 1325400 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776643.1 protein_id gnl|my_center|LOCUS_11770 1327020 1327742 gene locus_tag LOCUS_11780 1327020 1327742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 1327739 1328458 gene locus_tag LOCUS_11790 1327739 1328458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 1329083 1328538 gene locus_tag LOCUS_11800 1329083 1328538 CDS product NUDIX hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870383.1 protein_id gnl|my_center|LOCUS_11800 1330603 1329251 gene locus_tag LOCUS_11810 1330603 1329251 CDS product glycoside hydrolase family 76 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230849.1 protein_id gnl|my_center|LOCUS_11810 1331601 1330615 gene locus_tag LOCUS_11820 1331601 1330615 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977201.1 protein_id gnl|my_center|LOCUS_11820 1332668 1331601 gene locus_tag LOCUS_11830 1332668 1331601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 1332920 1336084 gene locus_tag LOCUS_11840 1332920 1336084 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189742338.1 protein_id gnl|my_center|LOCUS_11840 1341711 1336207 gene locus_tag LOCUS_11850 1341711 1336207 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109508967.1 protein_id gnl|my_center|LOCUS_11850 1341872 1342474 gene locus_tag LOCUS_11860 1341872 1342474 CDS product malonic semialdehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227150.1 protein_id gnl|my_center|LOCUS_11860 1343307 1342522 gene locus_tag LOCUS_11870 1343307 1342522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 1343653 1343333 gene locus_tag LOCUS_11880 1343653 1343333 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775686.1 protein_id gnl|my_center|LOCUS_11880 1343942 1345174 gene locus_tag LOCUS_11890 1343942 1345174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 1345403 1345328 gene locus_tag LOCUS_t00240 1345403 1345328 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1345855 1347711 gene locus_tag LOCUS_11900 1345855 1347711 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726783.1 protein_id gnl|my_center|LOCUS_11900 1347858 1348319 gene locus_tag LOCUS_11910 1347858 1348319 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727612.1 protein_id gnl|my_center|LOCUS_11910 1348658 1349860 gene locus_tag LOCUS_11920 1348658 1349860 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971715.1 protein_id gnl|my_center|LOCUS_11920 1351470 1350058 gene locus_tag LOCUS_11930 1351470 1350058 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028721.1 protein_id gnl|my_center|LOCUS_11930 1351577 1352773 gene locus_tag LOCUS_11940 gene manA 1351577 1352773 CDS product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877219.1 protein_id gnl|my_center|LOCUS_11940 1352766 1354112 gene locus_tag LOCUS_11950 1352766 1354112 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225761.1 protein_id gnl|my_center|LOCUS_11950 1354109 1354378 gene locus_tag LOCUS_11960 1354109 1354378 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856097.1 protein_id gnl|my_center|LOCUS_11960 1354388 1355749 gene locus_tag LOCUS_11970 1354388 1355749 CDS product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989505.1 protein_id gnl|my_center|LOCUS_11970 1356980 1355832 gene locus_tag LOCUS_11980 1356980 1355832 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776597.1 protein_id gnl|my_center|LOCUS_11980 1357699 1356977 gene locus_tag LOCUS_11990 1357699 1356977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 1357787 1358104 gene locus_tag LOCUS_12000 1357787 1358104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 1358187 1358927 gene locus_tag LOCUS_12010 1358187 1358927 CDS product phosphoglyceromutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222392.1 protein_id gnl|my_center|LOCUS_12010 1359736 1359074 gene locus_tag LOCUS_12020 gene phoU 1359736 1359074 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974747.1 protein_id gnl|my_center|LOCUS_12020 1359974 1361293 gene locus_tag LOCUS_12030 1359974 1361293 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974746.1 protein_id gnl|my_center|LOCUS_12030 1361290 1361970 gene locus_tag LOCUS_12040 1361290 1361970 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005062021.1 protein_id gnl|my_center|LOCUS_12040 1362609 1362088 gene locus_tag LOCUS_12050 1362609 1362088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 1362869 1363390 gene locus_tag LOCUS_12060 1362869 1363390 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804554.1 protein_id gnl|my_center|LOCUS_12060 1363531 1364952 gene locus_tag LOCUS_12070 gene cysS 1363531 1364952 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868385.1 protein_id gnl|my_center|LOCUS_12070 1365047 1366033 gene locus_tag LOCUS_12080 gene rlmB 1365047 1366033 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230407.1 protein_id gnl|my_center|LOCUS_12080 1366564 1368091 gene locus_tag LOCUS_r00050 1366564 1368091 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 1368518 1371603 gene locus_tag LOCUS_r00060 1368518 1371603 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 1371785 1371895 gene locus_tag LOCUS_r00070 1371785 1371895 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 1374699 1372243 gene locus_tag LOCUS_12090 1374699 1372243 CDS product bifunctional alpha,alpha-trehalose-phosphate synthase (UDP-forming)/trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775961.1 protein_id gnl|my_center|LOCUS_12090 1374849 1375730 gene locus_tag LOCUS_12100 1374849 1375730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 1375845 1375920 gene locus_tag LOCUS_t00250 1375845 1375920 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1376049 1376669 gene locus_tag LOCUS_12110 1376049 1376669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 1376852 1377643 gene locus_tag LOCUS_12120 1376852 1377643 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014761.1 protein_id gnl|my_center|LOCUS_12120 1377640 1378602 gene locus_tag LOCUS_12130 1377640 1378602 CDS product hexose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891418.1 protein_id gnl|my_center|LOCUS_12130 1378679 1381285 gene locus_tag LOCUS_12140 1378679 1381285 CDS product fructose-specific PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014766.1 protein_id gnl|my_center|LOCUS_12140 1379052 1378972 gene locus_tag LOCUS_t00260 1379052 1378972 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1381357 1383054 gene locus_tag LOCUS_12150 gene ptsP 1381357 1383054 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804335.1 protein_id gnl|my_center|LOCUS_12150 1383133 1383411 gene locus_tag LOCUS_12160 1383133 1383411 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804336.1 protein_id gnl|my_center|LOCUS_12160 1383605 1384738 gene locus_tag LOCUS_12170 1383605 1384738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 1384811 1386910 gene locus_tag LOCUS_12180 1384811 1386910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 1387655 1386972 gene locus_tag LOCUS_12190 1387655 1386972 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056911.1 protein_id gnl|my_center|LOCUS_12190 1387752 1387982 gene locus_tag LOCUS_12200 1387752 1387982 CDS product DUF3263 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486412.1 protein_id gnl|my_center|LOCUS_12200 1388039 1388623 gene locus_tag LOCUS_12210 1388039 1388623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 1388966 1390603 gene locus_tag LOCUS_12220 gene groL 1388966 1390603 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892307.1 protein_id gnl|my_center|LOCUS_12220 1390722 1391867 gene locus_tag LOCUS_12230 gene rlmC 1390722 1391867 CDS product 23S rRNA (uracil(747)-C(5))-methyltransferase RlmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208756.1 protein_id gnl|my_center|LOCUS_12230 1391947 1392672 gene locus_tag LOCUS_12240 1391947 1392672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 1392669 1393430 gene locus_tag LOCUS_12250 gene dhbA 1392669 1393430 CDS product 2,3-dihydro-2,3-dihydroxybenzoate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001048437.1 protein_id gnl|my_center|LOCUS_12250 1393481 1394620 gene locus_tag LOCUS_12260 gene amoC 1393481 1394620 CDS product amonabactin biosynthesis isochorismate synthase AmoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706310.1 protein_id gnl|my_center|LOCUS_12260 1394642 1395730 gene locus_tag LOCUS_12270 1394642 1395730 CDS product ribonuclease HI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804415.1 protein_id gnl|my_center|LOCUS_12270 1396147 1395857 gene locus_tag LOCUS_12280 1396147 1395857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 1397801 1396302 gene locus_tag LOCUS_12290 1397801 1396302 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804419.1 protein_id gnl|my_center|LOCUS_12290 1398515 1397808 gene locus_tag LOCUS_12300 1398515 1397808 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804420.1 protein_id gnl|my_center|LOCUS_12300 1398876 1398604 gene locus_tag LOCUS_12310 1398876 1398604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 1399158 1399538 gene locus_tag LOCUS_12320 1399158 1399538 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053193.1 protein_id gnl|my_center|LOCUS_12320 1399535 1400155 gene locus_tag LOCUS_12330 1399535 1400155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 1400257 1401555 gene locus_tag LOCUS_12340 1400257 1401555 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113311.1 protein_id gnl|my_center|LOCUS_12340 1402704 1401580 gene locus_tag LOCUS_12350 gene serC 1402704 1401580 CDS product phosphoserine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174401615.1 protein_id gnl|my_center|LOCUS_12350 1402923 1403618 gene locus_tag LOCUS_12360 1402923 1403618 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974588.1 protein_id gnl|my_center|LOCUS_12360 1403629 1404252 gene locus_tag LOCUS_12370 1403629 1404252 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775779.1 protein_id gnl|my_center|LOCUS_12370 1404858 1405439 gene locus_tag LOCUS_12380 1404858 1405439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 1405640 1406569 gene locus_tag LOCUS_12390 1405640 1406569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 1406782 1407000 gene locus_tag LOCUS_12400 1406782 1407000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 1407920 1406979 gene locus_tag LOCUS_12410 1407920 1406979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 1407995 1408068 gene locus_tag LOCUS_t00270 1407995 1408068 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1408156 1409709 gene locus_tag LOCUS_12420 1408156 1409709 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775824.1 protein_id gnl|my_center|LOCUS_12420 1410318 1409725 gene locus_tag LOCUS_12430 1410318 1409725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 1410731 1413256 gene locus_tag LOCUS_12440 gene pcrA 1410731 1413256 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029870.1 protein_id gnl|my_center|LOCUS_12440 1413637 1414803 gene locus_tag LOCUS_12450 gene sucC 1413637 1414803 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804537.1 protein_id gnl|my_center|LOCUS_12450 1414843 1415760 gene locus_tag LOCUS_12460 gene sucD 1414843 1415760 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896926.1 protein_id gnl|my_center|LOCUS_12460 1416232 1415999 gene locus_tag LOCUS_12470 1416232 1415999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 1416739 1416344 gene locus_tag LOCUS_12480 1416739 1416344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 1418125 1416917 gene locus_tag LOCUS_12490 1418125 1416917 CDS product VIT1/CCC1 transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015009.1 protein_id gnl|my_center|LOCUS_12490 1419666 1418425 gene locus_tag LOCUS_12500 1419666 1418425 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726670.1 protein_id gnl|my_center|LOCUS_12500 1421104 1419671 gene locus_tag LOCUS_12510 1421104 1419671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 1422067 1421234 gene locus_tag LOCUS_12520 1422067 1421234 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803740.1 protein_id gnl|my_center|LOCUS_12520 1422181 1423593 gene locus_tag LOCUS_12530 1422181 1423593 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730701.1 protein_id gnl|my_center|LOCUS_12530 1425303 1423711 gene locus_tag LOCUS_12540 1425303 1423711 CDS product GMC family oxidoreductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776259.1 protein_id gnl|my_center|LOCUS_12540 1426963 1425428 gene locus_tag LOCUS_12550 1426963 1425428 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208292971.1 protein_id gnl|my_center|LOCUS_12550 1429246 1426976 gene locus_tag LOCUS_12560 gene betT 1429246 1426976 CDS product choline BCCT transporter BetT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704693.1 protein_id gnl|my_center|LOCUS_12560 1429684 1430742 gene locus_tag LOCUS_12570 1429684 1430742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 1434822 1430896 gene locus_tag LOCUS_12580 1434822 1430896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 1435067 1435252 gene locus_tag LOCUS_12590 1435067 1435252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 1435249 1435716 gene locus_tag LOCUS_12600 1435249 1435716 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875325.1 protein_id gnl|my_center|LOCUS_12600 1436864 1435671 gene locus_tag LOCUS_12610 1436864 1435671 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804856.1 protein_id gnl|my_center|LOCUS_12610 1436989 1438992 gene locus_tag LOCUS_12620 1436989 1438992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 1439455 1438979 gene locus_tag LOCUS_12630 1439455 1438979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 1439514 1440077 gene locus_tag LOCUS_12640 gene purN 1439514 1440077 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898661.1 protein_id gnl|my_center|LOCUS_12640 1440180 1441784 gene locus_tag LOCUS_12650 gene purH 1440180 1441784 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029883.1 protein_id gnl|my_center|LOCUS_12650 1441784 1442755 gene locus_tag LOCUS_12660 1441784 1442755 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854741.1 protein_id gnl|my_center|LOCUS_12660 1446145 1442855 gene locus_tag LOCUS_12670 1446145 1442855 CDS product beta-phosphoglucomutase family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932984.1 protein_id gnl|my_center|LOCUS_12670 1446144 1446350 gene locus_tag LOCUS_12680 1446144 1446350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 1446397 1447689 gene locus_tag LOCUS_12690 1446397 1447689 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973528.1 protein_id gnl|my_center|LOCUS_12690 1447686 1448618 gene locus_tag LOCUS_12700 1447686 1448618 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776152.1 protein_id gnl|my_center|LOCUS_12700 1449064 1449552 gene locus_tag LOCUS_12710 1449064 1449552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 1449559 1450458 gene locus_tag LOCUS_12720 1449559 1450458 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776151.1 protein_id gnl|my_center|LOCUS_12720 1450476 1451513 gene locus_tag LOCUS_12730 gene trpS 1450476 1451513 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124091865.1 protein_id gnl|my_center|LOCUS_12730 1451532 1452083 gene locus_tag LOCUS_12740 1451532 1452083 CDS product 2'-5' RNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029900.1 protein_id gnl|my_center|LOCUS_12740 1452317 1453462 gene locus_tag LOCUS_12750 1452317 1453462 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226848.1 protein_id gnl|my_center|LOCUS_12750 1454688 1453570 gene locus_tag LOCUS_12760 1454688 1453570 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776146.1 protein_id gnl|my_center|LOCUS_12760 1454588 1454809 gene locus_tag LOCUS_12770 1454588 1454809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 1455012 1455392 gene locus_tag LOCUS_12780 gene sdhC 1455012 1455392 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776147.1 protein_id gnl|my_center|LOCUS_12780 1455396 1455881 gene locus_tag LOCUS_12790 gene sdhD 1455396 1455881 CDS product succinate dehydrogenase, hydrophobic membrane anchor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776148.1 protein_id gnl|my_center|LOCUS_12790 1455962 1457722 gene locus_tag LOCUS_12800 gene sdhA 1455962 1457722 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776149.1 protein_id gnl|my_center|LOCUS_12800 1457722 1458522 gene locus_tag LOCUS_12810 1457722 1458522 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776150.1 protein_id gnl|my_center|LOCUS_12810 1458695 1459906 gene locus_tag LOCUS_12820 1458695 1459906 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776145.1 protein_id gnl|my_center|LOCUS_12820 1460056 1461183 gene locus_tag LOCUS_12830 1460056 1461183 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776144.1 protein_id gnl|my_center|LOCUS_12830 1461208 1462779 gene locus_tag LOCUS_12840 1461208 1462779 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776143.1 protein_id gnl|my_center|LOCUS_12840 1462776 1464098 gene locus_tag LOCUS_12850 1462776 1464098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 1464095 1465381 gene locus_tag LOCUS_12860 1464095 1465381 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776141.1 protein_id gnl|my_center|LOCUS_12860 1465384 1465848 gene locus_tag LOCUS_12870 1465384 1465848 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776140.1 protein_id gnl|my_center|LOCUS_12870 1465886 1467217 gene locus_tag LOCUS_12880 1465886 1467217 CDS product thymidine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030872150.1 protein_id gnl|my_center|LOCUS_12880 1467300 1468853 gene locus_tag LOCUS_12890 1467300 1468853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 1468841 1470763 gene locus_tag LOCUS_12900 1468841 1470763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 1470931 1472220 gene locus_tag LOCUS_12910 gene eno 1470931 1472220 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975715.1 protein_id gnl|my_center|LOCUS_12910 1472471 1473118 gene locus_tag LOCUS_12920 1472471 1473118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_12920 1473150 1473848 gene locus_tag LOCUS_12930 1473150 1473848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 1473891 1474859 gene locus_tag LOCUS_12940 1473891 1474859 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804959.1 protein_id gnl|my_center|LOCUS_12940 1475026 1476414 gene locus_tag LOCUS_12950 1475026 1476414 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486678.1 protein_id gnl|my_center|LOCUS_12950 1476510 1476585 gene locus_tag LOCUS_t00280 1476510 1476585 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1476738 1477673 gene locus_tag LOCUS_12960 1476738 1477673 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804432.1 protein_id gnl|my_center|LOCUS_12960 1477801 1479099 gene locus_tag LOCUS_12970 1477801 1479099 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231015.1 protein_id gnl|my_center|LOCUS_12970 1479096 1480346 gene locus_tag LOCUS_12980 gene ilvA 1479096 1480346 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029975.1 protein_id gnl|my_center|LOCUS_12980 1480952 1480452 gene locus_tag LOCUS_12990 gene greA 1480952 1480452 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776308.1 protein_id gnl|my_center|LOCUS_12990 1481607 1481203 gene locus_tag LOCUS_13000 1481607 1481203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 1481675 1482655 gene locus_tag LOCUS_13010 gene mca 1481675 1482655 CDS product mycothiol conjugate amidase Mca inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229824.1 protein_id gnl|my_center|LOCUS_13010 1482652 1483041 gene locus_tag LOCUS_13020 1482652 1483041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 1483820 1483029 gene locus_tag LOCUS_13030 1483820 1483029 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029984.1 protein_id gnl|my_center|LOCUS_13030 1484075 1484836 gene locus_tag LOCUS_13040 gene uppS 1484075 1484836 CDS product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776303.1 protein_id gnl|my_center|LOCUS_13040 1484864 1485385 gene locus_tag LOCUS_13050 1484864 1485385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 1485425 1485988 gene locus_tag LOCUS_13060 1485425 1485988 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977815.1 protein_id gnl|my_center|LOCUS_13060 1487005 1486229 gene locus_tag LOCUS_13070 1487005 1486229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 1486965 1488425 gene locus_tag LOCUS_13080 1486965 1488425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 1490274 1488523 gene locus_tag LOCUS_13090 1490274 1488523 CDS product pyruvate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226369.1 protein_id gnl|my_center|LOCUS_13090 1491949 1490543 gene locus_tag LOCUS_13100 1491949 1490543 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776300.1 protein_id gnl|my_center|LOCUS_13100 1492657 1492019 gene locus_tag LOCUS_13110 1492657 1492019 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908614.1 protein_id gnl|my_center|LOCUS_13110 1492928 1493018 gene locus_tag LOCUS_t00290 1492928 1493018 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 1493558 1494556 gene locus_tag LOCUS_13120 gene glpX 1493558 1494556 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803850.1 protein_id gnl|my_center|LOCUS_13120 1494684 1496531 gene locus_tag LOCUS_13130 1494684 1496531 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056069.1 protein_id gnl|my_center|LOCUS_13130 1497619 1496597 gene locus_tag LOCUS_13140 1497619 1496597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 1499349 1497703 gene locus_tag LOCUS_13150 1499349 1497703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_13150 1500085 1499453 gene locus_tag LOCUS_13160 gene purE 1500085 1499453 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975752.1 protein_id gnl|my_center|LOCUS_13160 1501349 1500144 gene locus_tag LOCUS_13170 1501349 1500144 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776123.1 protein_id gnl|my_center|LOCUS_13170 1501630 1502235 gene locus_tag LOCUS_13180 1501630 1502235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 1502966 1502220 gene locus_tag LOCUS_13190 1502966 1502220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 1503147 1503515 gene locus_tag LOCUS_13200 1503147 1503515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 1503571 1503900 gene locus_tag LOCUS_13210 1503571 1503900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 1503988 1505253 gene locus_tag LOCUS_13220 1503988 1505253 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727602.1 protein_id gnl|my_center|LOCUS_13220 1505347 1506432 gene locus_tag LOCUS_13230 1505347 1506432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 1507103 1506372 gene locus_tag LOCUS_13240 1507103 1506372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 1508734 1507103 gene locus_tag LOCUS_13250 1508734 1507103 CDS product phospholipid carrier-dependent glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930192.1 protein_id gnl|my_center|LOCUS_13250 1510660 1508741 gene locus_tag LOCUS_13260 1510660 1508741 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776837.1 protein_id gnl|my_center|LOCUS_13260 1512507 1510657 gene locus_tag LOCUS_13270 1512507 1510657 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776838.1 protein_id gnl|my_center|LOCUS_13270 1512663 1513784 gene locus_tag LOCUS_13280 1512663 1513784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 1513794 1514711 gene locus_tag LOCUS_13290 gene rsmI 1513794 1514711 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229988.1 protein_id gnl|my_center|LOCUS_13290 1514721 1515746 gene locus_tag LOCUS_13300 1514721 1515746 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028796.1 protein_id gnl|my_center|LOCUS_13300 1516740 1515763 gene locus_tag LOCUS_13310 1516740 1515763 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339226.1 protein_id gnl|my_center|LOCUS_13310 1516899 1517750 gene locus_tag LOCUS_13320 gene rsmA 1516899 1517750 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975667.1 protein_id gnl|my_center|LOCUS_13320 1518997 1517822 gene locus_tag LOCUS_13330 1518997 1517822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 1520892 1519054 gene locus_tag LOCUS_13340 1520892 1519054 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729311.1 protein_id gnl|my_center|LOCUS_13340 1521016 1521088 gene locus_tag LOCUS_t00300 1521016 1521088 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 1521144 1522634 gene locus_tag LOCUS_13350 gene glmU 1521144 1522634 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467757.1 protein_id gnl|my_center|LOCUS_13350 1522638 1523621 gene locus_tag LOCUS_13360 1522638 1523621 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804951.1 protein_id gnl|my_center|LOCUS_13360 1523705 1524814 gene locus_tag LOCUS_13370 1523705 1524814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 1524844 1526052 gene locus_tag LOCUS_13380 1524844 1526052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 1526049 1527923 gene locus_tag LOCUS_13390 1526049 1527923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 1527920 1528939 gene locus_tag LOCUS_13400 1527920 1528939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 1528930 1530042 gene locus_tag LOCUS_13410 1528930 1530042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803906.1 protein_id gnl|my_center|LOCUS_13410 1530039 1530785 gene locus_tag LOCUS_13420 1530039 1530785 CDS product acylneuraminate cytidylyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932825.1 protein_id gnl|my_center|LOCUS_13420 1530782 1533025 gene locus_tag LOCUS_13430 1530782 1533025 CDS product N-acetylneuraminate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000582619.1 protein_id gnl|my_center|LOCUS_13430 1533022 1534170 gene locus_tag LOCUS_13440 1533022 1534170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 1534167 1535423 gene locus_tag LOCUS_13450 1534167 1535423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 1535420 1536334 gene locus_tag LOCUS_13460 1535420 1536334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 1536331 1537419 gene locus_tag LOCUS_13470 1536331 1537419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 1537416 1538390 gene locus_tag LOCUS_13480 1537416 1538390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 1538396 1539604 gene locus_tag LOCUS_13490 1538396 1539604 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966352.1 protein_id gnl|my_center|LOCUS_13490 1539995 1539645 gene locus_tag LOCUS_13500 1539995 1539645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 1540867 1539974 gene locus_tag LOCUS_13510 1540867 1539974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 1542427 1540967 gene locus_tag LOCUS_13520 1542427 1540967 CDS product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013584.1 protein_id gnl|my_center|LOCUS_13520 1542634 1543104 gene locus_tag LOCUS_13530 1542634 1543104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 1543982 1543119 gene locus_tag LOCUS_13540 gene rfbA 1543982 1543119 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726901.1 protein_id gnl|my_center|LOCUS_13540 1544037 1545035 gene locus_tag LOCUS_13550 gene rfbB 1544037 1545035 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803926.1 protein_id gnl|my_center|LOCUS_13550 1545038 1546468 gene locus_tag LOCUS_13560 1545038 1546468 CDS product bifunctional dTDP-4-dehydrorhamnose 3,5-epimerase family protein/NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803927.1 protein_id gnl|my_center|LOCUS_13560 1547027 1547347 gene locus_tag LOCUS_13570 1547027 1547347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 1547813 1548451 gene locus_tag LOCUS_13580 1547813 1548451 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804952.1 protein_id gnl|my_center|LOCUS_13580 1548628 1549209 gene locus_tag LOCUS_13590 gene pth 1548628 1549209 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804953.1 protein_id gnl|my_center|LOCUS_13590 1549301 1550179 gene locus_tag LOCUS_13600 1549301 1550179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 1550465 1550292 gene locus_tag LOCUS_13610 1550465 1550292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 1551108 1550539 gene locus_tag LOCUS_13620 1551108 1550539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 1552616 1551258 gene locus_tag LOCUS_13630 gene nhaA 1552616 1551258 CDS product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777007.1 protein_id gnl|my_center|LOCUS_13630 1553228 1552734 gene locus_tag LOCUS_13640 1553228 1552734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 1554759 1553251 gene locus_tag LOCUS_13650 1554759 1553251 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049744721.1 protein_id gnl|my_center|LOCUS_13650 1555189 1554752 gene locus_tag LOCUS_13660 1555189 1554752 CDS product adenylyltransferase/cytidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930108.1 protein_id gnl|my_center|LOCUS_13660 1555820 1555200 gene locus_tag LOCUS_13670 1555820 1555200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13670 1556293 1555844 gene locus_tag LOCUS_13680 1556293 1555844 CDS product UDP-N-acetylglucosamine--LPS N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686635.1 protein_id gnl|my_center|LOCUS_13680 1557451 1556336 gene locus_tag LOCUS_13690 1557451 1556336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 1559007 1557514 gene locus_tag LOCUS_13700 1559007 1557514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 1560296 1559004 gene locus_tag LOCUS_13710 1560296 1559004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 1561224 1560301 gene locus_tag LOCUS_13720 1561224 1560301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 1561967 1561221 gene locus_tag LOCUS_13730 1561967 1561221 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803937.1 protein_id gnl|my_center|LOCUS_13730 1565173 1561964 gene locus_tag LOCUS_13740 1565173 1561964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 1566008 1565271 gene locus_tag LOCUS_13750 1566008 1565271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 1567211 1566189 gene locus_tag LOCUS_13760 1567211 1566189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 1567576 1571205 gene locus_tag LOCUS_13770 gene mfd 1567576 1571205 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028772.1 protein_id gnl|my_center|LOCUS_13770 1571683 1571366 gene locus_tag LOCUS_13780 1571683 1571366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 1572461 1571805 gene locus_tag LOCUS_13790 gene deoC 1572461 1571805 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009933101.1 protein_id gnl|my_center|LOCUS_13790 1574262 1572514 gene locus_tag LOCUS_13800 1574262 1572514 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162495362.1 protein_id gnl|my_center|LOCUS_13800 1575159 1574317 gene locus_tag LOCUS_13810 1575159 1574317 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776134.1 protein_id gnl|my_center|LOCUS_13810 1575266 1576681 gene locus_tag LOCUS_13820 1575266 1576681 CDS product NAD(P)H-quinone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030872192.1 protein_id gnl|my_center|LOCUS_13820 1578247 1576781 gene locus_tag LOCUS_13830 1578247 1576781 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014385.1 protein_id gnl|my_center|LOCUS_13830 1580223 1578406 gene locus_tag LOCUS_13840 1580223 1578406 CDS product biotin carboxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029950.1 protein_id gnl|my_center|LOCUS_13840 1581066 1580329 gene locus_tag LOCUS_13850 1581066 1580329 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776131.1 protein_id gnl|my_center|LOCUS_13850 1582554 1581106 gene locus_tag LOCUS_13860 1582554 1581106 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776817.1 protein_id gnl|my_center|LOCUS_13860 1584338 1582608 gene locus_tag LOCUS_13870 1584338 1582608 CDS product DUF885 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776130.1 protein_id gnl|my_center|LOCUS_13870 1584659 1584417 gene locus_tag LOCUS_13880 1584659 1584417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 1586278 1584656 gene locus_tag LOCUS_13890 1586278 1584656 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029952.1 protein_id gnl|my_center|LOCUS_13890 1586663 1586361 gene locus_tag LOCUS_13900 1586663 1586361 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857466.1 protein_id gnl|my_center|LOCUS_13900 1586809 1587843 gene locus_tag LOCUS_13910 1586809 1587843 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029953.1 protein_id gnl|my_center|LOCUS_13910 1587840 1588331 gene locus_tag LOCUS_13920 1587840 1588331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 1588497 1589639 gene locus_tag LOCUS_13930 1588497 1589639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 1589636 1590676 gene locus_tag LOCUS_13940 1589636 1590676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 1590747 1593014 gene locus_tag LOCUS_13950 gene ligA 1590747 1593014 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030278.1 protein_id gnl|my_center|LOCUS_13950 1593429 1594175 gene locus_tag LOCUS_13960 1593429 1594175 CDS product transglycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230245.1 protein_id gnl|my_center|LOCUS_13960 1594400 1594696 gene locus_tag LOCUS_13970 gene gatC 1594400 1594696 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775914.1 protein_id gnl|my_center|LOCUS_13970 1594701 1596281 gene locus_tag LOCUS_13980 gene gatA 1594701 1596281 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775913.1 protein_id gnl|my_center|LOCUS_13980 1596281 1597783 gene locus_tag LOCUS_13990 gene gatB 1596281 1597783 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030281.1 protein_id gnl|my_center|LOCUS_13990 1598990 1597866 gene locus_tag LOCUS_14000 1598990 1597866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 1601257 1598987 gene locus_tag LOCUS_14010 1601257 1598987 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898586.1 protein_id gnl|my_center|LOCUS_14010 1602681 1601254 gene locus_tag LOCUS_14020 1602681 1601254 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817406.1 protein_id gnl|my_center|LOCUS_14020 1603168 1604577 gene locus_tag LOCUS_14030 1603168 1604577 CDS product bifunctional o-acetylhomoserine/o-acetylserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080715.1 protein_id gnl|my_center|LOCUS_14030 1604574 1605716 gene locus_tag LOCUS_14040 1604574 1605716 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229667.1 protein_id gnl|my_center|LOCUS_14040 1605828 1606499 gene locus_tag LOCUS_14050 1605828 1606499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_137447494.1 protein_id gnl|my_center|LOCUS_14050 1606581 1607615 gene locus_tag LOCUS_14060 1606581 1607615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 1607734 1607507 gene locus_tag LOCUS_14070 1607734 1607507 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728864.1 protein_id gnl|my_center|LOCUS_14070 1607852 1609234 gene locus_tag LOCUS_14080 1607852 1609234 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775737.1 protein_id gnl|my_center|LOCUS_14080 1609265 1610227 gene locus_tag LOCUS_14090 1609265 1610227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 1610238 1610636 gene locus_tag LOCUS_14100 1610238 1610636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 1611443 1610646 gene locus_tag LOCUS_14110 1611443 1610646 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002438224.1 protein_id gnl|my_center|LOCUS_14110 1611608 1612807 gene locus_tag LOCUS_14120 gene dusB 1611608 1612807 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010147544.1 protein_id gnl|my_center|LOCUS_14120 1612810 1614120 gene locus_tag LOCUS_14130 1612810 1614120 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775728.1 protein_id gnl|my_center|LOCUS_14130 1614200 1616083 gene locus_tag LOCUS_14140 gene dnaG 1614200 1616083 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775727.1 protein_id gnl|my_center|LOCUS_14140 1616212 1616287 gene locus_tag LOCUS_t00310 1616212 1616287 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 1616409 1616972 gene locus_tag LOCUS_14150 1616409 1616972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 1617113 1617985 gene locus_tag LOCUS_14160 1617113 1617985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 1618136 1619335 gene locus_tag LOCUS_14170 1618136 1619335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 1619433 1619507 gene locus_tag LOCUS_t00320 1619433 1619507 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1620166 1619663 gene locus_tag LOCUS_14180 1620166 1619663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 1620783 1621670 gene locus_tag LOCUS_14190 gene rpsB 1620783 1621670 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804634.1 protein_id gnl|my_center|LOCUS_14190 1621810 1622640 gene locus_tag LOCUS_14200 gene tsf 1621810 1622640 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804635.1 protein_id gnl|my_center|LOCUS_14200 1622864 1623595 gene locus_tag LOCUS_14210 gene pyrH 1622864 1623595 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804636.1 protein_id gnl|my_center|LOCUS_14210 1623707 1624264 gene locus_tag LOCUS_14220 gene frr 1623707 1624264 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973383.1 protein_id gnl|my_center|LOCUS_14220 1624264 1625124 gene locus_tag LOCUS_14230 1624264 1625124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_14230 1625175 1625822 gene locus_tag LOCUS_14240 1625175 1625822 CDS product DivIVA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804641.1 protein_id gnl|my_center|LOCUS_14240 1625928 1626347 gene locus_tag LOCUS_14250 1625928 1626347 CDS product DUF485 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223484.1 protein_id gnl|my_center|LOCUS_14250 1626344 1626493 gene locus_tag LOCUS_14260 1626344 1626493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 1626593 1627963 gene locus_tag LOCUS_14270 1626593 1627963 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223483.1 protein_id gnl|my_center|LOCUS_14270 1628135 1628401 gene locus_tag LOCUS_14280 1628135 1628401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 1628409 1629908 gene locus_tag LOCUS_14290 1628409 1629908 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804643.1 protein_id gnl|my_center|LOCUS_14290 1629905 1630882 gene locus_tag LOCUS_14300 1629905 1630882 CDS product DUF4081 domain-containing GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193499286.1 protein_id gnl|my_center|LOCUS_14300 1630970 1632772 gene locus_tag LOCUS_14310 1630970 1632772 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804649.1 protein_id gnl|my_center|LOCUS_14310 1632790 1633668 gene locus_tag LOCUS_14320 1632790 1633668 CDS product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805161.1 protein_id gnl|my_center|LOCUS_14320 1634645 1633665 gene locus_tag LOCUS_14330 1634645 1633665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 1634872 1635510 gene locus_tag LOCUS_14340 1634872 1635510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 1635627 1636634 gene locus_tag LOCUS_14350 gene nusA 1635627 1636634 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030401.1 protein_id gnl|my_center|LOCUS_14350 1636780 1637040 gene locus_tag LOCUS_14360 1636780 1637040 CDS product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804653.1 protein_id gnl|my_center|LOCUS_14360 1637284 1640172 gene locus_tag LOCUS_14370 1637284 1640172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14370 1640351 1640914 gene locus_tag LOCUS_14380 gene rbfA 1640351 1640914 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804655.1 protein_id gnl|my_center|LOCUS_14380 1640915 1642012 gene locus_tag LOCUS_14390 gene truB 1640915 1642012 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296636.1 protein_id gnl|my_center|LOCUS_14390 1642009 1642380 gene locus_tag LOCUS_14400 1642009 1642380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775676.1 protein_id gnl|my_center|LOCUS_14400 1642921 1642691 gene locus_tag LOCUS_14410 1642921 1642691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 1643311 1643784 gene locus_tag LOCUS_14420 1643311 1643784 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222283.1 protein_id gnl|my_center|LOCUS_14420 1643929 1644786 gene locus_tag LOCUS_14430 1643929 1644786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 1644798 1645766 gene locus_tag LOCUS_14440 1644798 1645766 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973315.1 protein_id gnl|my_center|LOCUS_14440 1646714 1645881 gene locus_tag LOCUS_14450 1646714 1645881 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971787.1 protein_id gnl|my_center|LOCUS_14450 1647609 1646821 gene locus_tag LOCUS_14460 gene mtnN 1647609 1646821 CDS product 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804292.1 protein_id gnl|my_center|LOCUS_14460 1648082 1647624 gene locus_tag LOCUS_14470 1648082 1647624 CDS product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804934.1 protein_id gnl|my_center|LOCUS_14470 1648224 1648604 gene locus_tag LOCUS_14480 1648224 1648604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 1648775 1649989 gene locus_tag LOCUS_14490 1648775 1649989 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028898.1 protein_id gnl|my_center|LOCUS_14490 1650724 1650125 gene locus_tag LOCUS_14500 1650724 1650125 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011265466.1 protein_id gnl|my_center|LOCUS_14500 1651003 1651272 gene locus_tag LOCUS_14510 gene rpsO 1651003 1651272 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814361.1 protein_id gnl|my_center|LOCUS_14510 1651570 1653798 gene locus_tag LOCUS_14520 1651570 1653798 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929901.1 protein_id gnl|my_center|LOCUS_14520 1653918 1655264 gene locus_tag LOCUS_14530 1653918 1655264 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973289.1 protein_id gnl|my_center|LOCUS_14530 1657219 1655261 gene locus_tag LOCUS_14540 1657219 1655261 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068225.1 protein_id gnl|my_center|LOCUS_14540 1657400 1658155 gene locus_tag LOCUS_14550 gene dapB 1657400 1658155 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804662.1 protein_id gnl|my_center|LOCUS_14550 1658175 1658789 gene locus_tag LOCUS_14560 1658175 1658789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 1658795 1659742 gene locus_tag LOCUS_14570 gene dapA 1658795 1659742 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030431.1 protein_id gnl|my_center|LOCUS_14570 1659847 1661550 gene locus_tag LOCUS_14580 1659847 1661550 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804669.1 protein_id gnl|my_center|LOCUS_14580 1661677 1664790 gene locus_tag LOCUS_14590 1661677 1664790 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929902.1 protein_id gnl|my_center|LOCUS_14590 1664842 1665459 gene locus_tag LOCUS_14600 gene pgsA 1664842 1665459 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857464.1 protein_id gnl|my_center|LOCUS_14600 1665507 1665962 gene locus_tag LOCUS_14610 1665507 1665962 CDS product CinA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228067.1 protein_id gnl|my_center|LOCUS_14610 1666182 1666634 gene locus_tag LOCUS_14620 1666182 1666634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 1666831 1667052 gene locus_tag LOCUS_14630 1666831 1667052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 1667348 1668481 gene locus_tag LOCUS_14640 gene recA 1667348 1668481 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804675.1 protein_id gnl|my_center|LOCUS_14640 1668481 1669194 gene locus_tag LOCUS_14650 gene recX 1668481 1669194 CDS product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_134111881.1 protein_id gnl|my_center|LOCUS_14650 1669258 1670832 gene locus_tag LOCUS_14660 gene miaB 1669258 1670832 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930170.1 protein_id gnl|my_center|LOCUS_14660 1670829 1671773 gene locus_tag LOCUS_14670 gene miaA 1670829 1671773 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804679.1 protein_id gnl|my_center|LOCUS_14670 1671879 1672850 gene locus_tag LOCUS_14680 gene dapF 1671879 1672850 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804680.1 protein_id gnl|my_center|LOCUS_14680 1673505 1672882 gene locus_tag LOCUS_14690 1673505 1672882 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804681.1 protein_id gnl|my_center|LOCUS_14690 1673737 1675320 gene locus_tag LOCUS_14700 gene hflX 1673737 1675320 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804682.1 protein_id gnl|my_center|LOCUS_14700 1675317 1677413 gene locus_tag LOCUS_14710 1675317 1677413 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804683.1 protein_id gnl|my_center|LOCUS_14710 1678225 1677437 gene locus_tag LOCUS_14720 gene lexA 1678225 1677437 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804684.1 protein_id gnl|my_center|LOCUS_14720 1678425 1678919 gene locus_tag LOCUS_14730 1678425 1678919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 1678971 1680095 gene locus_tag LOCUS_14740 1678971 1680095 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976762.1 protein_id gnl|my_center|LOCUS_14740 1680179 1680814 gene locus_tag LOCUS_14750 gene hisB 1680179 1680814 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389647.1 protein_id gnl|my_center|LOCUS_14750 1680811 1681581 gene locus_tag LOCUS_14760 gene hisH 1680811 1681581 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776205.1 protein_id gnl|my_center|LOCUS_14760 1681578 1681745 gene locus_tag LOCUS_14770 1681578 1681745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 1681813 1682553 gene locus_tag LOCUS_14780 gene priA 1681813 1682553 CDS product bifunctional 1-(5-phosphoribosyl)-5-((5-phosphoribosylamino)methylideneamino)imidazole-4-carboxamide isomerase/phosphoribosylanthranilate isomerase PriA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776203.1 protein_id gnl|my_center|LOCUS_14780 1682565 1683428 gene locus_tag LOCUS_14790 1682565 1683428 CDS product SseB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776202.1 protein_id gnl|my_center|LOCUS_14790 1683901 1683425 gene locus_tag LOCUS_14800 1683901 1683425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 1684360 1685079 gene locus_tag LOCUS_14810 1684360 1685079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 1685276 1685470 gene locus_tag LOCUS_14820 gene rpmI 1685276 1685470 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977225.1 protein_id gnl|my_center|LOCUS_14820 1685581 1685964 gene locus_tag LOCUS_14830 gene rplT 1685581 1685964 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977226.1 protein_id gnl|my_center|LOCUS_14830 1686113 1687036 gene locus_tag LOCUS_14840 1686113 1687036 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027873.1 protein_id gnl|my_center|LOCUS_14840 1686393 1686307 gene locus_tag LOCUS_t00330 1686393 1686307 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 1686991 1688196 gene locus_tag LOCUS_14850 1686991 1688196 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028720.1 protein_id gnl|my_center|LOCUS_14850 1688396 1689526 gene locus_tag LOCUS_14860 gene pheS 1688396 1689526 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227844.1 protein_id gnl|my_center|LOCUS_14860 1689531 1692089 gene locus_tag LOCUS_14870 gene pheT 1689531 1692089 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776192.1 protein_id gnl|my_center|LOCUS_14870 1692129 1692740 gene locus_tag LOCUS_14880 1692129 1692740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 1693885 1692863 gene locus_tag LOCUS_14890 1693885 1692863 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227740.1 protein_id gnl|my_center|LOCUS_14890 1694043 1695107 gene locus_tag LOCUS_14900 gene argC 1694043 1695107 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977244.1 protein_id gnl|my_center|LOCUS_14900 1695104 1696318 gene locus_tag LOCUS_14910 gene argJ 1695104 1696318 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776181.1 protein_id gnl|my_center|LOCUS_14910 1696352 1697401 gene locus_tag LOCUS_14920 gene argB 1696352 1697401 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227836.1 protein_id gnl|my_center|LOCUS_14920 1697398 1698633 gene locus_tag LOCUS_14930 1697398 1698633 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776179.1 protein_id gnl|my_center|LOCUS_14930 1698703 1699656 gene locus_tag LOCUS_14940 gene argF 1698703 1699656 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776178.1 protein_id gnl|my_center|LOCUS_14940 1699653 1700141 gene locus_tag LOCUS_14950 1699653 1700141 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977248.1 protein_id gnl|my_center|LOCUS_14950 1700661 1700212 gene locus_tag LOCUS_14960 1700661 1700212 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325767.1 protein_id gnl|my_center|LOCUS_14960 1700808 1701497 gene locus_tag LOCUS_14970 1700808 1701497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 1701604 1702806 gene locus_tag LOCUS_14980 1701604 1702806 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776176.1 protein_id gnl|my_center|LOCUS_14980 1702806 1704251 gene locus_tag LOCUS_14990 gene argH 1702806 1704251 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027854.1 protein_id gnl|my_center|LOCUS_14990 1704421 1705005 gene locus_tag LOCUS_15000 1704421 1705005 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944687.1 protein_id gnl|my_center|LOCUS_15000 1705054 1707417 gene locus_tag LOCUS_15010 1705054 1707417 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804687.1 protein_id gnl|my_center|LOCUS_15010 1707459 1708790 gene locus_tag LOCUS_15020 gene tyrS 1707459 1708790 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027993.1 protein_id gnl|my_center|LOCUS_15020 1709242 1710769 gene locus_tag LOCUS_r00080 1709242 1710769 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 1711196 1714281 gene locus_tag LOCUS_r00090 1711196 1714281 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 1714463 1714573 gene locus_tag LOCUS_r00100 1714463 1714573 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 1715397 1716530 gene locus_tag LOCUS_15030 1715397 1716530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_212647610.1 protein_id gnl|my_center|LOCUS_15030 1716527 1717516 gene locus_tag LOCUS_15040 1716527 1717516 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804972.1 protein_id gnl|my_center|LOCUS_15040 1717507 1717773 gene locus_tag LOCUS_15050 1717507 1717773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 1717770 1718534 gene locus_tag LOCUS_15060 1717770 1718534 CDS product TlyA family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804973.1 protein_id gnl|my_center|LOCUS_15060 1718610 1719554 gene locus_tag LOCUS_15070 1718610 1719554 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027973.1 protein_id gnl|my_center|LOCUS_15070 1719551 1721293 gene locus_tag LOCUS_15080 gene recN 1719551 1721293 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325905.1 protein_id gnl|my_center|LOCUS_15080 1721342 1723015 gene locus_tag LOCUS_15090 1721342 1723015 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063606961.1 protein_id gnl|my_center|LOCUS_15090 1723012 1723692 gene locus_tag LOCUS_15100 1723012 1723692 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977050.1 protein_id gnl|my_center|LOCUS_15100 1723689 1724672 gene locus_tag LOCUS_15110 gene xerD 1723689 1724672 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729303.1 protein_id gnl|my_center|LOCUS_15110 1725815 1724676 gene locus_tag LOCUS_15120 1725815 1724676 CDS product bifunctional 2-methylcitrate synthase/citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804817.1 protein_id gnl|my_center|LOCUS_15120 1726770 1725859 gene locus_tag LOCUS_15130 gene prpB 1726770 1725859 CDS product methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804818.1 protein_id gnl|my_center|LOCUS_15130 1728290 1726770 gene locus_tag LOCUS_15140 1728290 1726770 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804819.1 protein_id gnl|my_center|LOCUS_15140 1729009 1728287 gene locus_tag LOCUS_15150 1729009 1728287 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804820.1 protein_id gnl|my_center|LOCUS_15150 1729188 1731107 gene locus_tag LOCUS_15160 1729188 1731107 CDS product propionyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229993.1 protein_id gnl|my_center|LOCUS_15160 1731217 1732683 gene locus_tag LOCUS_15170 1731217 1732683 CDS product cation:dicarboxylase symporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896702.1 protein_id gnl|my_center|LOCUS_15170 1732846 1733712 gene locus_tag LOCUS_15180 1732846 1733712 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977053.1 protein_id gnl|my_center|LOCUS_15180 1733805 1734674 gene locus_tag LOCUS_15190 1733805 1734674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15190 1734671 1735525 gene locus_tag LOCUS_15200 1734671 1735525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 1735522 1736712 gene locus_tag LOCUS_15210 1735522 1736712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 1736716 1737858 gene locus_tag LOCUS_15220 1736716 1737858 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805132.1 protein_id gnl|my_center|LOCUS_15220 1737920 1738771 gene locus_tag LOCUS_15230 1737920 1738771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_15230 1738768 1740327 gene locus_tag LOCUS_15240 gene der 1738768 1740327 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977066.1 protein_id gnl|my_center|LOCUS_15240 1740592 1740666 gene locus_tag LOCUS_t00340 1740592 1740666 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 1740946 1742343 gene locus_tag LOCUS_15250 1740946 1742343 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731470.1 protein_id gnl|my_center|LOCUS_15250 1743085 1742432 gene locus_tag LOCUS_15260 1743085 1742432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 1743236 1745137 gene locus_tag LOCUS_15270 gene recQ 1743236 1745137 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775826.1 protein_id gnl|my_center|LOCUS_15270 1745727 1745134 gene locus_tag LOCUS_15280 1745727 1745134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 1746754 1745966 gene locus_tag LOCUS_15290 1746754 1745966 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859582.1 protein_id gnl|my_center|LOCUS_15290 1747016 1748452 gene locus_tag LOCUS_15300 1747016 1748452 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804601.1 protein_id gnl|my_center|LOCUS_15300 1748707 1748528 gene locus_tag LOCUS_15310 1748707 1748528 CDS product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014173.1 protein_id gnl|my_center|LOCUS_15310 1749292 1748717 gene locus_tag LOCUS_15320 1749292 1748717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 1749468 1749866 gene locus_tag LOCUS_15330 1749468 1749866 CDS product lycopene cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225087.1 protein_id gnl|my_center|LOCUS_15330 1749859 1750206 gene locus_tag LOCUS_15340 1749859 1750206 CDS product lycopene cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742202.1 protein_id gnl|my_center|LOCUS_15340 1750203 1751786 gene locus_tag LOCUS_15350 1750203 1751786 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877361.1 protein_id gnl|my_center|LOCUS_15350 1751783 1752649 gene locus_tag LOCUS_15360 1751783 1752649 CDS product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013774.1 protein_id gnl|my_center|LOCUS_15360 1752646 1754316 gene locus_tag LOCUS_15370 gene crtI 1752646 1754316 CDS product phytoene desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804092.1 protein_id gnl|my_center|LOCUS_15370 1754376 1755566 gene locus_tag LOCUS_15380 1754376 1755566 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479765.1 protein_id gnl|my_center|LOCUS_15380 1757251 1755542 gene locus_tag LOCUS_15390 1757251 1755542 CDS product ABC-ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804193.1 protein_id gnl|my_center|LOCUS_15390 1757970 1757296 gene locus_tag LOCUS_15400 1757970 1757296 CDS product GAP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804226.1 protein_id gnl|my_center|LOCUS_15400 1758067 1758741 gene locus_tag LOCUS_15410 1758067 1758741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 1759941 1758853 gene locus_tag LOCUS_15420 1759941 1758853 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776703.1 protein_id gnl|my_center|LOCUS_15420 1759894 1760283 gene locus_tag LOCUS_15430 1759894 1760283 CDS product DUF1304 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728710.1 protein_id gnl|my_center|LOCUS_15430 1760387 1761403 gene locus_tag LOCUS_15440 1760387 1761403 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976409.1 protein_id gnl|my_center|LOCUS_15440 1761499 1761978 gene locus_tag LOCUS_15450 1761499 1761978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 1762828 1762028 gene locus_tag LOCUS_15460 1762828 1762028 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973834.1 protein_id gnl|my_center|LOCUS_15460 1764659 1763088 gene locus_tag LOCUS_15470 gene glpK 1764659 1763088 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776956.1 protein_id gnl|my_center|LOCUS_15470 1765585 1764776 gene locus_tag LOCUS_15480 1765585 1764776 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776957.1 protein_id gnl|my_center|LOCUS_15480 1767473 1765722 gene locus_tag LOCUS_15490 1767473 1765722 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974200.1 protein_id gnl|my_center|LOCUS_15490 1767614 1768549 gene locus_tag LOCUS_15500 1767614 1768549 CDS product sugar-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036462291.1 protein_id gnl|my_center|LOCUS_15500 1769566 1768574 gene locus_tag LOCUS_15510 1769566 1768574 CDS product DUF389 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082376.1 protein_id gnl|my_center|LOCUS_15510 1769795 1769646 gene locus_tag LOCUS_15520 1769795 1769646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 1770056 1769823 gene locus_tag LOCUS_15530 1770056 1769823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 1770971 1770075 gene locus_tag LOCUS_15540 1770971 1770075 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775749.1 protein_id gnl|my_center|LOCUS_15540 1771128 1774613 gene locus_tag LOCUS_15550 1771128 1774613 CDS product proline dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197702416.1 protein_id gnl|my_center|LOCUS_15550 1774772 1775158 gene locus_tag LOCUS_15560 gene gcvH 1774772 1775158 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226819.1 protein_id gnl|my_center|LOCUS_15560 1775375 1775815 gene locus_tag LOCUS_15570 1775375 1775815 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004559567.1 protein_id gnl|my_center|LOCUS_15570 1775833 1776558 gene locus_tag LOCUS_15580 1775833 1776558 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027756.1 protein_id gnl|my_center|LOCUS_15580 1776754 1777434 gene locus_tag LOCUS_15590 1776754 1777434 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805153.1 protein_id gnl|my_center|LOCUS_15590 1778311 1777514 gene locus_tag LOCUS_15600 1778311 1777514 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805154.1 protein_id gnl|my_center|LOCUS_15600 1778531 1781977 gene locus_tag LOCUS_15610 1778531 1781977 CDS product pyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027194.1 protein_id gnl|my_center|LOCUS_15610 1782108 1783538 gene locus_tag LOCUS_15620 1782108 1783538 CDS product mycothione reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086123.1 protein_id gnl|my_center|LOCUS_15620 1785505 1783652 gene locus_tag LOCUS_15630 1785505 1783652 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805025.1 protein_id gnl|my_center|LOCUS_15630 1786422 1785553 gene locus_tag LOCUS_15640 1786422 1785553 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805028.1 protein_id gnl|my_center|LOCUS_15640 1786512 1787246 gene locus_tag LOCUS_15650 1786512 1787246 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977603.1 protein_id gnl|my_center|LOCUS_15650 1787256 1788650 gene locus_tag LOCUS_15660 1787256 1788650 CDS product 3-deoxy-7-phosphoheptulonate synthase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174265947.1 protein_id gnl|my_center|LOCUS_15660 1790045 1788705 gene locus_tag LOCUS_15670 1790045 1788705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 1790158 1790526 gene locus_tag LOCUS_15680 1790158 1790526 CDS product Rv2175c family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805032.1 protein_id gnl|my_center|LOCUS_15680 1791690 1790560 gene locus_tag LOCUS_15690 1791690 1790560 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171512886.1 protein_id gnl|my_center|LOCUS_15690 1791958 1793274 gene locus_tag LOCUS_15700 gene dinB 1791958 1793274 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228056.1 protein_id gnl|my_center|LOCUS_15700 1793347 1793742 gene locus_tag LOCUS_15710 1793347 1793742 CDS product DUF3040 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228055.1 protein_id gnl|my_center|LOCUS_15710 1793962 1793765 gene locus_tag LOCUS_15720 1793962 1793765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 1794007 1794438 gene locus_tag LOCUS_15730 gene mraZ 1794007 1794438 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804693.1 protein_id gnl|my_center|LOCUS_15730 1794612 1795607 gene locus_tag LOCUS_15740 gene rsmH 1794612 1795607 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729663.1 protein_id gnl|my_center|LOCUS_15740 1795604 1796359 gene locus_tag LOCUS_15750 1795604 1796359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 1796431 1798311 gene locus_tag LOCUS_15760 1796431 1798311 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804696.1 protein_id gnl|my_center|LOCUS_15760 1798435 1800123 gene locus_tag LOCUS_15770 1798435 1800123 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028131.1 protein_id gnl|my_center|LOCUS_15770 1800120 1801640 gene locus_tag LOCUS_15780 1800120 1801640 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228041.1 protein_id gnl|my_center|LOCUS_15780 1801648 1802775 gene locus_tag LOCUS_15790 gene mraY 1801648 1802775 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804699.1 protein_id gnl|my_center|LOCUS_15790 1802772 1804340 gene locus_tag LOCUS_15800 gene murD 1802772 1804340 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976729.1 protein_id gnl|my_center|LOCUS_15800 1804337 1805608 gene locus_tag LOCUS_15810 1804337 1805608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 1805644 1806780 gene locus_tag LOCUS_15820 gene murG 1805644 1806780 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976731.1 protein_id gnl|my_center|LOCUS_15820 1806777 1808306 gene locus_tag LOCUS_15830 gene murC 1806777 1808306 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228036.1 protein_id gnl|my_center|LOCUS_15830 1808303 1809580 gene locus_tag LOCUS_15840 1808303 1809580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 1809830 1811077 gene locus_tag LOCUS_15850 gene ftsZ 1809830 1811077 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976733.1 protein_id gnl|my_center|LOCUS_15850 1811267 1812118 gene locus_tag LOCUS_15860 1811267 1812118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 1812115 1812963 gene locus_tag LOCUS_15870 1812115 1812963 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856518.1 protein_id gnl|my_center|LOCUS_15870 1813023 1813727 gene locus_tag LOCUS_15880 gene sepF 1813023 1813727 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976736.1 protein_id gnl|my_center|LOCUS_15880 1813777 1814085 gene locus_tag LOCUS_15890 1813777 1814085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 1814131 1815000 gene locus_tag LOCUS_15900 1814131 1815000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 1814997 1815581 gene locus_tag LOCUS_15910 gene lspA 1814997 1815581 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093947675.1 protein_id gnl|my_center|LOCUS_15910 1815578 1816534 gene locus_tag LOCUS_15920 1815578 1816534 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224836.1 protein_id gnl|my_center|LOCUS_15920 1816539 1820090 gene locus_tag LOCUS_15930 gene dnaE 1816539 1820090 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804720.1 protein_id gnl|my_center|LOCUS_15930 1820125 1821510 gene locus_tag LOCUS_15940 gene hisD 1820125 1821510 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776210.1 protein_id gnl|my_center|LOCUS_15940 1821515 1822081 gene locus_tag LOCUS_15950 gene nrdR 1821515 1822081 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804686.1 protein_id gnl|my_center|LOCUS_15950 1823120 1822236 gene locus_tag LOCUS_15960 1823120 1822236 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284355.1 protein_id gnl|my_center|LOCUS_15960 1824118 1823204 gene locus_tag LOCUS_15970 gene map 1824118 1823204 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976546.1 protein_id gnl|my_center|LOCUS_15970 1824184 1824393 gene locus_tag LOCUS_15980 1824184 1824393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 1825362 1824490 gene locus_tag LOCUS_15990 gene panB 1825362 1824490 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223113.1 protein_id gnl|my_center|LOCUS_15990 1825355 1826830 gene locus_tag LOCUS_16000 gene glnA 1825355 1826830 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976572.1 protein_id gnl|my_center|LOCUS_16000 1826866 1829958 gene locus_tag LOCUS_16010 1826866 1829958 CDS product bifunctional [glutamine synthetase] adenylyltransferase/[glutamine synthetase]-adenylyl-L-tyrosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028215.1 protein_id gnl|my_center|LOCUS_16010 1830724 1829975 gene locus_tag LOCUS_16020 gene alsD 1830724 1829975 CDS product alpha-acetolactate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000215022.1 protein_id gnl|my_center|LOCUS_16020 1830831 1832276 gene locus_tag LOCUS_16030 gene thrC 1830831 1832276 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014964.1 protein_id gnl|my_center|LOCUS_16030 1832915 1832316 gene locus_tag LOCUS_16040 1832915 1832316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 1833272 1834225 gene locus_tag LOCUS_16050 1833272 1834225 CDS product IS630-like element ISMsm5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894950.1 protein_id gnl|my_center|LOCUS_16050 1834824 1834228 gene locus_tag LOCUS_16060 1834824 1834228 CDS product cadmium resistance transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053546291.1 protein_id gnl|my_center|LOCUS_16060 1835180 1834821 gene locus_tag LOCUS_16070 1835180 1834821 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776291.1 protein_id gnl|my_center|LOCUS_16070 1835476 1836456 gene locus_tag LOCUS_16080 1835476 1836456 CDS product Abi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083539905.1 protein_id gnl|my_center|LOCUS_16080 1838299 1836794 gene locus_tag LOCUS_16090 1838299 1836794 CDS product multicopper oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110043.1 protein_id gnl|my_center|LOCUS_16090 1838958 1838512 gene locus_tag LOCUS_16100 1838958 1838512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 1839109 1839318 gene locus_tag LOCUS_16110 1839109 1839318 CDS product heavy-metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775998.1 protein_id gnl|my_center|LOCUS_16110 1839465 1841732 gene locus_tag LOCUS_16120 1839465 1841732 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225368.1 protein_id gnl|my_center|LOCUS_16120 1841785 1842057 gene locus_tag LOCUS_16130 1841785 1842057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 1842172 1842777 gene locus_tag LOCUS_16140 1842172 1842777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 1843016 1842705 gene locus_tag LOCUS_16150 1843016 1842705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 1843086 1844987 gene locus_tag LOCUS_16160 1843086 1844987 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777103.1 protein_id gnl|my_center|LOCUS_16160 1844999 1845367 gene locus_tag LOCUS_16170 1844999 1845367 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776001.1 protein_id gnl|my_center|LOCUS_16170 1845411 1845935 gene locus_tag LOCUS_16180 1845411 1845935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 1846308 1846090 gene locus_tag LOCUS_16190 1846308 1846090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 1846204 1846752 gene locus_tag LOCUS_16200 1846204 1846752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 1847038 1847793 gene locus_tag LOCUS_16210 1847038 1847793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 1848021 1848395 gene locus_tag LOCUS_16220 1848021 1848395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 1848468 1849235 gene locus_tag LOCUS_16230 1848468 1849235 CDS product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974477.1 protein_id gnl|my_center|LOCUS_16230 1850339 1849437 gene locus_tag LOCUS_16240 1850339 1849437 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015373.1 protein_id gnl|my_center|LOCUS_16240 1850866 1850495 gene locus_tag LOCUS_16250 1850866 1850495 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173849887.1 protein_id gnl|my_center|LOCUS_16250 1850959 1851423 gene locus_tag LOCUS_16260 1850959 1851423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 1851443 1851811 gene locus_tag LOCUS_16270 1851443 1851811 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776291.1 protein_id gnl|my_center|LOCUS_16270 1851745 1853724 gene locus_tag LOCUS_16280 1851745 1853724 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776290.1 protein_id gnl|my_center|LOCUS_16280 1853724 1854305 gene locus_tag LOCUS_16290 1853724 1854305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 1854345 1854977 gene locus_tag LOCUS_16300 1854345 1854977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 1855149 1856330 gene locus_tag LOCUS_16310 1855149 1856330 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227156.1 protein_id gnl|my_center|LOCUS_16310 1857388 1856702 gene locus_tag LOCUS_16320 1857388 1856702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 1857457 1857816 gene locus_tag LOCUS_16330 1857457 1857816 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776291.1 protein_id gnl|my_center|LOCUS_16330 1857813 1858409 gene locus_tag LOCUS_16340 1857813 1858409 CDS product cadmium resistance transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053546291.1 protein_id gnl|my_center|LOCUS_16340 1859365 1858412 gene locus_tag LOCUS_16350 1859365 1858412 CDS product IS630-like element ISMsm5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894950.1 protein_id gnl|my_center|LOCUS_16350 1861459 1860035 gene locus_tag LOCUS_16360 gene glnA 1861459 1860035 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775685.1 protein_id gnl|my_center|LOCUS_16360 1861718 1862158 gene locus_tag LOCUS_16370 1861718 1862158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 1863049 1862300 gene locus_tag LOCUS_16380 1863049 1862300 CDS product DUF4191 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775683.1 protein_id gnl|my_center|LOCUS_16380 1864206 1863148 gene locus_tag LOCUS_16390 gene lipA 1864206 1863148 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775682.1 protein_id gnl|my_center|LOCUS_16390 1864933 1864265 gene locus_tag LOCUS_16400 gene lipB 1864933 1864265 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895681.1 protein_id gnl|my_center|LOCUS_16400 1865068 1867041 gene locus_tag LOCUS_16410 1865068 1867041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 1867418 1867071 gene locus_tag LOCUS_16420 1867418 1867071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 1869427 1867637 gene locus_tag LOCUS_16430 gene sucB 1869427 1867637 CDS product 2-oxoglutarate dehydrogenase, E2 component, dihydrolipoamide succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224050.1 protein_id gnl|my_center|LOCUS_16430 1870855 1869482 gene locus_tag LOCUS_16440 gene lpdA 1870855 1869482 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030873385.1 protein_id gnl|my_center|LOCUS_16440 1872596 1871076 gene locus_tag LOCUS_16450 1872596 1871076 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775677.1 protein_id gnl|my_center|LOCUS_16450 1872942 1873865 gene locus_tag LOCUS_16460 1872942 1873865 CDS product PAC2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413968.1 protein_id gnl|my_center|LOCUS_16460 1874014 1875507 gene locus_tag LOCUS_16470 1874014 1875507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 1875749 1877347 gene locus_tag LOCUS_16480 1875749 1877347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 1877695 1877486 gene locus_tag LOCUS_16490 1877695 1877486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805039.1 protein_id gnl|my_center|LOCUS_16490 1877915 1880020 gene locus_tag LOCUS_16500 1877915 1880020 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805040.1 protein_id gnl|my_center|LOCUS_16500 1880147 1881829 gene locus_tag LOCUS_16510 1880147 1881829 CDS product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246465.1 protein_id gnl|my_center|LOCUS_16510 1881935 1882981 gene locus_tag LOCUS_16520 1881935 1882981 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974145.1 protein_id gnl|my_center|LOCUS_16520 1883272 1884858 gene locus_tag LOCUS_16530 1883272 1884858 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222114.1 protein_id gnl|my_center|LOCUS_16530 1884868 1885935 gene locus_tag LOCUS_16540 gene cydB 1884868 1885935 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222115.1 protein_id gnl|my_center|LOCUS_16540 1885943 1889950 gene locus_tag LOCUS_16550 1885943 1889950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16550 1892535 1889989 gene locus_tag LOCUS_16560 1892535 1889989 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929932.1 protein_id gnl|my_center|LOCUS_16560 1892674 1895400 gene locus_tag LOCUS_16570 1892674 1895400 CDS product bifunctional GNAT family N-acetyltransferase/acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224292.1 protein_id gnl|my_center|LOCUS_16570 1895512 1896111 gene locus_tag LOCUS_16580 1895512 1896111 CDS product DUF5998 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030492.1 protein_id gnl|my_center|LOCUS_16580 1896108 1897331 gene locus_tag LOCUS_16590 1896108 1897331 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030493.1 protein_id gnl|my_center|LOCUS_16590 1898414 1897404 gene locus_tag LOCUS_16600 1898414 1897404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 1899563 1898499 gene locus_tag LOCUS_16610 gene sepH 1899563 1898499 CDS product septation protein SepH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973165.1 protein_id gnl|my_center|LOCUS_16610 1899519 1899713 gene locus_tag LOCUS_16620 1899519 1899713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 1899907 1900206 gene locus_tag LOCUS_16630 1899907 1900206 CDS product DUF4193 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003993510.1 protein_id gnl|my_center|LOCUS_16630 1900911 1900330 gene locus_tag LOCUS_16640 1900911 1900330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 1901136 1901594 gene locus_tag LOCUS_16650 1901136 1901594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 1901664 1902461 gene locus_tag LOCUS_16660 1901664 1902461 CDS product DUF3710 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973152.1 protein_id gnl|my_center|LOCUS_16660 1902454 1902927 gene locus_tag LOCUS_16670 1902454 1902927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 1902968 1903717 gene locus_tag LOCUS_16680 1902968 1903717 CDS product DUF3159 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805054.1 protein_id gnl|my_center|LOCUS_16680 1904405 1903668 gene locus_tag LOCUS_16690 1904405 1903668 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973146.1 protein_id gnl|my_center|LOCUS_16690 1905145 1904408 gene locus_tag LOCUS_16700 1905145 1904408 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973145.1 protein_id gnl|my_center|LOCUS_16700 1905262 1907310 gene locus_tag LOCUS_16710 1905262 1907310 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742167.1 protein_id gnl|my_center|LOCUS_16710 1907307 1908623 gene locus_tag LOCUS_16720 1907307 1908623 CDS product TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805055.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16720 1908623 1908820 gene locus_tag LOCUS_16730 1908623 1908820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_16730 1909107 1911914 gene locus_tag LOCUS_16740 gene acnA 1909107 1911914 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805056.1 protein_id gnl|my_center|LOCUS_16740 1912516 1912007 gene locus_tag LOCUS_16750 1912516 1912007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 1914774 1912630 gene locus_tag LOCUS_16760 1914774 1912630 CDS product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224500.1 protein_id gnl|my_center|LOCUS_16760 1916187 1914895 gene locus_tag LOCUS_16770 1916187 1914895 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972895.1 protein_id gnl|my_center|LOCUS_16770 1916689 1916225 gene locus_tag LOCUS_16780 gene msrB 1916689 1916225 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804985.1 protein_id gnl|my_center|LOCUS_16780 1917185 1916682 gene locus_tag LOCUS_16790 1917185 1916682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 1917286 1918539 gene locus_tag LOCUS_16800 1917286 1918539 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047119416.1 protein_id gnl|my_center|LOCUS_16800 1919041 1918550 gene locus_tag LOCUS_16810 gene ybaK 1919041 1918550 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976757.1 protein_id gnl|my_center|LOCUS_16810 1919246 1920301 gene locus_tag LOCUS_16820 gene zapE 1919246 1920301 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485435.1 protein_id gnl|my_center|LOCUS_16820 1920320 1921057 gene locus_tag LOCUS_16830 1920320 1921057 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775799.1 protein_id gnl|my_center|LOCUS_16830 1921262 1921190 gene locus_tag LOCUS_t00350 1921262 1921190 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1921362 1921291 gene locus_tag LOCUS_t00360 1921362 1921291 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 1921491 1921418 gene locus_tag LOCUS_t00370 1921491 1921418 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1921776 1921848 gene locus_tag LOCUS_t00380 1921776 1921848 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1921999 1922931 gene locus_tag LOCUS_16840 1921999 1922931 CDS product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775690.1 protein_id gnl|my_center|LOCUS_16840 1922928 1923527 gene locus_tag LOCUS_16850 1922928 1923527 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230292.1 protein_id gnl|my_center|LOCUS_16850 1923527 1924462 gene locus_tag LOCUS_16860 gene fmt 1923527 1924462 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027805.1 protein_id gnl|my_center|LOCUS_16860 1924459 1926105 gene locus_tag LOCUS_16870 1924459 1926105 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805210.1 protein_id gnl|my_center|LOCUS_16870 1926248 1926913 gene locus_tag LOCUS_16880 gene rpe 1926248 1926913 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977361.1 protein_id gnl|my_center|LOCUS_16880 1927826 1926888 gene locus_tag LOCUS_16890 1927826 1926888 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261950.1 protein_id gnl|my_center|LOCUS_16890 1928262 1928999 gene locus_tag LOCUS_16900 gene pnuC 1928262 1928999 CDS product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805208.1 protein_id gnl|my_center|LOCUS_16900 1929065 1930099 gene locus_tag LOCUS_16910 gene ribD 1929065 1930099 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803669.1 protein_id gnl|my_center|LOCUS_16910 1930174 1932168 gene locus_tag LOCUS_16920 1930174 1932168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 1932165 1932650 gene locus_tag LOCUS_16930 gene ribH 1932165 1932650 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803672.1 protein_id gnl|my_center|LOCUS_16930 1932765 1933028 gene locus_tag LOCUS_16940 1932765 1933028 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929945.1 protein_id gnl|my_center|LOCUS_16940 1933059 1933904 gene locus_tag LOCUS_16950 gene hisG 1933059 1933904 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977387.1 protein_id gnl|my_center|LOCUS_16950 1933948 1934712 gene locus_tag LOCUS_16960 gene hisF 1933948 1934712 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976768.1 protein_id gnl|my_center|LOCUS_16960 1935432 1934767 gene locus_tag LOCUS_16970 1935432 1934767 CDS product TIGR03085 family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028115.1 protein_id gnl|my_center|LOCUS_16970 1935520 1936005 gene locus_tag LOCUS_16980 1935520 1936005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 1936002 1937630 gene locus_tag LOCUS_16990 1936002 1937630 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224165.1 protein_id gnl|my_center|LOCUS_16990 1937627 1938283 gene locus_tag LOCUS_17000 1937627 1938283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 1938350 1938613 gene locus_tag LOCUS_17010 1938350 1938613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 1938747 1939583 gene locus_tag LOCUS_17020 gene trpC 1938747 1939583 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028110.1 protein_id gnl|my_center|LOCUS_17020 1939580 1941049 gene locus_tag LOCUS_17030 gene trpB 1939580 1941049 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930205.1 protein_id gnl|my_center|LOCUS_17030 1941046 1942014 gene locus_tag LOCUS_17040 gene trpA 1941046 1942014 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908239.1 protein_id gnl|my_center|LOCUS_17040 1942011 1942898 gene locus_tag LOCUS_17050 gene lgt 1942011 1942898 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971316.1 protein_id gnl|my_center|LOCUS_17050 1942936 1947837 gene locus_tag LOCUS_17060 gene gltB 1942936 1947837 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028104.1 protein_id gnl|my_center|LOCUS_17060 1947830 1949290 gene locus_tag LOCUS_17070 1947830 1949290 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005062753.1 protein_id gnl|my_center|LOCUS_17070 1949962 1949411 gene locus_tag LOCUS_17080 1949962 1949411 CDS product flavodoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949081.1 protein_id gnl|my_center|LOCUS_17080 1950102 1951571 gene locus_tag LOCUS_17090 gene pyk 1950102 1951571 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805095.1 protein_id gnl|my_center|LOCUS_17090 1951670 1951754 gene locus_tag LOCUS_t00390 1951670 1951754 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1954769 1951791 gene locus_tag LOCUS_17100 1954769 1951791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 1955094 1955558 gene locus_tag LOCUS_17110 1955094 1955558 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776962.1 protein_id gnl|my_center|LOCUS_17110 1955768 1956442 gene locus_tag LOCUS_17120 1955768 1956442 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976804.1 protein_id gnl|my_center|LOCUS_17120 1956943 1956485 gene locus_tag LOCUS_17130 1956943 1956485 CDS product hotdog fold thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976812.1 protein_id gnl|my_center|LOCUS_17130 1957014 1959782 gene locus_tag LOCUS_17140 gene polA 1957014 1959782 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805099.1 protein_id gnl|my_center|LOCUS_17140 1959838 1961319 gene locus_tag LOCUS_17150 1959838 1961319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 1961556 1963028 gene locus_tag LOCUS_17160 gene rpsA 1961556 1963028 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976820.1 protein_id gnl|my_center|LOCUS_17160 1963997 1963236 gene locus_tag LOCUS_17170 1963997 1963236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 1964252 1965001 gene locus_tag LOCUS_17180 1964252 1965001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 1965223 1965843 gene locus_tag LOCUS_17190 1965223 1965843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 1966594 1965857 gene locus_tag LOCUS_17200 1966594 1965857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 1967993 1966527 gene locus_tag LOCUS_17210 1967993 1966527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 1968145 1969962 gene locus_tag LOCUS_17220 1968145 1969962 CDS product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804020.1 protein_id gnl|my_center|LOCUS_17220 1970145 1971650 gene locus_tag LOCUS_17230 1970145 1971650 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027916.1 protein_id gnl|my_center|LOCUS_17230 1971678 1973006 gene locus_tag LOCUS_17240 1971678 1973006 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005095203.1 protein_id gnl|my_center|LOCUS_17240 1973957 1973034 gene locus_tag LOCUS_17250 1973957 1973034 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533169.1 protein_id gnl|my_center|LOCUS_17250 1974096 1975523 gene locus_tag LOCUS_17260 1974096 1975523 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_159656430.1 protein_id gnl|my_center|LOCUS_17260 1975600 1977126 gene locus_tag LOCUS_17270 1975600 1977126 CDS product GMC family oxidoreductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887610.1 protein_id gnl|my_center|LOCUS_17270 1977286 1979487 gene locus_tag LOCUS_17280 gene uvrB 1977286 1979487 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028069.1 protein_id gnl|my_center|LOCUS_17280 1979499 1980545 gene locus_tag LOCUS_17290 1979499 1980545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 1980946 1981248 gene locus_tag LOCUS_17300 1980946 1981248 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000165196.1 protein_id gnl|my_center|LOCUS_17300 1982107 1981493 gene locus_tag LOCUS_17310 1982107 1981493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 1982432 1982764 gene locus_tag LOCUS_17320 1982432 1982764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 1982863 1984029 gene locus_tag LOCUS_17330 1982863 1984029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 1984029 1985732 gene locus_tag LOCUS_17340 1984029 1985732 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116957511.1 protein_id gnl|my_center|LOCUS_17340 1986756 1986262 gene locus_tag LOCUS_17350 1986756 1986262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_17350 1987288 1986770 gene locus_tag LOCUS_17360 1987288 1986770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17360 1987966 1987520 gene locus_tag LOCUS_17370 1987966 1987520 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815987.1 protein_id gnl|my_center|LOCUS_17370 1988259 1989689 gene locus_tag LOCUS_17380 1988259 1989689 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804724.1 protein_id gnl|my_center|LOCUS_17380 1990061 1989825 gene locus_tag LOCUS_17390 1990061 1989825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 1990353 1991552 gene locus_tag LOCUS_17400 1990353 1991552 CDS product TerC/Alx family metal homeostasis membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_179943937.1 protein_id gnl|my_center|LOCUS_17400 1991682 1992017 gene locus_tag LOCUS_17410 1991682 1992017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 1992050 1993015 gene locus_tag LOCUS_17420 1992050 1993015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 1993041 1993781 gene locus_tag LOCUS_17430 1993041 1993781 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038535056.1 protein_id gnl|my_center|LOCUS_17430 1993814 1997233 gene locus_tag LOCUS_17440 gene dnaE 1993814 1997233 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027948.1 protein_id gnl|my_center|LOCUS_17440 1997530 1997261 gene locus_tag LOCUS_17450 gene yoeB 1997530 1997261 CDS product type II toxin-antitoxin system mRNA interferase toxin YoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767829.1 protein_id gnl|my_center|LOCUS_17450 1997774 1997523 gene locus_tag LOCUS_17460 gene yefM 1997774 1997523 CDS product YoeB-YefM toxin-antitoxin system antitoxin YefM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815401.1 protein_id gnl|my_center|LOCUS_17460 1997996 1999282 gene locus_tag LOCUS_17470 1997996 1999282 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085746.1 protein_id gnl|my_center|LOCUS_17470 1999433 2001448 gene locus_tag LOCUS_17480 gene thrS 1999433 2001448 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804992.1 protein_id gnl|my_center|LOCUS_17480 2002033 2001527 gene locus_tag LOCUS_17490 2002033 2001527 CDS product FBP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978065.1 protein_id gnl|my_center|LOCUS_17490 2002148 2002714 gene locus_tag LOCUS_17500 2002148 2002714 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804993.1 protein_id gnl|my_center|LOCUS_17500 2003333 2002728 gene locus_tag LOCUS_17510 2003333 2002728 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015078.1 protein_id gnl|my_center|LOCUS_17510 2004586 2003465 gene locus_tag LOCUS_17520 2004586 2003465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 2006720 2004579 gene locus_tag LOCUS_17530 2006720 2004579 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226475.1 protein_id gnl|my_center|LOCUS_17530 2006774 2008066 gene locus_tag LOCUS_17540 2006774 2008066 CDS product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068484.1 protein_id gnl|my_center|LOCUS_17540 2008069 2008842 gene locus_tag LOCUS_17550 2008069 2008842 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114099.1 protein_id gnl|my_center|LOCUS_17550 2008975 2009736 gene locus_tag LOCUS_17560 2008975 2009736 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977306.1 protein_id gnl|my_center|LOCUS_17560 2009726 2010382 gene locus_tag LOCUS_17570 2009726 2010382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 2010439 2011056 gene locus_tag LOCUS_17580 gene ruvA 2010439 2011056 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728708.1 protein_id gnl|my_center|LOCUS_17580 2011148 2012182 gene locus_tag LOCUS_17590 gene ruvB 2011148 2012182 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977309.1 protein_id gnl|my_center|LOCUS_17590 2012288 2012782 gene locus_tag LOCUS_17600 2012288 2012782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 2012874 2014694 gene locus_tag LOCUS_17610 gene secD 2012874 2014694 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805000.1 protein_id gnl|my_center|LOCUS_17610 2014687 2015826 gene locus_tag LOCUS_17620 gene secF 2014687 2015826 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805001.1 protein_id gnl|my_center|LOCUS_17620 2015903 2018248 gene locus_tag LOCUS_17630 gene relA 2015903 2018248 CDS product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977314.1 protein_id gnl|my_center|LOCUS_17630 2018924 2018217 gene locus_tag LOCUS_17640 2018924 2018217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 2020286 2019015 gene locus_tag LOCUS_17650 2020286 2019015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17650 2020270 2020482 gene locus_tag LOCUS_17660 2020270 2020482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 2020656 2022014 gene locus_tag LOCUS_17670 gene hisS 2020656 2022014 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805006.1 protein_id gnl|my_center|LOCUS_17670 2022152 2023921 gene locus_tag LOCUS_17680 gene aspS 2022152 2023921 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805009.1 protein_id gnl|my_center|LOCUS_17680 2024046 2024498 gene locus_tag LOCUS_17690 gene dtd 2024046 2024498 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029487.1 protein_id gnl|my_center|LOCUS_17690 2024524 2026056 gene locus_tag LOCUS_17700 2024524 2026056 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977320.1 protein_id gnl|my_center|LOCUS_17700 2026317 2026958 gene locus_tag LOCUS_17710 gene rpsD 2026317 2026958 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775672.1 protein_id gnl|my_center|LOCUS_17710 2027172 2027567 gene locus_tag LOCUS_17720 2027172 2027567 CDS product DUF948 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224580.1 protein_id gnl|my_center|LOCUS_17720 2027564 2028016 gene locus_tag LOCUS_17730 2027564 2028016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 2028019 2030703 gene locus_tag LOCUS_17740 gene alaS 2028019 2030703 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977325.1 protein_id gnl|my_center|LOCUS_17740 2030735 2031298 gene locus_tag LOCUS_17750 gene ruvX 2030735 2031298 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775670.1 protein_id gnl|my_center|LOCUS_17750 2031295 2032506 gene locus_tag LOCUS_17760 gene mltG 2031295 2032506 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775669.1 protein_id gnl|my_center|LOCUS_17760 2032497 2033474 gene locus_tag LOCUS_17770 2032497 2033474 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005114425.1 protein_id gnl|my_center|LOCUS_17770 2033626 2034846 gene locus_tag LOCUS_17780 gene aroC 2033626 2034846 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977330.1 protein_id gnl|my_center|LOCUS_17780 2034843 2035412 gene locus_tag LOCUS_17790 2034843 2035412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_17790 2035409 2036524 gene locus_tag LOCUS_17800 gene aroB 2035409 2036524 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027813.1 protein_id gnl|my_center|LOCUS_17800 2036664 2037227 gene locus_tag LOCUS_17810 gene efp 2036664 2037227 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224610.1 protein_id gnl|my_center|LOCUS_17810 2037248 2037634 gene locus_tag LOCUS_17820 gene nusB 2037248 2037634 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977336.1 protein_id gnl|my_center|LOCUS_17820 2037767 2038438 gene locus_tag LOCUS_17830 gene pyrR 2037767 2038438 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805074.1 protein_id gnl|my_center|LOCUS_17830 2038435 2039436 gene locus_tag LOCUS_17840 2038435 2039436 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027811.1 protein_id gnl|my_center|LOCUS_17840 2039429 2040787 gene locus_tag LOCUS_17850 2039429 2040787 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977340.1 protein_id gnl|my_center|LOCUS_17850 2040784 2041365 gene locus_tag LOCUS_17860 2040784 2041365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 2041374 2042570 gene locus_tag LOCUS_17870 gene carA 2041374 2042570 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027810.1 protein_id gnl|my_center|LOCUS_17870 2042575 2045898 gene locus_tag LOCUS_17880 gene carB 2042575 2045898 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977343.1 protein_id gnl|my_center|LOCUS_17880 2045895 2046806 gene locus_tag LOCUS_17890 gene pyrF 2045895 2046806 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485777.1 protein_id gnl|my_center|LOCUS_17890 2046965 2047279 gene locus_tag LOCUS_17900 gene mihF 2046965 2047279 CDS product integration host factor, actinobacterial type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_110106423.1 protein_id gnl|my_center|LOCUS_17900 2047284 2047868 gene locus_tag LOCUS_17910 gene gmk 2047284 2047868 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805082.1 protein_id gnl|my_center|LOCUS_17910 2047987 2048448 gene locus_tag LOCUS_17920 2047987 2048448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 2048611 2049918 gene locus_tag LOCUS_17930 gene coaBC 2048611 2049918 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485775.1 protein_id gnl|my_center|LOCUS_17930 2049975 2051177 gene locus_tag LOCUS_17940 gene metK 2049975 2051177 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894439.1 protein_id gnl|my_center|LOCUS_17940 2051202 2053313 gene locus_tag LOCUS_17950 2051202 2053313 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027807.1 protein_id gnl|my_center|LOCUS_17950 2053455 2054735 gene locus_tag LOCUS_17960 2053455 2054735 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014119.1 protein_id gnl|my_center|LOCUS_17960 2054732 2055970 gene locus_tag LOCUS_17970 2054732 2055970 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014119.1 protein_id gnl|my_center|LOCUS_17970 2057057 2055921 gene locus_tag LOCUS_17980 2057057 2055921 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391749.1 protein_id gnl|my_center|LOCUS_17980 2058058 2057054 gene locus_tag LOCUS_17990 2058058 2057054 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055490.1 protein_id gnl|my_center|LOCUS_17990 2058176 2060683 gene locus_tag LOCUS_18000 gene leuS 2058176 2060683 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082796.1 protein_id gnl|my_center|LOCUS_18000 2060820 2061755 gene locus_tag LOCUS_18010 2060820 2061755 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223549.1 protein_id gnl|my_center|LOCUS_18010 2061880 2062791 gene locus_tag LOCUS_18020 2061880 2062791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 2062793 2064688 gene locus_tag LOCUS_18030 2062793 2064688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 2064619 2065623 gene locus_tag LOCUS_18040 2064619 2065623 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775770.1 protein_id gnl|my_center|LOCUS_18040 2066074 2065811 gene locus_tag LOCUS_18050 gene rpsT 2066074 2065811 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775769.1 protein_id gnl|my_center|LOCUS_18050 2066840 2066289 gene locus_tag LOCUS_18060 2066840 2066289 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775768.1 protein_id gnl|my_center|LOCUS_18060 2067073 2068935 gene locus_tag LOCUS_18070 gene lepA 2067073 2068935 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775765.1 protein_id gnl|my_center|LOCUS_18070 2068932 2070161 gene locus_tag LOCUS_18080 gene hemW 2068932 2070161 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326185.1 protein_id gnl|my_center|LOCUS_18080 2070666 2070247 gene locus_tag LOCUS_18090 2070666 2070247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 2071660 2070800 gene locus_tag LOCUS_18100 2071660 2070800 CDS product DUF3097 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775761.1 protein_id gnl|my_center|LOCUS_18100 2071936 2072973 gene locus_tag LOCUS_18110 gene hrcA 2071936 2072973 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976249.1 protein_id gnl|my_center|LOCUS_18110 2073045 2074184 gene locus_tag LOCUS_18120 gene dnaJ 2073045 2074184 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976250.1 protein_id gnl|my_center|LOCUS_18120 2074209 2075054 gene locus_tag LOCUS_18130 2074209 2075054 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775758.1 protein_id gnl|my_center|LOCUS_18130 2075166 2076269 gene locus_tag LOCUS_18140 2075166 2076269 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976271.1 protein_id gnl|my_center|LOCUS_18140 2076266 2076763 gene locus_tag LOCUS_18150 gene ybeY 2076266 2076763 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005060346.1 protein_id gnl|my_center|LOCUS_18150 2076776 2078059 gene locus_tag LOCUS_18160 2076776 2078059 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228398.1 protein_id gnl|my_center|LOCUS_18160 2078062 2079087 gene locus_tag LOCUS_18170 gene era 2078062 2079087 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326176.1 protein_id gnl|my_center|LOCUS_18170 2079164 2080633 gene locus_tag LOCUS_18180 2079164 2080633 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486662.1 protein_id gnl|my_center|LOCUS_18180 2080878 2082611 gene locus_tag LOCUS_18190 gene leuA 2080878 2082611 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930223.1 protein_id gnl|my_center|LOCUS_18190 2082705 2083466 gene locus_tag LOCUS_18200 gene recO 2082705 2083466 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228390.1 protein_id gnl|my_center|LOCUS_18200 2083463 2084248 gene locus_tag LOCUS_18210 2083463 2084248 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775743.1 protein_id gnl|my_center|LOCUS_18210 2084297 2085409 gene locus_tag LOCUS_18220 2084297 2085409 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977344.1 protein_id gnl|my_center|LOCUS_18220 2086158 2085418 gene locus_tag LOCUS_18230 2086158 2085418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 2086157 2087593 gene locus_tag LOCUS_18240 2086157 2087593 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805011.1 protein_id gnl|my_center|LOCUS_18240 2087695 2088060 gene locus_tag LOCUS_18250 gene erpA 2087695 2088060 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805013.1 protein_id gnl|my_center|LOCUS_18250 2088375 2089241 gene locus_tag LOCUS_18260 gene coxB 2088375 2089241 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805014.1 protein_id gnl|my_center|LOCUS_18260 2089252 2090955 gene locus_tag LOCUS_18270 gene ctaD 2089252 2090955 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976660.1 protein_id gnl|my_center|LOCUS_18270 2090971 2091372 gene locus_tag LOCUS_18280 2090971 2091372 CDS product cytochrome c oxidase subunit 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976661.1 protein_id gnl|my_center|LOCUS_18280 2094526 2092895 gene locus_tag LOCUS_18290 2094526 2092895 CDS product cytochrome bc complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805018.1 protein_id gnl|my_center|LOCUS_18290 2095620 2094529 gene locus_tag LOCUS_18300 2095620 2094529 CDS product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976666.1 protein_id gnl|my_center|LOCUS_18300 2096467 2095676 gene locus_tag LOCUS_18310 2096467 2095676 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805020.1 protein_id gnl|my_center|LOCUS_18310 2097160 2096522 gene locus_tag LOCUS_18320 2097160 2096522 CDS product heme-copper oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976664.1 protein_id gnl|my_center|LOCUS_18320 2097386 2097231 gene locus_tag LOCUS_18330 2097386 2097231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 2097418 2098497 gene locus_tag LOCUS_18340 gene trpD 2097418 2098497 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028166.1 protein_id gnl|my_center|LOCUS_18340 2098924 2098520 gene locus_tag LOCUS_18350 2098924 2098520 CDS product DUF3054 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079821.1 protein_id gnl|my_center|LOCUS_18350 2099130 2099609 gene locus_tag LOCUS_18360 2099130 2099609 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977025.1 protein_id gnl|my_center|LOCUS_18360 2099673 2100848 gene locus_tag LOCUS_18370 2099673 2100848 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027982.1 protein_id gnl|my_center|LOCUS_18370 2100989 2101324 gene locus_tag LOCUS_18380 2100989 2101324 CDS product RNA polymerase-binding protein RbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805194.1 protein_id gnl|my_center|LOCUS_18380 2102248 2101493 gene locus_tag LOCUS_18390 2102248 2101493 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895306.1 protein_id gnl|my_center|LOCUS_18390 2103242 2102373 gene locus_tag LOCUS_18400 2103242 2102373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 2106109 2103239 gene locus_tag LOCUS_18410 2106109 2103239 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027893.1 protein_id gnl|my_center|LOCUS_18410 2107042 2106182 gene locus_tag LOCUS_18420 gene tatC 2107042 2106182 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977194.1 protein_id gnl|my_center|LOCUS_18420 2107351 2107052 gene locus_tag LOCUS_18430 gene tatA 2107351 2107052 CDS product Sec-independent protein translocase subunit TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410768.1 protein_id gnl|my_center|LOCUS_18430 2107712 2107344 gene locus_tag LOCUS_18440 2107712 2107344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 2109873 2107786 gene locus_tag LOCUS_18450 2109873 2107786 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805203.1 protein_id gnl|my_center|LOCUS_18450 2110321 2109926 gene locus_tag LOCUS_18460 2110321 2109926 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805213.1 protein_id gnl|my_center|LOCUS_18460 2111341 2110355 gene locus_tag LOCUS_18470 2111341 2110355 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068443.1 protein_id gnl|my_center|LOCUS_18470 2112887 2111445 gene locus_tag LOCUS_18480 gene pafA 2112887 2111445 CDS product Pup--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005061320.1 protein_id gnl|my_center|LOCUS_18480 2113093 2112893 gene locus_tag LOCUS_18490 2113093 2112893 CDS product ubiquitin-like protein Pup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027899.1 protein_id gnl|my_center|LOCUS_18490 2114716 2113130 gene locus_tag LOCUS_18500 gene dop 2114716 2113130 CDS product depupylase/deamidase Dop inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775655.1 protein_id gnl|my_center|LOCUS_18500 2116419 2114713 gene locus_tag LOCUS_18510 gene arc 2116419 2114713 CDS product proteasome ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027900.1 protein_id gnl|my_center|LOCUS_18510 2117539 2116466 gene locus_tag LOCUS_18520 2117539 2116466 CDS product tRNA (adenine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929946.1 protein_id gnl|my_center|LOCUS_18520 2118700 2117651 gene locus_tag LOCUS_18530 2118700 2117651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_18530 2120076 2118748 gene locus_tag LOCUS_18540 gene mshC 2120076 2118748 CDS product cysteine--1-D-myo-inosityl 2-amino-2-deoxy-alpha-D-glucopyranoside ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977162.1 protein_id gnl|my_center|LOCUS_18540 2120951 2120154 gene locus_tag LOCUS_18550 2120951 2120154 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775661.1 protein_id gnl|my_center|LOCUS_18550 2121401 2121096 gene locus_tag LOCUS_18560 2121401 2121096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 2122512 2121547 gene locus_tag LOCUS_18570 2122512 2121547 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112440.1 protein_id gnl|my_center|LOCUS_18570 2122821 2122735 gene locus_tag LOCUS_t00400 2122821 2122735 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2123933 2122962 gene locus_tag LOCUS_18580 2123933 2122962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 2125270 2123930 gene locus_tag LOCUS_18590 2125270 2123930 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776345.1 protein_id gnl|my_center|LOCUS_18590 2126700 2125402 gene locus_tag LOCUS_18600 2126700 2125402 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776346.1 protein_id gnl|my_center|LOCUS_18600 2126798 2127517 gene locus_tag LOCUS_18610 2126798 2127517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 2127586 2129727 gene locus_tag LOCUS_18620 2127586 2129727 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776348.1 protein_id gnl|my_center|LOCUS_18620 2129852 2132455 gene locus_tag LOCUS_18630 gene pepN 2129852 2132455 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326219.1 protein_id gnl|my_center|LOCUS_18630 2132527 2133909 gene locus_tag LOCUS_18640 2132527 2133909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 2133909 2135573 gene locus_tag LOCUS_18650 2133909 2135573 CDS product AarF/UbiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941749.1 protein_id gnl|my_center|LOCUS_18650 2136633 2135608 gene locus_tag LOCUS_18660 2136633 2135608 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804560.1 protein_id gnl|my_center|LOCUS_18660 2137072 2136812 gene locus_tag LOCUS_18670 2137072 2136812 CDS product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858446.1 protein_id gnl|my_center|LOCUS_18670 2138133 2137198 gene locus_tag LOCUS_18680 2138133 2137198 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930212.1 protein_id gnl|my_center|LOCUS_18680 2138918 2138130 gene locus_tag LOCUS_18690 2138918 2138130 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805182.1 protein_id gnl|my_center|LOCUS_18690 2139625 2139017 gene locus_tag LOCUS_18700 2139625 2139017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 2140637 2139966 gene locus_tag LOCUS_18710 2140637 2139966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 2141211 2140777 gene locus_tag LOCUS_18720 2141211 2140777 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036347.1 protein_id gnl|my_center|LOCUS_18720 2141362 2142504 gene locus_tag LOCUS_18730 2141362 2142504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 2143303 2142560 gene locus_tag LOCUS_18740 2143303 2142560 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776018.1 protein_id gnl|my_center|LOCUS_18740 2144154 2143417 gene locus_tag LOCUS_18750 2144154 2143417 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805189.1 protein_id gnl|my_center|LOCUS_18750 2144361 2144813 gene locus_tag LOCUS_18760 2144361 2144813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 2144804 2145049 gene locus_tag LOCUS_18770 2144804 2145049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 2145107 2146093 gene locus_tag LOCUS_18780 2145107 2146093 CDS product SURF1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805192.1 protein_id gnl|my_center|LOCUS_18780 2147746 2146148 gene locus_tag LOCUS_18790 2147746 2146148 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976982.1 protein_id gnl|my_center|LOCUS_18790 2148211 2147876 gene locus_tag LOCUS_18800 2148211 2147876 CDS product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805068.1 protein_id gnl|my_center|LOCUS_18800 2148981 2148208 gene locus_tag LOCUS_18810 gene sufC 2148981 2148208 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805067.1 protein_id gnl|my_center|LOCUS_18810 2150341 2149034 gene locus_tag LOCUS_18820 gene sufD 2150341 2149034 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805065.1 protein_id gnl|my_center|LOCUS_18820 2151803 2150346 gene locus_tag LOCUS_18830 gene sufB 2151803 2150346 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976894.1 protein_id gnl|my_center|LOCUS_18830 2152593 2151796 gene locus_tag LOCUS_18840 2152593 2151796 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742174.1 protein_id gnl|my_center|LOCUS_18840 2152690 2153757 gene locus_tag LOCUS_18850 2152690 2153757 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976891.1 protein_id gnl|my_center|LOCUS_18850 2153754 2154542 gene locus_tag LOCUS_18860 2153754 2154542 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805060.1 protein_id gnl|my_center|LOCUS_18860 2154950 2154708 gene locus_tag LOCUS_18870 2154950 2154708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 2154838 2155803 gene locus_tag LOCUS_18880 2154838 2155803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 2156816 2155839 gene locus_tag LOCUS_18890 2156816 2155839 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805128.1 protein_id gnl|my_center|LOCUS_18890 2157175 2159283 gene locus_tag LOCUS_18900 gene tkt 2157175 2159283 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167022841.1 protein_id gnl|my_center|LOCUS_18900 2159329 2160429 gene locus_tag LOCUS_18910 gene tal 2159329 2160429 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976882.1 protein_id gnl|my_center|LOCUS_18910 2160522 2162072 gene locus_tag LOCUS_18920 gene zwf 2160522 2162072 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805125.1 protein_id gnl|my_center|LOCUS_18920 2162072 2163061 gene locus_tag LOCUS_18930 2162072 2163061 CDS product glucose-6-phosphate dehydrogenase assembly protein OpcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_122823891.1 protein_id gnl|my_center|LOCUS_18930 2163054 2163881 gene locus_tag LOCUS_18940 gene pgl 2163054 2163881 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407433.1 protein_id gnl|my_center|LOCUS_18940 2164262 2164014 gene locus_tag LOCUS_18950 gene secG 2164262 2164014 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004115170.1 protein_id gnl|my_center|LOCUS_18950 2165280 2164468 gene locus_tag LOCUS_18960 gene tpiA 2165280 2164468 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976873.1 protein_id gnl|my_center|LOCUS_18960 2166553 2165330 gene locus_tag LOCUS_18970 2166553 2165330 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224667.1 protein_id gnl|my_center|LOCUS_18970 2167610 2166606 gene locus_tag LOCUS_18980 gene gap 2167610 2166606 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224666.1 protein_id gnl|my_center|LOCUS_18980 2167937 2167725 gene locus_tag LOCUS_18990 2167937 2167725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 2168905 2167934 gene locus_tag LOCUS_19000 gene whiA 2168905 2167934 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901156.1 protein_id gnl|my_center|LOCUS_19000 2170040 2169015 gene locus_tag LOCUS_19010 gene yvcK 2170040 2169015 CDS product uridine diphosphate-N-acetylglucosamine-binding protein YvcK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805118.1 protein_id gnl|my_center|LOCUS_19010 2171019 2170045 gene locus_tag LOCUS_19020 gene rapZ 2171019 2170045 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093455885.1 protein_id gnl|my_center|LOCUS_19020 2173167 2171146 gene locus_tag LOCUS_19030 gene uvrC 2173167 2171146 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728800.1 protein_id gnl|my_center|LOCUS_19030 2173905 2173219 gene locus_tag LOCUS_19040 2173905 2173219 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007447704.1 protein_id gnl|my_center|LOCUS_19040 2174762 2174034 gene locus_tag LOCUS_19050 2174762 2174034 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027441.1 protein_id gnl|my_center|LOCUS_19050 2177665 2174759 gene locus_tag LOCUS_19060 gene uvrA 2177665 2174759 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895254.1 protein_id gnl|my_center|LOCUS_19060 2177947 2178615 gene locus_tag LOCUS_19070 2177947 2178615 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805114.1 protein_id gnl|my_center|LOCUS_19070 2180444 2178750 gene locus_tag LOCUS_19080 2180444 2178750 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925143.1 protein_id gnl|my_center|LOCUS_19080 2180585 2183257 gene locus_tag LOCUS_19090 2180585 2183257 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222778.1 protein_id gnl|my_center|LOCUS_19090 2183254 2184675 gene locus_tag LOCUS_19100 2183254 2184675 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027368.1 protein_id gnl|my_center|LOCUS_19100 2184842 2185345 gene locus_tag LOCUS_19110 2184842 2185345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 2186230 2185439 gene locus_tag LOCUS_19120 2186230 2185439 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_203416553.1 protein_id gnl|my_center|LOCUS_19120 2186375 2187223 gene locus_tag LOCUS_19130 2186375 2187223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 2188623 2187922 gene locus_tag LOCUS_19140 2188623 2187922 CDS product biotin/lipoate A/B protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903895.1 protein_id gnl|my_center|LOCUS_19140 2188788 2190014 gene locus_tag LOCUS_19150 2188788 2190014 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727675.1 protein_id gnl|my_center|LOCUS_19150 2190669 2190055 gene locus_tag LOCUS_19160 2190669 2190055 CDS product SRPBCC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804012.1 protein_id gnl|my_center|LOCUS_19160 2191775 2190798 gene locus_tag LOCUS_19170 gene nrdF 2191775 2190798 CDS product class 1b ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070938867.1 protein_id gnl|my_center|LOCUS_19170 2194020 2191837 gene locus_tag LOCUS_19180 gene nrdE 2194020 2191837 CDS product class 1b ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876938.1 protein_id gnl|my_center|LOCUS_19180 2194499 2193987 gene locus_tag LOCUS_19190 gene nrdI 2194499 2193987 CDS product class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776780.1 protein_id gnl|my_center|LOCUS_19190 2194852 2194616 gene locus_tag LOCUS_19200 gene nrdH 2194852 2194616 CDS product glutaredoxin-like protein NrdH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930015.1 protein_id gnl|my_center|LOCUS_19200 2196265 2195180 gene locus_tag LOCUS_19210 2196265 2195180 CDS product DUF2183 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930149.1 protein_id gnl|my_center|LOCUS_19210 2196345 2197379 gene locus_tag LOCUS_19220 2196345 2197379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 2198151 2197354 gene locus_tag LOCUS_19230 2198151 2197354 CDS product urease accessory protein UreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027661.1 protein_id gnl|my_center|LOCUS_19230 2198984 2198148 gene locus_tag LOCUS_19240 gene ureG 2198984 2198148 CDS product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803979.1 protein_id gnl|my_center|LOCUS_19240 2199681 2198977 gene locus_tag LOCUS_19250 2199681 2198977 CDS product urease accessory UreF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729212.1 protein_id gnl|my_center|LOCUS_19250 2201418 2199691 gene locus_tag LOCUS_19260 2201418 2199691 CDS product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079396.1 protein_id gnl|my_center|LOCUS_19260 2201759 2201415 gene locus_tag LOCUS_19270 2201759 2201415 CDS product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230176.1 protein_id gnl|my_center|LOCUS_19270 2202055 2201756 gene locus_tag LOCUS_19280 2202055 2201756 CDS product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003525618.1 protein_id gnl|my_center|LOCUS_19280 2202247 2203968 gene locus_tag LOCUS_19290 2202247 2203968 CDS product allantoin permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111162.1 protein_id gnl|my_center|LOCUS_19290 2204115 2205518 gene locus_tag LOCUS_19300 2204115 2205518 CDS product anion permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233725.1 protein_id gnl|my_center|LOCUS_19300 2206436 2205675 gene locus_tag LOCUS_19310 2206436 2205675 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803868.1 protein_id gnl|my_center|LOCUS_19310 2206812 2206441 gene locus_tag LOCUS_19320 2206812 2206441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 2206724 2207248 gene locus_tag LOCUS_19330 2206724 2207248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 2207894 2207430 gene locus_tag LOCUS_19340 2207894 2207430 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000965180.1 protein_id gnl|my_center|LOCUS_19340 2208016 2207943 gene locus_tag LOCUS_t00410 2208016 2207943 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 2208206 2208727 gene locus_tag LOCUS_19350 2208206 2208727 CDS product tryptophan-rich sensory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222428.1 protein_id gnl|my_center|LOCUS_19350 2208749 2209153 gene locus_tag LOCUS_19360 2208749 2209153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 2209154 2209468 gene locus_tag LOCUS_19370 2209154 2209468 CDS product SMR family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777070.1 protein_id gnl|my_center|LOCUS_19370 2209607 2210032 gene locus_tag LOCUS_19380 2209607 2210032 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226860.1 protein_id gnl|my_center|LOCUS_19380 2210319 2210244 gene locus_tag LOCUS_t00420 2210319 2210244 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 2210894 2210469 gene locus_tag LOCUS_19390 gene rsfS 2210894 2210469 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003067112.1 protein_id gnl|my_center|LOCUS_19390 2211780 2210995 gene locus_tag LOCUS_19400 2211780 2210995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 2212649 2211831 gene locus_tag LOCUS_19410 2212649 2211831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 2212936 2212703 gene locus_tag LOCUS_19420 2212936 2212703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 2214314 2213007 gene locus_tag LOCUS_19430 2214314 2213007 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775851.1 protein_id gnl|my_center|LOCUS_19430 2215549 2214347 gene locus_tag LOCUS_19440 gene proB 2215549 2214347 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028438.1 protein_id gnl|my_center|LOCUS_19440 2217374 2215638 gene locus_tag LOCUS_19450 gene obgE 2217374 2215638 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775853.1 protein_id gnl|my_center|LOCUS_19450 2217685 2217428 gene locus_tag LOCUS_19460 gene rpmA 2217685 2217428 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976205.1 protein_id gnl|my_center|LOCUS_19460 2218042 2217731 gene locus_tag LOCUS_19470 gene rplU 2218042 2217731 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775855.1 protein_id gnl|my_center|LOCUS_19470 2221416 2218258 gene locus_tag LOCUS_19480 2221416 2218258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_19480 2221942 2222577 gene locus_tag LOCUS_19490 2221942 2222577 CDS product vitamin K epoxide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908466.1 protein_id gnl|my_center|LOCUS_19490 2223156 2222743 gene locus_tag LOCUS_19500 gene ndk 2223156 2222743 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412592.1 protein_id gnl|my_center|LOCUS_19500 2224499 2223240 gene locus_tag LOCUS_19510 2224499 2223240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 2224939 2224496 gene locus_tag LOCUS_19520 2224939 2224496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 2226612 2224927 gene locus_tag LOCUS_19530 2226612 2224927 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228491.1 protein_id gnl|my_center|LOCUS_19530 2229920 2226621 gene locus_tag LOCUS_19540 gene ileS 2229920 2226621 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804609.1 protein_id gnl|my_center|LOCUS_19540 2230313 2230717 gene locus_tag LOCUS_19550 2230313 2230717 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223040.1 protein_id gnl|my_center|LOCUS_19550 2231999 2230782 gene locus_tag LOCUS_19560 gene cobA 2231999 2230782 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977272.1 protein_id gnl|my_center|LOCUS_19560 2233711 2231996 gene locus_tag LOCUS_19570 gene sirA 2233711 2231996 CDS product sulfite reductase SirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972818.1 protein_id gnl|my_center|LOCUS_19570 2234700 2233885 gene locus_tag LOCUS_19580 2234700 2233885 CDS product sirohydrochlorin chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080998.1 protein_id gnl|my_center|LOCUS_19580 2235473 2234697 gene locus_tag LOCUS_19590 2235473 2234697 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804604.1 protein_id gnl|my_center|LOCUS_19590 2235579 2237480 gene locus_tag LOCUS_19600 2235579 2237480 CDS product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015065.1 protein_id gnl|my_center|LOCUS_19600 2237556 2240210 gene locus_tag LOCUS_19610 gene valS 2237556 2240210 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804592.1 protein_id gnl|my_center|LOCUS_19610 2240200 2241792 gene locus_tag LOCUS_19620 2240200 2241792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 2242527 2241907 gene locus_tag LOCUS_19630 2242527 2241907 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730011.1 protein_id gnl|my_center|LOCUS_19630 2242743 2242606 gene locus_tag LOCUS_19640 2242743 2242606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 2243064 2242840 gene locus_tag LOCUS_19650 2243064 2242840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 2243611 2243153 gene locus_tag LOCUS_19660 2243611 2243153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 2244993 2243698 gene locus_tag LOCUS_19670 gene clpX 2244993 2243698 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004562779.1 protein_id gnl|my_center|LOCUS_19670 2245858 2245184 gene locus_tag LOCUS_19680 2245858 2245184 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930165.1 protein_id gnl|my_center|LOCUS_19680 2246549 2245914 gene locus_tag LOCUS_19690 2246549 2245914 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115412275.1 protein_id gnl|my_center|LOCUS_19690 2248133 2246808 gene locus_tag LOCUS_19700 gene tig 2248133 2246808 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804577.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_19700 2248369 2248296 gene locus_tag LOCUS_t00430 2248369 2248296 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 2248601 2248672 gene locus_tag LOCUS_t00440 2248601 2248672 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 2249699 2248794 gene locus_tag LOCUS_19710 2249699 2248794 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804784.1 protein_id gnl|my_center|LOCUS_19710 2250186 2249692 gene locus_tag LOCUS_19720 2250186 2249692 CDS product ribose-5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804783.1 protein_id gnl|my_center|LOCUS_19720 2250352 2252898 gene locus_tag LOCUS_19730 gene pepN 2250352 2252898 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028475.1 protein_id gnl|my_center|LOCUS_19730 2252905 2253285 gene locus_tag LOCUS_19740 2252905 2253285 CDS product globin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028501.1 protein_id gnl|my_center|LOCUS_19740 2253985 2253290 gene locus_tag LOCUS_19750 2253985 2253290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 2254071 2254976 gene locus_tag LOCUS_19760 2254071 2254976 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804769.1 protein_id gnl|my_center|LOCUS_19760 2256748 2255066 gene locus_tag LOCUS_19770 gene ettA 2256748 2255066 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804765.1 protein_id gnl|my_center|LOCUS_19770 2257233 2256793 gene locus_tag LOCUS_19780 2257233 2256793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 2258010 2257351 gene locus_tag LOCUS_19790 2258010 2257351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 2258810 2258274 gene locus_tag LOCUS_19800 2258810 2258274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 2258932 2258858 gene locus_tag LOCUS_t00450 2258932 2258858 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2260489 2259026 gene locus_tag LOCUS_19810 gene mptB 2260489 2259026 CDS product polyprenol phosphomannose-dependent alpha 1,6 mannosyltransferase MptB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224695.1 protein_id gnl|my_center|LOCUS_19810 2260380 2260733 gene locus_tag LOCUS_19820 2260380 2260733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 2260712 2261296 gene locus_tag LOCUS_19830 gene orn 2260712 2261296 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976007.1 protein_id gnl|my_center|LOCUS_19830 2261500 2261574 gene locus_tag LOCUS_t00460 2261500 2261574 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 2262258 2261659 gene locus_tag LOCUS_19840 2262258 2261659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 2263115 2262255 gene locus_tag LOCUS_19850 2263115 2262255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 2264401 2263178 gene locus_tag LOCUS_19860 2264401 2263178 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241160.1 protein_id gnl|my_center|LOCUS_19860 2265737 2264394 gene locus_tag LOCUS_19870 2265737 2264394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 2266318 2265734 gene locus_tag LOCUS_19880 2266318 2265734 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001093325.1 protein_id gnl|my_center|LOCUS_19880 2266526 2267095 gene locus_tag LOCUS_19890 2266526 2267095 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950402.1 protein_id gnl|my_center|LOCUS_19890 2267881 2267114 gene locus_tag LOCUS_19900 gene yaaA 2267881 2267114 CDS product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976516.1 protein_id gnl|my_center|LOCUS_19900 2268365 2268592 gene locus_tag LOCUS_19910 2268365 2268592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 2269529 2268627 gene locus_tag LOCUS_19920 2269529 2268627 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028263.1 protein_id gnl|my_center|LOCUS_19920 2269643 2270167 gene locus_tag LOCUS_19930 gene msrA 2269643 2270167 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017870242.1 protein_id gnl|my_center|LOCUS_19930 2270283 2271218 gene locus_tag LOCUS_19940 gene cysK 2270283 2271218 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066567803.1 protein_id gnl|my_center|LOCUS_19940 2271221 2271805 gene locus_tag LOCUS_19950 gene cysE 2271221 2271805 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006286028.1 protein_id gnl|my_center|LOCUS_19950 2273445 2271919 gene locus_tag LOCUS_19960 gene gndA 2273445 2271919 CDS product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856232.1 protein_id gnl|my_center|LOCUS_19960 2273589 2273515 gene locus_tag LOCUS_t00470 2273589 2273515 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 2274108 2273695 gene locus_tag LOCUS_19970 2274108 2273695 CDS product DUF3052 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775705.1 protein_id gnl|my_center|LOCUS_19970 2274422 2277166 gene locus_tag LOCUS_19980 gene aceE 2274422 2277166 CDS product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804451.1 protein_id gnl|my_center|LOCUS_19980 2277355 2278248 gene locus_tag LOCUS_19990 2277355 2278248 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775707.1 protein_id gnl|my_center|LOCUS_19990 2278393 2278638 gene locus_tag LOCUS_20000 2278393 2278638 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775709.1 protein_id gnl|my_center|LOCUS_20000 2278771 2280039 gene locus_tag LOCUS_20010 2278771 2280039 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028323.1 protein_id gnl|my_center|LOCUS_20010 2280659 2280153 gene locus_tag LOCUS_20020 2280659 2280153 CDS product DUF3145 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775711.1 protein_id gnl|my_center|LOCUS_20020 2281878 2280793 gene locus_tag LOCUS_20030 2281878 2280793 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389693.1 protein_id gnl|my_center|LOCUS_20030 2282678 2281842 gene locus_tag LOCUS_20040 2282678 2281842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 2284108 2282750 gene locus_tag LOCUS_20050 gene dprA 2284108 2282750 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804631.1 protein_id gnl|my_center|LOCUS_20050 2285705 2284164 gene locus_tag LOCUS_20060 2285705 2284164 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804630.1 protein_id gnl|my_center|LOCUS_20060 2286093 2285707 gene locus_tag LOCUS_20070 2286093 2285707 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030872622.1 protein_id gnl|my_center|LOCUS_20070 2287176 2286400 gene locus_tag LOCUS_20080 2287176 2286400 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030471.1 protein_id gnl|my_center|LOCUS_20080 2287955 2287176 gene locus_tag LOCUS_20090 2287955 2287176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 2288611 2288018 gene locus_tag LOCUS_20100 gene lepB 2288611 2288018 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804625.1 protein_id gnl|my_center|LOCUS_20100 2289036 2288686 gene locus_tag LOCUS_20110 gene rplS 2289036 2288686 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973398.1 protein_id gnl|my_center|LOCUS_20110 2290036 2289224 gene locus_tag LOCUS_20120 gene trmD 2290036 2289224 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804623.1 protein_id gnl|my_center|LOCUS_20120 2290722 2290033 gene locus_tag LOCUS_20130 gene rimM 2290722 2290033 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973400.1 protein_id gnl|my_center|LOCUS_20130 2291105 2290866 gene locus_tag LOCUS_20140 2291105 2290866 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973401.1 protein_id gnl|my_center|LOCUS_20140 2291518 2291108 gene locus_tag LOCUS_20150 2291518 2291108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 2292887 2291724 gene locus_tag LOCUS_20160 2292887 2291724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 2293801 2292884 gene locus_tag LOCUS_20170 2293801 2292884 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230149.1 protein_id gnl|my_center|LOCUS_20170 2294758 2293958 gene locus_tag LOCUS_20180 2294758 2293958 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390051.1 protein_id gnl|my_center|LOCUS_20180 2296190 2294751 gene locus_tag LOCUS_20190 2296190 2294751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 2297482 2296187 gene locus_tag LOCUS_20200 2297482 2296187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 2298036 2297545 gene locus_tag LOCUS_20210 2298036 2297545 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184978408.1 protein_id gnl|my_center|LOCUS_20210 2299629 2298046 gene locus_tag LOCUS_20220 gene ffh 2299629 2298046 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389541.1 protein_id gnl|my_center|LOCUS_20220 2300147 2299797 gene locus_tag LOCUS_20230 2300147 2299797 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051565.1 protein_id gnl|my_center|LOCUS_20230 2301447 2300191 gene locus_tag LOCUS_20240 2301447 2300191 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893791.1 protein_id gnl|my_center|LOCUS_20240 2302707 2301604 gene locus_tag LOCUS_20250 gene ftsY 2302707 2301604 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164278219.1 protein_id gnl|my_center|LOCUS_20250 2302761 2303990 gene locus_tag LOCUS_20260 2302761 2303990 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014146.1 protein_id gnl|my_center|LOCUS_20260 2307724 2304116 gene locus_tag LOCUS_20270 gene smc 2307724 2304116 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030315.1 protein_id gnl|my_center|LOCUS_20270 2308072 2309028 gene locus_tag LOCUS_20280 2308072 2309028 CDS product 3-oxoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775776.1 protein_id gnl|my_center|LOCUS_20280 2309073 2311832 gene locus_tag LOCUS_20290 2309073 2311832 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775775.1 protein_id gnl|my_center|LOCUS_20290 2311829 2312968 gene locus_tag LOCUS_20300 2311829 2312968 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775774.1 protein_id gnl|my_center|LOCUS_20300 2314007 2313096 gene locus_tag LOCUS_20310 2314007 2313096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 2315139 2314192 gene locus_tag LOCUS_20320 gene mutM 2315139 2314192 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223692.1 protein_id gnl|my_center|LOCUS_20320 2315839 2315141 gene locus_tag LOCUS_20330 gene rnc 2315839 2315141 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973423.1 protein_id gnl|my_center|LOCUS_20330 2316036 2315854 gene locus_tag LOCUS_20340 2316036 2315854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 2316671 2316060 gene locus_tag LOCUS_20350 2316671 2316060 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973424.1 protein_id gnl|my_center|LOCUS_20350 2317228 2316737 gene locus_tag LOCUS_20360 gene coaD 2317228 2316737 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414998.1 protein_id gnl|my_center|LOCUS_20360 2317270 2318532 gene locus_tag LOCUS_20370 2317270 2318532 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776977.1 protein_id gnl|my_center|LOCUS_20370 2319169 2318597 gene locus_tag LOCUS_20380 gene rsmD 2319169 2318597 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466716.1 protein_id gnl|my_center|LOCUS_20380 2321489 2319249 gene locus_tag LOCUS_20390 gene recG 2321489 2319249 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973428.1 protein_id gnl|my_center|LOCUS_20390 2322478 2321486 gene locus_tag LOCUS_20400 2322478 2321486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 2323601 2322468 gene locus_tag LOCUS_20410 gene thiL 2323601 2322468 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775876.1 protein_id gnl|my_center|LOCUS_20410 2324626 2323598 gene locus_tag LOCUS_20420 2324626 2323598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 2324746 2325399 gene locus_tag LOCUS_20430 2324746 2325399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 2326560 2325418 gene locus_tag LOCUS_20440 2326560 2325418 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973434.1 protein_id gnl|my_center|LOCUS_20440 2327408 2326656 gene locus_tag LOCUS_20450 2327408 2326656 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015582873.1 protein_id gnl|my_center|LOCUS_20450 2329369 2327405 gene locus_tag LOCUS_20460 2329369 2327405 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013606.1 protein_id gnl|my_center|LOCUS_20460 2330136 2329366 gene locus_tag LOCUS_20470 2330136 2329366 CDS product succinate dehydrogenase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855465.1 protein_id gnl|my_center|LOCUS_20470 2331514 2330387 gene locus_tag LOCUS_20480 2331514 2330387 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030308.1 protein_id gnl|my_center|LOCUS_20480 2332395 2331589 gene locus_tag LOCUS_20490 2332395 2331589 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973436.1 protein_id gnl|my_center|LOCUS_20490 2333732 2332401 gene locus_tag LOCUS_20500 gene murA 2333732 2332401 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975861.1 protein_id gnl|my_center|LOCUS_20500 2334517 2333918 gene locus_tag LOCUS_20510 gene leuD 2334517 2333918 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223620.1 protein_id gnl|my_center|LOCUS_20510 2336019 2334580 gene locus_tag LOCUS_20520 gene leuC 2336019 2334580 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223619.1 protein_id gnl|my_center|LOCUS_20520 2336154 2336981 gene locus_tag LOCUS_20530 gene ndgR 2336154 2336981 CDS product IclR family transcriptional regulator NdgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030305.1 protein_id gnl|my_center|LOCUS_20530 2337236 2337163 gene locus_tag LOCUS_t00480 2337236 2337163 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 2337438 2337366 gene locus_tag LOCUS_t00490 2337438 2337366 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 2339121 2337604 gene locus_tag LOCUS_20540 gene gltX 2339121 2337604 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775887.1 protein_id gnl|my_center|LOCUS_20540 2339994 2339215 gene locus_tag LOCUS_20550 2339994 2339215 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775888.1 protein_id gnl|my_center|LOCUS_20550 2341182 2340073 gene locus_tag LOCUS_20560 2341182 2340073 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036086.1 protein_id gnl|my_center|LOCUS_20560 2342324 2341248 gene locus_tag LOCUS_20570 2342324 2341248 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775902.1 protein_id gnl|my_center|LOCUS_20570 2342987 2342379 gene locus_tag LOCUS_20580 2342987 2342379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 2343706 2342984 gene locus_tag LOCUS_20590 2343706 2342984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 2345319 2343769 gene locus_tag LOCUS_20600 gene metG 2345319 2343769 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296388.1 protein_id gnl|my_center|LOCUS_20600 2346951 2345356 gene locus_tag LOCUS_20610 gene serA 2346951 2345356 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973481.1 protein_id gnl|my_center|LOCUS_20610 2348117 2347092 gene locus_tag LOCUS_20620 gene ilvC 2348117 2347092 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775904.1 protein_id gnl|my_center|LOCUS_20620 2348711 2348202 gene locus_tag LOCUS_20630 gene ilvN 2348711 2348202 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973483.1 protein_id gnl|my_center|LOCUS_20630 2350517 2348718 gene locus_tag LOCUS_20640 2350517 2348718 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775906.1 protein_id gnl|my_center|LOCUS_20640 2350955 2351416 gene locus_tag LOCUS_20650 2350955 2351416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 2351555 2351630 gene locus_tag LOCUS_t00500 2351555 2351630 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 2351675 2351749 gene locus_tag LOCUS_t00510 2351675 2351749 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 2352339 2351839 gene locus_tag LOCUS_20660 2352339 2351839 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226972.1 protein_id gnl|my_center|LOCUS_20660 2352400 2352879 gene locus_tag LOCUS_20670 gene bcp 2352400 2352879 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229449.1 protein_id gnl|my_center|LOCUS_20670 2352992 2353075 gene locus_tag LOCUS_t00520 2352992 2353075 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2353108 2354706 gene locus_tag LOCUS_20680 2353108 2354706 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230617.1 protein_id gnl|my_center|LOCUS_20680 2354904 2356391 gene locus_tag LOCUS_20690 2354904 2356391 CDS product malate:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219978.1 protein_id gnl|my_center|LOCUS_20690 2356500 2357582 gene locus_tag LOCUS_20700 2356500 2357582 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189282703.1 protein_id gnl|my_center|LOCUS_20700 2357584 2358474 gene locus_tag LOCUS_20710 2357584 2358474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 2358565 2359671 gene locus_tag LOCUS_20720 2358565 2359671 CDS product S-(hydroxymethyl)mycothiol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027326.1 protein_id gnl|my_center|LOCUS_20720 2359668 2360318 gene locus_tag LOCUS_20730 2359668 2360318 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978121.1 protein_id gnl|my_center|LOCUS_20730 2361800 2360451 gene locus_tag LOCUS_20740 2361800 2360451 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969418.1 protein_id gnl|my_center|LOCUS_20740 2365246 2361797 gene locus_tag LOCUS_20750 2365246 2361797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 2366409 2365243 gene locus_tag LOCUS_20760 2366409 2365243 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284170.1 protein_id gnl|my_center|LOCUS_20760 2366449 2367567 gene locus_tag LOCUS_20770 2366449 2367567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 2368441 2367584 gene locus_tag LOCUS_20780 2368441 2367584 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776087.1 protein_id gnl|my_center|LOCUS_20780 2369098 2368448 gene locus_tag LOCUS_20790 gene rdgB 2369098 2368448 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028655.1 protein_id gnl|my_center|LOCUS_20790 2369852 2369091 gene locus_tag LOCUS_20800 gene rph 2369852 2369091 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776022.1 protein_id gnl|my_center|LOCUS_20800 2370705 2369911 gene locus_tag LOCUS_20810 2370705 2369911 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776023.1 protein_id gnl|my_center|LOCUS_20810 2371778 2370696 gene locus_tag LOCUS_20820 gene murI 2371778 2370696 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066567685.1 protein_id gnl|my_center|LOCUS_20820 2372430 2371879 gene locus_tag LOCUS_20830 2372430 2371879 CDS product DUF2017 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776025.1 protein_id gnl|my_center|LOCUS_20830 2372773 2372432 gene locus_tag LOCUS_20840 2372773 2372432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 2372938 2374269 gene locus_tag LOCUS_20850 2372938 2374269 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028662.1 protein_id gnl|my_center|LOCUS_20850 2374367 2375002 gene locus_tag LOCUS_20860 2374367 2375002 CDS product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015162.1 protein_id gnl|my_center|LOCUS_20860 2375082 2375483 gene locus_tag LOCUS_20870 2375082 2375483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 2375480 2375836 gene locus_tag LOCUS_20880 2375480 2375836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978731.1 protein_id gnl|my_center|LOCUS_20880 2377702 2375909 gene locus_tag LOCUS_20890 2377702 2375909 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929967.1 protein_id gnl|my_center|LOCUS_20890